KR20120133044A - New infectious bronchitis virus K40/09 and vaccines forpreventing infectious bronchitis using the same - Google Patents

Abstract

PURPOSE: An infectious bronchitis(IB) virus K40/09 strain and a vaccine using the same are provided to effectively prevent novel mutant type IB and to prevent IB in a domestic chicken. CONSTITUTION: An infectious bronchitis(IB) virus K40-09 strain (deposit number KCTC 11937BP) is isolated from domestic poultry. A vaccine for preventing poultry from diseases caused by IB viral infection contains the IB virus and a pharmaceutically acceptable carrier or diluent. The virus is an attenuated or inactivated virus. The vaccine additionally contains an adjuvant and one or more vaccine ingredients for infectious other pathogen. A method for controlling the diseases caused by IB viral infection comprises a step of administering the virus to birds. A method for manufacturing the IB virus comprises: a step of inoculating to IB virus to a substrate which is susceptible to infection; a step of proliferating the IB virus; and a step of collecting materials containing the IB virus. The substrate is an embryonic egg. [Reference numerals] (AA) Aggressive vaccination group; (BB) Negative control group; (CC) Spawning rate(5%); (DD) K40/09 week aggressive vaccination; (EE) Days after aggressive vaccination

Description

Infectious bronchitis virus Ｋ40 / 09 strains and vaccine for infectious bronchitis using the same {new infectious bronchitis virus K40 / 09 and vaccines forpreventing infectious bronchitis using the same}

The present invention relates to infectious bronchitis virus K40 / 09 strain and infectious bronchitis vaccine using same, and more particularly to infectious bronchitis virus K40 / 09 strain isolated from domestic field farms and infectious bronchitis vaccine using the same.

Infectious bronchitis (IB) is an acute epidemic of chickens with a very high propagation rate caused by the IB virus (IBV). IB does not have a high mortality rate when infected, but has a high morbidity rate and causes a wide variety of productivity declines such as coughing, runny nose, lowering of birth rate, lowering of egg laying rate accompanied by external and internal dizziness, as well as chronic mortality due to respiratory sequelae accompanied by E. coli. Causing huge economic damage to the poultry industry worldwide.

IBV is an RNA virus belonging to the corona virus, similar to the influenza virus, and has a characteristic of easily changing the gene constituting the virus particle. Therefore, a wide variety of IBV serotypes have been reported and reported worldwide, and it is estimated that there will be dozens of species including the mutated mutant virus in each serotype. As with various serotypes, virus-sensitive organs and pathogenics vary as well as different serotypes by region and country. And these serotypes are not well cross-reaction or cross-immunity is accompanied with a lot of difficulties in the prevention and control of the disease.

IB, which is currently in vogue in Korea, is accompanied by respiratory type IB and respiratory tract, which mainly cause severe respiratory and spawning depression, but can be classified into two types, nephritis and renal type IB with more severe spawning depression.

The first IB in Korea was reported in 1986, and the virus was continuously invaded until the late 1990s, and it can be effectively controlled by live and deadly poisoned oil vaccines made with Massachusetts type IBV (H120, Ma5). It was. At the time, the damage caused by IB infection was mainly caused by respiratory symptoms and spawning damage accompanied by malformed eggs.However, since 1990, various cases of spawning losses have been reported in laying hens and breeders despite the nationwide use of vaccines. In the growing chicks, about 10% mortality, along with severe depression, uterine inversion, diarrhea, urinary acid deposition, and nephritis have been reported, causing severe local damage.

In spite of widespread vaccination, after IB damage persisted and the cause of kidney type IB was found, in 1997, IB Sadok oil vaccine using KM91 strain was developed to effectively prevent kidney type IBV. It is completed and currently used in Korea.

Kidney-type IB-deck oil vaccines are effective in preventing spawning caused by renal IB infection, a major domestic epidemic strain, and have also been effective in preventing spawning caused by respiratory type IB infection. In the case of kidney IBV (QXIBV strain), cross-immunity was low, and the incidence of reaching the spawning peak was increased even after inoculation with the dead venom vaccine prepared with domestic kidney IBV strain (KM91 strain). As a result of challenge with the new serotype IBV it was confirmed that the effect on the egg production rate (Fig. 1).

In addition, as the number of new mutant IBVs has increased in Korea since 2005, the necessity for the development of new poisoning vaccines has increased.

The present invention has been made in view of the above necessity, and an object of the present invention is to provide an IBV outdoor isolate for the production of an effective vaccine against various types of mutant IBV that is popular in Korea.

Another object of the present invention is to attenuate the pathogenicity of the IBV outdoor isolate, to provide an IBV apothecary for the production of an effective vaccine against IBV.

Another object of the present invention is to provide an effective vaccine against IBV using the IBV outdoor isolate and attenuated strain.

In order to achieve the above object, the present invention provides infectious bronchitis virus K40 / 09 strain deposited with accession number KCTC 11937BP to achieve the above object.

The virus of the present invention was deposited on May 23, 2011 with accession number KCTC 11937BP to the Korea Institute of Bioscience and Biotechnology, Yuseong-gu, Daejeon, Korea.

In one embodiment of the present invention, the virus is preferably an infectious bronchitis virus isolated from domestic poultry, but is not limited thereto.

As a preferred starting material in the isolation method of the virus of the present invention, it can be isolated from diseased algae, in particular from the respiratory tract of poultry or excreta excreted by such algae. It should not be excluded that other organs may be used as starting materials for the isolation of the virus of the invention.

In another aspect, the present invention provides a vaccine for protecting poultry against clinical symptoms caused by infectious bronchitis virus infection, comprising the infectious bronchitis virus of the present invention and a pharmaceutically acceptable carrier or diluent.

Infectious bronchitis virus of the present invention may be included in a vaccine in an inactivated form. If the infectious bronchitis virus is in an inactivated form, the nature of the infectious bronchitis virus causing the above-mentioned diseases is completely lost.

Vaccines of the invention can be prepared according to conventional methods commonly used, for example, for commercially inactivated infectious bronchitis virus vaccines. Preparation of veterinary vaccine compositions is particularly described in "Handbunch der Schutzimpfungen in der Tiermedizin" (ed. Mays, A. et al., Verlag Paul Parey, Berlin und Hamburg, Germany, 1984) and "Vaccines or Veterinary Applications" (ed. Peters, AR). Et al., Butterworth-Heinemann Ltd, 1993 .

In brief, the substrate susceptible to infection is inoculated with the infectious bronchitis virus of the present invention in a live form and propagated until the virus replicates at a predetermined infectious titer or antigen content (mass). The infectious bronchitis virus bearing the substance can then be harvested and formulated into a pharmaceutical composition with prophylactic activity.

All substrates that can be used for replication of the infectious bronchitis virus as defined above can be used to produce a vaccine according to the invention if necessary after the infectious bronchitis virus adapts to the substrate.

Alternatively, after the infectious bronchitis virus of the present invention is propagated in embryonated eggs, the infectious bronchitis virus material may be collected by conventional methods.

The present invention also provides a vaccine comprising an infectious bronchitis virus in an inactivated form against an infectious bronchitis infection. The main advantage of inactivated vaccines is that long levels of high levels of protective antibodies persist. This property makes inactivated vaccines particularly suitable for breeder vaccination.

The purpose of inactivating the harvested virus after the propagation step is to prevent the regeneration of the virus. In general, this can be done by chemical or physical means. Chemical inactivation can be performed, for example, by treating the virus with enzymes, formaldehyde, β-propiolactone, ethylene-imine or derivatives thereof. If necessary, the deactivated compound is later neutralized. Formaldehyde inactivated material may be neutralized with, for example, thiosulfate. Physical inactivation may preferably be carried out by irradiating the virus with sufficient energy, for example UV light. If necessary, the pH can be adjusted to a value of about 7 after treatment .

Vaccines containing the inactivated infectious bronchitis virus may comprise one or more of the aforementioned pharmaceutically acceptable carriers or diluents suitable for this purpose, for example. Preferably, the inactivated vaccine of the present invention comprises one or more compounds with adjuvant activity. Suitable compounds or compositions for this purpose include vegetable oils such as aluminum hydroxide, -phosphate, -oxide, mineral oil, vitamin E acetate, and oil-in-water or water-in-oil emulsions based on saponins.

Inactivated vaccines are usually administered parenterally, ie intramuscularly or subcutaneously.

The vaccine of the present invention comprises, as an active ingredient, an infectious bronchitis virus in an effective amount, that is, in an amount that immunizes an infectious bronchitis virus substance that will induce immunity in an vaccinated bird or their offspring against an attack by an toxic virus (antigen administration). . Immunity is defined herein to induce a significantly higher level of protection in avian populations after vaccination compared to the non-vaccinated group.

Typically, the inactivated vaccine of the present invention can be administered with an antigen equivalent to a dose of 10 ⁴ -10 ¹⁰ TCID ₅₀ per bird.

The infectious bronchitis virus vaccine of the present invention can be used effectively in chickens, but other poultry such as turkey, guinea fowl and quail can also be vaccinated effectively. Chickens include edible chickens, cloned cattle, and laying eggs.

The age of the animals receiving the live or inactivated vaccine according to the present invention is the same as the age of the animals receiving the commercially available inactivated infectious bronchitis virus vaccine. Vaccination of parental livestock, such as breeders of edible chickens, can be performed with the live, attenuated or inactivated vaccine of the present invention, or a combination of both. The advantages of this type of vaccine program include the direct protection of one day old offspring provided by antibodies from the maternal line that are delivered vertically to the offspring. A typical breeder's vaccination program involves inoculating a six week old breeder with a live, weakened vaccine followed by an inactivated vaccine at 14-18 weeks of age. Alternatively, live vaccines may be given two doses with inactivated vaccines at 10-12 weeks of age and 16-18 weeks of age.

The present invention also encompasses vaccine combinations comprising one or more vaccine components of other pathogens infected with poultry in addition to the infectious bronchitis virus of the present invention.

Preferably the vaccine component in the vaccine combination is a live, attenuated or inactivated form of the pathogen infected with the poultry.

In particular, the present invention provides a vaccine combination in which all vaccine components are in an inactivated form.

Vaccine combinations include influenza virus, avian reovirus, infectious bursal disease virus (IBDV), fowl adenovirus (FAdV), and hypoglycaemia syndrome (egg drop syndrome 76 'virus, EDS 76). It is preferred to include one or more (inactivated) vaccine strains of virus and turkey rhinotracheitis virus (TRTV).

In the present invention, the murine vaccine is produced using the mutant IBV K40 / 09 strains that are popular in outdoor farms in Korea, and the safety and efficacy of the produced vaccine are compared with existing commercially available IBV killed virus vaccines to make the vaccine available in Korea. Developed.

Infectious bronchitis virus according to the present invention as a vaccine for the effective prevention of new variant IB occurring in the country, which complements the disadvantages of the existing vaccine, will greatly contribute to the prevention of domestic chicken infectious bronchitis.

1 is a diagram showing the protective efficacy test for a new IBV isolate (QXIBV) of commercially available deadly vaccine vaccine (KM91).
Figure 2 is a photograph confirming the presence of IBV in the intestinal ureum fluids.
3 shows the result of expressing S1 protein (RT-PCR) through reverse transcriptase polymerase chain reaction.
4 is a diagram illustrating a gene group of viruses through a phylogenetic method.
Figure 5 shows the results of the protective efficacy test in laying hens for the new IBV isolate of the new IBV K40 / 09 strain deadly vaccine.
Figure 6 shows the virus propagated in the intestinal urea of the poultry eggs by reverse transcription polymerase chain reaction (RT-PCR) Avian influenza virus (AIV) (forward primer sequence AGCAAAAGCAGGTAG, reverse primer sequence AGTAGAAACAAGGTAGTTTTT) and Newcastle disease (NDV) (forward frigo and nucleotide sequences GCTGATCATGAGGTTACCTC, reverse frigo and nucleotide sequences AGTCGGAGGATGTTGGCAGC) do not proliferate (FIG. 6a and b), and only for infectious bronchitis virus (TT-PRA and CTATGTGACTG TATGCGA It was confirmed that it is the reverse primer and propagated nucleotide sequence GTTTGTAT GTACTCATCTGTAAC) (FIG. 6C).

Hereinafter, the present invention will be described in more detail with reference to non-limiting examples. However, the following examples are illustrated to illustrate the present invention and the scope of the present invention is not to be construed as limited by the following examples.

Example  1: domestic market Zadok vaccine  ( KM91 ) New IBV On the separator (QXIBV)  Defense efficacy test

The number of 180-week-old 35-week laying hens (large microorganisms, Korea) used in Korea was divided into two groups, each of which was divided into two groups: the inoculation group and the negative control group, and then challenged with the new domestic serotype IBV isolate (QXIBV). The change in daily scattering rate was measured. In the case of challenge group, it was confirmed that the post-vaccination spawning rate was reduced compared to the negative control group (FIG. 1).

Example  2: Existing Zapokism  domestic Variant IBV K40 Immunogenicity for Week / 09 At evaluation Hum

In this study, to evaluate the immunogenicity of domestic mutant IBV of the existing dead venom vaccine, three weeks-old SPF chickens were vaccinated with the existing dead venom vaccine 10 ^3.0 EID ₅₀ / ml in the eye, and three weeks after vaccination Type IBV K40 / 09 Inoculated with IBV 10 ^4.5 EID ₅₀ per chick mainly, and then investigated the effect of defensive immunity.

The protective immunity effect was evaluated as having a protective effect if the virus was not re-isolated by re-isolating the challenge virus from the kidney and organ 5 days after challenge.

The final immunogenicity test results are shown in Table 1 below. As a result of the experiment, it was confirmed that the existing virulent vaccine strain had a low protective effect against domestic variant IBV (Table 1).

Original Poison Vaccine
Inoculation group Attack IBV Genetic Group Attack IBV Re-Isolate Vaccine Virus / Execute Vaccine Agency kidney Control group Vaccine group Control group Vaccine group One Korean 2 K40 / 09 10/10 5/10 10/10 1/10

Table 1 is a table showing the results of immunogenicity evaluation test for domestic variants of IBV K40 / 09 strains of existing poisoning vaccine.

Example  3: Infectious bronchitis virus in domestic outdoor farm K40 Week 09 Separation and Inactivation

New IBV  Separation and Identification of Outdoor Separation

Separation of IBV field isolates was performed after aseptic sampling of organs or kidneys of suspected IB infection, 20% emulsion with sterile PBS, centrifugation at 3,000 rpm for 20 minutes, and supernatant taken to infiltrate the 10-day-old SPF oviduct. After inoculation and incubation at 37 ° C. for 72 hours, the intestinal ureum fluid is collected aseptically. The collected urea membrane fluid was finally confirmed whether IBV was present in the urea membrane fluid according to the method of Song et al. (Avian Diseases, 42, 92-100, 1998) (FIG. 2).

New IBV  Outdoor separation S1  Protein gene analysis

In addition, it contains neutralizing epitopes and serotype-specific epitopes of IBV virus, and the S1 protein, which is known to play an important role in determining the type of virus, such as its neutralizing ability and serotype of virus, is subjected to reverse transcription polymerase chain reaction (RT- PCR) (forward frigonucleotide sequencing TAGTGACCCTTTTGTGTGCACTAT, reverse frigonucleotide sequencing GTTTGTAT GTACTCATCTGTAAC), followed by expression (FIG. 3) and homology with IBV outdoor isolates isolated in Korea (Table 2). The genetic group of the virus was examined (FIG. 4). The homology of the IBV S1 protein genes showed 85% lower homology with QXIBV, a new pandemic strain, in the KM91 strain, but a new strain of K40 / 09 strains in the open air. It was confirmed that it showed about 90% homology with the other two serotypes of IBV strains (KM91 and QXIBV strains).

IBV Isolation S1 protein gene homology (%) KM91 QXIBV K40 / 09 93.4 89.6 KM91 100 85 QXIBV 85 100

Table 2 is a comparative analysis of S1 protein gene homology with the domestic isolates.

SEQ ID NO: 1 shows the gene sequence of the S1 protein of the strain.

New IBV Outdoor separator  My other pathogen fraud test

To determine the presence of other pathogens capable of proliferation in the urea, the M protein gene of Avian influenza virus (AIV) and the F (Fusion) protein gene of Newcastle disease (NDV) Reverse transcriptase polymerase chain reaction (RT-PCR) was performed to confirm that there were no pathogens other than Newcastle disease virus in wild feces .

New IBV Outdoor separator Seed virus stock Production

Urinary fluid obtained from organs suspected of IB infection or chick embryos inoculated with kidney emulsions was used as a master seed to prepare two seeded virus stocks. The virus content of Seed virus stock was found to be 10 ^9.0 EID ₅₀ / ml as a result of calculating 50% Egg infectious dose (EID ₅₀ ).

New IBV Outdoor separator  Used Zadok vaccine  making

The inactivation of the IBV K40 / 09 strain was treated with intestinal urea solution containing IBV cultured in SPF oocytes after adding 0.2% formalin for 15 hours at 37 ° C. and then inactivating at 4 ° C. for one week, The solution is treated with 0.01M BEI (Binary ethylenimine) and inactivated at 37 ° C. for 3 hours or 0.2% B-PL in the intestinal fluid.

Example  4 : IBV K40 / 09 weeks Zadok vaccine SPF  For chicks In the lab  Safety test

To test the safety of IBV K40 / 09 strains of dead poison vaccine, 1 ml (2 doses) of dead poison vaccine was injected in 15 labor 3 to 4 week old SPF chicken thigh muscles. The clinical symptoms, weight gain and mortality were examined for 3 weeks after inoculation, and the number of gross lesions at the 3, 4, and 5 weeks was examined to determine the formation of gross lesions at the site of inoculation. Significant analysis was performed using the Student's t-test and the mortality by One-tailed Fisher's test. The final immunogenicity test results are shown in Tables 2 and 3 below.

Safety test of IBV K40 / 09 strain of deadly vaccine showed no clinical symptoms and no death in both inoculated and control groups. In addition, there was no significant difference in the gain ratio between the inoculation group and the control group, and granulomatous formation did not show any difference.

Test vaccine Test system
Sorghum Clinical Symptoms and Death Expression after Test Vaccination ^A) Clinical symptoms Our company Zadok vaccine group    15 0/15 ^† 0/15 ^† Control group    15 0/15 0/15

Table 3 shows the clinical symptoms and mortality findings of the three-week-old SPF inoculation system after IBV K40 / 09 weekly deadly-vaccinated vaccine.

^A) Clinical symptoms and pulmonary expression observed for 3 weeks after 1 ml inoculation of the test vaccine into the muscles of the femoral region (expression / immunization)

^† Student's t-test P-value compared with control group> 0.5

Test vaccine Test system
Sorghum By age after vaccination
Granulomatous ^C) 3 weeks 4 weeks 5 Weeks Vaccination group 15 0/5 0/5 0/5 Control group 15 0/5 0/5 0/5

Table 4 shows the results of the weight change and granulomatous formation of the three-week-old SPF inoculation system after the IBV K40 / 09 strain of dead venom vaccine.

^A) Three test vaccines were observed for 3 weeks after 1 ml inoculation of the muscle of the femoral portion of 3 week-old SPF chickens.

^B) Weight change calculated by measuring mean weight and standard deviation of groups before and after 3 weeks of inoculation

^C) After 3, 4, and 5 weeks of vaccination, each group was examined for 5 granules to observe granulomas formation at the site of inoculation.

^† Student's t-test P-value compared with control group> 0.5

Example  5: IBV K40 / 09 weeks Zadok vaccine  domestic Variant IBV Immunogenicity for

In order to evaluate the immunogenicity of the IBV K40 / 09 strain of deadly vaccinated domestic IBV, 6-week-old SPF chickens were inoculated with 1-minute muscles of deadly-vaccinated vaccines, and 3 weeks after vaccination in Korea. Influenza IBV 10 ^4.5 EID ₅₀ per chick was used as a prevalent IBV isolate. The protective immunity effect was evaluated as having a protective effect if the virus was not re-isolated by re-isolating the challenge virus from the kidney and organ 5 days after challenge. The final immunogenicity test results are shown in Table 5 below. As a result, the new IBV K40 / 09 strain Zadok vaccine showed high protection against domestic variant IBV.

IBV K40 / 09 strain Zadok vaccine
Inoculation group Attack IBV Genetic Group Attack IBV Re-Isolate Vaccine Virus / Execute Vaccine Agency kidney Control group Vaccine group Control group Vaccine group One Korean 2 K40 / 09 10/10 0/10 10/10 0/10

Table 5 shows the results of cross-immunogenicity test for domestic variant IBV of IBV K40 / 09 strain of deadly poison vaccine.

Example  6: New IBV K40 / 09 weeks Zadok vaccine  new IBV On a separate note  Protective efficacy test in Korean laying hens

Ninety-three 35-week-old laying hens vaccinated with new IBV K40 / 09 strains were divided into two groups, each with two groups: challenge and negative control, and then challenged with the new domestic serotype IBV isolate (IBV K40 / 09). The change in scattering rate was measured for 30 days. The group vaccinated showed no significant difference in egg production compared to the negative control (FIG. 5).

Korea Biotechnology Research Institute KCTC11937BP 20110523

Claims (11)

Infectious bronchitis virus K40 / 09, deposited under accession number KCTC 11937BP. The infectious bronchitis virus of claim 1, wherein the virus is isolated from domestic poultry. A vaccine for poultry protection against diseases caused by infectious bronchitis virus infection comprising the infectious bronchitis virus of claim 1 and a pharmaceutically acceptable carrier or diluent. 4. The vaccine of claim 3 wherein the infectious bronchitis virus is in live, attenuated form. The vaccine of claim 3, wherein the infectious bronchitis virus is in an inactivated form. 4. The vaccine of claim 3 wherein said vaccine further comprises an adjuvant. The vaccine of claim 3, wherein the vaccine further comprises one or more vaccine components of other pathogens infectious to poultry. A method of controlling a disease resulting from an infectious bronchitis infection in poultry comprising administering the virus of claim 1 to a bird. a) inoculating an infectious substrate with an infectious bronchitis virus as defined in claim 1;
b) propagating said infectious bronchitis virus; And
c) collecting the infectious bronchitis virus-containing material. 10. The method of claim 9, wherein the substrate is embryonated egg. Infectious bronchitis virus infection comprising the step of combining the collected infectious bronchitis virus obtained by the method of claim 9 with a pharmaceutically acceptable carrier or diluent, if necessary, after the inactivation of the infectious bronchitis virus. Method of preparing a vaccine for poultry protection against diseases caused from.

Images