KR101757752B1 - Infectious bronchitis virus k40/09 strain, and vaccine for infectious bronchitis using same - Google Patents

Abstract

The present invention relates to an infectious bronchitis virus K40 / 09 strain and an infectious bronchitis vaccine using the same. More particularly, the present invention relates to an infectious bronchitis virus K40 / 09 strain isolated from a domestic outdoor farm and an infectious bronchitis vaccine using the same.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a vaccine for infectious bronchitis virus K40 / 09 and a vaccine for infectious bronchitis using the same,

The present invention relates to an infectious bronchitis virus K40 / 09 strain and an infectious bronchitis vaccine using the same. More particularly, the present invention relates to an infectious bronchitis virus K40 / 09 strain isolated from a domestic outdoor farm and an infectious bronchitis vaccine using the same.

Infectious bronchitis (hereinafter referred to as 'IB') is an acute infectious disease of chickens with a very high spreading power generated by IB virus (Infectious bronchitis virus: hereinafter referred to as IBV). IB is not high in mortality but has a high morbidity rate and causes a decrease in egg production accompanied by a cough, a runny nose, a decrease in weight, a decrease in external and internal quality, as well as a persistent chronic disease due to colicosis accompanied by respiratory sequelae And has caused enormous economic damage to the poultry industry worldwide.

IBV is an RNA virus belonging to the coronavirus, and has a characteristic that the gene constituting the virus particle is easily mutated similarly to the influenza virus. Therefore, very diverse serotype IBVs have been reported worldwide, and it is presumed that several kinds of IBVs including mutated viruses in each of these serotypes are included. The susceptibility of the virus to various serotypes is variable, and the long-term and pathogenicity varies. In addition, cross-reactivity and cross-immunity between these serotypes are not well-established, which is accompanied by many difficulties in the prevention and control of disease.

IB, which is currently prevalent in Korea, can be divided into two types, respiratory type IB, which mainly causes severe respiratory and spawning degradation, and kidney type IB, which is accompanied by a respiratory disease but has more severe nephritis and scattering.

Domestic IB outbreaks were first reported in 1986, and respiratory viruses continued to be prevalent until late 1990s. Effective control of viruses and Sadok oil vaccines made with mesothecous IBV (H120, Ma5) Respectively. However, in spite of the use of vaccine nationwide since 1990, there have been many cases of damages caused by laying hens or laying hens, and in case of broiler chickens It has been reported that kidney type IB, which is accompanied by severe depression, diarrhea, diarrhea, kidney uric acid deposition, and nephritis together with 10% or so of the chicks being raised, has caused serious damage locally until now.

In order to effectively prevent IBD, we developed IB Xodox oil vaccine using KM91 vaccine in 1997 to prevent industrialization of IBD in Korea after effective vaccination despite extensive vaccination. And has been used in domestic market.

The kidney-type IB Xedok oil vaccine has been effective in preventing spawning degradation caused by IB infection in Korea, but it has also effectively inhibited spoilage caused by respiratory IB infection. However, since early 2000, a new serotype from China In the case of the kidney-type IBV (QXIBV strain), the cross-over immunity was lowered, and the Sdox vaccine manufactured by the domestic kidney-type IBV (KM91 strain) was inoculated. As a result of attacking the new serotype IBV, it was confirmed that it affects the egg production rate (Fig. 1).

Since 2005, the number of new mutant IBV has increased in Korea, and the need for the development of a new Sadox vaccine has increased.

Korean Patent Publication No. 1020120006164 discloses a Newcastle Disease Virus vaccine that can prevent Newcastle Disease which is a malicious infectious disease of chicken and a Newcastle Disease Virus Vaccine including the same. More specifically, A novel vaccinia virus vaccine belonging to genotype I genotype I (class 1) of class 1 in a phylogenetic analysis based on the nucleic acid sequence of the isolated and viral F protein, and a Newcastle disease virus vaccine containing it In addition,

Korean Patent Publication No. 1020120024493 discloses a vaccine for Newcastle Disease Virus and a vaccine for Newcastle Disease Virus comprising the same. Specifically, the gene is an amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having 96% The present invention relates to a kit and a kit for providing information on diagnosis of a Newcastle disease virus, a vaccine comprising the same, a antibody specifically recognizing the same, a composition for diagnosing a Newcastle disease virus containing the antibody, .

The present invention has been made in view of the above needs, and it is an object of the present invention to provide an IBV outdoor isolate for the production of a preventive vaccine effective against various kinds of mutant IBVs which are prevalent in Korea.

Another object of the present invention is to provide an IBV drug drink for the production of an effective preventive vaccine for IBV by attenuating the IBV outdoor isolation pathogenicity.

It is another object of the present invention to provide an effective prophylactic vaccine for IBV using the IBV outdoor isolate and the drug isolate.

In order to achieve the above object, the present invention provides an infectious bronchitis virus K40 / 09 strain deposited with Accession No. KCTC 11937BP.

The virus of the present invention was deposited on May 23, 2011 with the accession number KCTC 11937BP to the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology in Daejeon, Korea.

In one embodiment of the present invention, the virus is preferably an infectious bronchitis virus isolated from domestic poultry, but is not limited thereto.

As a preferred starting material in the virus isolation method of the present invention, it can be separated from diseased algae, in particular from the respiratory organs of poultry, or excreta excreted by such algae. It should not be excluded that other organs can be used as a starting material for the isolation of viruses of the present invention.

In another aspect, the invention provides a vaccine for the protection of poultry against clinical symptoms resulting from infectious bronchitis virus infection, comprising the infectious bronchitis virus of the present invention and a pharmaceutically acceptable carrier or diluent.

The infectious bronchitis virus of the present invention may be included in the vaccine as an inactivated form. If the infectious bronchitis virus is in an inactivated form, the nature of the infectious bronchitis virus inducing the abovementioned disease is completely eliminated.

The vaccine of the present invention can be prepared according to conventional methods commonly used, for example, in commercial inactivated infectious bronchitis virus vaccines. The preparation of veterinary vaccine compositions is described in particular in "Handbunch der Schutzimpfungen in der Tiermedizin" (eds. Mays, A., Verlag Paul Parey, Berlin und Hamburg, Germany, 1984) and "Vaccines or Veterinary Applications" Et al., Butterworth-Heinemann Ltd, 1993) .

Briefly, infectious bronchitis virus of the present invention is inoculated in live form to the susceptible substrate, and propagated until the virus is replicated at a predetermined infection specific antigen concentration (mass). Thereafter, the infectious bronchitis virus carrying the substance can be collected and formulated into a pharmaceutical composition having prophylactic activity.

All substrates that can be used for replication of the infectious bronchitis virus defined above can be used to generate a vaccine according to the invention, if necessary after the infectious bronchitis virus has adapted to the substrate.

Alternatively, the infectious bronchitis virus of the present invention may be propagated in embryonated eggs, and then the infectious bronchitis virus material may be collected by a conventional method.

The invention also provides a vaccine comprising an inactivated form of infectious bronchitis virus for infectious bronchitis infection. The main advantage of an inactivated vaccine is that a high level of protective antibody lasts for a long time. Because of this nature, inactivated vaccines are particularly suitable for vertical vaccination.

The purpose of inactivating the collected virus after the propagation step is to prevent regeneration of the virus. Generally, this can be done by chemical or physical means. Chemical desalting can be performed, for example, by treating the virus with an enzyme, formaldehyde,? -Propiolactone, ethylene-imine or a derivative thereof. If necessary, the inactivated compound is neutralized later. The substance inactivated with formaldehyde can be neutralized, for example, with thiosulfate. Physical inactivation can be preferably performed by irradiating the virus with sufficient radioactivity, for example UV light, of energy. If necessary, the pH after treatment can be adjusted to a value of about 7 .

Vaccines containing the inactivated infectious bronchitis virus may comprise, for example, one or more of the above-mentioned pharmaceutically acceptable carriers or diluents suitable for this purpose. Preferably, the inactivated vaccine of the present invention comprises at least one compound having an auxiliary activity. Suitable compounds or compositions for this purpose include vegetable oils such as aluminum hydroxide, -phosphate, -oxide, mineral oil, vitamin E acetate, and water-in-oil or oil-in-water emulsions based on saponin.

Inactivated vaccines are usually administered parenterally, i. E., Intramuscularly or subcutaneously.

The vaccine of the present invention comprises an effective amount of an infectious bronchitis virus as an active ingredient, i.e., an amount that immunizes a vaccinated bird or an infectious bronchitis virus substance that will induce immunity in their offspring against an attack by a toxic virus (antigen administration) . Immunity is defined herein as inducing a significantly higher level of protection in a population of birds following vaccination compared to the non-vaccinated population.

Typically, the inactivated vaccine of the present invention can be administered in an amount equivalent to 10 ⁴ -10 ¹⁰ TCID ₅₀ per bird and equivalent antigen.

The infectious bronchitis virus vaccine of the present invention can be effectively used in chickens, but other poultry such as turkey, guinea fowl, and quail can also be effectively vaccinated. Chickens include edible chickens, replica livestock, and livestock.

The age of the animal receiving the live or inactivated vaccine according to the present invention is equal to the age of the animal receiving the currently marketed inactivated infectious bronchitis virus vaccine. Vaccination of the parent animal, such as the breeder of the edible chicken, may be performed with the live attenuated or inactivated vaccine of the present invention, or a mixture of both. The advantages of this type of vaccination program include the direct protection of one day old offspring provided by maternally derived antibodies transmitted vertically to the offspring. A typical longitudinal vaccination program involves inoculating inactivated vaccine at 14-18 weeks of age after inoculation of live attenuated vaccine to 6 calf axes at birth. Alternatively, two inoculations may be inoculated with inactivated vaccine at 10-12 weeks after birth and at 16-18 weeks after inoculation of the live vaccine.

The invention also encompasses vaccine combinations comprising one or more vaccine components of other pathogens that are infected with poultry in addition to the infectious bronchitis virus of the present invention.

Preferably, the vaccine component in the vaccine combination is a live attenuated or inactivated form of the pathogen infecting the poultry.

In particular, the invention provides vaccine combinations wherein all vaccine components of the vaccine combination are in an inactivated form.

The combination of vaccines may include influenza virus, avian reovirus, infectious bursal disease virus (IBDV), fowl adenovirus (FAdV), egg drop syndrome 76 'virus, EDS 76 virus " virus) and turkey rhinotracheitis virus (TRTV). < / RTI >

In addition, the present invention relates to a method for the treatment or prevention of IBV infection, which comprises culturing a bovine granulosa fluid containing the IBV of claim 1 cultured in a specific pathogen member group (SPF) bovine, inactivating the bovine fluid after treatment with formalin, or applying a binary ethylenimine The method comprising the step of treating and inactivating the infectious bronchitis virus K40 / 09 deposited with the deposit number KCTC 11937BP.

In the present invention, a Sadox vaccine was prepared using a mutant IBV K40 / 09 strain, which is popular in domestic farms, and the safety and efficacy of the manufactured vaccine were compared with a commercially available IBV Sadox vaccine. Respectively.

The infectious bronchitis virus according to the present invention is a vaccine for effectively preventing new mutant type IB occurring in Korea, which is complementary to the disadvantages of existing vaccines, and will contribute to prevention of domestic chicken infectious bronchitis.

FIG. 1 is a photograph showing the final confirmation of the presence of IBV in intestinal fluid.
Figure 2 shows the results of expression of S1 protein through reverse transcription polymerase chain reaction (RT-PCR).
FIG. 3 is a diagram of a gene group of a virus through a systematic method.
FIG. 4-6 shows the results of reverse transcription-polymerase chain reaction (RT-PCR) of viruses proliferated in the metaplasia of the fetal calf. As a result, Avian influenza virus (AIV) (forward primer sequence AGCAAAAGCAGGTAG, reverse primer (Fig. 4 and 5), but only for the infectious bronchitis virus (nucleotide sequence AGTAGAAACAAGGTAGTTTTT) and Newcastle disease (NDV) (reverse transcriptase and GCTGATCATGAGGTTACCTC, reverse transcriptase and nucleotide sequence AGTCGGAGGATGTTGGCAGC) TAGTGACCCTTTTGTGTGCACTAT, reverse primer and nucleotide sequence GTTTGTAT GTACTCATCTGTAAC) (Fig. 6).

Hereinafter, the present invention will be described in more detail by way of non-limiting examples. The following examples are provided to illustrate the present invention and the scope of the present invention is not construed as being limited by the following examples.

Example 1 Immunogenicity evaluation test for the mutant IBV K40 / 09 strain of the existing Sadox vaccine strain

In order to evaluate the immunogenicity of the existing mutant IBV strain of Sadok Vaccine, 3-week-old SPF chickens were vaccinated with Sadox vaccine 10 ^3.0 EID ₅₀ / ml at the end of the experiment. After 3 weeks of vaccination, IBV K40 / 09 IBV 10 ^4.5 EID ₅₀ chickens per dose.

The protective immunity effect was evaluated as the protective effect when the virus was not re - separated by re - separating the attacked virus in the kidney and organs 5 days after the inoculation.

The results of the final immunogenicity test are shown in Table 1 below. As a result of the experiment, it was confirmed that the existing Sodox vaccine showed low defense effect against the mutant IBV (Table 1).

Table 1 shows the results of the immunogenicity test for the mutant IBV K40 / 09 strain of the existing Sadox vaccine.

Example 2: Infectious bronchitis virus K40 / 09 strain isolation and inactivation in domestic outdoor farms

Isolation and identification of new IBV outdoor separation

The isolation of IBV outdoors was performed by aseptically collecting aspirin or kidneys from IB-infected suspensions and then centrifuging at 3,000 rpm for 20 minutes. The supernatant was collected at 10% And incubated at 37 ° C for 72 hours. Aseptic medium is then collected aseptically. The presence or absence of IBV in the intestinal fluid was finally confirmed based on the method of Avian Diseases, 42, 92-100, 1998 (Fig. 1).

New IBV Outdoor Segregation S1 Protein Gene Analysis

In addition, it contains the neutralizing epitope of the IBV virus and the serotype specific epitope, and it is known that the S1 protein, which is known to play an important role in determining the virus type such as the neutralization ability of the virus and the serotype of the virus, PCR) (reverse transcriptase sequence, TAGTGACCCTTTTGTGTGCACTAT, reverse transcriptase sequence GTTTGTAT GTACTCATCTGTAAC), expression (Fig. 2), homology to isolated IBV isolates in Korea (Table 2), phylogenetic analysis (Figure 3). ≪ / RTI > As a result of comparing the homology of the IBV S1 protein gene with that of the existing Sadox vaccine strain KM91, it showed 85% homology with the newly introduced outdoor isolate QXIBV. However, in the case of the new K40 / 09 strain, It was confirmed that the strain has high homology of about 90% with IBV strain of two other serotypes (KM91 and QXIBV strain).

Table 2 is a comparative analysis of the S1 protein gene homology with the dominant isolates.

SEQ ID NO: 1 represents the gene sequence of the S1 protein of this strain.

Other pathogen fraud tests in new IBV outdoor isolates

In order to confirm the presence of other pathogenic agents capable of proliferating in the metaplasias of the fetal canine, the M protein gene of Avian influenza virus (AIV), the F (fusion) protein gene of Newcastle disease (NDV) (RT-PCR) were performed to confirm that there were no other pathogens other than Newcastle disease virus in the wild duck feces .

Fabrication of Seed virus stock of a new IBV outdoor isolate

Seed virus stocks were prepared two times in the fetal bovine serum by using the umbilical cord fluid collected from the fetal bovine serum of the IB infection suspect system or the kidney emulsion. The virus content of Seed virus stock was calculated to be 10 ^8.0 EID ₅₀ / ㎖ by calculating 50% Egg infectious dose (EID ₅₀ ).

Production of Sadoc vaccine using a new IBV outdoor isolate

Inactivation of the IBV K40 / 09 strain was performed by adding 0.2% formalin to IBF containing IBV cultured in an SPF strain for 15 hours at 37 ° C, followed by inactivation for 1 week at 4 ° C, Treated with 0.01 M BEI (Binary ethylenimine) at 37 ° C for 3 hours or with 0.2% B-PL treated with a buffer solution and inactivated at 25 ° C for 3 hours.

Example 3: Experimental safety tests on SPF chicks of IBV K40 / 09 strain Sadox vaccine

In order to test the safety of the IBV K40 / 09 primary Sodok vaccine, this test is used to inoculate 1 dose (2dose) of Sodok Vaccine into the 15th three to four week old SPF chicken thigh muscles in the experimental room. The clinical symptoms, body weight gain rate and mortality rate were measured at 3 weeks after inoculation and autopsy was performed at 5, 6, and 7 weeks to determine whether glaucomatous lesions were formed. Student's t-test and mortality rate were analyzed by One-tailed Fisher's test. The final immunogenicity test results are shown in Tables 3 and 4 below.

As a result of the safety test of the IBV K40 / 09 strain Sadox vaccine, neither the inoculation group nor the control group showed clinical signs and mortality. In addition, there was no significant difference in the growth rate between the inoculated group and the control group, and the granuloma formation did not show any difference. Thus, the safety of the K40 / 09 primary sadox vaccine was confirmed.

Table 3 shows the results of the clinical symptoms and mortality rates of 3-week-old SPF inoculation system after IBV K40 / 09 weekly sadox vaccination.

* ^A) Clinical symptoms and mortality (expressed / inoculated) observed for 3 weeks after inoculation of 1 mL of test vaccine in muscle of femoral region.

^† Student's t-test P-value compared with control group> 0.5

Table 4 is a table showing the results of weight change and granuloma formation of three weeks old SPF inoculation system after IBV K40 / 09 week Sadox vaccination.

^A) Three test vaccines were inoculated in the muscle of the femoral area of 3 weeks old SPF chickens and incubated for 3 weeks

^B) Weight change before and after 3 weeks of vaccination by measuring the mean weight and standard deviation of each group

^C) After autopsy, autopsy was performed at 3 weeks, 4 weeks, and 5 weeks after vaccination to determine the granuloma formation at the inoculation site (granuloma formation / inoculation)

^† Student's t-test P-value compared with control group> 0.5

Example 4: Growth culture and potency measurement

Infection titers of IBV were measured using SPF eggs. Specifically, 10 ⁷ EID ₅₀ / ml virus solution diluted 10-fold with PBS buffer was inoculated into the intestinal membrane of 10-day-old SPF seedlings in an amount of 0.1 ml per egg, followed by incubation at 37 ° C for 48 hours and 72 hours . At least five strains per dilution were inoculated and cultured for 48 hours and 72 hours. Real - time PCR was performed, and the bacterial viability was measured at high incubation times. The infectivity of the virus was calculated by the method of Reed & Muench (Reed LJ, Muench), expressed as the reciprocal of the dilution of the virus solution that infects 50% of the embryonic fetuses H., American J Hyg, 1938, 27, 493-497).

Table 5 shows the results of the proliferation activity measurement.

Example 5: Pathogenicity measurement for chicken

Pathogenicity tests were performed on chickens of IBV K40 / 09 strain at 1-day-old SPF chicks. The viruses were used at 10 day old chickens per virus group, and 10.5 ^4.5 EID ₅₀ viruses per chick were infected by eye drop, and clinical symptoms and mortality were observed for 14 days. As a control group, 10 days old SPF chicks were inoculated with PBS buffer in the same manner, and mortality and viral re - isolation were performed.

As a result of the pathogenic test, the trachea and kidney tissue samples of the infectious system were collected on the 14th day after the IBV K40 / 09 main artificial infection and the virus was re-isolated from the organs and kidneys of all infectious systems (10/10).

Table 6 shows the results of pathogenicity and virus re-isolation in 1-day-old chicks of IBV K40 / 09.

Example 6: Minimum immunogenicity test of IBV K40 / 09 primary Sadox vaccine

In order to test the minimum immunogenicity of the IBV K40 / 09 strain Sodok vaccine, a sadox vaccine with an antigen amount of 10 ^4.5 , 10 ^5.5 , 10 ^6.5 , 10 ^7.5 EID ₅₀ / dose was prepared based on the virus titer before inactivation. Each vaccine with different amounts of antigen was inoculated intramuscularly for one minute into the test group, and blood was collected from the test group and the control group after 3 weeks. The serum was immobilized at 56 ° C for 30 minutes and then equilibrated with the diluted neutralizing test virus at the same time and neutralized at 37 ° C for 1 hour. After neutralization, 0.2 ml of each egg was inoculated into the intestinal membranes of 5 or more 9-11 day old eggs and cultured at 37 ° C for 3 days. Three days after the inoculation, the juvenile fluid was collected and the neutralization index was calculated by confirming the presence of IBV according to the method of Song et al. (Avian Diseases, 42, 92-100, 1998).

Three weeks after the vaccination, serum was collected from the test group and the control group and the neutralization index was calculated. Minimal immunogenicity test results showed that the Sadox vaccine prepared for the IB7.V K40 / 09 vaccine showed immunogenicity at an antigen concentration of 10 ^6.5 EID ₅₀ / dose or more.

Table 7 shows the minimum immunogenicity table of the Sadok oil vaccine prepared for K40 / 09 vaccine.

la. IBV K40 / 09 Crossover protection ability test in chicken

In order to confirm the cross immunogenicity of the IBV K40 / 09 strain Sodok vaccine, we measured the defense efficacy against seven strains that are prevalent in Korea and abroad. . IBV K40 / 09 strain was vaccinated with 3-week-old SPF chickens, which are host animals, in a dose of IBV 10 ^3.5 EID ₅₀ per chick, except for the control group, and representative of domestic and overseas prevalent IBV genetic groups 3 weeks after vaccination Seven IBVs were inoculated with 10 ^4.5 EID ₅₀ per mouse per chick. Controls were also inoculated with the same virus in the same manner. On the 5th day after inoculation, all surviving chickens were euthanized and then autopsied to collect aseptically the organ and kidney tissue samples. The virus isolation test from the organs was carried out by the inoculation method in the developing egg according to the above. The protective efficacy of chicken was evaluated by the IBV re - isolation rate in the organs and kidneys of chickens.

Table 8 shows the results of the cross protection test for the domestic and overseas epidemics of IBV inoculation in IBV K40 / 09 vaccine chickens.

Table 9 shows the results of the cross protection test for IBV H120 vaccinated chickens in Korea and overseas.

Table 10 shows the results of the cross protection test for the inoculation of domestic and foreign epidemics of IBV in KV vaccine.

Tables 8 to 10 of the present invention utilize a separate virus (K40 / 09 and other recombinant viruses) to identify a wide range of immunogenicity, and thus, a total of seven (7) strains including domestic respiratory type, infectious bronchial infectious and infectious bronchitis virus The vaccine strains were selected by confirming the cross protective ability using the egg virus (Table 8). In addition, a cross-protective ability of the infectious bronchitis vaccine of the present invention and the vaccine host K40 / 09 of the present invention was compared and tested for its potential as a vaccine strain (Table 9 and Table 10).

The test for testing the cross protective ability of the IBV vaccine of the present invention was conducted as follows. According to the test schedule, the vaccine was administered to 3-week-old SPF chickens at a dose of 10 ^3.5 EID ₅₀ per well. Three weeks after vaccination, seven genotypic IBVs domestically and overseas were inoculated with an eye drop of 10 ^4.5 EID ₅₀ virus per chicken. Five days after the inoculation, the kidneys were collected from the organs and the viruses were re - isolated from these organs to evaluate the cross - protective ability of the vaccine. Experimental results showed that IBV K40 / 09 exhibited a high level of cross protection ability as compared to conventional vaccines.

In general, IBV is known to have a relatively low cross-reactivity to different serotypes or genotypes (Ignjatovi and Sapats, 2000). However, some virus strains have been reported to exhibit cross protection against different serotypes or genotypes. Therefore, it is most important to select a vaccine that exhibits a broad cross-immunogenicity to produce a vaccine. Based on the results of this experiment, IBV K40 / 09 is highly effective as a vaccine because it has been shown that it has high cross immunogenicity against 7 kinds of IBV which are prevalent in domestic and overseas.

Korea Biotechnology Research Institute KCTC11937BP 20110523

Claims (9)

Infectious bronchitis virus K40 / 09 strain deposited with the deposit number KCTC 11937BP, and a pharmaceutically acceptable carrier or diluent, for infectious bronchitis virus genotypes M41, K107 / 04, KM91, K1227 / 03, K26 / 10 and 4/91 Vaccine protective vaccine with cross reactivity. delete delete delete delete The method according to claim 1,
Wherein the vaccine further comprises an adjuvant. The method according to claim 1,
Wherein the vaccine further comprises at least one vaccine component of another pathogenic organism infectious to the poultry. A method for controlling a disease caused by an infectious bronchitis infection in a poultry comprising administering the vaccine of claim 1 to the algae. delete

Images