KR101360112B1 - A novel airborn transmissible low pathogenic avian Influenza virus (H9N2) K040110/2010 and vaccine for low pathogenic avian Influenza comprising the same - Google Patents

A novel airborn transmissible low pathogenic avian Influenza virus (H9N2) K040110/2010 and vaccine for low pathogenic avian Influenza comprising the same Download PDF

Info

Publication number
KR101360112B1
KR101360112B1 KR20120013759A KR20120013759A KR101360112B1 KR 101360112 B1 KR101360112 B1 KR 101360112B1 KR 20120013759 A KR20120013759 A KR 20120013759A KR 20120013759 A KR20120013759 A KR 20120013759A KR 101360112 B1 KR101360112 B1 KR 101360112B1
Authority
KR
Grant status
Grant
Patent type
Prior art keywords
virus
vaccine
avian influenza
influenza virus
k040110
Prior art date
Application number
KR20120013759A
Other languages
Korean (ko)
Other versions
KR20120135015A (en )
Inventor
송창선
이중복
김명섭
최인수
박승용
Original Assignee
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date

Links

Images

Abstract

본 발명은 공기전파가 가능한 신규한 H9N2형 저병원성 조류인플루엔자 바이러스 A/Korean native chicken/Korea/K040110/2010 (H9N2)주, 및 이의 사균 또는 이의 항원을 유효성분으로 포함하는 인플루엔자 바이러스 면역원성 조성물에 관한 것이다. The present invention relates to influenza virus immunogenic compositions comprising a possible novel H9N2 type jeobyeongwonseong avian influenza virus A / Korean native chicken / Korea / K040110 / 2010 (H9N2) state, and its dead cells or an antigen air propagation as an active ingredient will be.

Description

공기전파가 가능한 신규한 H9N2형 저병원성 조류인플루엔자 바이러스 균주 및 그로부터 유래된 백신{A novel airborn transmissible low pathogenic avian Influenza virus (H9N2) K040110/2010 and vaccine for low pathogenic avian Influenza comprising the same} The novel H9N2 type avian influenza virus strain jeobyeongwonseong and vaccines derived from it the air propagation is {A novel airborn transmissible low pathogenic avian Influenza virus (H9N2) K040110 / 2010 and vaccine for low pathogenic avian Influenza comprising the same}

본 발명은 공기전파가 가능한 신규한 H9N2형 저병원성 조류인플루엔자 바이러스 A/Korean native chicken/Korea/K040110/2010 (H9N2)주, 및 이의 사균 또는 이의 항원을 유효성분으로 포함하는 인플루엔자 바이러스 면역원성 조성물에 관한 것이다. The present invention relates to influenza virus immunogenic compositions comprising a possible novel H9N2 type jeobyeongwonseong avian influenza virus A / Korean native chicken / Korea / K040110 / 2010 (H9N2) state, and its dead cells or an antigen air propagation as an active ingredient will be.

A형 인플루엔자 바이러스는 오쏘믹소바이러스 속, 오쏘믹소비리대 과의 멤버이며, 네거티브 센스 단일 가닥 RNA를 포함하며(Lamb, RA and Krug, R. 1996. In Field Virology. 3 rd Influenza A virus is a member of the ortho and myxovirus, An ortho ridae dynamic consumption, negative sense single-stranded RNA, and including (Lamb, RA and Krug, R. 1996. In Field Virology. 3 rd Edn. Edn. Eds BN Field, DM Knipe, PM Howley. Eds BN Field, DM Knipe, PM Howley. Philadelphia, Lippincott-Raven. Philadelphia, Lippincott-Raven. p.1353-1395), 항원으로 및 유전적으로 구분될 수 있는 16가지 상이한 서브타입의 적혈구응집소 (HA) 및 9가지 상이한 서브타입의 뉴라미니다제(NA)가 존재한다(Choi et al., 2004. Vet. Rec. 154, 274-275; Fouchier et al., 2005. J. Virol. 79, 2814-2822). And the p.1353-1395), which may be an antigen, and genetically nine minutes is 16 of different subtypes of hemagglutinin (HA) and 9 of different subtypes of New lamina claim (NA) exists (Choi et al., 2004. Vet Rec 154, 274-275;.... Fouchier et al, 2005. J. Virol 79, 2814-2822).

이들 상이한 서브타입 간에는 항원성이 달라 상호 교차 반응이나 교차 면역이 잘 되지 않고 동일한 서브타입 간에도 대변이 및 소변이에 따른 빈번한 항원성의 변이가 나타나므로 인플루엔자바이러스에 대한 예방에는 많은 어려움이 따르게 된다. Between these different subtypes are different each other antigenic cross-reactivity and so cross-immunity does not represent a frequent variation of the antigenicity and the urine appeared even between the same sub-type well for the prevention of influenza virus there are many difficulties to follow.

또한 이러한 변이는 예방과 관계되는 항원성의 변이뿐 아니라 기존의 인플루엔자 바이러스의 숙주 범위 확대, 숙주 간 전파력 및 병원성 변화를 유발하므로 인플루엔자바이러스에 대한 통제를 더욱 어렵게 한다. In addition, these mutations, as well as antigenicity because mutations that are associated with the prevention of influenza viruses cause an existing host range expansion, between the host and the pathogenic changes in disseminative it more difficult to control the influenza virus. 특히 변이로 인해 생성된 신규한 인플루엔자바이러스가 사람에서 감염시, 2년간 5000만 명의 사망자를 발생시켜 인류 최대의 재앙으로 기록된 스페인 독감과 같은 대유행인플루엔자로 발전할 가능성이 있다. In particular, there is a possibility that a novel influenza virus generated due to variations caused by the infection during 2 years 50 million deaths in people to develop into pandemic influenza, such as the Spanish flu recorded the biggest human catastrophe.

상기의 중요성으로 인해 이러한 인플루엔자 바이러스의 변이원리를 주제로 다양한 연구가 전 세계적으로 활발히 이뤄지고 있으며 다양한 특성을 가지는 다양한 종류의 인플루엔자 바이러스 균주가 연구의 수단으로써 활용되고 있다. Subject to the principle of variability of influenza virus due to the importance of actively being made in various studies around the world and has been utilized a wide variety of influenza virus strains have different characteristics by means of research.

특히 변이를 통해 생성되어 기존의 통상적인 인플루엔자 바이러스균주와 전파력, 병원성의 차이를 나타내는 신규한 특성을 가지는 인플루엔자바이러스 균주는 연구용 균주 및 이와 같은 특성을 가지는 인플루엔자 질병에 유효한 면역원성 조성물의 생산에 이용되는 항원제조용 균주로써 가치가 높다. In particular, as generated by the mutations used in the production having the novel features of influenza virus strains are effective immunogenic influenza disease with laboratory strains and these characteristics composition representing the difference between the existing conventional influenza virus strain and disseminative, pathogenic the high value as an antigen for producing strains.

인플루엔자바이러스에 대한 연구용 및 면역원성조성물의 생산에 이용되는 항원제조용 균주는 사람 및 가축을 대상으로 다양한 종류가 분리 및 개발되어 있다. Research and antigen-producing strains used in the production of immunogenic compositions for the influenza virus is a wide selection for people and livestock separation and development.

가금을 대상으로 한 H9형 저병원성 조류 인플루엔자 바이러스 균주의 경우, 불활성화된 면역원성 제제 및 백신의 형태로 단일 및 다른 감염성 질병에 대한 면역원성 조성물과 복합된 형태로 가공되어 시판되고 있다. For one type jeobyeongwonseong H9 of avian influenza virus strain poultry targeted, is processed in the form of inactivated immunogenic preparations and vaccines in an immunogenic composition with a combined form of a single and other infectious diseases are commercially available.

그러나 인플루엔자바이러스는 상기된 바와 같이 항원성의 변이가 빈번해 과거에 분리 또는 개발된 백신 균주는 최근의 인플루엔자 유행주에 대해 충분한 방어효과를 제공하지 못한다(Palese P. Making better influenza virus vaccines? Emerg Infect Dis 2006;12(January(1)):61-5) . However, the influenza virus is a vaccine strain antigenicity frequent mutations separated or developed in the past as described above does not provide a sufficient protective effect (Palese P. Making better influenza virus vaccines for influenza in recent weeks? Emerg Infect Dis 2006 ; 12 (January (1)): 61-5).

따라서 최근 국내에서 유행하고 있는 신규 인플루엔자바이러스 균주에 유효한 방어능을 제공하는 면역원성 제제 및 백신의 개발이 요구된다. Therefore, the development of immunogenic preparations and vaccines that provide effective defense capability is required in recent years a new influenza virus strain that is prevalent in the country. 인플루엔자 바이러스의 경우, 바이러스균주를 이용하여 기존의 통상적인 방법으로 불활성화할 경우, 효과적으로 면역원성 제제 및 백신을 생산할 수 있다. In the case of influenza virus, when inactivated with existing conventional method using a virus strain, it can effectively produce the immunogenic preparations and vaccines.

따라서 위와 같은 형태의 면역원성 제제 및 백신의 개발에는 신규한 인플루엔자균주의 분리 및 확보가 핵심단계가 된다. Therefore, development of a form of the immunogenic and vaccine formulation as above, the separating and securing of a new influenza strain is a key step.

관련 선행특허로 대한민국특허공개번호 제1020070060049호, '인플루엔자 백신의 제조방법'은 예방, 진단, 면역치료 또는 치료 목적을 위한 인플루엔자 바이러스 또는 항원의 산업적-규모의 제조방법에 관한 것으로, 특히, 인플루엔자 백신, 보다 특히 인플루엔자 A형 및 B형을 포함하는 사람 백신의 매딘-다비 개 신장(Madin-Darby Canine Kidney; MDCK) 유래의 세포주 및 세포 배양물에 기반한 제조방법에 관한 것이 기재되어 있으며, Relevant prior patent Republic of Korea Patent Publication No. 1020070060049 No. 'method for producing influenza vaccine is preventive, diagnostic, industrial influenza virus or antigens for immunotherapy or therapeutic purposes - as a method of manufacturing a scale, particularly influenza vaccine , more in particular influenza maedin human vaccine containing type a and type B-Darby canine kidney; which is that which is related to the manufacturing method based (Madin-Darby Canine kidney MDCK) cell line and a cell culture derived from the water,

다른 관련 선행특허로 대한민국특허공개번호 제1020070092474호, 'H3 말 인플루엔자 A 바이러스'는 78번 위치의 발린 또는 159번 위치의 아르기닌을 가지지 않는, 서열 1을 갖는 HA(헤마글루티닌) 또는 서열 1과 실질적으로 동일한 아미노산 서열을 갖는 HA를 포함하는 단리된 H3 말 (equine) 인플루엔자 바이러스가 기재되어 있다. With other relevant prior patent Republic of Korea Patent Publication No. 1020070092474 call, "H3 end of influenza A virus" is having no arginine-valine, or 159-position of the number 78 position, having the sequence 1, HA (hemagglutinin) or SEQ ID NO: 1 and it is substantially the isolated H3 horse (equine) influenza virus comprising the HA has the same amino acid sequence as described.

본 발명은 상기의 문제점을 해결하고, 상기 필요성에 의하여 안출된 것으로서, 본 발명의 목적은 저병원성 조류인플루엔자 질병에 유효한 면역원성 조성물의 생산에 이용되는 항원제조용 균주를 제공하는 것이다. The present invention is to solve the above problems and, as a by the necessity made in view, an object of the present invention provides an antigen-producing strains used in the production of an immunogenic composition effective for jeobyeongwonseong avian influenza disease.

본 발명의 다른 목적은 기존의 저병원성 인플루엔자와 전파력 및 병원성이 다른 신규한 저병원성 조류인플루엔자의 특성을 분석하는 방법을 제공한다. Another object of the present invention provides a method for the conventional jeobyeongwonseong influenza and disseminative, and pathogenic analysis of the other novel features of jeobyeongwonseong avian influenza.

본 발명의 또 다른 목적은 기존의 저병원성 인플루엔자와 전파력 및 병원성이 다른 신규한 저병원성 조류인플루엔자의 균주를 연구용 및 상품제조를 목적으로 제조하는 것이다. Another object of the invention to a conventional influenza jeobyeongwonseong and disseminative, and pathogenic prepared for the purpose of research and product manufacturing a strain of the avian influenza jeobyeongwonseong one another novel.

본 발명의 또 다른 목적은 가금에서 저병원성 조류인플루엔자 바이러스 감염으로부터 유발된 질병 상태를 제어하는 방법을 제공한다 A further object of the present invention provides a method for controlling a disease state resulting from jeobyeongwonseong avian influenza virus infection in poultry

상기의 목적을 달성하기 위하여 본 발명은 기탁번호 KCTC 11938BP로 기탁된 H9N2형 저병원성 조류인플루엔자 A 바이러스를 제공한다. The present invention for achieving the above object provides a jeobyeongwonseong H9N2 type avian influenza A virus deposited with Accession No. KCTC 11938BP.

본 발명의 바이러스는 대한민국 대전시 유성구 소재 한국생명공학연구원 생물자원센터에 기탁번호 KCTC 11938BP로 2011년 5월 23일에 기탁하였다. Viruses of the invention was deposited on May 23, 2011, accession number KCTC 11938BP biological resource centers Republic of Korea Yuseong material, Korea Research Institute of Bioscience and Biotechnology.

본 발명의 일 구현예에 있어서, 상기 바이러스는 국내 가금류로부터 분리한 조류인플루엔자 A 바이러스인 것이 바람직하나 이에 한정되지 아니한다. In one embodiment, the virus is preferably the avian influenza A virus isolated from domestic poultry, one is not limited to this.

또한 본 발명의 조류 인플루엔자 바이러스의 분리 방법에 대한 자세한 설명이 실시예1에 개시되어 있다. There is also a detailed explanation of the separation method of the avian influenza virus of the present invention are disclosed in the first embodiment.

본 발명의 바이러스의 분리 방법에서 바람직한 출발 물질로서 병에 걸린 조류, 특히 가금류의 호흡기관 또는 이러한 조류에 의해 배설되는 배설물로부터 분리될 수 있다. Diseased birds as the preferred starting material in the method of separating viruses according to the present invention, in particular, may be isolated from the feces are excreted by the respiratory system of the poultry or birds such. 기타 기관이 본 발명의 바이러스의 분리를 위한 출발 물질로서 사용될 수 있다는 점이 제외되어서는 안된다. The other organs should not be excluded that the point can be used as a starting material for the isolation of virus of the present invention.

또 다른 측면에서 본 발명은 저병원성 조류인플루엔자 바이러스 감염에서 야기되는 임상증상에 대한 가금의 보호용 백신을 제공하는데, 본 발명의 인플루엔자 바이러스 및 약학적 허용 담체나 희석제를 포함한다. In the present invention in another aspect it comprises a jeobyeongwonseong avian influenza virus to provide a vaccine for protecting poultry for clinical signs resulting from infection, an influenza virus and a pharmaceutically acceptable carrier or diluent according to the present invention.

본 발명의 저병원성 조류인플루엔자 바이러스는 불활성화된 형태로서 백신 중에 포함될 수 있다. Jeobyeongwonseong avian influenza virus of the present invention can be included in the vaccine, as the active form of fire. 만일 저병원성 조류인플루엔자 바이러스가 불활성화된 형태라면, 상기에 전술한 질병을 유도하는 저병원성 조류인플루엔자 바이러스의 성질은 완전히 없어진다. If ten thousand and one jeobyeongwonseong avian influenza virus is inactivated form, the nature of the jeobyeongwonseong avian influenza virus to induce the above-mentioned diseases are in the completely eliminated.

본 발명의 백신은 예를 들면 시판용 불활성화된 조류인플루엔자 바이러스 백신에 흔히 사용되는 통상적인 방법에 따라 준비될 수 있다. Vaccines of the invention may, for example, be prepared in a conventional manner commonly used in commercially available inactivated avian influenza virus vaccine. 수의학적 백신 조성물의 제조는 특히 "Handbunch der Schutzimpfungen in der Tiermedizin"(편집: Mays,A.등, Verlag Paul Parey, Berlin und Hamburg, Germany, 1984) 및 "Vaccines or Veterinary Applications"(편집: Peters,AR등, Butterworth-Heinemann Ltd,1993)에 설명되어 있다 . Preparation of veterinary vaccine compositions is especially "Handbunch der Schutzimpfungen in der Tiermedizin" (edited:. Mays, A, etc., Verlag Paul Parey, Berlin und Hamburg, Germany, 1984) and "Vaccines or Veterinary Applications" (edited: Peters, AR or the like, is described in the Butterworth-Heinemann Ltd, 1993).

간단하게 설명하면, 감염되기 쉬운 기질에는 본 발명의 H9형 저병원성 조류인플루엔자 바이러스를 살아있는 형태로 접종하고, 바이러스가 소정의 감염 적정농도 또는 항원 함량(질량)으로 복제될 때까지 증식시킨다. Briefly, susceptible substrate is inoculated and the type jeobyeongwonseong H9 of avian influenza virus of the present invention as a live form, the growth until the virus is replicated in a predetermined infection titer or antigen content (by weight). 그 후에 물질을 보유한 조류인플루엔자 바이러스를 수거하고 예방적 활성을 갖는 약학적 조성물로 제제화할 수 있다. Thereafter it is possible to collect the avian influenza viruses have the materials and formulated in a pharmaceutical composition with prophylactic activity.

상기에서 정의된 조류 인플루엔자 바이러스의 복제에 사용할 수 있는 모든 기질은, 조류인플루엔자 바이러스가 기질에 적응한 후 필요하다면, 본 발명에 따른 백신을 생성하는데 사용될 수 있다. All substrates that can be used for the replication of the avian influenza virus as defined above, if necessary after adaptation of avian influenza virus to a substrate, can be used to produce a vaccine according to the invention.

적당한 기질은 1차(조류) 세포 배양물[예를 들면, 닭의 계태아 섬유아세포(chicken embryo fibroblast, CEF), 또는 닭의 신장세포(chicken kidney cell, CK)], 포유동물 세포주를[예를 들어, Madin·Darby canine kidney, MDCK 세포주] 포함한다. Suitable substrates are primary (avian) cell culture [e.g., a chicken-based embryo fibroblast cells (chicken embryo fibroblast, CEF), or kidney cells (chicken kidney cell, CK), chicken], for a mammalian cell line [ example, include Madin · Darby canine kidney, MDCK cell lines. 대개, 세포의 접종 후에 트립신효소가 포함된 배지에서 바이러스를 3-10일 동안 증식시키고, 그 후 세포 배양 상층액을 수거하고, 필요한 경우 세포 잔해를 제거하기 위해 여과하거나 원심분리한다. Usually, the growth for 3-10 days in the virus containing the enzyme trypsin medium after inoculation of the cells and then the cell culture supernatant is collected, filtered or centrifuged to remove cellular debris as needed.

또는 본 발명의 조류인플루엔자 바이러스를 배(胚)화된 달걀에서 증식시킨 후, 통상적인 방법으로 조류인플루엔자 바이러스 물질을 수거할 수 있다. Or it is possible to collect the avian influenza virus material then multiply the avian influenza virus of the present invention in the ship (胚) qualified eggs, the conventional method.

또한 본 발명은 조류인플루엔자감염에 대하여 불활성화된 형태의 조류인플루엔자 바이러스를 포함하는 백신을 제공한다. In another aspect, the present invention provides a vaccine comprising an inactivated form of the avian influenza virus against avian influenza infection. 불활성화된 백신의 주된 장점은 높은 레벨의 보호 항체가 장기간 지속된다는 것이다. The main advantages of inactivated vaccines is that the long-lasting antibodies have a high level of protection. 이러한 성질로 인해, 불활성화된 백신이 종축 백신접종에 특히 적합하게 된다. Due to these properties, the inactivated vaccine is particularly suited for breeder vaccination.

증식 단계 후 수거된 바이러스를 불활성화하는 목적은 바이러스의 재생성을 방지하는 것이다. The purpose of inactivating viruses harvested after the propagation step is to prevent the virus re-creation of the. 일반적으로, 이것은 화학적 또는 물리적 수단으로 수행될 수 있다. In general, this can be carried out in a chemical or physical means. 화학적 불화성화는 예를 들어 효소, 포름알데하이드, β-프로피오락톤, 에틸렌-이민 또는 그것의 유도체로 바이러스를 처리함으로써 수행될 수 있다. Chemical fluoride torch, for example, enzymes, formaldehyde, β- propiolactone, ethylene may be carried out by treating the virus with imine or a derivative thereof. 필요한 경우, 불활성화 된 화합물은 나중에 중화된다. If necessary, the inactivated compound is neutralized afterwards. 포름알데히드로 불활성화된 물질은 예를 들어 티오설페이트로 중화될 수 있다. The inactivated material with formaldehyde can be neutralized with thiosulphate, for example. 물리적 불활성화는 에너지가 충분한 방사능, 예를 들면 UV 광을 바이러스에 조사함으로써 바람직하게 수행될 수 있다. Physical inactivation can be carried out by irradiation of energy is preferably sufficient radiation, for example UV light to the virus. 필요한 경우, 처치 후 pH 가 약 7의 값으로 조정될 수 있다 . If necessary, the pH after the procedure can be adjusted to a value of about 7.

불활성화된 조류인플루엔자 바이러스를 함유하는 백신은 예를 들면 이 목적에 적당한 전술한 약학적 허용 담체 또는 희석제를 하나 이상 포함할 수 있다. Vaccines containing inactivated avian influenza virus may comprise for example one or more of the aforementioned suitable pharmaceutically acceptable carrier or diluent for this purpose. 바람직하게는, 본 발명의 불활성화된 백신은 보조적 활성을 갖는 하나 이상의 화합물을 포함한다. Preferably, the inactivated vaccine of the present invention comprises at least one compound having adjuvant activity. 이 목적에 적당한 화합물이나 조성물은 알루미늄 히드록시드, -포스페이트, -옥시드, 광유, 비타민 E 아세테이트와 같은 식물유 및 사포닌을 주성분으로 하는 수중유형 또는 유중수형 유제를 포함한다. Suitable compounds or compositions for this purpose include aluminum hydroxide, - comprises oxide, mineral oil, water type or water-in-oil type emulsion as the main component such as vegetable oils and saponins and vitamin E acetate-phosphate.

불활성화된 백신은 대개 비경구적으로, 즉 근육내 또는 피하내로 투여된다. Inactivated vaccines are usually administered into parenterally, that is, the muscle or subcutaneously.

본 발명의 백신은 활성 성분으로서 조류인플루엔자 바이러스를 유효량, 즉 독성 바이러스에 의한 공격(항원 투여)에 대항하여 백신 접종된 조류 또는 그들의 자손에서 면역을 유도할 조류인플루엔자 바이러스 물질을 면역화시키는 양으로 포함한다. Vaccines of the present invention includes avian influenza virus as an active ingredient an effective amount, i.e., an attack (antigen dose) vaccination of birds or a positive crystallized immunity to avian influenza virus substance to induce immunity in their offspring against the by-toxic virus . 본원에서 면역은 백신접종되지 않은 군에 비해 백신접종 후 조류 집단에서 상당히 높은 레벨의 보호를 유도하는 것으로 정의된다. Immune herein is defined as the induction of a significant higher level of protection from bird populations after vaccination compared to non-vaccinated groups.

통상적으로, 본 발명의 불활성화된 백신은 조류 1 마리당 10 7 -10 9 EID 50 의 용량과 등가의 항원을 포함하여 투여될 수 있다. Typically, the inactivated vaccine of the invention may be administered, including the capacity equivalent of an antigen of avian maridang 1 10 7 -10 9 EID 50.

본 발명의 저병원성인플루엔자 바이러스 백신은 닭에 효과적으로 사용될 수 있으나, 칠면조, 기니아 파울(guinea fowl) 및 메추라기와 같은 기타의 가금도 효과적으로 백신으로 접종될 수 있다. Jeobyeongwonseong influenza virus vaccine of the present invention may be used effectively in chickens, turkeys, may be inoculated into guinea pawl (guinea fowl) and effective vaccines for other poultry such as quail. 닭은 식용 닭, 복제 가축, 및 알을 낳는 가축을 포함한다. Chickens include edible Cattle Breeding chickens, cloning animals, and eggs.

본 발명에 따른 살아있는 또는 불활성화된 백신을 투여받은 동물의 나이는 현재 시판되는 불활성화된 조류인플루엔자 바이러스 백신을 투여받은 동물의 나이와 동일하다. The age of the animals treated with live or inactivated vaccine according to the invention is equal to the age of the animals treated with the inactivated avian influenza virus vaccines that are currently commercially available. 식용 닭의 종축과 같은 부모 가축의 백신접종은 본 발명의 살아있는 약화된 또는 불활성화된 백신, 또는 양자의 혼합으로 수행될 수 있다. Vaccination of parent breeders of livestock, such as chickens cooking can be performed in a live attenuated or inactivated vaccine, or a mixture of both of the present invention. 이런 유형의 면역주사 프로그램의 장점은 수직적으로 새끼에게 전달되는 모계 유래의 항체에 의해 제공된 생후 1일된 자손의 직접적인 보호를 포함한다. The advantage of this type of vaccine programs include the direct protection of the age of 1 day-old progeny provided by maternally derived antibodies are the vertically transmitted to offspring.

또한, 본 발명은 본 발명의 저병원성 조류 인플루엔자 바이러스 외에 가금에 감염되는 기타 병원균의 하나 이상의 백신 성분을 포함하는 백신 조합을 포함한다. The invention also includes combination vaccines comprising one or more vaccine components of other pathogens that infect poultry addition jeobyeongwonseong avian influenza virus of the present invention.

바람직하게는 백신 조합에서 백신 성분은 가금에 감염되는 병원균의 살아있는 약화된 또는 불활성화된 형태이다. Preferably a live attenuated or inactivated forms of the pathogens vaccine components in the combination vaccine are infected poultry.

특히, 본 발명은 백신 조합을 제공하며 이 백신 조합의 모든 백신 성분은 불활성화된 형태이다. In particular, the present invention provides a vaccine, and combining all the components of the vaccine The vaccine combination is inactivated form.

백신 조합은 전염성 기관지염 바이러스 (infectious bronchitis virus, IBV), 조류 레오바이러스 (avian reovirus), 전염성 F낭병 바이러스(Infectious bursal disease virus, IBDV), 가금 아데노바이러스 (fowl adenovirus, FAdV), 산란저하증 바이러스 (egg drop syndrome 76' virus, EDS 76' virus) 및 칠면조 비기관지 염 바이러스 (turkey rhinotracheitis virus, TRTV)의 하나 이상의 (불활성화된) 백신 균주를 포함하는 것이 바람직하다. Vaccine combination is infectious bronchitis virus (infectious bronchitis virus, IBV), avian Leo virus (avian reovirus), infectious F nangbyeong virus (Infectious bursal disease virus, IBDV), fowl adenovirus (fowl adenovirus, FAdV), scattering hypothyroidism virus (egg drop syndrome 76 'virus, EDS 76' virus) and turkey ratio bronchial salt is preferably a virus (including one or more (inactivated) vaccine strains of turkey rhinotracheitis virus, TRTV).

본 발명에 따른 새로운 H9형 저병원성 조류인플루엔자 바이러스, 이를 포함하는 백신 및 이들의 제조 방법을 제공함으로써 최근의 저병원성 조류인플루엔자 바이러스 감염증으로부터 유효하게 가금을 보호할 수 있다. By providing a new type jeobyeongwonseong H9 of avian influenza virus, vaccines and methods for their preparation comprising the same according to the present invention can be effectively protect poultry from recent jeobyeongwonseong avian influenza virus infections.

도 1은 토종닭으로부터 채취한 검채를 유제하여 접종한 계태아난으로부터 인플루엔자 바이러스의 유무를 확인하기 위해 인플루엔자 바이러스의 M단백질에 대한 연쇄중합효소반응을 실시한 후 전기영동을 실시한 결과를 나타낸 그림이다. 1 is an illustration showing an after performing the Polymerase Chain Reaction response to the M protein of the influenza virus to the emulsion a geomchae collected from chicken to determine the presence or absence of the influenza virus from a system fetal I inoculated as a result of the electrophoresis.
도 2는 토종닭으로부터 채취한 검채를 유제하여 접종한 계태아난으로부터 닭 전염성 기관지염 바이러스(IBV)와 뉴캣슬 바이러스(NDV)의 유무를 확인하기 위해 닭 전염성기관지염 바이러스의 S1 단백질과 뉴캣슬 바이러스의 M 단백질과 F 단백질에 대한 연쇄중합효소반응을 실시한 후 전기영동을 실시한 결과를 나타낸 그림이다. Figure 2 is a chicken infectious bronchitis virus S1 protein and nyukaetseul viruses to check for the presence of chickens from one type of fetal I emulsions were inoculated a geomchae collected from the chicken infectious bronchitis virus (IBV) and nyukaetseul virus (NDV) M protein and a diagram showing the result of the electrophoresis and then subjected to polymerase chain reaction for the F protein.
도 3은 조류인플루엔자 바이러스 K040110/2010 분리주의 증식성을 동물실험을 통해 분석한 결과를 나타낸 표이다. 3 is a table showing a result of the avian influenza virus K040110 / 2010 isolates proliferative was analyzed through animal experiments.
도 4는 기존에 상용화 되어 조류인플루엔자 바이러스의 항원으로 사용되고 있는 K01310/2001 분리주의 전파력을 동물실험을 통해 분석한 결과를 나타낸 표이다. Figure 4 is a table K01310 / 2001 Removing the disseminative capability, which are commercially available in the existing used as the avian influenza virus antigen showing a result of analysis by the animal experiments.
도 5는 조류인플루엔자 바이러스 K040110/2010 분리주의 전파력을 동물실험을 통해 분석한 결과를 나타낸 표이다. 5 is a table showing the result of the avian influenza virus K040110 / 2010 CAUTION disseminative analyzed through animal experiments.
도 6은 조류인플루엔자 바이러스 K040110/2010를 사용하여 제작한 시험용 사독백신의 K040110/2010에 대한 방어능을 동물실험을 통해 분석한 결과를 나타낸 표이다. Figure 6 is showing a result of analysis of the protective function for K040110 / 2010 of the avian influenza virus K040110 / test Zadok vaccine produced using 2010 through animal testing table.
도 7은 6주령 닭에 조류인플루엔자 바이러스 K040110/2010를 사용하여 제작한 시험용 사독백신을 접종 한 후 2주 및 3주 후에 채혈한 혈청의 인플루엔자 바이러스에 대한 항체가를 HI test를 이용하여 측정한 결과이다. 7 is the result of antibody measurement using the HI test for the influenza virus of blood sera two weeks and three weeks after vaccination the test Zadok vaccine production using avian influenza virus K040110 / 2010 6-week-old chickens to be.
도 8은 조류인플루엔자 바이러스 K040110/2010 및 K01310/2001에 대한 방어능을 동물실험을 통해 분석한 결과를 나타낸 표이다. 8 is avian influenza virus K040110 / 2010 and K01310 / is a protective function for 2001 showing a result of analysis by the Animal table.

이하, 비한정적인 실시예를 통하여 본 발명을 더욱 상세하게 설명한다. Hereinafter, the present invention through the non-limiting examples in greater detail. 단 하기 실시예는 본 발명을 설명하기 위하여 예시된 것으로서 본 발명의 범위는 하기 실시예에 의하여 제한되는 것으로 해석되지 아니한다. However the following Examples shall not be construed as being limited by the examples as to the scope of the present invention is illustrated to describe the present invention.

실시예 1: 닭으로부터 바이러스의 분리 및 동정 Example 1: Isolation and Identification of the virus from the chicken

2010년 저병원성 조류인플루엔자 감염이 의심되는 토종닭 농장으로부터 폐사계를 수거한 후 기관과 맹장편도를 검체로서 채취하였다. After the return of our system from a chicken farm where avian influenza infection is suspected jeobyeongwonseong 2010 it was collected agencies and cecum way as the samples.

채취한 검체를 유제한 후 PBS에 10% weight/volume(w/v)으로 희석하고 원심분리한 후 상층액을 0.45 pore size로 여과하여 세균오염을 배제한 후 10일령 특정병원성부재 (Specific pathogen free, SPF) 계태아란에 접종한 후 37℃ 항온기에서 배양하였다. An emulsion for collecting a sample after 10% in PBS weight / volume (w / v) by diluting and centrifuged and then supernatant of 0.45 pore 10 days of age specific pathogenic member then filtered through a size exclusion of bacterial contamination (Specific pathogen free, was inoculated in SPF) based embryo is cultured at 37 ℃ thermostat.

3일간 배양 후, 계태아란에서 요막강액 (Allantoic fluid)를 채취하여 10% SPF 닭 적혈구와 1:1 비율로 반응하여 요막강 내 바이러스의 혈구 응집능 (Hemmagglutination activity, HA) 보유여부를 판단하였다. 3 days after incubation, total fetus is in the required film strength solution (Allantoic fluid) the solid was 10% SPF chicken red blood cells and 1: determines whether or not pictures required film strength in the virus hemagglutination capacity (Hemmagglutination activity, HA) in response to the first ratio It was.

혈구 응집능을 가지는 요막강내 바이러스에 대해 인루엔자바이러스의 특이적 단백질인 Matrix (M) 단백질 유전자에 대한 중합효소연쇄반응 (Polymerase chain reaction, PCR)을 실시한 후 (정방향 프라이머 염기서열 AGCAAAAGCAGGTAG, 역방향 프라이머 염기서열 AGTAGAAACAAGGTAGTTTTT) 전기영동을 실시한 결과 해당 유전자크기의 유전체를 확인하여 채취한 검체 내에 조류인플루엔자 바이러스가 존재함을 확인하였다. And then subjected to the influenza virus-specific protein, Matrix (M) polymerase chain reaction for the protein gene (Polymerase chain reaction, PCR) for the required film strength in the virus having a hemagglutination capacity (forward primer nucleotide sequence AGCAAAAGCAGGTAG, reverse primer sequences AGTAGAAACAAGGTAGTTTTT) as a result of the electrophoresis confirmed that the avian influenza virus is present in a collected sample to determine the genome size of the corresponding gene. (도 1) (Fig. 1)

실시예 2: 신규한 조류인플루엔자 바이러스 야외분리주 내 기타병원체 부정 시험 Example 2: in other pathogens cheating novel avian influenza virus isolates outdoors

계태아란의 장요막강액에서 증식이 가능한 기타 병원체의 존재 유무를 확인하기 위하여 닭 전염성기관지염 바이러스의 (Infectious bronchitis virus IBV)의 S1 단백질 유전자 (정방향 프라이며 염기서열 TAGTGACCCTTTTGTGTGCACTAT , 역방향 프라이며 염기서열GTTTGTATGTACTCATCTGTAAC), 뉴캣슬병 바이러스 (Newcastle disease, NDV)의 F (Fusion) 단백질 유전자 (정방향 프라이며 염기서열 GCTGATCATGAGGTTACCTC, 역방향 프라이며 염기서열 AGTCGGAGGATGTTGGCAGC) 등에 대한 역전사 중합효소연쇄반응을(RT-PCR) 실시한 후 전기영동을 실시한 결과 해당 유전자 크기의 유전체를 확인하지 못하였다. System of the chicken infectious bronchitis virus (Infectious bronchitis virus IBV) to identify jangyo other the presence or absence of pathogen proliferation is available in film strength solution of the fetus is S1 protein gene (forward PRA and sequencing TAGTGACCCTTTTGTGTGCACTAT, reverse PRA and sequencing GTTTGTATGTACTCATCTGTAAC) , Newcastle disease virus (Newcastle disease, NDV) of F (Fusion) protein gene and then conducted (normal plastic, and the base sequence GCTGATCATGAGGTTACCTC, reverse PRA and sequencing AGTCGGAGGATGTTGGCAGC) a reverse transcription polymerase chain reaction (RT-PCR) for the like subjected to electrophoresis the results did not confirm the size of the corresponding gene in the genome. 따라서 토종닭의 기관과 맹장편도 내에 조류인플루엔자 바이러스 외에는 기타 병원체가 없음을 확인하였다. Therefore, it was confirmed that the avian influenza virus and other pathogens None, except in the way institutions and cecum of chicken. (도 2) (2)

실시예 3: 동물실험을 통한 병원성 분석 Example 3: Pathogenic analysis through animal experiments

토종닭에서 분리한 조류인플루엔자 바이러스의 생체 내 병원성을 조사하기 위하여 OIE 규정에 따라 PBS로 10배 희석한 바이러스를 4주령의 SPF 닭 10마리에 수당 10 6 EID 50 씩 0.2ml의 용량으로 정맥 접종하였다. Virus was diluted 10 times with PBS according to the OIE regulations were intravenously inoculated at a dose of medical treatment to SPF chickens of 4 weeks of age by 10 10 6 EID 50 0.2ml to investigate the pathogenicity avian influenza virus isolated from a living body of chicken . 공격접종 후 10일간 임상증상 및 폐사율을 관찰한 결과 접종 후 4일과 9일 사이에 3마리의 닭이 폐사하여 폐사율은 30%로 확인되었고, OIE 규정에 따라 IVPI지수를 산출하였을 때 1.15로 확인되어 저병원성 조류인플루엔자 바이러스에 속하는 것을 확인하였다. Attack inoculated after 10 days of clinical symptoms and in three chickens between four days after the results inoculated observed mortality on the 9th and our mortality has been identified as 30%, it is sure to 1.15 when calculating the IVPI index according to OIE rules it was confirmed that jeobyeongwonseong belonging to the avian influenza virus.

실시예 4: 동물실험을 통한 증식성 분석 Example 4: Analysis by proliferative animal experiments

토종닭에서 분리한 조류인플루엔자 바이러스의 병원성과 증식성을 확인하기 위하여 백신이 이뤄지지 않은 3주령 병아리와 9주령 병아리로 각각 실험군을 구성하였고 기존에 상용화되어 이용되는 조류인플루엔자 백신을 접종한 (A/Chicken/Korea/01310/01 백신주를 항원으로 사용하여 제작된 상용화 백신, 대성미생물, 대한민국) 9주령 닭으로 실험군을 구성하여 총 3개의 실험군을 구성하였다. One was composed each test group to the 3-week-old chicks and 9-week-old chickens the vaccine is not yirwojiji inoculated with the avian flu vaccine to be used is commercially available in the conventional to determine the virulence and proliferation of avian influenza viral isolated from chicken (A / Chicken / Korea / 01310/01 of the baeksinju produced using a commercially available vaccine antigen, DAE microorganism, Republic of Korea) to configure a group of 9-week-old chicken was constructed of three experimental groups. 모든 실험군에 속한 실험계에 수당 10 6.0 EID 50 씩 0.1ml의 용량으로 비강접종하였다. Were inoculated intranasally at a dose of 0.1ml per payment 10 6.0 EID 50 in the experimental system belongs to all groups. 접종 3, 5 그리고 7일 후 구강과 총배설강을 면봉채취(Swab)하였고 채취에 사용한 면봉을 겐타마이신 항생제가 1% 함유되어 있는 PBS에 보관하였다. Inoculation 3, 5 and 7 days after the oral and total cloaca swab (Swab) were then stored on the swab used for gentamycin in PBS containing 1% antibiotic is collected. PBS와 면봉이 잘 섞이도록 한 후 PBS에 함유된 바이러스의 역가를 측정하는 방법으로 구강과 총배설강에서 배출되는 바이러스의 양을 확인하였다. After the PBS and the swab well blend the lock was confirmed that the amount of virus by measuring the titer of the virus contained in the PBS being discharged from the mouth to the total cloaca. (도 4) (4)

실험결과, 상용화된 백신을 접종한 실험군에서 80%의 바이러스 배출율을 나타내 기존에 상용화된 백신으로는 토종닭에서 분리한 바이러스를 효과적으로 방어하지 못하는 것이 확인되었다. The experimental results, in the vaccinated group showed a commercialized vaccine virus release rate of 80% on existing commercial vaccines have been found to fail to effectively defend the virus isolated from chicken.

실시예 5: 동물실험을 통한 기존 조류인플루엔자 바이러스 백신주의 공기전 파력 분석 Example 5: The existing avian influenza virus caution before air wave analysis through animal experiments

기존에 상용화되어 조류인플루엔자 사독백신의 항원으로 사용되고 있는 A/Chicken/Korea/01310/01 주의 전파력을 확인하기 위하여 바이러스 접종군, 바이러스 접종군과 직접적인 접촉은 불가능 하지만 공기는 서로 통하는 사육장에서 사육되는 공기전파군으로 실험군을 구성하였다. Is commercially available in the existing avian influenza Zadok virus inoculation group to confirm that the used A / Chicken / Korea / 01310/01 Note disseminative that the antigen of the vaccine, virus inoculation group and the direct contact is not possible, but the air is air that is kept in each other through the kennel It was constructed for experimental group with the group propagation. 바이러스 접종군에 수당 10 6.0 EID50씩 0.1ml의 용량으로 비강접종하였다. Benefits to the virus inoculated group were inoculated intranasally each with a capacity of 10 6.0 EID50 0.1ml. 접종 1, 2, 3, 4, 5, 그리고 6일 후 구강과 총배설강을 면봉채취(Swab)하였고 채취에 사용한 면봉을 겐타마이신 항생제가 1% 함유되어 있는 PBS에 보관하였다. The swab used to inoculate 1, 2, 3, 4, 5, and 6 days after oral and was shot swab (Swab) the cloaca collected Gentamicin and stored in PBS with antibiotics is contained 1%. PBS와 면봉이 잘 섞이도록 한 후 PBS에 함유된 바이러스의 유전자를 검출하는 방법으로 구강과 총배설강에서 배출되는 바이러스의 유무를 확인하였다. After the PBS and the swab well blend the lock was confirmed for the presence of virus released from the oral cavity to the total cloaca by the method for detecting a gene of a virus contained in the PBS. (도 5) (5)

실험결과 공기전파군에 속하는 실험계에서 바이러스 배출이 확인되지 않아 기존에 분리되어 백신주로 사용되고 있는 인플루엔자 바이러스 균주는 공기전파가 불가능 하다는 것이 확인되었다. Experimental results not visible to the experiment system belonging to the group of air spread the virus discharge influenza virus strain which is separate to the existing vaccines mainly used was confirmed that the air can not spread.

실시예 6: 동물실험을 통한 신규한 조류인플루엔자 바이러스 균주의 공기전 파력 분석 Example 6: The air around the wave analysis of the novel avian influenza virus strains through the animal experiment

토종닭에서 분리한 조류인플루엔자 바이러스의 전파력을 확인하기 위하여 바이러스 접종군, 바이러스 접종군과 동거사육 되는 직접접촉군, 바이러스 접종군과 직접적인 접촉은 불가능 하지만 공기는 서로 통하는 사육장에서 사육되는 공기전파군으로 실험군을 구성하였다. The virus inoculated group, virus inoculation group and the living being bred in direct contact groups, virus inoculation group and the direct contact is not possible, but the air is housed in each through aviary air propagation group to ensure disseminative of the avian influenza virus isolation in chicken the group was composed. 바이러스 접종군에 수당 10 6.0 EID 50 씩 0.1ml의 용량으로 비강접종하였다. Allowance for virus inoculation group were inoculated intranasally with 10 6.0 EID 50 per dose of 0.1ml. 접종 3, 5, 7 그리고 9일 후 구강과 총배설강을 면봉채취(Swab)하였고 채취에 사용한 면봉을 겐타마이신 항생제가 1% 함유되어 있는 PBS에 보관하였다. Inoculation 3, 5, 7 and 9 days after the oral and total cloaca swab (Swab) were then stored on the swab used for gentamycin in PBS containing 1% antibiotic is collected. PBS와 면봉이 잘 섞이도록 한 후 PBS에 함유된 바이러스의 유전자를 검출하는 방법으로 구강과 총배설강에서 배출되는 바이러스의 유무를 확인하였다.(도 5) PBS and the swabs were well blend check for the presence of virus released from the oral cavity to the total cloaca in the rock after method of detecting a gene of a virus contained in the PBS. (5)

실험결과 직접접촉군은 3일 이내에 모두 직접전파되어 모두 감염되는 것이 확인되었고, 공기전파군은 3일 이내에 전파가 시작되어 9일째에 모든 개체가 감염된 것이 확인되어 실험에 사용된 바이러스가 공기전파가 가능하다는 것이 확인되었다. Results in direct contact groups were confirmed to be infected both directly propagate all three days, the air propagation group begins to propagate within three days is confirmed that all of the objects on the ninth day infected with a virus that air propagation used in the experiment is it is possible have been identified.

실시예 7: 신규한 조류인플루엔자 바이러스 균주의 Seed Example 7: Preparation of the novel avian influenza virus strain Seed virus virus stock 의 제작 Production of stock

토종닭의 기관 또는 맹장편도 유제액을 접종한 계태아란에서 채취한 요막강액을 Master seed로 사용하여 계태아란에 2회 계대한 Seed virus stock을 제작하였다. Yo powerful solution collected from the inoculated organs or cecum way of emulsion liquid chicken embryo system is based on the fetus is used to prepare a Master seed Seed virus stock based on twice. Seed virus stock의 바이러스량을 확인하기 위해 종란에 접종하여 역가를 산출한 결과 Seed virus stock의 바이러스 함량은 10 9.0 EID 50 /로 확인되었다. After inoculation with the jongran calculates the potency in order to determine the amount of virus Seed virus stock virus content of Seed virus stock was identified as a 10 9.0 EID 50 /.

실시예 8: 신규한 조류인플루엔자 바이러스 야외분리주를 이용한 사독백신 Example 8: Zadok the vaccine using a novel avian influenza virus isolates outdoors 제작 making

K040110/2010 분리주 배양액에 0.2% 포르말린을 첨가한 후 37℃에서 15시간 처리한 후 4℃에서 1주일간 불활화 처리를 하거나, 장요막강액에 0.01M BEI(Binary ethylenimine)를 처리하여 37℃에서 3시간 또는 장요막강액에 0.2% B-PL을 처리하여 25℃에서 3시간 불활화하여 사독백신용 항원을 제작하였다. To the K040110 / 2010 1 week inactivation treatment at 4 ℃ after 15 hours treatment at 37 ℃ followed by the addition of 0.2% formalin to isolate the culture medium, or process the 0.01M BEI (Binary ethylenimine) in jangyo film strength solution at 37 ℃ 3 by treating a 0.2% B-PL in time or film strength jangyo solution was screen 3 hours inactivation at 25 ℃ to prepare a four monologue credit antigen.

실시예 9: 신규분리주를 불활화하여 제작한 백신의 안전성시험 Example 9: Safety test of the vaccine produced by inactivation of new isolates

K040110/2010 분리주를 불활화하여 제작한 시험용 사독백신의 안전성을 확인하기 위하여 15수의 3~4주령 SPF 닭 대퇴부 근육내에 1 (2dose)씩 접종하였다. K040110 / 2010 was inoculated by 1 (2dose) within 3-4 weeks old SPF chickens thigh muscle 15 can to ensure the safety of the experimental vaccine produced by Zadok Tuesday inactivated strains. 접종 후 3주간 임상증상, 증체율 그리고 폐사율을 조사하고 3주, 4주, 5주에 그룹별 5수씩 부검하여 접종부위의 육안적 병변의 형성여부를 조사한다. 3 weeks after vaccination investigate the clinical symptoms, and the growth rate and mortality by 5 per group sussik autopsy in three weeks, four weeks, five weeks investigate whether the formation of gross lesions at the injection site. 시험결과 임상증상, 증체율, 폐사율 그리고 접종부위의 육안적 병변의 형성이 무접종 대조군과 비교하여 차이가 나타나지 않아 시험제작된 백신의 안전성을 입증하였다. Test results to the clinical symptoms, growth rate, mortality, and the formation of gross lesions at the injection site compared to the non-vaccinated control group demonstrated the safety of the tested vaccine production do not differ.

실시예 10: 신규분리주를 불활화하여 제작한 백신의 효능시험 Example 10: Efficacy test of the vaccine produced by the novel isolates inactivated Chemistry

K040110/2010 분리주를 불활화하여 제작한 시험용 사독백신의 효능을 확인하기 위하여 6주령 SPF 닭을 대상으로 동물실험을 실시하였다. K040110 / 2010 were an animal experiment with the six-week-old SPF chickens in order to verify the efficacy of the experimental vaccine produced by Zadok Tuesday inactivated strains. 백신군과 대조군으로 나누었으며 백신군에는 제작한 시험백신을 1수분 접종하였다. Were divided into the vaccine and control groups were inoculated with 1 moisture test vaccine has produced the vaccine group. 백신접종 2주와 3주 후 채혈을 통하여 H9 인플루엔자 특이 항체역가를 혈구응집 억제시험을 통하여 확인하였다. The vaccination 2 weeks and specific antibody titers H9 influenza via the blood after 3 weeks was confirmed by the hemagglutination inhibition test. 2에 대한 로그값으로 항체역가를 표시하였을 때 측정한 백신 2주 후의 항체역가는 6이상이었으며 3주 후의 항체역가는 7이상으로 나타나 충분한 정도의 항체반전이 나타난 것을 확인하였다. When display the antibody as a logarithm were for 2 weeks after the second vaccination antibody titers were measured over 6 antibody confirmed that the reversal of sufficient antibody titers appeared indicated by 7 or more after three weeks. (도 7) (7)

백신 3주 후, 시험제작한 백신의 방어능을 확인하기 위하여 인플루엔자 바이러스 K040110/2010 및 K01310/2001를 마리당 10 6.0 EID 50 씩 0.1ml의 용량으로 비강접종하였다. 3 weeks after vaccination, influenza virus K040110 / maridang 2010 and K01310 / 2001 10 6.0 EID were inoculated intranasally each with a capacity of 50 0.1ml to ensure the defense capability of the test vaccine production. 공격접종 5일 후 실험계를 부검하였고 기관과 맹장편도를 채취하여 유제한 후 겐타마이신 항생제가 1% 함유되어 있는 PBS에 희석하였다. Attack autopsy was inoculated 5 days after the experiment system after the emulsion was sampled and the engine sliding door one way was diluted in PBS with 1% gentamycin antibiotic is contained. 희석한 유제액을 종란에 접종하여 바이러스의 유무를 확인하는 방법으로 기관과 맹장편도내 바이러스의 유무를 확인하였다. By inoculating the emulsion diluted to jongran it was identified as a way to check for the presence of viruses institutions and cecum presence of the virus within the Way. (도 8) (8)

시험결과 백신을 접종하지 않은 실험군의 경우 인플루엔자바이러스 K040110/2010을 공격접종하였을 때 모든 기관과 맹장편도에서 바이러스가 발견되었지만 백신을 접종한 실험군의 경우 K040110/2010을 공격접종한 후에도 모든 검체에서 바이러스가 검출되지 않아 100%에 해당하는 방어능을 보인 것을 확인하였다. The test results if the group is not vaccinated influenza virus K040110 / When the 2010 hayeoteul attack inoculated virus was found in all the organs and the cecum way, but in all samples after the case of the group inoculated with the vaccine attacked K040110 / 2010 vaccination virus not detected was found that showing the defense capacity corresponding to 100%.

또한 백신을 접종하지 않은 실험군의 경우 기존의 백신균주로 사용된 인플루엔자바이러스 K01310/2001을 공격접종하였을 때 80%에 해당하는 기관과 맹장편도에서 바이러스가 검출되었지만 백신을 접종한 실험군의 경우 K01310/2001을 공격접종한 후에도 모든 검체에서 바이러스가 검출되지 않았다. In addition, if the group is not vaccinated, but the virus is detected in the organs and the cecum way corresponding to 80% when existing hayeoteul attack inoculated with influenza virus K01310 / 2001 used as a vaccine strain, if the group was vaccinated K01310 / 2001 after the attack has not been vaccinated with the virus detected in all samples. 따라서 인플루엔자바이러스 야외분리주 K040110/2010을 사용하여 제작한 백신은 동일바이러스 외에도 기존에 백신제조용으로 사용되었던 균주에 대해서도 100%의 방어효과를 가지는 것이 확인되었다. Therefore, influenza virus isolates outdoor K040110 / vaccine produced using a 2010 was found to have a 100% protective effect even for the strains that were used for preparing a vaccine in addition to the same existing virus.

한국생명공학연구원 Korea Research Institute of Bioscience and Biotechnology KCTC11938BP KCTC11938BP 20110530 20110530

Claims (11)

  1. 삭제 delete
  2. 삭제 delete
  3. 기탁번호 KCTC 11938BP로 기탁된 H9N2형 저병원성 조류인플루엔자 A 바이러스 K040110/2010 주 및 약학적 허용 담체 또는 희석제를 포함하고, Accession No comprises a jeobyeongwonseong H9N2 type avian influenza virus A K040110 / 2010 state, and a pharmaceutically acceptable carrier or diluent deposited as KCTC 11938BP,
    상기 조류인플루엔자 A 바이러스는 불활성화된 형태인 것을 특징으로 하는 조류인플루엔자 A 바이러스 감염으로부터 유발된 질병에 대한 가금 보호용 백신. The avian influenza A virus vaccine for the protection of poultry from the disease-causing avian influenza A virus infection, characterized in that the active form of fire.
  4. 삭제 delete
  5. 삭제 delete
  6. 제3항에 있어서, 상기 백신이 보조제를 추가로 포함하는 것을 특징으로 하는 백신. The method of claim 3 wherein the vaccine is characterized in that the vaccine further comprises an adjuvant.
  7. 제3항에 있어서, 상기 백신이 가금에 감염성이 있는 다른 병원균의 백신성분을 하나 이상 추가로 포함하는 것을 특징으로 하는 백신. The method of claim 3 wherein the vaccine is characterized in that the vaccine further comprises one or more vaccine components of other pathogens infectious to poultry.
  8. 삭제 delete
  9. 삭제 delete
  10. 삭제 delete
  11. 삭제 delete
KR20120013759A 2011-05-30 2012-02-10 A novel airborn transmissible low pathogenic avian Influenza virus (H9N2) K040110/2010 and vaccine for low pathogenic avian Influenza comprising the same KR101360112B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR20110051518 2011-05-30
KR1020110051518 2011-05-30

Publications (2)

Publication Number Publication Date
KR20120135015A true KR20120135015A (en) 2012-12-12
KR101360112B1 true KR101360112B1 (en) 2014-02-06

Family

ID=47903107

Family Applications (1)

Application Number Title Priority Date Filing Date
KR20120013759A KR101360112B1 (en) 2011-05-30 2012-02-10 A novel airborn transmissible low pathogenic avian Influenza virus (H9N2) K040110/2010 and vaccine for low pathogenic avian Influenza comprising the same

Country Status (1)

Country Link
KR (1) KR101360112B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110027309A1 (en) 2006-09-18 2011-02-03 Walter Bottje Compositions and methods of enhancing immune responses
US20110150912A1 (en) 2008-03-13 2011-06-23 Perez Daniel R Avian influenza virus live attenuated vaccine and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110027309A1 (en) 2006-09-18 2011-02-03 Walter Bottje Compositions and methods of enhancing immune responses
US20110150912A1 (en) 2008-03-13 2011-06-23 Perez Daniel R Avian influenza virus live attenuated vaccine and uses thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Veterinary Microbiology. 2006, Volume 118, Issues 3-4, Pages 169-176. *
Veterinary Microbiology. 2006, Volume 118, Issues 3-4, Pages 169-176.*
Virus Research. 2008, Volume 133, Issue 2, Pages 187-194. *
Virus Research. 2008, Volume 133, Issue 2, Pages 187-194.*

Also Published As

Publication number Publication date Type
KR20120135015A (en) 2012-12-12 application

Similar Documents

Publication Publication Date Title
Cavanagh Severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus
Cavanagh et al. Infectious bronchitis
Kapczynski et al. Immune responses of poultry to Newcastle disease virus
Cook Avian pneumovirus infections of turkeys and chickens
Swayne et al. Highly pathogenic avian influenza
Alexander Newcastle disease and other avian paramyxoviruses
Miller et al. Evidence for a new avian paramyxovirus serotype-10 detected in rockhopper penguins from the Falkland Islands
Bijlenga et al. Development and use of the H strain of avian infectious bronchitis virus from the Netherlands as a vaccine: a review
Miller et al. Comparison of viral shedding following vaccination with inactivated and live Newcastle disease vaccines formulated with wild-type and recombinant viruses
Meulemans Infectious bursal disease (Gumboro disease)
Terregino et al. Pathogenicity of a QX strain of infectious bronchitis virus in specific pathogen free and commercial broiler chickens, and evaluation of protection induced by a vaccination programme based on the Ma5 and 4/91 serotypes
Jones Avian reovirus infections
Cook et al. Antigenic differentiation of strains of turkey rhinotracheitis virus using monoclonal antibodies
Webster et al. The immunogenicity and efficacy against H5N1 challenge of reverse genetics-derived H5N3 influenza vaccine in ducks and chickens
Van Reeth et al. Influenza virus
Cook et al. Preliminary antigenic characterization of an avian pneumovirus isolated from commercial turkeys in Colorado, USA
US6919084B2 (en) Duck pneumovirus and corresponding vaccines
McFerran et al. Avian adenoviruses
Allwright et al. Isolation of an influenza A virus from ostriches (Struthio camelus)
Cook Avian rhinotracheitis
Kim et al. Biological and phylogenetic characterization of pigeon paramyxovirus serotype 1 circulating in wild North American pigeons and doves
Verwoerd Ostrich diseases
WO1999024068A1 (en) Immortal avian cell line to grow avian and animal viruses to produce vaccines
Dortmans et al. Newcastle disease virus outbreaks: vaccine mismatch or inadequate application?
Cook et al. Detection and differentiation of avian pneumoviruses (metapneumoviruses)

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E601 Decision to refuse application
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20161228

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180102

Year of fee payment: 5