KR20240014010A - Infectious Bronchitis virus attenuated strain and Vaccine composition comprising the same - Google Patents

Abstract

The present invention relates to an attenuated chicken infectious bronchitis virus strain and a vaccine composition containing the same. The attenuated strain of the present invention has weak pathogenicity and excellent immunogenicity, and can induce protective ability against chicken infectious bronchitis virus, so it can be usefully used as a live attenuated vaccine.

Description

Attenuated chicken infectious bronchitis virus strain and vaccine composition comprising the same {Infectious Bronchitis virus attenuated strain and Vaccine composition comprising the same}

The present invention relates to an attenuated strain of chicken infectious bronchitis virus and a vaccine composition containing the same. More specifically, the present invention relates to the attenuated IBV QX 1830029 HP70 strain of the chicken infectious bronchitis virus IBV/Korea/289/2018 strain at a high temperature of 60°C - 70°C and the chicken infectious bronchitis virus vaccine composition using the same. It's about.

Avian Infectious Bronchitis (IB) is an acute respiratory infectious disease in chickens caused by the Infectious bronchitis virus (IBV). IB has a high morbidity rate of close to 100% and causes a decrease in overall productivity, including coughing, runny nose, decreased body weight gain, and decreased egg production accompanied by decreased external and internal egg quality. Although the mortality rate of chickens due to IBV infection itself is not high, most IB is accompanied by secondary bacterial infections such as colibacillosis, which results in a high mortality rate and causes additional economic losses such as antibiotic administration. This is causing enormous economic damage in most countries where the poultry industry exists.

The pathogen that causes this disease is IBV, a member of the Gammacoronavirus family of Coronaviridae. Since the first diagnosis of IBV was reported in the United States in the 1930s, only the Massachusetts (Mass) serotype, called the respiratory type, was known to exist until the 1940s. However, after a new serotype distinct from the respiratory type was reported, it was reported worldwide. Reports of various serotypes continue to occur in each country. IBV has a much higher mutation rate in the Spike gene, which encodes the major antigen-determining protein, than other viruses, and genetic mutations occur through various mechanisms such as recombination and self-mutation within the viral gene, resulting in genetic mutations. More than dozens of serotypes have been reported, and the emergence of new serotypes continues.

Since the first respiratory type IBV (hereinafter referred to as GI-15 IBV) was isolated and reported in Korea in 1986, IBV infection has continuously caused respiratory symptoms and reduced egg production accompanied by malformed eggs. After the Korean isolated renal-type IBV (hereinafter referred to as KM91-like IBV) was reported in the 1990s, kidney-type IBV began to account for most of the IB occurring in Korea, and since the early 2000s, kidney-type IBV (hereinafter referred to as QX-like) originating in China Continuous mutations of the IBV epidemic are being reported, such as the simultaneous occurrence of subgroup IBV and the emergence of a recombinant virus of the two. Due to the nature of IBV, there is a limitation in the cross-protection ability between different serotypes, so vaccines currently used in the poultry industry are being developed to match the prevalent IBV serotypes in each country. The Massachusetts serotype (Mass type) preventive vaccine (e.g., H120 strain), developed in the late 1980s shortly after the occurrence of IB was first confirmed, is still used in live and killed vaccine forms to this day, and was introduced in 1997 when KM91-like IBV was identified. Since 2011, a dead-toxin vaccine using the KM91 strain has been developed and is being used along with the mass-type vaccine. Subsequently, K-II type live and killed vaccines were developed using the K2 strain, which has the same genotype as the KM91 strain. However, despite the use of various vaccine strains, damage caused by IB in poultry farms still continues due to differences in the protective type of existing vaccines from prevalent strains and quality issues with the vaccine.

In particular, the renal type IBV (hereinafter referred to as IBV QX-like subgroup III IBV), which has recently become prevalent in Korea and causes damage, includes isolates belonging to the KM91-like IBV, which was prevalent in the 1990s, and QX-like subgroup I, which originated in China in the early 2000s. It was confirmed that it had relatively low genetic homology with viruses that were prevalent in the past, forming a genetically phylogenetically different cluster from isolates belonging to IBV. (Genomic Analysis of Avian Infectious Bronchitis Viruses Recently Isolated in South Korea Reveals Multiple Introductions of GI-19 Lineage (IBV QX Genotype), Viruses (2021 May) 31;13(6), 1045) Nevertheless, the latest trendy stock, QX- There are no vaccines developed against IBV belonging to like subgroup III.

The present inventors have made intensive research efforts to develop and manufacture a preventive vaccine based on the recently prevalent IBV. As a result, the present invention was produced by producing an attenuated IBV QX 1830029 HP70 strain of the IBV/Korea/289/2018 virus belonging to the QX-like subgroup III genotype IBV that is recently prevalent in Korea, and by identifying its effect in preventing chicken infectious bronchitis infection. was completed.

Therefore, the object of the present invention is to provide an attenuated chicken infectious bronchitis virus QX 1830029 HP70 strain.

Another object of the present invention is to provide a vaccine composition for preventing chicken infectious bronchitis virus, including the chicken infectious bronchitis virus QX 1830029 HP70 strain.

According to one aspect of the present invention, the present invention provides chicken infectious bronchitis virus QX 1830029 HP70 strain.

In one embodiment of the present invention, the QX 1830029 HP70 strain is attenuated from chicken infectious bronchitis virus IBV/Korea/289/2018.

The QX 1830029 HP70 strain according to one embodiment of the present invention was deposited by the Korea Research Institute of Biotechnology Biological Resources Center (KCTC) under the accession number KCTC 15049BP on August 11, 2022.

In one embodiment of the present invention, the Spike protein of the QX 1830029 HP70 strain contains the amino acid sequence of SEQ ID NO: 6.

In one embodiment of the present invention, the Spike protein of the QX 1830029 HP70 strain is encoded by the nucleotide sequence of SEQ ID NO: 4.

In one embodiment of the present invention, the chicken infectious bronchitis virus QX 1830029 HP70 strain is attenuated by subculturing the IBV/Korea/289/2018 virus.

In one embodiment of the present invention, the subculture is performed by heat treatment at a temperature of 60 to 70°C.

In one embodiment of the present invention, the subculture is carried out in chicken embryo eggs.

In one embodiment of the present invention, the subculture is repeated 50 to 70 times.

In one embodiment of the present invention, the heat treatment is performed for 20 minutes to 3 hours, or 20 minutes to 2 hours.

According to another aspect of the present invention, the present invention provides a vaccine composition for preventing chicken infectious bronchitis virus, including the chicken infectious bronchitis virus QX 1830029 HP70 strain described above.

In one embodiment of the present invention, the vaccine is an attenuated vaccine or an inactivated vaccine.

The vaccine according to the present invention can be produced by conventional methods such as those commonly used for commercially available IBV attenuated vaccines and IBV inactivated vaccines. In summary, cells or individuals susceptible to IBV are inoculated with IBV according to the present invention, propagated until the virus replicates to the desired infectious titer, and then IBV-containing material is recovered and optionally attenuated or inactivated. After that, it is mixed with a pharmaceutically acceptable carrier or diluent.

The attenuated vaccine according to the present invention containing the live virus of the present invention may be manufactured and sold in the form of a suspension or lyophilized form, and may be prepared using a pharmaceutically acceptable carrier or a pharmaceutically acceptable carrier commonly used in such compositions. Additionally contains a diluent. Carriers include stabilizers, preservatives and buffering agents. Suitable stabilizers are, for example, SPGA, carbohydrates (such as sorbitol, mannitol, starch, sucrose, dextran, glutamate or glucose), proteins (such as albumin or casein) or their degradation products. Suitable buffering agents are, for example, alkali metal phosphates. Suitable preservatives are thimerosal, merthiolate and gemtamycin. Diluents include water, aqueous buffers (such as PBS), alcohols, and polyols (such as glycerol).

If necessary, the live attenuated vaccine according to the present invention may contain an adjuvant. Examples of suitable compounds and compositions having immunoadjuvant activity are mentioned below.

The live vaccine according to the invention can be administered by injection, for example by intramuscular injection, subcutaneous injection or into eggs, but not by the inexpensive mass application route commonly used for IBV vaccination. It is desirable. For IBV vaccination, these routes include drinking water, spray, and aerosol vaccination.

Alternatively, the present invention provides a vaccine comprising an inactivated, or killed form of IBV. The advantage of the inactivated IBV vaccine is that high concentrations of protective antibodies can be maintained for a long period of time.

The purpose of inactivation of viruses recovered after the propagation step is to prevent replication of the virus. Generally, this can be done by chemical or physical means known in the art.

Vaccines comprising inactivated IBV may comprise, for example, one or more of the above-mentioned pharmaceutically acceptable carriers or diluents suitable for this purpose.

Preferably, the inactivated vaccine according to the invention comprises at least one compound having immune adjuvant activity. Compounds or compositions suitable for this use include aluminum hydroxide, aluminum phosphate or aluminum oxide, for example oil-in-water or water-in-oil emulsions based on mineral oils (e.g. Bayol F or Marcol 52) or vegetable oils. , such as vitamin E acetate and saponins.

The vaccine according to the invention comprises as active ingredient an effective amount of the isolated IBV of the invention, i.e. an amount of IBV that induces immunity in vaccinated birds against challenge by wild IBV. Immunity is defined herein as inducing a significantly higher level of protection in vaccinated avian populations compared to non-vaccinated groups.

In general, the live vaccine according to the present invention can be administered at a dose of 10 ⁰ to 10 ⁹ TCID ₅₀ per animal, preferably 10 ³ to 10 ⁶ TCID ₅₀ per animal. The inactivated vaccine may contain an antigenic equivalent of 10 ⁶ to ^{10 10} TCID ₅₀ per animal.

Inactivated vaccines are usually administered parenterally, for example by intramuscular or subcutaneous injection.

The IBV vaccine according to the present invention can be effectively used in chickens, but can also be effectively used in other poultry, such as turkeys, guinea fowl, etc. The chickens include young chickens, broilers and laying hens.

The age of animals administered the live attenuated or inactivated vaccine according to the present invention is the same as that of animals administered the conventional live attenuated vaccine or inactivated IBV vaccine. For example, young chickens (without maternally derived antibodies - MDA) can be vaccinated at 1 day of age or in eggs, while young chickens with high levels of MDA are preferably vaccinated at 2 to 3 weeks of age. Layers or broiler chickens with low MDA levels are vaccinated at 1 to 10 days of age, followed by additional inactivated vaccines at 6 to 12 weeks of age and 16 to 20 weeks of age.

The present invention also includes combination vaccines comprising, in addition to IBV as described above, other pathogens infectious to poultry or one or more vaccine components prepared therefrom.

In a specific embodiment of the present invention, the combination vaccine is used against Mareks Disease virus (MDV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV), and low egg production syndrome. (egg drop syndrome; EDS) virus, turkey rhinotracheitis virus (TRTV), or reovirus, or one or more pathogens, or a vaccine manufactured therefrom.

The present invention relates to an attenuated chicken infectious bronchitis virus strain and a vaccine composition containing the same. The attenuated chicken infectious bronchitis virus QX 1830029 HP70 strain of the present invention has weak pathogenicity and excellent immunogenicity, and can induce a protective effect against chicken infectious bronchitis virus, so it can be usefully used as an attenuated live vaccine. Considering that QX-type IBV is a threat not only in Korea but also in most countries such as China, Japan, Southeast Asia, and Europe, it can contribute to preventing productivity decline in the global poultry industry.

Figure 1 is a diagram showing the results of genetic analysis of the IBV/Korea/289/2018 virus (IBV QX 1830029 low passage).
Figure 2 is a diagram showing the tissue safety evaluation results (Two-way ANOVA, Bonferroni posttests between each column) by day after eye drop vaccination with IBV QX 1830029 low passage and HP70 caution in 1-day-old SPF chicks.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Throughout this specification, “%” used to indicate the concentration of a specific substance means (weight/weight) % for solid/solid, (weight/volume) % for solid/liquid, and Liquid/liquid is (volume/volume) %.

Example 1: Isolation and identification of infectious bronchitis virus (IBV) in a domestic outdoor farm

In 2018, organs and kidneys were collected from suspected chicken infectious bronchitis virus infection at a domestic chicken farm, and sterile phosphate buffer solution (PBS, pH 7.2) was added to create an emulsion of 10% weight. The prepared emulsion was centrifuged at 3,000 g for 15 minutes to precipitate cells and tissues, and the supernatant was filtered through a 0.45 μm syringe filter to extract live viruses. The extracted virus was inoculated into the allantoic cavity (AC) of 11-day-old SPF embryonated eggs, and the virus was collected after culturing for 48 to 72 hours. To separate the red blood cells mixed in during the collection process, centrifugation was performed at 2,000 g for 10 minutes, and the presence of chicken infectious bronchitis virus was confirmed in the supernatant through reverse transcription polymerase chain reaction (RT-PCR).

Example 2: Attenuation of virus through continuous subculture and heat treatment in chicken embryo eggs

In order to reduce the pathogenicity of the isolated IBV/Korea/289/2018 virus (hereinafter referred to as IBV QX 1830029 low passage) and use it as a live vaccine, it was subcultured continuously in 10-day-old SPF chicken embryo eggs. Serial subculture of chicken embryos for attenuation, as described by Jackwood et al. (Rapid heat-treatment attenuation of infectious bronchitis virus, Avian Pathology (June 2010) 39(3), 227-233), weakens the original pathogenicity of the virus. This was repeated until the test was complete, and as a result of 70 passages, IBV QX 1830029 Heat passage 70 (hereinafter referred to as 'IBV QX 1830029 HP70') strain was obtained.

Normal IBV isolates are generally weak to heat to the extent that they are inactivated when heat treated at 56°C for 15 minutes, but in the case of IBV QX 1830029 low passage strain, unlike other IBVs, it is easily attenuated due to its strong resistance to heat. It showed the characteristic of not being angry. Accordingly, the present inventors performed attenuation under temperature conditions varying from 60°C to 70°C during continuous subculture. The heat treatment temperature and time were as shown in [Table 1] below.

Subculture procedure and heat treatment temperature and time to secure IBV QX 18300029 HP70 stock Number of passages heat treatment temperature heat treatment time CE1-CE33 65℃ 120min CE34-CE41 70℃ 45min CE42-CE63 62℃ 25min CE64-CE70 60℃ 20min

Example 3: Base sequence analysis of IBV QX 1830029 HP70 strain and homology comparison with field isolates

In order to confirm changes as the chicken infectious bronchitis virus is attenuated, the present inventors conducted comparative base sequence analysis on the S1 protein, which determines the neutralization ability and serotype of the virus, including neutralization and serotype-specific epitopes. .

Reverse transcription polymerization using the forward primer nucleotide sequence of SEQ ID NO: 1 (20,180-F: TGGAAAAACACTGCACGCAA) and the reverse primer nucleotide sequence of SEQ ID NO: 2 (24,216-R: TCACCTGAACAATCGTCAGCT) The genetic homology of the IBV QX 1830029 low-passage and HP70 strains was compared by expressing them through enzyme chain reaction (RT-PCR) and then analyzing their base sequences.

[Table 2] and [Table 3] are the results of Spike protein gene sequence analysis of IBV QX 1830029 low passage and HP70 strains, respectively.

In addition, to analyze the phylogenetic characteristics of the outdoor IBV/Korea/289/2018 virus (IBV QX 1830029 low passage), the S1 protein base sequence and phylogenetic analysis of the major IBV isolates were performed. As a result, IBV/Korea/289 /2018 virus (IBV QX 1830029 low passage) was confirmed to belong to the IBV QX-like III subgroup, which has recently been prevalent in Korea, as shown in [Figure 1].

Example 4: Attenuation evaluation of IBV QX 1830029 HP70 caution

4-1. IBV QX 1830029 HP70 Caution Safety evaluation during eye drop vaccination

In order to evaluate whether the attenuated strain of the present invention, the IBV QX 1830029 HP70 strain, was successfully attenuated, a pathogenicity comparison test was conducted through eye drop inoculation of the IBV QX 1830029 low passage and HP70 strains.

The negative control group was inoculated with the same amount of sterilized phosphate buffer solution (PBS) and observed for 21 days. On the 3rd, 5th, 7th, 10th, 14th, and 21st days after vaccination, an appropriate amount of samples were extracted from each test group and control group, and safety was assessed based on the tissue lesion index of organs and kidneys and the ciliary loss index (ciliostasis). was evaluated. The results are shown in [Table 4] and [Figure 2].

Comparison results of clinical symptoms and mortality rate for 21 days after IBV QX 1830029 low-passage and HP70 eye drop vaccination in 1-day-old SPF chicks group inoculum concentration Dead yarn ^B G1:
IBV QX 1830029 HP70 Note
(1830029 HP) 10 ^4.5 EID ₅₀ /Number 0/36 G2:
IBV QX 1830029 Low Passage Share
(1830029 LP) 10 ^4.5 EID ₅₀ /Number 7/35 G3:
Negative control group - 0/36

^A Number of sorghums that developed clinical symptoms after eye drop vaccination/Total number of tested sorghums ^B Number of sorghums that died after eye drop vaccination/Total number of tested sorghums

As a result of evaluating attenuation through eye drop vaccination, clinical symptoms and mortality were not confirmed in the IBV QX 1830029 HP70 strain and the negative control group, but a 20% mortality rate for 21 days was confirmed in the IBV QX 1830029 Low Passage strain. I was able to.

In addition, as a result of comparing histological lesions, statistically significant differences were observed in the IBV QX 1830029 low-passage strain compared to the negative control and HP70 strains, but similar results to the negative control were obtained in the IBV QX 1830029 HP70 strain.

Therefore, the pathogenicity of IBV QX 1830029 HP70, the attenuated strain of the present invention, was reduced, and it was confirmed to be safe when inoculated by eye drop in 1-day-old chicks.

4-2. IBV QX 1830029 HP70 Caution Safety evaluation during spray vaccination

To evaluate the safety of IBV QX 1830029 HP70, the attenuated strain of the present invention, during spray inoculation, a tissue safety comparison test was conducted through spray inoculation of IBV QX 1830029 HP70 and the control vaccine. As a control vaccine, a vaccine that was commercialized and widely used in Korea was selected.

A total of 60 1-day-old SPF chicks were divided into 20 groups each, IBV QX 1830029 HP70 group, control vaccine group, and negative control group, and spray vaccination was performed at 10 ^4.5 EID ₅₀ / number. The negative control group was inoculated with the same amount of sterilized phosphate buffer solution (PBS). Five days after inoculation, organs and kidneys were collected through autopsy of 10 animals each from the test and control groups, fixed in 10% formalin, and tissue lesion index and ciliary loss index (ciliostasis) were calculated to evaluate safety. The remaining animals were observed for clinical symptoms related to chicken infectious bronchitis, including death, for 14 days after vaccination, and the results were recorded in [Table 5] and [Table 6].

Evaluation results of tissue lesion index and cilia loss index 5 days after spray vaccination of IBV QX 1830029 HP70 main and control vaccines in 1-day-old SPF chicks group Tissue Lesion Index ^A (Mean ± SD) Ciliary loss index ^B (Mean ± SD) upper body central agency lower body height upper body central agency lower body IBV QX 1830029
HP70 weeks 0.8±0.6 0.4±0.5 0.5±0.5 0.6±0.5 2.5±1.4 1.4±1.4 1.7±1.2 Control vaccine group 1.9±0.7 1.8±0.6 1.1±0.3 0.7±0.5 2.4±1.2 2.7±1.3 2.0±1.4 Negative control group 0.9±0.6 0.4±0.5 0.3±0.4 0.6±0.5 2.0±0.9 1.1±1.2 1.1±1.5

^A Histological lesion index of organs and kidneys collected 5 days after test vaccine vaccination (0, normal; 1, extensively focal; 2, multifocal; 3, diffuse) ^B Ciliary loss lesion index of organs collected 5 days after test vaccine vaccination (0, normal cilia; 1, ≤25% cilia damaged; 2, ≤50%; 3, ≤75%; 4, ≥75)

Observation results of clinical symptoms and mortality for 14 days after spray vaccination with IBV QX 1830029 HP70 strain and control vaccine in 1-day-old SPF chicks group inoculum concentration Clinical symptoms ^A Dead yarn ^B IBV QX 1830029
HP70 weeks 10 ^4.5 EID ₅₀ /Number 0/10 0/10 Control vaccine group 10 hydration (x10 dose) 0/10 0/10 Negative control group - 0/10 0/10

^A Number of sorghums that developed clinical symptoms after spray vaccination/total number of tested sorghums ^B Number of sorghums that died after spray vaccination/total number of tested sorghums

As a result of the safety evaluation of IBV QX 1830029 HP70 caution spray vaccination, it was confirmed that there were no clinical symptoms and mortality, the same as the control vaccine group and negative control group. In addition, as a result of comparing histological lesions, lesions of a lower or similar degree were observed compared to the control vaccine group, and similar results to the negative control group were obtained. Therefore, it was confirmed that the IBV QX 1830029 HP70 strain of the present invention was safe when spray-inoculated in 1-day-old chicks.

4-3. IBV QX 1830029 HP70 Caution Safety evaluation during drinking water vaccination

To evaluate the safety of IBV QX 1830029 HP70 by drinking water inoculation, a tissue safety comparative test was conducted through drinking water inoculation of IBV QX 1830029 HP70 and the control vaccine. The control vaccine was a vaccine that was commercialized and widely used in Korea.

A total of 60 3-week-old SPF chickens were divided into 10 groups of IBV QX 1830029 HP70 group, control vaccine group, and negative control group, and then administered negative vaccination at 10 ^4.5 EID ₅₀ /number. The negative control group was inoculated with the same amount of sterilized phosphate buffer solution (PBS). Five days after vaccination, organs and kidneys were collected through autopsy of 10 animals each from the test and control groups, fixed in 10% formalin, and tissue lesion index and ciliary loss index (ciliostasis) were calculated to evaluate safety. The results were recorded in [Table 7] and [Table 8].

Observation results of clinical symptoms and mortality for 14 days after oral vaccination with IBV QX 1830029 HP70 strain and control vaccine in 3-week-old SPF chickens group inoculum concentration Clinical symptoms ^A Dead yarn ^B IBV QX 1830029 HP70 10 ^4.5 EID ₅₀ /Number 0/10 0/10 Control vaccine group 10 hydration (x10 dose) 0/10 0/10 Negative control group PBS 0/10 0/10

Tissue lesion index and cilia loss index evaluation results 5 days after negative inoculation with IBV QX 1830029 HP70 in 3-week-old SPF chickens group Tissue Lesion Index ^A (Mean ± SD) Ciliary loss index ^B (Mean ± SD) upper body central agency lower body height upper body central agency lower body IBV QX 1830029 HP70 Note 0.1±0.3 0.2±0.4 0.2±0.4 0.4±0.7 0.4±0.5 0.1±0.3 0.1±0.3 Control vaccine group 0.7±0.7 0.2±0.4 0.2±0.4 1.0±0.7 0.2±0.4 0.0±0.0 0.0±0.0 Negative control group 0.4±0.5 0.2±0.4 0.0±0.0 0.4±0.5 0.0±0.0 0.0±0.0 0.0±0.0

^A Histological lesion index of organs and kidneys collected 5 days after test vaccine vaccination (0, normal; 1, extensively focal; 2, multifocal; 3, diffuse) ^B Ciliary loss lesion index of organs collected 5 days after test vaccine vaccination (0, normal cilia; 1, ≤25% cilia damaged; 2, ≤50%; 3, ≤75%; 4, ≥75)

As a result of the safety evaluation in drinking water inoculation with IBV QX 1830029 HP70, it was confirmed that there were no clinical symptoms and mortality, the same as the control vaccine group and negative control group. In addition, as a result of comparing histological lesions, lesions of a lower or similar degree were observed compared to the control vaccine group, and similar results to the negative control group were obtained. Therefore, it was confirmed that IBV QX 1830029 HP70 was safe when administered in drinking water to 3-week-old chickens.

4-4. IBV QX 1830029 HP70 Caution Minimum immunogenicity test

An evaluation test was conducted through eye drop vaccination to measure the minimum immunogen performance of IBV QX 1830029 HP70. A total of 40 1-day-old SPF chicks were divided into 10 groups, 10 ^2.5 EID ₅₀ /number inoculation group, 10 ^3.0 EID ₅₀ /number inoculation group, 10 ^3.5 EID ₅₀ /number inoculation group, and negative control group and then inoculated. The negative control group was inoculated with the same amount of sterilized phosphate buffer solution (PBS). The development of clinical symptoms in each individual was observed for 21 days after vaccination, and blood was collected from all subjects in the test and control groups 21 days after vaccination, and the neutralization index for IBV was measured. The results are recorded in [Table 9].

Observation results of IBV neutralization index and clinical symptoms when inoculated with IBV QX 1830029 HP70 by eye drop in 1-day-old SPF chicks division inoculum concentration IBV neutralization index (Log10) ^A Clinical symptoms ^B IBV QX 1830029
HP70 weeks 10 ^2.5 EID ₅₀ /Number 3.3 0/10 10 ^3.0 EID ₅₀ /Number 4.0 0/10 10 ^3.5 EID ₅₀ /Number 4.5 0/10 control group - - 0/10

^A Neutralization index of each test vaccine against control serum 3 weeks after test vaccine vaccination ^B Sorghum/vaccine sorghum that showed clinical symptoms, including death, after test vaccine vaccination

As a result of the evaluation, it was confirmed that when inoculating the IBV QX 1830029 HP70 by eye drop, the neutralization index exceeded 2.0 at all concentrations, meeting the national release approval test standards for veterinary drugs.

Example 5: Evaluation of efficacy during spray vaccination with IBV QX 1830029 HP70 caution

An evaluation test was conducted to measure the efficacy of IBV QX 1830029 HP70 in 1-day-old chicks. A total of 30 1-day-old SPF chicks were divided as shown in [Table 10] and spray-inoculated at 10 ^3.5 EID ₅₀ / number. 21 days after vaccination, blood was collected from all the vaccinated and negative control groups, and the neutralization index against IBV was measured. At the same time, as shown in [Table 10], the organs and kidneys were collected through autopsy 5 days after the challenge, and the virus was re-isolated. The results are recorded in [Table 11].

IBV 1830029 HP70 Caution Overview of spray efficacy test on 1-day-old chicks division public announcement Juryeong vaccine strain Attack inoculation strain Group1 10 1 day old IBV QX 1830029 HP70 IBV QX 1830029 Low Passage Group2 9 1 day old - IBV QX 1830029 Low Passage Group3 10 1 day old - -

Test results of IBV neutralization index and protective activity against IBV QX 1830029 low passage when sprayed with IBV QX 1830029 HP70 caution in 1-day-old SPF chicks division IBV neutralization index ^A Clinical symptoms ^B Re-separation rate ^c Agency height IBV QX 1830029
HP70 main vaccination group 5.2 1/10 1/10 1/10 control group 0.0 9/9 9/9 9/9

^A Neutralization index of each test vaccine against control serum 3 weeks after test vaccine ^B Sorghum/vaccine sorghum that showed clinical symptoms, including death, after challenge vaccination

^C Re-isolation of challenge inoculation strain from each organ Positive sorghum/IBV challenge inoculation sorghum

As a result of the evaluation, it was confirmed that IBV QX 1830029 HP70 Caution 1-day-old chicks were spray-inoculated at a concentration of 10 ^3.5 EID ₅₀ / number, and the neutralization index exceeded 2.0, meeting the national release approval test standards for veterinary drugs. Result of re-isolation test A high defense rate was confirmed. Therefore, it was confirmed that IBV QX 1830029 HP70 was effective when sprayed in 1-day-old chicks.

Example 6: Evaluation of efficacy during drinking water inoculation with IBV QX 1830029 HP70 caution

IBV QX 1830029 HP70 Caution An evaluation test was conducted to measure efficacy in 3-week-old chickens. A total of 30 3-week-old SPF chickens were divided as shown in [Table 12] and then negatively inoculated at a concentration of 10 ^3.5 EID ₅₀ / number. 21 days after vaccination, blood was collected from all of the vaccinated group and the negative control group to measure the neutralization index for IBV, and at the same time, they were challenged with IBV QX 1830029 low-passage strain as shown in [Table 12]. Five days after the challenge vaccination, organs and kidneys were collected through autopsy and virus re-isolation was performed, and the results are recorded in [Table 13].

IBV QX 1830029 HP70 Caution Overview of drinking efficacy test in 3-week-old chickens division public announcement Juryeong vaccine strain Attack inoculation strain Group1 10 3 weeks old IBV QX 1830029 HP70 IBV QX 1830029 Low Passage Group2 10 3 weeks old - IBV QX1830029 Low Passage Group3 10 3 weeks old - -

Test results of IBV neutralization index and protective activity against IBV QX 1830029 low-passage when inoculated with IBV QX 1830029 HP70 caution in 3-week-old SPF chickens division IBV neutralization index ^A Clinical symptoms ^B Re-separation rate ^c Agency height IBV QX 1830029
HP70 main vaccination group 4.0 0/10 0/10 1/10 control group - 0/10 10/10 10/10

^A Neutralization index of each test vaccine against control serum 3 weeks after test vaccine ^B Sorghum/vaccine sorghum that showed clinical symptoms, including death, after challenge vaccination

^C Re-isolation of challenge inoculation strain from each organ Positive sorghum/IBV challenge inoculation sorghum

As a result of the evaluation, it was confirmed that when IBV QX 1830029 HP70 was inoculated into 3-week-old chickens at a concentration of 10 ^3.5 EID ₅₀ / number, the neutralization index exceeded 2.0 and met the national release approval test standards for veterinary drugs. Re-isolation test A high defense rate was confirmed in the results. Therefore, it was confirmed that IBV QX 1830029 HP70 was effective when administered in water to 3-week-old chickens.

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC15049BP 20220811

Claims (11)

Chicken infectious bronchitis virus QX 1830029 HP70, deposited under accession number KCTC 15049 BP.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 1, wherein the QX 1830029 HP70 strain is attenuated from chicken infectious bronchitis virus IBV/Korea/289/2018.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 1, wherein the Spike protein of the QX 1830029 HP70 strain contains the amino acid sequence of SEQ ID NO: 6.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 1, wherein the Spike protein of the QX 1830029 HP70 strain is encoded by the nucleotide sequence of SEQ ID NO: 4.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 1, wherein the chicken infectious bronchitis virus QX 1830029 HP70 strain is attenuated by subculturing the IBV/Korea/289/2018 virus.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 5, wherein the subculture is performed by heat treatment at a temperature of 60 to 70°C.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 5, wherein the subculture is performed in chicken embryo eggs.
The chicken infectious bronchitis virus QX 1830029 HP70 strain according to claim 5, wherein the subculture is repeated 50 to 70 times.
A vaccine composition for preventing chicken infectious bronchitis virus, comprising the chicken infectious bronchitis virus QX 1830029 HP70 strain of any one of claims 1 to 8.
The vaccine composition according to claim 5, wherein the vaccine is an attenuated vaccine.
The vaccine composition according to claim 5, wherein the vaccine is administered by oral inoculation or spray inoculation.