KR20120056614A - Biomarker for measuring radiation exposure - Google Patents
Biomarker for measuring radiation exposure Download PDFInfo
- Publication number
- KR20120056614A KR20120056614A KR1020100118237A KR20100118237A KR20120056614A KR 20120056614 A KR20120056614 A KR 20120056614A KR 1020100118237 A KR1020100118237 A KR 1020100118237A KR 20100118237 A KR20100118237 A KR 20100118237A KR 20120056614 A KR20120056614 A KR 20120056614A
- Authority
- KR
- South Korea
- Prior art keywords
- genbank accession
- radiation
- gene
- expression
- elavl4
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6884—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from lung
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Urology & Nephrology (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- General Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
본 발명은 방사선 저항성 세포주인 사람 폐암 세포주 A549로부터 발굴된 방사선 피폭 측정용 바이오마커 및 이의 의학적 용도에 관한 것이다. The present invention relates to a biomarker for measuring radiation exposure and its medical use discovered from human lung cancer cell line A549 which is a radiation resistant cell line.
암의 치료법은 수술, 방사선 치료법 및 화학요법으로 크게 나눌 수 있다. 상기 치료법으로 50% 정도의 완치율을 나타내는데, 현재 암 환자 중 국내의 경우 약 35%, 미국의 경우 약 50% 정도가 방사선 치료를 받고 있으며, 국내에서 방사선 치료를 받는 암환자의 수가 매년 증가하고 있는 추세여서 암치료에 있어 방사선 치료의 중요성 또한 증가하고 있다.Cancer treatments can be broadly divided into surgery, radiation therapy and chemotherapy. The treatment shows a cure rate of about 50%. Currently, about 35% of cancer patients in Korea and about 50% in the United States are receiving radiation therapy, and the number of cancer patients receiving radiation therapy in Korea is increasing every year. As a result, the importance of radiation therapy in the treatment of cancer is also increasing.
방사선 치료는 현재 다양한 종류의 암에 필수적인 치료 방법으로 알려져 있으나, 암세포의 방사선 내성 획득, 고선량 방사선 치료시 정상 조직의 손상 등이 치료의 효율을 떨어뜨려 방사선 치료의 문제점으로 대두되어 왔다.Radiation therapy is currently known as an essential treatment method for various types of cancers, but radiation resistance of cancer cells and damage to normal tissues during high-dose radiation treatments have become a problem of radiation therapy due to poor treatment efficiency.
따라서, 이러한 방사선 치료의 효율을 증대시키기 위한 증진제에 관한 연구들이 계속 진행되고 있는 실정이며, 다양한 체내 2차 신호전달물질들을 자극하는 세포사멸촉진제나 암세포 특이 수용체를 자극하여 세포사멸을 일으키는 물질, 세포주기 교란물질, 전사인자 억제물질 등을 대상으로 하여 연구를 하고 있다.Therefore, studies on enhancing agents for increasing the efficiency of such radiation treatments continue to progress, apoptosis stimulating agents that stimulate a variety of secondary signaling materials in the body or substances that stimulate cell death by stimulating cancer cell specific receptors, cells Research is conducted on periodic disturbances and transcription factor inhibitors.
현재 항암제로 알려진 탁솔(Taxol)과 5-FU(5-fluorouracil) 등이 방사선치료시 병용투여를 통하여 방사선 치료 효율을 증진시키는 것으로 알려져 있다.Taxol and 5-FU (5-fluorouracil), which are currently known as anticancer agents, are known to enhance radiation treatment efficiency through co-administration.
그러나, 상기와 같이 방사선치료 효과를 증진시키기 위해 사용되는 항암제들을 방사선 치료와 병용할 때, 항암제의 독성이 방사선 치료시 나타나는 부작용, 즉, 방사선 치료부위의 염증, 위장장애, 오심, 구토, 설사 등과 복합적으로 나타날 수 있기 때문에 사용에 제한이 있다는 단점이 있다.However, when the anticancer agents used to enhance the radiotherapy effect in combination with radiation treatment, the toxicity of the anticancer agent, namely inflammation, gastrointestinal disorders, nausea, vomiting, diarrhea, etc. There is a limitation to use because it can appear complex.
방사선 치료의 효과를 최대화시켜 다양한 암 질환을 효과적으로 치료하기 위해서 상기 문제점이 해결되어 부작용이 최소화된 방사선 민감제의 개발이 요구되며, 또한 방사선 피폭 또는 조사 시에 발현량이 변화되는 유전자를 발굴하여 방사선 피폭에 의한 세포손상을 확인할 수 있다.In order to maximize the effect of radiation therapy to effectively treat various cancer diseases, the above problems are solved and development of a radiation sensitive agent with minimized side effects is required. Furthermore, by discovering a gene whose expression level changes during radiation exposure or irradiation, radiation exposure is discovered. Cell damage caused by can be confirmed.
이에, 본 발명자는 방사선 피폭 또는 조사 시에 발현량이 변화되는 유전자를 발굴하던 연구를 하던 중, 방사선 저항성 세포주인 사람 폐암 세포주 A549로부터 발굴된 특정 유전자들이 방사선 피폭에 따라 발현량이 변화하는 것을 확인함으로써 본 발명을 완성하였다. Thus, the present inventors have been studying the discovery of genes whose expression levels change at the time of radiation exposure or irradiation, and by confirming that specific genes discovered from human lung cancer cell line A549, which is a radiation resistant cell line, the expression level changes according to the radiation exposure. The invention was completed.
본 발명의 목적은 방사선 저항성 세포주인 사람 폐암 세포주 A549로부터 발굴된 특정 유전자들 또는 그 발현 단백질을 포함하는 방사선 피폭 측정용 바이오마커 및 이를 이용한 키트를 제공하는 데에 있다.Disclosure of Invention An object of the present invention is to provide a biomarker for measuring radiation exposure and a kit using the same, including specific genes or expression proteins thereof extracted from human lung cancer cell line A549 which is a radiation resistant cell line.
또한, 본 발명의 또다른 목적은 방사선 저항성 세포주인 사람 폐암 세포주 A549로부터 발굴된 특정 유전자들 또는 그 발현 단백질 중 어느 하나의 억제제를 포함하는 방사선 민감성 증진용 조성물을 제공하는 데에 있다.In addition, another object of the present invention to provide a composition for enhancing radiation sensitivity comprising an inhibitor of any one of the specific genes or expression proteins thereof discovered from a human lung cancer cell line A549 which is a radiation resistant cell line.
또한, 본 발명의 또다른 목적은 방사선 피폭 측정용 바이오마커인 유전자 또는 그 발현 단백질을 이용한 방사선 민감성 증진용 물질의 스크리닝 방법을 제공하는 데에 있다.In addition, another object of the present invention is to provide a method for screening a substance for enhancing radiation sensitivity using a gene that is a biomarker for measuring radiation exposure or an expression protein thereof.
상기 목적을 달성하기 위하여, 본 발명은 FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966) 및 DEAF1 (GenBank accession ID: NM_021008)로 이루어진 군에서 선택된 유전자 또는 그 발현 단백질 중 어느 하나 또는 둘 이상을 포함하는 방사선 피폭 측정용 바이오마커를 제공한다.In order to achieve the above object, the present invention provides FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession) ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966), and DEAF1 (GenBank accession ID: NM_021008), or a gene selected from the group It provides a biomarker for measuring radiation exposure comprising any one or two or more of them.
또한, 본 발명은 FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966) 및 DEAF1 (GenBank accession ID: NM_021008)로 이루어진 군에서 선택된 유전자 또는 그 발현 단백질 중 어느 하나 또는 둘 이상을 포함하는 방사선 피폭 측정용 키트를 제공한다.In addition, the present invention provides FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), Any one or two of a gene selected from the group consisting of ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966), and DEAF1 (GenBank accession ID: NM_021008) Provided is a kit for measuring radiation exposure comprising the above.
상기 유전자로는 바람직하게는 ELAVL4, TMPRRS7, PPP3CA, CDCA7 및 ZNF239로 이루어진 군에서 선택된 어느 하나일 수 있으며, 보다 바람직하게는 ELAVL4이다.Preferably, the gene may be any one selected from the group consisting of ELAVL4, TMPRRS7, PPP3CA, CDCA7, and ZNF239, and more preferably ELAVL4.
본 발명의 일실시예에 따르면, 방사선 저항성 세포주인 사람 폐암 세포주 A549에서 방사선 조사 후 발현량이 증가 또는 감소하는 ELAVL4, TMPRRS7, PPP3CA, CDCA7, ZNF239는 그 발현량이 방사선에 의해 크게 변화하고, 그 중에서도 ELAVL4는 방사선에 의해 발현량이 증가하고 그들로 인해 방사선에 대한 저항성을 갖게 하는데 중요한 역할을 하는 것으로 확인하였다. 이러한 결과로부터 ELAVL4, TMPRSS7, CDCA7, ZNF239는 방사선 피폭 바이오마커로서 활용할 수 있으며, ELAVL4는 발현량을 조절하는 타겟 유전자로 하여 방사선 민감성을 높이는 약물을 개발할 수 있다. According to one embodiment of the present invention, ELAVL4, TMPRRS7, PPP3CA, CDCA7, ZNF239 whose expression level increases or decreases after irradiation in human lung cancer cell line A549, a radiation resistant cell line, is significantly changed by radiation, among them ELAVL4. We found that the amount of expression is increased by radiation and they play an important role in making them resistant to radiation. From these results, ELAVL4, TMPRSS7, CDCA7, ZNF239 can be used as a radiation exposure biomarker, and ELAVL4 can be developed as a target gene that regulates the expression level, thereby improving the drug sensitivity.
본 발명의 키트는 상기 유전자의 센스 및 안티센스 프라이머를 포함하거나, 상기 유전자에 상보적인 프로브를 포함하거나, 상기 유전자에 의해 코딩되는 그 발현 단백질에 특이적인 항체를 포함할 수 있다.The kit of the present invention may comprise an antibody comprising the sense and antisense primers of the gene, comprising a probe complementary to the gene, or specific for the expression protein encoded by the gene.
또한, 본 발명은 FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966) 및 DEAF1 (GenBank accession ID: NM_021008)로 이루어진 군에서 선택된 유전자 중 어느 하나 또는 둘 이상을 포함하는 방사선 피폭 측정용 마이크로어레이를 제공한다.In addition, the present invention provides FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), One or more genes selected from the group consisting of ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966), and DEAF1 (GenBank accession ID: NM_021008) A microarray for measuring radiation exposure is provided.
본 발명에서 "측정"은 폐암세포 또는 골육종세포 등과 같은 암세포에서 방사선 피폭 또는 조사 정도를 확인하는 것이다. 하나의 양태로서, 본 발명은 개체로부터 얻어진 생물학적 샘플로부터 상기 유전자의 mRNA 발현 수준 또는 이의 단백질의 발현 수준을 측정하고, 이를 정상대조군 샘플의 발현 수준과 비교하여 방사선 피폭 또는 조사 정도를 확인할 수 있다.In the present invention, "measurement" is to confirm the radiation exposure or irradiation degree in cancer cells such as lung cancer cells or osteosarcoma cells. In one embodiment, the present invention can determine the level of radiation exposure or irradiation by measuring the mRNA expression level of the gene or the expression level of the protein thereof from a biological sample obtained from an individual and comparing it with the expression level of the normal control sample.
본 발명에서 "mRNA 발현 수준 측정"이란 방사선 피폭 또는 조사 정도를 확인하기 위하여 생물학적 샘플에서 상기 유전자의 mRNA 존재 여부와 발현 정도를 확인하는 과정으로 mRNA의 양을 측정한다. 이를 위한 분석 방법으로는 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), 노던 블롯팅(Northern blotting), DNA 칩 등이 있으나 이에 한정되는 것은 아니다. In the present invention, "mRNA expression level measurement" is a process of confirming the presence and expression level of mRNA of the gene in a biological sample in order to confirm the degree of radiation exposure or irradiation, the amount of mRNA is measured. Analytical methods for this purpose include, but are not limited to, RT-PCR, competitive RT-PCR, Real-time RT-PCR, Northern blotting, and DNA chips. It is not.
상기 검출 방법들을 통하여, 정상대조군에서의 mRNA 발현량과 개체로부터 얻어진 생물학적 샘플에서의 mRNA 발현량을 비교할 수 있고, 상기 유전자에서 mRNA로의 유의한 발현양의 변화를 판단하여 방사선 피폭 또는 조사 정도를 판단할 수 있다. mRNA 발현 수준 측정은 바람직하게는, 상기 유전자에 특이적인 프라이머를 이용하는 RT-PCR법을 이용할 수 있다. RT-PCR은 P. Seeburg(Cold Spring Harb Symp Quant Biol 1986, Pt 1:669-677)에 의해 RNA를 분석하는데 도입된 방법으로, mRNA를 역전사하여 얻어진 cDNA를 PCR로 증폭하여 분석한다. 이때 증폭 단계에서 상기 유전자에 특이적으로 제조된 프라이머 쌍을 사용하며, RT-PCR 후 전기영동하여 밴드 패턴과 밴드의 두께를 확인함으로써 상기 유전자의 mRNA 발현 여부와 발현 수준을 확인할 수 있고 이를 정상대조군과 비교함으로써, 방사선 피폭 또는 조사 정도를 간편하게 판단할 수 있다.Through the detection methods, it is possible to compare the mRNA expression level in the normal control group and the mRNA expression level in the biological sample obtained from the individual, and to determine the change in the expression level of the gene to mRNA to determine the radiation exposure or the degree of irradiation. Can be. Determination of mRNA expression level may preferably be carried out using the RT-PCR method using a primer specific for the gene. RT-PCR is a method introduced to analyze RNA by P. Seeburg (Cold Spring Harb Symp Quant Biol 1986, Pt 1: 669-677). The cDNA obtained by reverse transcription of mRNA is amplified and analyzed by PCR. At this time, using a primer pair prepared specifically for the gene in the amplification step, by electrophoresis after RT-PCR to check the band pattern and the thickness of the band can determine the mRNA expression and expression level of the gene and normal control group By comparing with, the radiation exposure or the degree of irradiation can be easily determined.
본 발명의 "프라이머"는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로, 상보적인 주형과 염기쌍을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오타이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. 본 발명의 프라이머는, 상기 유전자 특이적인 프라이머로 7개 내지 50개의 뉴클레오타이드 서열을 가진 센스 및 안티센스 핵산일 수 있고, DNA 합성의 개시점으로 작용하는 프라이머의 기본 성질을 변화시키지 않는 한, 추가의 특징을 혼입할 수 있다.A "primer" of the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which forms a complementary template and base pair and serves as a starting point for template strand copying. it means. Primers can initiate DNA synthesis in the presence of four different nucleotide triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. The primer of the present invention may be a sense and antisense nucleic acid having 7 to 50 nucleotide sequences as the gene specific primer, and further features so long as the basic properties of the primer serving as an initiation point of DNA synthesis are not changed. Can be mixed.
본 발명의 핵산 서열은 또한 검출 가능한 시그날을 직접적으로 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 표지의 예로는 방사성 동위원소, 형광성 분자, 바이오틴 등이 있다.Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.
본 발명에서 "단백질 발현수준 측정"이란 방사선 피폭 정도를 확인하기 위하여 생물학적 샘플에서의 상기 단백질의 존재 여부와 발현 정도를 확인하는 과정으로, 상기 단백질에 대하여 특이적으로 결합하는 항체를 이용하여 단백질의 양을 확인할 수 있다.In the present invention, "measurement of protein expression level" refers to a process of confirming the presence and expression of the protein in a biological sample in order to confirm the degree of radiation exposure, by using an antibody that specifically binds to the protein. You can check the amount.
단백질 발현수준 측정은 바람직하게는, ELISA(enzyme-linked immunosorbent assay)법을 이용할 수 있다. ELISA는 고체 지지체에 부착된 항원을 인지하는 표지된 항체를 이용하는 직접적 ELISA, 고체 지지체에 부착된 항원을 인지하는 항체의 복합체에서 포획 항체를 인지하는 표지된 항체를 이용하는 간접적 ELISA, 고체 지지체에 부착된 항체와 항원의 복합체에서 항원을 인지하는 표지된 또 다른 항체를 이용하는 직접적 샌드위치 ELISA, 고체 지지체에 부착된 항체와 항원의 복합체에서 항원을 인지하는 또 다른 항체와 반응시킨 후 이 항체를 인지하는 표지된 2차 항체를 이용하는 간접적 샌드위치 ELISA 등 다양한 ELISA 방법을 포함한다. 보다 바람직하게는, 고체 지지체에 항체를 부착시키고 시료를 반응시킨 후 항원-항체 복합체의 항원을 인지하는 표지된 항체를 부착시켜 효소적으로 발색시키거나 항원-항체 복합체의 항원을 인지하는 항체에 대해 표지된 2차 항체를 부착시켜 효소적으로 발색시키는 샌드위치 ELISA 방법에 의해서 검출할 수 있고, 상기 단백질과 항체의 복합체 형성 정도를 확인하여, 방사선 피폭 또는 조사 정도를 확인할 수 있다.The protein expression level may be preferably measured by using an enzyme-linked immunosorbent assay (ELISA). ELISA is a direct ELISA using a labeled antibody that recognizes an antigen attached to a solid support, an indirect ELISA using a labeled antibody that recognizes a capture antibody in a complex of antibodies that recognize an antigen attached to a solid support, attached to a solid support Direct sandwich ELISA using another labeled antibody that recognizes the antigen in the antibody-antigen complex, a labeled antibody that recognizes the antibody after reacting with another antibody that recognizes the antigen in the complex of the antigen with the antibody attached to the solid support Various ELISA methods include indirect sandwich ELISA using secondary antibodies. More preferably, the antibody is enzymatically developed by attaching the antibody to the solid support, reacting the sample, and then attaching a labeled antibody that recognizes the antigen of the antigen-antibody complex, or to an antibody that recognizes the antigen of the antigen-antibody complex. It can be detected by the sandwich ELISA method which attaches a labeled secondary antibody and enzymatically develops it, and can confirm the radiation exposure or irradiation grade by confirming the formation degree of the complex of the said protein and an antibody.
또한, 바람직하게는, 상기 단백질에 대한 하나 이상의 항체를 이용한 웨스턴 블롯 분석을 이용할 수 있다. 샘플에서 전체 단백질을 분리하고, 이를 전기영동을 하여, 단백질을 크기에 따라 분리한 다음, 니트로셀룰로오즈 막으로 이동시켜 항체와 반응시킨다. 생성된 항원-항체 복합체의 양을 표지된 항체를 이용하여 확인하는 방법으로 상기 단백질의 양을 확인하여, 방사선 피폭 또는 조사 정도를 확인할 수 있다.Also preferably, Western blot analysis using one or more antibodies to the protein can be used. The entire protein is isolated from the sample, electrophoresed to separate the protein according to size, and then transferred to a nitrocellulose membrane to react with the antibody. The amount of the produced antigen-antibody complex can be confirmed by using a labeled antibody to confirm the amount of the protein, thereby confirming the degree of radiation exposure or irradiation.
상기 검출 방법은 정상대조군에서의 상기 단백질의 발현양과 생물학적 샘플에서의 상기 단백질의 발현양을 조사하는 방법으로 이루어질 수 있고, mRNA 또는 단백질 수준은 상기한 마커의 절대적(예: ㎍/㎖) 또는 상대적(예: 시그널의 상대 강도) 차이로 나타낼 수 있다.The detection method may be performed by examining the expression level of the protein in the normal control group and the expression level of the protein in a biological sample, and mRNA or protein level may be absolute (eg, μg / ml) or relative to the above-mentioned marker. (Eg the relative strength of the signal).
본 발명에서 "항체"란 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 상기 단백질에 대해 특이적으로 결합하는 항체를 의미하며, 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함하며, 상기 단백질에 대한 항체는 당업계에 널리 공지된 기술을 이용하여 용이하게 제조할 수 있다. 본 발명의 항체는 당 분야에 공지된 통상의 방법에 따라 단클론 항체 또는 다클론 항체로서 제조할 수 있으며, 이러한 항체들을 이용하여 당 분야에 공지된 효소 면역측정법(enzyme linked immunosorbent assay; ELISA), 방사선면역 측정법(radioimmunoassay; RIA), 샌드위치 측정법(sandwich assay), 폴리아크릴 겔상의 웨스턴 블롯팅 또는 면역 블롯팅 등의 방법에 의해 생물학적 샘플 중에 상기 단백질이 발현되었는지를 확인함으로써 진단할 수 있다. "Antibody" in the present invention means a specific protein molecule directed against an antigenic site. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to the protein, and includes all polyclonal antibodies, monoclonal antibodies, and recombinant antibodies, wherein the antibodies to the proteins are well known in the art. It can be manufactured easily. Antibodies of the present invention can be prepared as monoclonal antibodies or polyclonal antibodies according to conventional methods known in the art, using these antibodies known enzyme linked immunosorbent assay (ELISA), radiation Diagnosis can be made by confirming whether the protein is expressed in a biological sample by methods such as radioimmunoassay (RIA), sandwich assay, western blotting or immunoblotting on polyacryl gel.
본 발명에 따른 마이크로어레이는 상기 유전자를 이용하여 당업계에서 통상적으로 사용되는 제조방법에 의하여 용이하게 제조될 수 있다.Microarray according to the present invention can be easily produced by the production method commonly used in the art using the gene.
또한, 본 발명은 FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966) 및 DEAF1 (GenBank accession ID: NM_021008)로 이루어진 군에서 선택된 유전자 또는 그 발현 단백질의 억제제 중 하나 또는 둘 이상을 포함하는 방사선 민감성 증진용 조성물을 제공한다.In addition, the present invention provides FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), One of the genes selected from the group consisting of ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966), and DEAF1 (GenBank accession ID: NM_021008), or an inhibitor of an expression protein thereof It provides a composition for enhancing radiation sensitivity comprising two or more.
상기 억제제는 암세포의 방사선에 대한 민감도를 증진시킬 수 있으며, 상기 암세포는 폐암세포 또는 골육종세포 중에서 선택된 어느 하나일 수 있다.The inhibitor may enhance sensitivity of cancer cells to radiation, and the cancer cells may be any one selected from lung cancer cells or osteosarcoma cells.
상기 억제제로는 상기 유전자의 mRNA에 상보적으로 결합하는 안티센스 핵산 또는 작은 간섭 RNA(small interfering RNA)에서 선택된 어느 하나일 수 있으며, 또한 상기 단백질에 상보적으로 결합하는 화합물, 펩타이드 및 항체로 이루어진 군에서 선택된 어느 하나일 수 있다.The inhibitor may be any one selected from antisense nucleic acids or small interfering RNAs that complementarily bind to the mRNA of the gene, and also a group consisting of compounds, peptides and antibodies that complementarily bind to the protein. It may be any one selected from.
일실시예로서, 본 발명의 안티센스 핵산을 세포 내로 도입시켜 암세포의 방사선 민감성을 증진시킬 수 있는데, 여기서 "도입"은 형질감염(transfection) 또는 형질도입(transduction)에 의해 외래 DNA를 세포로 유입시키는 것을 의미한다. 형질감염은 칼슘 포스페이트-DNA 공침전법, DEAE-덱스트란-매개 형질감염법, 폴리브렌-매개 형질감염법, 전기충격법, 미세주사법, 리포좀 융합법, 리포펙타민 및 원형질체 융합법 등의 당업계에 공지된 여러 방법에 의해 수행될 수 있다. 형질도입은 감염(infection)을 수단으로 하여 바이러스 또는 바이러스 벡터 입자를 사용하여 세포 내로 유전자를 전달시키는 것을 의미한다.In one embodiment, the antisense nucleic acid of the present invention can be introduced into a cell to enhance the radiation sensitivity of cancer cells, where "introduction" introduces foreign DNA into the cell by transfection or transduction. Means that. Transfections include sugars such as calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroshock, microinjection, liposome fusion, lipofectamine and protoplast fusion. It can be carried out by various methods known in the art. Transduction refers to the transfer of genes into cells using viral or viral vector particles by means of infection.
본 발명에서 "방사선 민감성 증진"이란 방사선을 이용한 질병 치료에 있어서, 방사선에 대한 세포의 민감성을 증진시키는 것을 의미한다. 이를 통해 방사선 치료 효율을 상승시킬 수 있는데, 특히, 암치료시 병행처리되면 암세포의 방사선 민감성이 증진되어 암세포의 살상 효과 및 증식 억제효과를 나타낼 수 있다.In the present invention, "radiation sensitivity enhancement" means to improve the sensitivity of the cells to radiation in the treatment of diseases using radiation. Through this, the radiation treatment efficiency can be increased. In particular, when the cancer treatment is performed in parallel, the radiation sensitivity of the cancer cells can be enhanced, and the killing effect and the proliferation inhibitory effect of the cancer cells can be exhibited.
본 발명의 방사선 민감성 증진용 조성물은 약학적으로 허용가능한 담체를 추가로 포함할 수 있으며, 담체와 함께 제제화될 수 있다.The composition for enhancing radiation sensitivity of the present invention may further include a pharmaceutically acceptable carrier, and may be formulated with the carrier.
본 발명에서 "약학적으로 허용가능한 담체"란 생물체를 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 의미한다. 액상 용액으로 제제화되는 조성물에 있어서 허용되는 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.By "pharmaceutically acceptable carrier" is meant a carrier or diluent that does not stimulate the organism and does not inhibit the biological activity and properties of the administered compound. Examples of the pharmaceutical carrier which is acceptable for the composition to be formulated into a liquid solution include sterilized and sterile water suitable for the living body such as saline, sterilized water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
본 발명의 방사선 민감성 증진용 조성물은 어떠한 제형으로도 적용가능하며, 경구용 또는 비경구용 제형으로 제조할 수 있으며, 투여의 용이성과 투여량의 균일화를 위해 단위 투여 형태로 제형화할 수 있다. 본 발명의 약학적 제형은 구강(oral), 직장(rectal), 비강(nasal), 국소(topical; 볼 및 혀 밑을 포함), 피하, 질(vaginal) 또는 비경구(parenteral; 근육내, 피하 및 정맥 내를 포함) 투여에 적당한 것 또는 흡입(inhalation) 또는 주입(insufflation)에 의한 투여에 적당한 형태를 포함한다.The composition for enhancing radiation sensitivity of the present invention can be applied in any dosage form, can be prepared in oral or parenteral dosage form, and can be formulated in unit dosage form for ease of administration and uniformity of dosage. Pharmaceutical formulations of the invention may be oral, rectal, nasal, topical (including the cheek and sublingual), subcutaneous, vaginal or parenteral (intramuscular, subcutaneous). And forms suitable for administration by inhalation or insufflation.
상기 경구 투여용 제형으로는, 예를 들어 정제, 트로키제, 로렌지, 수용성 또는 유성현탁액, 조제분말 또는 과립, 에멀젼, 하드 또는 소프트 캡슐, 시럽 또는 엘릭시르제로 제제화할 수 있다. 정제 및 캡슐 등의 제형으로 제제화하기 위해, 락토오스, 사카로오스, 솔비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제, 디칼슘 포스페이트와 같은 부형제, 옥수수 전분 또는 고구마 전분과 같은 붕괴제, 스테아르산 마스네슘, 스테아르산 칼슘, 스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유를 포함할 수 있으며, 캡슐제형의 경우 상기 언급한 물질 외에도 지방유와 같은 액체 담체를 더 함유할 수 있다.The oral dosage form may be formulated, for example, in tablets, troches, lozenges, water-soluble or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs. For formulation into tablets and capsules, lactose, saccharose, sorbitol, mannitol, starch, amylopectin, binders such as cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, stearic acid masne It may include a lubricating oil such as calcium, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax, and in the case of a capsule, it may further contain a liquid carrier such as fatty oil in addition to the above-mentioned materials.
또한, 상기 비경구 투여용 제형으로는, 피하주사, 정맥주사 또는 근육내 주사 등의 주사용 형태, 좌제 주입방식 또는 호흡기를 통하여 흡입이 가능하도록 하는 에어로졸제 등 스프레이용으로 제제화할 수 있다. 주사용 제형으로 제제화하기 위해서는 본 발명의 조성물을 안정제 또는 완충제와 함께 물에서 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알의 단위 투여용으로 제제화할 수 있다. 좌제로 주입하기 위해서는, 코코아버터 또는 다른 글리세라이드 등 통상의 좌약 베이스를 포함하는 좌약 또는 체료 관장제와 같은 직장투여용 조성물로 제제화할 수 있다. 에어로졸제 등의 스프레이용으로 제형화하는 경우, 수분산된 농축물 또는 습윤 분말이 분산되도록 추진제 등이 첨가제와 함께 배합될 수 있다.In addition, the parenteral formulation may be formulated for injection such as subcutaneous injection, intravenous injection or intramuscular injection, suppository injection method, or aerosol for inhalation through the respiratory system. To formulate injectable formulations, the compositions of the present invention may be mixed in water with stabilizers or buffers to prepare solutions or suspensions, which may be formulated for unit administration of ampoules or vials. For infusion into suppositories, it may be formulated as a rectal composition such as suppositories or body enema including conventional suppository bases such as cocoa butter or other glycerides. When formulated for spraying such as aerosols, a propellant or the like may be combined with the additives to disperse the dispersed dispersion or wet powder.
또한, 본 발명은 FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966) 및 DEAF1 (GenBank accession ID: NM_021008)로 이루어진 군에서 선택된 유전자 또는 그 발현 단백질의 억제제 중 어느 하나 또는 둘 이상을 포함하는 방사선 민감성 증진용 조성물을 사용하여 암세포의 방사선 민감성을 증진시키는 방법을 제공한다. 또한, 본 발명의 상기 조성물을 투여하는 단계를 포함하는 암치료를 위한 방사선 요법을 제공한다.In addition, the present invention provides FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), Any one of genes selected from the group consisting of ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966), and DEAF1 (GenBank accession ID: NM_021008) Or it provides a method for enhancing the radiation sensitivity of cancer cells using a composition for enhancing radiation sensitivity comprising two or more. In addition, there is provided a radiation therapy for the treatment of cancer comprising the step of administering the composition of the present invention.
본 발명에서 "투여"는 어떠한 적절한 방법으로 환자에게 본 발명의 조성물을 도입하는 것을 의미하며, 예를 들어 안티센스 핵산 분자의 바이러스성 또는 비바이러스성 기술에 의한 운반을 포함한다. 본 발명의 조성물이 암세포 내로 도입되면, 상기 유전자 또는 그 발현 단백질의 발현 수준을 낮추거나 활성을 저해함으로써, 방사선 민감성을 증진시키게 된다.By “administration” in the present invention is meant introducing the composition of the invention to a patient in any suitable way, including for example by delivery of an antisense nucleic acid molecule by viral or nonviral technology. When the composition of the present invention is introduced into cancer cells, the radiation sensitivity is enhanced by lowering the expression level or inhibiting the activity of the gene or its expressed protein.
본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한, 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있으며, 구체적으로, 구강, 직장, 국소, 정맥내, 복강내, 근육내, 동맥내, 경피, 비측내, 흡입, 안구내 또는 피내경로를 통해 통상적인 방식으로 투여될 수 있다. 바람직하게는 해당 조직에 국소 투여한다.The route of administration of the composition of the present invention can be administered via various routes orally or parenterally, as long as it can reach the target tissue, and specifically, oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial It may be administered in a conventional manner via transdermal, nasal, inhalation, intraocular or intradermal routes. Preferably it is administered topically to the tissue.
본 발명의 암치료를 위한 방사선 요법은 본 발명의 방사선 민감성 증진용 조성물을 치료적 유효량으로 투여하는 것을 포함한다. 상기 치료적 유효량은 방사선에 대해 암세포 내의 종양의 민감성을 효과적으로 증진시키는 양을 의미한다. 적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 및 조사되는 방사선량을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서 본 발명의 목적에 적합한 방사선 민감성 증진용 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다. 또한, 경우에 따라, 본 발명의 방사선 민감성 증진용 조성물과 함께 공지의 항암제를 병용 투여하여 방사선 치료 효과를 포함한 항암 효과를 증대시킬 수 있다.Radiation therapy for the treatment of cancer of the present invention comprises administering a therapeutically effective amount of the composition for enhancing radiation sensitivity of the present invention. The therapeutically effective amount means an amount that effectively enhances the sensitivity of the tumor in cancer cells to radiation. It will be apparent to those skilled in the art that a suitable total daily dose may be determined by the practitioner within the correct medical judgment. The specific therapeutically effective amount for a particular patient may be based on the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, body weight, general health, sex and diet, time of administration, It is desirable to apply differently depending on various factors including the route of administration and the rate of release of the composition, the duration of treatment, and the radiation dose to be irradiated and similar factors well known in the pharmaceutical art. Therefore, the effective amount of the composition for enhancing radiation sensitivity suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned matters. In addition, in some cases, by using a known anticancer agent in combination with the radiation sensitivity enhancing composition of the present invention can increase the anticancer effect including the radiation treatment effect.
또한, 본 발명은 생물학적 샘플에 임의의 화합물을 처리하는 단계; 상기 생물학적 샘플로부터 FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966) 및 DEAF1 (GenBank accession ID: NM_021008)로 이루어진 군에서 선택된 유전자 또는 그 발현 단백질의 발현 수준을 확인하는 단계; 및 상기 발현 수준을 임의의 화합물을 처리하지 않은 정상대조군에서의 상기 유전자 또는 그 발현 단백질의 발현 수준과 비교하는 단계를 포함하는, 암세포에서 방사선에 대한 민감도를 증진시키는 화합물 스크리닝 방법을 제공한다.In addition, the present invention provides a method of treating a biological sample comprising the steps of: treating any compound with a biological sample; From the biological sample, FBXL6 (GenBank accession ID: NM_024555), PPP3CA (GenBank accession ID: BC025714), MOCS1 (GenBank accession ID: NM_005942), ELAVL4 (GenBank accession ID: AY033995), TMPRSS7 (GenBank accession ID: AK131211), ID1 (GenBank accession ID: NM_181353), ZNF239 (GenBank accession ID: NM_005674), CDCA7 (GenBank accession ID: BC027966), and DEAF1 (GenBank accession ID: NM_021008) to identify the expression level of a gene selected from the group or its expression protein. step; And comparing the expression level with the expression level of the gene or its expression protein in the normal control group not treated with any compound, thereby providing a compound screening method for enhancing sensitivity to radiation in cancer cells.
본 발명에 따르면, 방사선 저항성 세포주인 사람 폐암 세포주 A549에서 방사선 조사 후 발현량이 크게 변화되는 ELAVL4, TMPRRS7, PPP3CA, CDCA7, ZNF239 등의 유전자 또는 그 발현 단백질을 방사선 피폭 바이오마커로서 활용할 수 있으며, 또한, 이러한 유전자 또는 그 발현 단백질을 타겟으로 하여 방사선 민감성을 높이는 약물을 개발하여 방사선 치료 효과를 한층 증진시킬 수 있다. According to the present invention, a gene such as ELAVL4, TMPRRS7, PPP3CA, CDCA7, ZNF239 or its expression protein, whose expression level is greatly changed after irradiation in human lung cancer cell line A549, which is a radiation resistant cell line, can be utilized as a radiation exposure biomarker. By targeting such genes or their expression proteins, drugs that enhance radiation sensitivity can be developed to further enhance the effects of radiation therapy.
도 1은 본 발명의 일실시예에 따라 발굴된 총 유전자의 계층별 클러스터링을 나타낸 것이고,
도 2는 본 발명의 일실시예에 따라 발굴된 총 유전자 중 발현양상이 달라진 유전자들의 기능별 분류를 도식화한 것이고,
도 3은 본 발명의 일실시예 따른 마이크로어레이 데이터를 재확인 하고자 수행한 RT-PCR(a) 및 실시간 PCR(b) 분석 결과를 나타낸 것이고,
도 4는 특정 유전자의 넉아웃 후 방사선 조사의 영향을 실시간 PCR로 확인한 것이고,
도 5는 특정 유전자의 넉아웃 후 방사선 조사의 영향을 집락형성 분석으로 확인한 것이고,
도 6은 특정 유전자의 넉아웃 후 방사선 조사의 영향을 MTT 분석으로 확인한 것이고,
도 7은 특정 유전자의 넉아웃 후 방사선 조사의 영향을 FACS 분석으로 확인한 것이다.Figure 1 illustrates the clustering of the hierarchy of the total genes discovered according to an embodiment of the present invention,
Figure 2 is a schematic of the functional classification of the genes of the expression pattern is changed among the total genes excavated according to an embodiment of the present invention,
Figure 3 shows the results of RT-PCR (a) and real-time PCR (b) analysis performed to reconfirm the microarray data according to an embodiment of the present invention,
4 shows the effect of irradiation after knockout of a specific gene by real-time PCR,
5 is confirmed by colonization analysis of the impact of irradiation after knockout of a specific gene,
Figure 6 confirms the effect of irradiation after knockout of a specific gene by MTT analysis,
Figure 7 confirms the effect of irradiation after knockout of specific genes by FACS analysis.
이하, 하기 실시예를 통해 본 발명을 보다 상세하게 설명한다. 다만, 이러한 실시예에 의해 본 발명이 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.
<실시예 1> 세포주 및 방사선 조사Example 1 Cell Line and Irradiation
사람 폐암세포주인 A549 세포는 RPMI 1640 미디어에 10% FBS와 100 units/ml의 페니실린, 10 ㎍/ml의 스트렙토마이신을 첨가하여 5% CO2, 37℃ 인큐베이터에서 배양하였다. 방사선 조사는 감마선을 조사하였고 이것은 137Cs γ-선 소스 (Atomic Energy of Canada, Ltd, Canada)를 사용하였다.Human lung cancer cell line A549 cells were cultured in a 5% CO 2 , 37 ° C. incubator with 10% FBS, 100 units / ml penicillin and 10 μg / ml streptomycin in RPMI 1640 media. Irradiation irradiated gamma rays with a 137 Cs γ-ray source (Atomic Energy of Canada, Ltd, Canada).
<실시예 2> 마이크로어레이 분석을 통한 방사선 피폭 진단용 유전자 발굴Example 2 Discovery of Gene for Diagnosis of Radiation Exposure through Microarray Analysis
1. RNA 추출1. RNA extraction
제조자의 지침에 따라 상기 세포주가 분주된 플레이트에 TRIzol (Invitrogen life Technologies, Shanghai, China) 첨가 후, 클로로포름을 첨가하여 RNA를 추출하였다. 샘플을 15 내지 20초 동안 진탕하고, 실온에서 2-3분 동안 배양한 후, 콜드 이소프로판올을 처리하여 수층을 분리하고 콜드 70% 에탄올로 세정하였다. RNA 펠렛을 공기 건조하여 디에틸 피로카보네이트(DEPC)-처리된 물에서 재현탁하고, 아가로즈겔 분석과 분광광도적 정량 분석을 위해 소량의 시료를 채취하였다.RNA was extracted by adding TRIzol (Invitrogen life Technologies, Shanghai, China) to the plate dispensed with the cell line according to the manufacturer's instructions, followed by addition of chloroform. The sample was shaken for 15-20 seconds, incubated for 2-3 minutes at room temperature, then treated with cold isopropanol to separate the aqueous layer and washed with cold 70% ethanol. The RNA pellet was air dried and resuspended in diethyl pyrocarbonate (DEPC) -treated water, and a small sample was taken for agarose gel analysis and spectrophotometric quantitative analysis.
2. 마이크로어레이 분석2. Microarray Analysis
앞서 준비된 각각의 총 RNA (10㎍)을 역전사효소, SuperScrip ll (Invitrogen, Carlsbad, California)을 이용한 역전사반응을 통해 시아닌(Cy5) 접합 dCTP (Amersharm, Piscataway, NJ)로 표지하였다. 에탄올 침강법을 이용하여 표지된 cDNA를 농축하였다. 상기 표지 cDNA를 Roche NimbleGen Human whole genome 12-plex array (Roche NimbleGen, Inc., WI) 상에 놓고, NimbleGen H12 mixer (Roche NimbleGen, Inc., WI)로 덮었다. 상기 슬라이드를 이용하여 42℃ MAUI 시스템 (Biomicro systems, Inc. UT)에서 12시간 동안 혼성화 반응을 수행하였다. 혼성화된 슬라이드를 실온에서 2X SSC, 0.1 % SDS에서 2분, 1 X SSC에서 3분, 그후 0.2 X SSC에서 2분 동안 세정하였다. 얻어진 슬라이드를 3,000rpm에서 20초 동안 원심분리하여 건조하였다.Each total RNA (10 μg) prepared above was labeled with cyanine conjugated dCTP (Amersharm, Piscataway, NJ) via reverse transcription using reverse transcriptase, SuperScrip ll (Invitrogen, Carlsbad, California). The labeled cDNA was concentrated using ethanol sedimentation. The labeled cDNA was placed on a Roche NimbleGen Human whole genome 12-plex array (Roche NimbleGen, Inc., WI) and covered with a NimbleGen H12 mixer (Roche NimbleGen, Inc., WI). Hybridization reaction was performed using the slide for 12 hours in a 42 ° C MAUI system (Biomicro systems, Inc. UT). Hybridized slides were washed at 2X SSC at room temperature, 2 minutes at 0.1% SDS, 3 minutes at 1 X SSC, then 2 minutes at 0.2 X SSC. The slide obtained was dried by centrifugation at 3,000 rpm for 20 seconds.
3. 데이터 분석3. Data Analysis
상기 어레이를 Roche NimbleGen Inc.에 제출하였다. 칩 당 각 게놈의 12개의 복제물이 포함되었다. 평균 3개의 다른 60-베이스 올리고뉴클레오티드 (60-mer 탐침)가 게놈의 각 유전자로 나타났다. 표적 게놈에서 모든 다른 60-mer 탐침과 비교하여 적어도 3개의 미스매치를 가지는 각 탐침을 선별하였다. 대조군 체크(혼성화)는 on-chip 대조군 올리고뉴클레오티드를 포함한 각 어레이에서 수행되었다. 상기 어레이는 관련 소프트웨어를 갖는 Axon GenePix 4000B 스캐너를 이용하여 분석하였다. 유전자 발현 수준은 NimbeScan Version 2.4 (Roche NimbleGen, Inc., WI)를 이용하여 산출하였다. 각 유전자에 관한 상대적인 신호강도는 Robust Multi-Array Average algorithm을 이용하여 산출하였다. 각 데이터는 NimbeScan Version 2.4 (Roche NimbleGen, Inc., WI)를 이용한 중위수 다듬기 표준화법(median polish normalization method)을 근거로 처리하였다. 이렇게 표준화되고 로그 변환된 강도값은 GeneSpring GX 10 (Agilent technologies, CA)을 이용하여 분석하였다. 상향 조절된 유전자로서 대조군의 적어도 200% 이상으로 존재하는 유전자와, 하향 조절된 유전자로서 대조군의 50% 이하로 존재하는 유전자를 측정하기 위하여 배수 변화 필터를 포함하였다.The array was submitted to Roche NimbleGen Inc. Twelve copies of each genome per chip were included. An average of three different 60-base oligonucleotides (60-mer probes) were shown for each gene in the genome. Each probe with at least three mismatches was selected as compared to all other 60-mer probes in the target genome. Control checks (hybridization) were performed on each array containing on-chip control oligonucleotides. The array was analyzed using an Axon GenePix 4000B scanner with associated software. Gene expression levels were calculated using NimbeScan Version 2.4 (Roche NimbleGen, Inc., WI). Relative signal intensity for each gene was calculated using Robust Multi-Array Average algorithm. Each data was processed based on median polish normalization method using NimbeScan Version 2.4 (Roche NimbleGen, Inc., Wis.). These standardized and logarithmic intensity values were analyzed using GeneSpring GX 10 (Agilent technologies, CA). A fold change filter was included to measure genes present in at least 200% or more of the control as an upregulated gene and genes present in up to 50% or less of the control as a downregulated gene.
그 결과, 도 1과 같은 총 유전자의 계층별 클러스터링이 나타났으며, 방사선 조사 전후 발현 양상이 달라진 총 2637개의 유전자 중 1330개 유전자의 발현이 증가되었고, 1307개 유전자가 발현이 감소되었다. 또한, 방사선 조사 전후 발현 양상이 달라진 총 2637개의 유전자를 기능별로 분류해 본 결과 도 2와 같이 신호전달에 관여하는 유전자 21%, 전달에 관여하는 유전자 19%, 전사에 관여하는 유전자 15%, 면역반응에 관여하는 유전자 7% 등을 나타내는 것을 확인되었다.As a result, hierarchical clustering of the total genes as shown in FIG. 1 appeared, and expression of 1330 genes was increased and expression of 1307 genes was reduced among 2,637 genes whose expression patterns were different before and after irradiation. In addition, as a result of classifying a total of 2637 genes with different expression patterns before and after irradiation, 21% of genes involved in signal transduction, 19% of genes involved in transmission, 15% of genes involved in transcription, and immunity, as shown in FIG. It was confirmed that 7%, etc. of genes involved in the reaction.
이렇게 발현 양상이 달라지는 많은 유전자 중에서 암세포의 방사선 치료의 효율을 감소하게 하는 주원인인 세포의 분화와 암화를 촉진하는 유전자를 표 1과 같이 선별하였다. Among the genes with different expression patterns, genes that promote cell differentiation and cancer, which are the main causes of reducing the efficiency of radiotherapy of cancer cells, were selected as shown in Table 1.
<실시예 3> RT-PCR 및 실시간 PCR을 통한 유전자 발현양 분석Example 3 Gene Expression Analysis by RT-PCR and Real-Time PCR
앞선 실시예에 따른 마이크로어레이 데이터를 재확인 하고자 RT-PCR 및 실시간 PCR을 수행하였다.RT-PCR and real-time PCR were performed to reconfirm the microarray data according to the previous example.
1. RT-PCR 분석1. RT-PCR Analysis
뽑아놓은 RNA을 정량해서 2㎍의 RNA에 올리고 dT, dNTP를 넣고 65℃에서 5분간 가열하고 얼음에 꽂아 식혔다. 여기에 5X First strand buffer (invitrogen superscript II kit), 0.1M DTT, RNase 억제제를 넣고 42℃에 2분 가열 후, 1㎕의 superscript II를 넣고 42℃에서 1시간 방치한 뒤, 70℃에서 15분을 가열하여 반응을 종료시켜 cDNA를 합성하였다. 이렇게 합성한 cDNA를 가지고 각각의 프라이머에 맞는 어닐링 온도를 잡아 PCR을 수행하였다. The extracted RNA was quantified, oligo dT and dNTP were added to 2 μg of RNA, heated at 65 ° C. for 5 minutes, and cooled on ice. Add 5X First strand buffer (invitrogen superscript II kit), 0.1M DTT, RNase inhibitor and heat at 42 ℃ for 2 minutes, add 1μl superscript II and leave at 42 ℃ for 1 hour, and then at 70 ℃ for 15 minutes The reaction was terminated by heating to synthesize cDNA. PCR was performed using the cDNA synthesized as described above to obtain the annealing temperature for each primer.
그 결과, 도 3a와 같이 A549 세포에서 방사선에 의해서 FBXL6, PPP3CA, MOCS1, ELAVL4, TMPRSS7, ID1, ZNF239, CDCA7 그리고 DEAF가 증가됨을 RT-PCR로 확인할 수 있었다. As a result, it was confirmed by RT-PCR that FBXL6, PPP3CA, MOCS1, ELAVL4, TMPRSS7, ID1, ZNF239, CDCA7 and DEAF were increased by radiation in A549 cells as shown in FIG. 3A.
2. 실시간 PCR 분석2. Real time PCR analysis
총 RNA를 뽑은 후 100ng의 RNA를 One Step SYBR PrimeScript RT-PCR Kit (Perfect Real Time, takara)를 이용하여 혼합물을 만든 뒤, DNA engine2. OPTICON (MJ Research)를 이용하여 실시간 정량 역전사중합효소 PCR을 수행하였다. 이때 사용된 프라이머 시퀀스는 하기 표 2와 같다.After extracting total RNA, 100ng of RNA was prepared using a One Step SYBR PrimeScript RT-PCR Kit (Perfect Real Time, takara), followed by DNA engine2. Real-time quantitative reverse transcriptase PCR was performed using OPTICON (MJ Research). The primer sequence used at this time is shown in Table 2 below.
Reverse: AGGGGCTGCCCTCCTTGGCT (서열번호 2)Forward: CTCCGGGACGAGGGGTGGCT (SEQ ID NO: 1)
Reverse: AGGGGCTGCCCTCCTTGGCT (SEQ ID NO: 2)
Reverse: GGGCTTCGTGGGCTCGGAGT (서열번호 4)Forward: CTGCCTTCCCCTGGCTGCCC (SEQ ID NO: 3)
Reverse: GGGCTTCGTGGGCTCGGAGT (SEQ ID NO: 4)
Reverse: GCGCACATCCAGGGGGAGGC (서열번호 6)Forward: CTGGCCCGGCTACTGCCCCA (SEQ ID NO: 5)
Reverse: GCGCACATCCAGGGGGAGGC (SEQ ID NO: 6)
Reverse: GGGGAGAACCTGGGGGAACAAGC (서열번호 8)Forward: GGGCTGAATGGCCAGAAGCCCAG (SEQ ID NO: 7)
Reverse: GGGGAGAACCTGGGGGAACAAGC (SEQ ID NO: 8)
Reverse: TGGTCGTCCACATCCATGTCCCCA (서열번호 10) Forward: TGGCTGGGGGCGAAGACACGA (SEQ ID NO: 9)
Reverse: TGGTCGTCCACATCCATGTCCCCA (SEQ ID NO: 10)
Reverse: CATGCCGCCTCGGCCGTCAG (서열번호 12)Forward: CGCCTGCCTGCCCTGCTGGA (SEQ ID NO: 11)
Reverse: CATGCCGCCTCGGCCGTCAG (SEQ ID NO: 12)
Reverse: TGCGAAGATCCGAGCTCTGGCTGA (서열번호 14)Forward: TGCACATCCACCAGCGAGTCCA (SEQ ID NO: 13)
Reverse: TGCGAAGATCCGAGCTCTGGCTGA (SEQ ID NO: 14)
Reverse: AGGCGGGCAATGCCAGTTCGG (서열번호 16)Forward: TGCCCAGAAGCCGTCGCTCCA (SEQ ID NO: 15)
Reverse: AGGCGGGCAATGCCAGTTCGG (SEQ ID NO: 16)
Reverse: CACTGCAAGGGTCGGCCCGC (서열번호 18)Forward: CCCCTCTGGCTCCCGGCCAA (SEQ ID NO: 17)
Reverse: CACTGCAAGGGTCGGCCCGC (SEQ ID NO: 18)
그 결과, 도 3b와 같이 A549 세포에서 방사선에 의해서 FBXL6, PPP3CA, MOCS1, ELAVL4, TMPRSS7, ID1, ZNF239, CDCA7 그리고 DEAF가 증가됨을 실시간 PCR로 확인할 수 있었다. As a result, it could be confirmed by real-time PCR that the radiation increased FBXL6, PPP3CA, MOCS1, ELAVL4, TMPRSS7, ID1, ZNF239, CDCA7 and DEAF in A549 cells as shown in Figure 3b.
<실시예 4> 유전자 넉다운 후 방사선 조사에 따른 세포의 영향 분석Example 4 Analysis of Effects of Cells on Irradiation after Gene Knockdown
1. siRNA 형질감염 1. siRNA transfection
siRNA는 바이오니아에서 구입하여 사용하였다. 세포를 분주하여 siRNA를 150nM의 농도로 리포펙타민 2000 (invitrogen)을 이용하여 형질감염 시켰다. 형질감염 후 72 시간 이후 RNA 양이 50% 미만으로 감소하는 것을 확인 후 실험에 사용하였다. siRNA was purchased from Bioneer and used. The cells were aliquoted and siRNA was transfected using lipofectamine 2000 (invitrogen) at a concentration of 150 nM. After 72 hours after transfection, the amount of RNA was reduced to less than 50% and used in the experiment.
2. 실시간 PCR 분석2. Real time PCR analysis
RNA를 추출한 뒤, One Step SYBR PrimeScriptTM RT-PCR Kit (takara, Osaka, Japan)와 DNA Engine2.OPTICON (MJ Reserch, MA, USA)를 이용하여 수행하였다. 각각의 유전자의 발현은 GAPDH로 정량을 하였다. 이때, 사용된 프라이머는 표 2와 같고, 실시간 PCR 조건은 다음과 같다. 즉, 제1단계(역전사 공정)를 hold, 42℃에서 5분, 95℃에서 10초의 반응조건으로 수행하였고, 제2단계(PCR 반응 공정)을 95℃에서 5초, 60℃에서 30초의 반응조건으로 40회 반복 수행하였으며, 제3단계(해리 공정)를 수행하였다.RNA was extracted and performed using One Step SYBR PrimeScript ™ RT-PCR Kit (takara, Osaka, Japan) and DNA Engine2.OPTICON (MJ Reserch, MA, USA). Expression of each gene was quantified by GAPDH. At this time, the primers used are shown in Table 2, and the real-time PCR conditions are as follows. That is, the first step (reverse transcription process) was held, and reaction conditions of 5 minutes at 42 ° C. and 10 seconds at 95 ° C. were performed. The second step (PCR reaction process) was performed at 95 ° C. for 5 seconds and 60 ° C. for 30 seconds. 40 times was carried out under the conditions, and the third step (dissociation step) was performed.
그 결과, 도 4와 같이 ELAVL4를 넉다운 시키면 방사선에 의한 민감도가 증가하는 것을 확인할 수 있었다. 하지만 TMPRSS7의 경우에는 방사선에 의해 발현양은 크게 증가하지만 넉다운시킨 경우 방사선에 의한 민감도에는 큰 영향을 주지는 않았다. As a result, as shown in Figure 4 when knocking down ELAVL4 it was confirmed that the sensitivity by radiation increases. In the case of TMPRSS7, however, the amount of expression was greatly increased by radiation, but the knockdown did not significantly affect the sensitivity of radiation.
3. 집락형성 분석3. Colony Formation Analysis
형질감염 후 60mm 디쉬에 세포를 100, 200, 500, 1000, 2000 개를 분주한 뒤 0, 1, 2, 3, 4 Gy의 방사선을 조사한 뒤 14일 뒤, 75% 메탄올과 25% 아세트산, 0.4% 트립판블루로 고정 및 염색을 시켜 콜로니 개수를 카운팅 하였다. After transfection, 100, 200, 500, 1000, 2000 cells were dispensed into 60 mm dishes and irradiated with 0, 1, 2, 3, 4 Gy, 14 days after irradiation, 75% methanol, 25% acetic acid, 0.4 The colonies were counted by fixation and staining with% trypan blue.
그 결과, 도 5와 같이 ELAVL4를 넉다운 시키면 방사선에 의한 민감도가 증가하는 것을 확인할 수 있었다. 하지만 TMPRSS7의 경우에는 방사선에 의해 발현양은 크게 증가하지만 넉다운시킨 경우 방사선에 의한 민감도에는 큰 영향을 주지는 않았다. As a result, it was confirmed that the sensitivity of radiation increases when knocking down the ELAVL4 as shown in FIG. In the case of TMPRSS7, however, the amount of expression was greatly increased by radiation, but the knockdown did not significantly affect the sensitivity of radiation.
4. 세포 생존율 분석 (MTT 분석)4. Cell Viability Assay (MTT Assay)
ELAVL4와 TMPRSS7을 각각 siRNA로 넉다운 시키고 10Gy의 방사선을 조사한 것(오른쪽) 과 하지 않은 것(왼쪽)의 분화정도를 MTT 분석을 통해 측정하였다. 세포를 24well plate에 분주하고 방사선을 조사한 것과 조사하지 않은 두 군으로 나누고, 방사선 조사 후 24, 48, 72 시간에 각각 MTT 분석을 수행하였다. 5mg/ml의 MTT를 각 well에 넣어주고 1시간을 37℃에서 배양하였고 배양배지를 제거한 뒤, 300㎕의 DMSO를 넣었다. 그 후 마이크로플레이트를 이용하여 595nm 파장에서 값을 관찰하였다. ELAVL4 and TMPRSS7 were knocked down with siRNA, respectively, and the degree of differentiation of 10 Gy irradiation (right) and no (left) was measured by MTT analysis. The cells were divided into 24well plates and divided into two groups, irradiated and unirradiated, and MTT analysis was performed at 24, 48 and 72 hours after irradiation. 5 mg / ml of MTT was added to each well and incubated at 37 ° C. for 1 hour, and culture medium was removed, followed by 300 μl of DMSO. The value was then observed at 595 nm wavelength using a microplate.
그 결과, 도 6과 같이 ELAV와 TMPRSS7은 모두 넉다운 시키는 것만으로도 분화 정도가 감소하는 것을 확인할 수 있었다. 그리고 방사선 조사 후에는 분화 정도가 현격하게 더 줄어드는 것을 확인할 수 있었다. 따라서 ELAVL4와 TMPRSS7 모두 암세포의 분화에 밀접한 관계를 하고 있는 것을 알 수 있고 이들의 발현을 조절할 때 암세포의 분화 속도를 조절할 수 있을 것으로 사료된다. As a result, as shown in Figure 6 ELAV and TMPRSS7 it was confirmed that the degree of differentiation is reduced only by knocking down. After irradiation, the degree of differentiation was significantly reduced. Therefore, ELAVL4 and TMPRSS7 are closely related to the differentiation of cancer cells, and it is thought that the regulation of the differentiation rate of cancer cells can be controlled when their expression is regulated.
5. 세포사멸 분석 (FACS 분석)5. Apoptosis Analysis (FACS Analysis)
ELAVL4와 TMPRSS7의 siRNA 처리 후, 방사선 조사 전후의 세포사멸 정도를 FACS 분석을 통해 평가하였다. 즉, 방사선을 조사한 뒤, 72시간 동안 놔두었다. 세포는 차가운 PBS로 두 번 씻어내고 트립신 처리하여 떼어냈다. 세포사멸(apoptosis)을 관찰하기 위해서 FITC Annexin V Apoptosis Detection kit I (BD Biosciences,CA, USA)를 이용하여 PI와 Annexin V로 15분간 어두운 상온에서 염색하였다. 형광은 flow cytometer로 측정하고 데이터는 CellQuest 소프트웨어를 사용하여 분석하였다. After siRNA treatment of ELAVL4 and TMPRSS7, the degree of apoptosis before and after irradiation was evaluated by FACS analysis. That is, after irradiation, it was left for 72 hours. Cells were washed twice with cold PBS and detached by trypsinization. To observe apoptosis, the cells were stained with PI and Annexin V for 15 minutes at room temperature using FITC Annexin V Apoptosis Detection kit I (BD Biosciences, CA, USA). Fluorescence was measured with a flow cytometer and data were analyzed using CellQuest software.
그 결과, 도 7과 같이 ELAVL4 유전자의 넉다운 시 방사선에 의한 세포사멸의 정도가 더 높게 나타나는 것을 확인할 수 있었다.
As a result, it was confirmed that the degree of apoptosis due to radiation was higher when knocking down the ELAVL4 gene as shown in FIG. 7.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다. While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.
Claims (8)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020100118237A KR101237117B1 (en) | 2010-11-25 | 2010-11-25 | Biomarker for measuring radiation exposure |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020100118237A KR101237117B1 (en) | 2010-11-25 | 2010-11-25 | Biomarker for measuring radiation exposure |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020120119698A Division KR101230781B1 (en) | 2012-10-26 | 2012-10-26 | Composition for enhancing radiation sensitivity comprising siRNA of ELAVL4 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20120056614A true KR20120056614A (en) | 2012-06-04 |
| KR101237117B1 KR101237117B1 (en) | 2013-02-25 |
Family
ID=46608712
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020100118237A KR101237117B1 (en) | 2010-11-25 | 2010-11-25 | Biomarker for measuring radiation exposure |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101237117B1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160078065A (en) * | 2014-12-24 | 2016-07-04 | 한국원자력의학원 | Radiation sensitive marker composition and diagnosing method |
| CN109295200A (en) * | 2018-09-27 | 2019-02-01 | 南方医科大学 | The Biological Detection marker of High Linear energy transmission ray radiation and its application |
| CN111004848A (en) * | 2019-12-11 | 2020-04-14 | 中国人民解放军陆军军医大学第一附属医院 | Application of FBXL6 as target in preparation of antitumor drugs |
-
2010
- 2010-11-25 KR KR1020100118237A patent/KR101237117B1/en active IP Right Grant
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160078065A (en) * | 2014-12-24 | 2016-07-04 | 한국원자력의학원 | Radiation sensitive marker composition and diagnosing method |
| CN109295200A (en) * | 2018-09-27 | 2019-02-01 | 南方医科大学 | The Biological Detection marker of High Linear energy transmission ray radiation and its application |
| CN111004848A (en) * | 2019-12-11 | 2020-04-14 | 中国人民解放军陆军军医大学第一附属医院 | Application of FBXL6 as target in preparation of antitumor drugs |
| CN111004848B (en) * | 2019-12-11 | 2022-09-23 | 中国人民解放军陆军军医大学第一附属医院 | Application of FBXL6 as target in preparation of antitumor drugs |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101237117B1 (en) | 2013-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3458604B1 (en) | Method for determining sensitivity to a cdk4/6 inhibitor | |
| EP2744917A2 (en) | Methods and compositions for the treatment and diagnosis of breast cancer | |
| CN109468382B (en) | Application of lncRNA in diagnosis and treatment of lung adenocarcinoma | |
| KR20080005193A (en) | Breast cancer related gene znfn3a1 | |
| KR101237117B1 (en) | Biomarker for measuring radiation exposure | |
| TW200538555A (en) | PIN-PRC transition genes | |
| CN110358834B (en) | Application of lncRNA, kit and medicine | |
| KR101358810B1 (en) | IGFBP-5, a marker for diagnosing radiation exposure, a composition for diagnosing radiation exposure to measure the level of expression of the marker, a kit for diagnosing radiation exposure comprising the composition, and a method for diagnosing radiation exposure using the marker | |
| KR101230781B1 (en) | Composition for enhancing radiation sensitivity comprising siRNA of ELAVL4 gene | |
| CN111733248B (en) | Application of LOC158435 as biomarker for diagnosing and treating laryngeal squamous cell carcinoma | |
| WO2019014664A1 (en) | Modulating biomarkers to increase tumor immunity and improve the efficacy of cancer immunotherapy | |
| Liu et al. | Effects of miR-222 on cisplatin resistance of renal cancer cell strains and related mechanisms | |
| Shi et al. | Long intergenic non‐coding RNA 00337 confers progression of esophageal cancer by mediating microrna‐145‐dependent fscn1 | |
| CN111733247A (en) | Application of long-chain non-coding RNA in cancer diagnosis and treatment | |
| Lin et al. | Identification of differentially expressed genes in human lymphoblastoid cells exposed to irradiation and suppression of radiation-induced apoptosis with antisense oligonucleotides against caspase-4 | |
| KR101245111B1 (en) | Radiation sensitive marker comprising HMG17 gene or expression protein thereof, or protein regulated by expression-decreased HMG17 gene | |
| CN111534587A (en) | Molecular marker 5-tRF-His, breast cancer detection kit and application thereof | |
| US10865415B2 (en) | Prevention, diagnosis and treatment of cancer overexpressing GPR160 | |
| KR20200022187A (en) | Composition for enhancing radiation sensitivity comprising expression or activity inhibitor of NONO | |
| CN111733246B (en) | Molecules for early diagnosis and treatment of cancer | |
| CN111733249B (en) | Molecular marker related to occurrence and development of laryngeal carcinoma | |
| CN111635946B (en) | Molecular biomarker for diagnosis and treatment of glioma and application thereof | |
| KR101245112B1 (en) | Radiation sensitive marker comprising APRIN gene or expression protein thereof, or protein regulated by expression-decreased APRIN gene | |
| KR20230172647A (en) | Use of leucine-zipper protein for diagnosing or treating cancer | |
| KR20200122183A (en) | A composition for preventing or treating cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| A107 | Divisional application of patent | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20160121 Year of fee payment: 4 |
|
| FPAY | Annual fee payment |
Payment date: 20170102 Year of fee payment: 5 |
|
| FPAY | Annual fee payment |
Payment date: 20171208 Year of fee payment: 6 |