KR20200022187A - Composition for enhancing radiation sensitivity comprising expression or activity inhibitor of NONO - Google Patents

Abstract

The present invention relates to a composition for enhancing radiation sensitivity containing an expression or activity inhibitor of NONO as an active component. According to the present invention, the expression level of NONO gene or protein is specifically increased in various carcinomas such as breast cancer, liver cancer, lung cancer etc., which indicates that the expression level of NONO gene or protein has a high correlation with a cancer patient survival rate, anticancer agent reactivity, and radiation sensitivity. Therefore, the expression or activity inhibitor of targeting NONO can be usefully utilized as a novel cancer therapy which suppresses tumors and promotes anticancer agent reactivity and radiation sensitivity.

Description

Composition for enhancing radiation sensitivity comprising expression or activity inhibitor of NONO}

The present invention relates to a composition for enhancing radiation sensitivity comprising NONO expression or activity inhibitor as an active ingredient.

According to the National Statistical Office, cancer deaths are the number one cause of death among Koreans. Cancer is a disease in which cell cycles that normally make up human tissues cause abnormal cell division and continue cell division. They occur through three stages: initiation, promotion, and progression. . The cause of cancer is that mutations in genes or cancer suppressor genes of normal cells are caused by carcinogens contained in the environment or foods, and these cells are known to proliferate abnormally to form cancer tissues under continuous stimulation of carcinogens. The cause of cancer has not been clearly understood to date.

Cancer is divided into a benign tumor and a malignant tumor, which are relatively malignant, whereas malignant tumors are relatively slow in growth and do not have metastasis, which is transferred from the original site of the tumor to other tissues. Tumors are invasive to other tissues leaving the primary and rapidly growing, which is a life-threatening and very important cause of death.

Surgery, radiation therapy, and chemotherapy are used to treat cancer, but despite many studies, more than 50% of cancer patients eventually die without healing. The reason for this is that even after surgical resection, the cancer cannot retreat due to the failure to remove the finely metastasized cancer cells, or despite the development of various anticancer drugs, cancer cell death to the anticancer drugs is not induced or early in the treatment of cancer with the anticancer drugs. This is because the tumor cells appear to decrease in response to cancer, but cancer cells that develop resistance to anticancer drugs proliferate rapidly during or after treatment. Today, about 60 kinds of various anticancer drugs are used, and as much knowledge about cancer development and characteristics of cancer cells is known, researches on the development of new anticancer drugs are actively conducted. However, the anticancer drugs have a disadvantage in that the cancer cells lose the therapeutic effect by repeatedly obtaining long-term administration or recurring cancer, thereby obtaining resistance to the anticancer drugs. In addition, most of the anticancer drugs are effective by inhibiting the synthesis of nucleic acid in the cell or by binding directly to the nucleic acid and impairs its function, these anticancer drugs not only act selectively on cancer cells but also on normal cells, especially tissue cells with active cell division. Because of the damage, there are many side effects such as decreased bone marrow function, damage to the gastrointestinal tract and hair loss. In addition, even in the case of radiation treatment, obtaining radiation resistance of cancer cells, damage to normal tissues during high-dose radiation treatment, and the like, reduce the efficiency of treatment, and thus are emerging as a problem of radiation treatment.

In other words, the cancer therapies show a number of limitations, and most targeted therapies have limitations targeting previously known signaling systems, requiring new alternatives to identify and target new tumor-generating signaling systems. to be.

Republic of Korea Patent Publication No. 10-2018-0056796 (published May 29, 2018)

An object of the present invention is to provide a composition for enhancing radiation sensitivity, or a method for screening a radiation sensitivity enhancer.

Another object of the present invention is to provide a biomarker composition for predicting radiotherapy prognosis, or a method for providing information necessary for predicting radiotherapy prognosis.

Another object of the present invention is to provide a composition for predicting radiotherapy prognosis, or a kit for predicting radiotherapy prognosis.

In order to achieve the above object, the present invention provides a composition for enhancing radiation sensitivity comprising an NONO gene expression inhibitor, or an inhibitor of the expression or activity of the protein encoded by the gene as an active ingredient.

In addition, the present invention comprises the first step of treating a test substance to a sample separated from a cancer patient; A second step of measuring the expression of NONO gene in the sample treated with the test substance, or the expression or activity level of the protein encoded by the gene; And a third step of selecting a test substance in which the expression of the NONO gene or the expression or activity level of the protein encoded by the gene is reduced compared to a control sample. do.

In another aspect, the present invention provides a biomarker composition for predicting the prognosis of the radiation therapy of cancer patients comprising a NONO gene or a protein encoded by the gene as an active ingredient.

In addition, the present invention comprises a composition for predicting the prognosis of the radiation therapy of cancer patients, or the composition comprising a formulation capable of measuring the expression of NONO gene, or the expression or activity level of the protein encoded by the gene as an active ingredient, Provided are kits for predicting the prognosis of radiation therapy in cancer patients.

In addition, the present invention comprises a first step of measuring the expression or activity level of the NONO gene from the sample isolated from the cancer patient, or the protein encoded by the gene; A second step of comparing the expression of the NONO gene or the expression or activity level of the protein encoded by the gene with a control sample; And a third step of determining that the prognosis of the radiation therapy is worse when the expression of the NONO gene, or the expression or activity level of the protein encoded by the gene is higher than that of the control sample. Provide a way to provide.

According to the present invention, the expression level of the NONO gene or protein is specifically increased in various cancers such as breast cancer, liver cancer and lung cancer, which indicates a high correlation with the survival rate, anticancer reactivity and radiation sensitivity of cancer patients. The expression or activity inhibitors can be usefully used as a novel cancer therapy that inhibits tumors and enhances anticancer reactivity and radiation sensitivity.

1 is a result of analyzing the RNA binding protein expressed in lung cancer tissue and normal tissue using a lung cancer patient-derived genomic profile.
2 is a result of analyzing the expression of NONO gene using a genomic profile derived from lung cancer patients.
Figure 3 analyzes the expression of NONO gene using a genomic profile derived from liver cancer patients.
Figure 4 is a result of analyzing the patient survival rate by NONO gene expression using lung cancer patient-derived genomic profile.
5 is a result of analyzing the patient survival rate by NONO gene expression using liver cancer patient-derived genome profile.
6 is a result of analyzing the patient survival rate by NONO gene expression using a breast cancer patient-derived genomic profile.
7 is a result of analyzing the drug reactivity by NONO gene expression using a breast cancer patient-derived genomic profile.
8 is a result showing the growth inhibitory effect of cancer cells by inhibiting NONO expression in lung cancer cell line.
9 is a result showing the growth inhibitory effect of cancer cells by inhibiting NONO expression in liver cancer cell line.
10 is a result showing the growth inhibitory effect of cancer cells by NONO expression inhibition in breast cancer cell line.
11 shows the results of tumor growth inhibition effect by NONO expression inhibition.
12 is a result showing the anticancer drug sensitivity enhancement effect by NONO expression inhibition.
Figure 13 is the result showing the radiation sensitivity enhancement effect by NONO expression inhibition.

The inventors of the present invention confirmed that the expression level of the NONO gene or protein is specifically increased in various carcinomas. As a result, a novel cancer in which NONO-targeting expression or activity inhibitors inhibit tumors and enhance anticancer drug reactivity and radiation sensitivity The present invention has been completed confirming that it can be used as a treatment.

Accordingly, the present invention provides a composition for enhancing radiation sensitivity comprising an NONO (GenBank accession ID: NM_001145408.1) gene expression inhibitor, or an inhibitor of expression or activity of a protein encoded by the gene as an active ingredient.

The NONO gene expression inhibitor may be selected from the group consisting of small interfering RNA (siRNA), antisense nucleotides and short hairpin RNA (shRNA) that complementarily bind to the mRNA of the NONO gene, The expression or activity inhibitor of the protein encoded by the NONO gene may be selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, antibodies, and natural products that specifically bind to NONO proteins, but is not limited thereto. Specifies.

The composition may enhance sensitivity to radiation in cancer cells, preferably, the cancer may be selected from the group consisting of breast cancer, liver cancer, lung cancer and colorectal cancer, but is not limited thereto.

As used herein, the term "enhancing radiation sensitivity" refers to enhancing the sensitivity of cells to radiation in treating diseases with radiation. Through this, the radiation treatment efficiency can be increased. In particular, in the treatment of cancer, the radiation treatment of the cancer cells can be enhanced when the cancer treatment is performed in parallel, thereby exhibiting the killing effect and the proliferation inhibitory effect of the cancer cells.

The composition for enhancing radiation sensitivity of the present invention may further include a pharmaceutically acceptable carrier, and may be formulated with the carrier.

The term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not interfere with the biological activity and properties of the composition to be administered without stimulating the organism. Acceptable pharmaceutical carriers in compositions formulated as liquid solutions are sterile and biocompatible, which include saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary. Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

"Administration" in the present invention means introducing the composition of the present invention to a patient in any suitable way, including for example by delivery of an antisense nucleic acid molecule by viral or non-viral technology. When the composition of the present invention is introduced into cancer cells, the radiation sensitivity is enhanced by lowering the expression level or inhibiting the activity of the gene or protein.

The composition for enhancing radiation sensitivity of the present invention can be applied in any dosage form, can be prepared in oral or parenteral dosage form, and can be formulated in unit dosage form for ease of administration and uniformity of dosage. Pharmaceutical formulations of the present invention may be oral, rectal, nasal, topical (including the cheek and sublingual), subcutaneous, vaginal or parenteral (intramuscular, subcutaneous). And forms suitable for administration by inhalation or insufflation.

The oral dosage form may be formulated, for example, in tablets, troches, lozenges, water-soluble or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs. For formulation into formulations such as tablets and capsules, lactose, saccharose, sorbitol, mannitol, starch, amylopectin, binders such as cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, stearic acid masne It may include a lubricating oil such as calcium, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax, and in the case of a capsule, it may further contain a liquid carrier such as fatty oil in addition to the above-mentioned materials.

In addition, the parenteral dosage form may be formulated for injection such as subcutaneous injection, intravenous injection or intramuscular injection, suppository injection method, or aerosol for inhalation through respiratory system. To formulate injectable formulations, the compositions of the invention can be mixed in water with stabilizers or buffers to prepare solutions or suspensions, which can be formulated for unit administration of ampoules or vials. For infusion into suppositories, it may be formulated into compositions for rectal administration such as suppositories or body enema including conventional suppository bases such as cocoa butter or other glycerides. When formulated for sprays such as aerosols, a propellant or the like may be combined with the additives to disperse the dispersed dispersion or wet powder.

Radiation therapy for the treatment of cancer of the present invention comprises administering a therapeutically effective amount of the composition for enhancing radiation sensitivity of the present invention. The therapeutically effective amount means an amount that effectively enhances the sensitivity of the tumor in cancer cells to radiation. It will be apparent to those skilled in the art that a suitable total daily dose can be determined by the practitioner within the correct medical judgment. The specific therapeutically effective amount for a particular patient may be based on the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, body weight, general health, sex and diet, time of administration, It is desirable to apply differently depending on various factors including the route of administration and the rate of release of the composition, duration of treatment, and the radiation dose to be irradiated and similar factors well known in the medical arts. Therefore, the effective amount of the composition for enhancing radiation sensitivity suitable for the purpose of the present invention is preferably determined in consideration of the above matters. In addition, in some cases, a known anticancer agent may be co-administered together with the radiation sensitivity enhancing composition of the present invention to increase anticancer effects including radiotherapy effects.

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, which forms a complementary template and base pair and functions as a starting point for template strand copying. Means. Primers can initiate DNA synthesis in the presence of four different nucleotide triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. The primers of the present invention may be sense and antisense nucleic acids having 7 to 50 nucleotide sequences as the gene specific primers, and as long as they do not change the basic properties of the primers serving as the starting point of DNA synthesis, Can be mixed.

In the present invention, the term "probe" refers to nucleic acid fragments such as RNA or DNA, which are short to several bases to hundreds of bases that can specifically bind to mRNA, and are labeled so that the presence or absence of a specific mRNA is expressed. You can check the amount. Probes may be made in the form of oligonucleotide probes, single strand DNA probes, double strand DNA probes, RNA probes and the like. Selection of appropriate probes and hybridization conditions may be appropriately selected according to techniques known in the art.

As used herein, the term “antibody” refers to a specific immunoglobulin directed to an antigenic site as is known in the art. The antibody in the present invention means an antibody that specifically binds to the NONO of the present invention, and the antibody can be prepared according to conventional methods in the art. Forms of such antibodies include polyclonal antibodies or monoclonal antibodies, and all immunoglobulin antibodies. By said antibody is meant a complete form having two full length light chains and two full length heavy chains. In addition, the said antibody also contains special antibodies, such as a humanized antibody.

The term "peptide" in the present invention has the advantage of high binding strength to the target material, and does not occur denaturation even during thermal / chemical treatment. In addition, the small size of the molecule can be attached to other proteins and used as a fusion protein. Specifically, since it can be used by attaching to a polymer protein chain, it can be used as a diagnostic kit and drug delivery material.

In the present invention, the term "aptamer" refers to a special kind of single-stranded nucleic acid (DNA, RNA or modified nucleic acid) which has a stable tertiary structure and has a characteristic of being able to bind to a target molecule with high affinity and specificity. It means a kind of polynucleotide consisting of). As described above, aptamers are composed of polynucleotides that can bind specifically to antigenic substances like antibodies, but are more stable than proteins, simple in structure, and easy to synthesize. Can be.

In addition, the present invention comprises the first step of treating a test substance to a sample separated from a cancer patient; A second step of measuring the expression of NONO gene in the sample treated with the test substance, or the expression or activity level of the protein encoded by the gene; And a third step of selecting a test substance in which the expression of the NONO gene or the expression or activity level of the protein encoded by the gene is reduced compared to a control sample. do.

In the present invention, the term "sample isolated from cancer patients" refers to tissues, cells, whole blood, serum, plasma, saliva, which differ from the control in the expression of the NONO gene or the expression or activity level of the protein encoded by the gene. It may include, but is not limited to, samples such as sputum, cerebrospinal fluid, or urine.

The expression level of the gene is RT-PCR, competitive RT-PCR, Real-time RT-PCR, RNase protection assay (RPA), Northern blotting (Northern) It may be measured by any one or more methods selected from the group consisting of blotting) and DNA chips, but is not limited thereto.

The protein expression or activity level is Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunity Electrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS and protein chip can be measured by one or more methods selected from the group consisting of, but not limited thereto. do.

In another aspect, the present invention provides a biomarker composition for predicting the prognosis of the radiation therapy of cancer patients comprising a NONO gene or a protein encoded by the gene as an active ingredient.

In the present invention, the term "prognostic prediction" means the act of predicting the progress and outcome of the disease in advance. More specifically, the prognosis prediction may vary depending on the physiological or environmental condition of the patient, and is interpreted to mean all actions for predicting the progress of the disease after the treatment in consideration of the patient's condition. Can be.

For the purposes of the present invention, the prognosis prediction may be interpreted as an act of predicting disease-free survival or survival rate of the cancer patient by predicting the progress and cure of the disease in advance after radiation treatment of the cancer patient. For example, predicting "good prognosis" indicates a high level of disease-free survival or survival in cancer patients after radiation treatment, meaning that cancer patients are more likely to be treated, and predicting "prognosis is poor." The low disease-free survival rate or survival rate of cancer patients after radiation is indicated, which means that the cancer patients are more likely to recur or die from cancer.

In another aspect, the present invention provides a composition for predicting the prognosis of the cancer treatment of a cancer patient comprising as an active ingredient an agent capable of measuring the expression of the NONO gene, or the expression or activity level of the protein encoded by the gene.

The agent may be, but is not limited to, a primer or probe that specifically binds to the NONO gene, or an antibody, peptide, peptide mystic, aptamer or compound that specifically binds to the NONO protein. do.

The present invention also provides a kit for predicting radiotherapy prognosis of a cancer patient comprising the composition.

The kit may comprise an antibody comprising a sense or antisense primer of a gene of the invention, comprising a probe complementary to the gene, or specific for that expression protein encoded by the gene.

In addition, the present invention comprises a first step of measuring the expression or activity level of the NONO gene, or the protein encoded by the gene from a sample isolated from cancer patients; A second step of comparing the expression of the NONO gene or the expression or activity level of the protein encoded by the gene with a control sample; And a third step of determining that the prognosis of the radiation therapy is worse when the expression of the NONO gene, or the expression or activity level of the protein encoded by the gene is higher than that of the control sample. Provide a way to provide.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Example 1 Analysis of Increased NONO Gene Expression in Cancer Cells

RNA binding proteins (RBPs) are known to play an important role in cancer production and metastasis, and cancer treatment techniques targeting them are being explored as new alternatives.

Thus, as shown in Figure 1, after obtaining the human-derived lung cancer genome profile GSE19188, GSE30219, GSE43458, GSE31210, GSE40275 data from the NCBI GEO site, normalization was performed using the BRB-Array tool, Genes with p values of 0.001 or less in lung cancer tissues were selected by class comparison assay. RNA binding proteins (NONO, CSTF2, IGF2BP3, MSI2, PABPC3, RBM34, RNPS1, SF3B4, SRP54, TIA1), which showed common expression differences by comparing the selected genes, were finally selected, and the expression of NONO gene was normal tissue. Compared with lung cancer tissues it was significantly increased.

Next, NONO genes were selected using the genome profile derived from lung cancer (GSE19188, GSE30219, GSE43458, GSE31210) and liver cancer (TCGA LIHC, SKKU HCC, GSE39791, Korea Pool), and then cancer tissue and Differences in NONO gene expression in normal tissues were analyzed. As a result, as shown in Figures 2 and 3, it was confirmed that the expression of NONO gene significantly increased in lung cancer tissues and liver cancer tissues compared to normal tissues (p <0.05).

Example 2 Analysis of Association with NONO Gene Expression and Patient Survival

After analyzing the expression of the NONO gene using genome profiles derived from lung cancer (GSE8894, GSE29013, GSE14814, GSE31210), the patients with high NONO gene expression and low NONO gene expression were analyzed and a log rank test was performed. Afterwards, Kaplan meir plotting was performed to analyze patient survival. As a result, as shown in FIG. 4, the lung cancer patients with high NONO gene expression were poor in prognosis and high recurrence rate, while the survival rate was improved in lung cancer patients with low NONO gene expression.

In addition, as a result of analyzing the patient survival rate using the genome profile derived from other cancers (Fudan LIHC, Korea Pool, TCGA LIHC Updated) and breast cancer (UNC TNBC) patient, as shown in Figure 5 and 6, In patients with liver or breast cancer with high NONO gene expression, the prognosis was poor and the recurrence rate was high, whereas in patients with liver or breast cancer with low NONO gene expression, survival was improved.

In addition, as shown in Figure 7, the expression of the NONO gene in the breast cancer patient-derived genome profile was confirmed that the poor reactivity to the drug.

Example 3: Analysis of cancer cell growth inhibition effect by NONO expression inhibition

As NONO gene expression was found to be highly correlated with patient survival and various clinical parameters, the following experiment was performed to determine whether NONO gene directly affects cancer cell growth.

Lung cancer (A549, H1299), liver cancer (Hep3B, SNU449) and breast cancer cell lines (Hs578T, MDA-MB-231) were purchased from ATCC and Korea Cell Line Bank, 10% fetal bovine serum (FBS) and 1% Incubated in 37%, 5% Co ₂ incubator using RPMI1640 medium containing antibiotics. EZ-cytox, a reagent for measuring cell viability, was developed by Daeil Lab Service Co. Purchase from Ltd.

Cancer cells were treated with shCon or shNONO (Sigma) for 72 hours and then seeded in 96 well plates at a concentration of 1 × 10 4 cells / well. After culturing according to the time (24, 48, 72 hours), 10 μL of EZ-cytox was added to the well for each incubation time, and further incubated for 1 hour, and the absorbance was measured at 450 nm.

As a result, as shown in Figure 8, lung cancer cell lines (A549, H1299) significantly reduced the growth of cancer cells when NONO expression is inhibited by shNONO. In addition, as shown in Figs. 9 and 10, it was confirmed that the growth of cancer cells was reduced when the expression of NONO was inhibited by shNONO in liver cancer (Hep3B, SNU449) and breast cancer (Hs578T, MDA-MB-231) cell lines.

Sequence (5'-3 ') shCon GCAAGCTGACCCTGAAGTTCAT shNONO # 1 / # 562 CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG shNONO # 2 / # 628 CCGGGCTGCTACAATGGAAGGAATTCTCGAGAATTCCTTCCATTGTAGCAGCTTTTTG shNONO # 558 / # 693 CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG shNONO # 663 CCGGTGAGCACCAGGTCATGCTAATCTCGAGATTAGCATGACCTGGTGCTCATTTTTG shNONO # 1049 CCGGTCCAGAGAAGCTGGTTATAAACTCGAGTTTATAACCAGCTTCTCTGGATTTTTG

Example 4: Analysis of tumor growth inhibition effect by NONO expression inhibition

As NONO gene expression has been shown to affect patient survival and treatment prognosis, the technique of targeting NONO in vivo is very important in improving survival and drug treatment.

Thus, after implanting cancer tissues from lung cancer patients into the immune-suppressed nude mice, siCon (UUCUCCGAACGUGUCACGU) or siNONO (GAUGGAAGCUGCACGCCAU, Sigma) nanoparticles coated with nano chitosan were intraperitoneally injected twice a week. After 5 weeks, the tumor size and weight were generated. As a result, as shown in Figure 11, it was confirmed that the size and weight of the tumor significantly reduced in the group treated with the NORNA targeting siRNA.

Example 5: Analysis of association between NONO expression and anticancer drug sensitivity

To analyze the association between NONO expression and anticancer susceptibility, breast cancer cell lines were treated with doxorubicin (LC Laboratories) as an anticancer agent and shNONO as an NONO expression inhibitor, and then cultured for 24 to 96 hours, and EZ- 10 μL of the cytox was added to the wells and further incubated for 1 hour, and then the cell growth was analyzed by measuring the absorbance at 450 nm. As a result, as shown in Figure 12, it was confirmed that the growth of breast cancer cells significantly reduced when the expression of NONO was suppressed by shNONO in combination with the anticancer agent alone treatment.

Example 6: Analysis of association between NONO expression and radiation sensitivity

The liver cancer cell line (Hep3B) was irradiated with 10 Gy of radiation and then cells were obtained at different time intervals to extract proteins. 50 μg of the protein was separated by SDS-PAGE method (Bio-rad) to perform Western blot. Electrophoretically separated proteins were transferred to PVDF (polyvinylidene fluoride) membranes (Millipore) using a transfer buffer. The protein-translated membrane was blocked with skim milk, and then reacted with a primary antibody at 4 ° C. for 24 hours, and then with a secondary antibody conjugated with HRP for 1 hour at room temperature. The membrane was then developed by exposure to an X-ray film using an ECL detection kit (Daeil Lab Service Co. Ltd) luminescence method and then observed the expression level of the protein on the film. The antibodies used in the western blot were as follows: NONO (Bethyl A300-582A), H2AX (Millipore 05-636), FOXM1 (Cellsignaling 5436), Actin (Cellsignaling 3700).

In addition, in order to analyze the association between radiation sensitivity and NONO expression, hepatic cancer cell line (Hep3B) was treated with shNONO for 72 hours, and then inoculated in a 6 well plate at a concentration of 1 X 10 ^ 3 cells / well, and 2 weeks after radiation treatment. Colony formation assays were performed.

As a result, as shown in Fig. 13, when the liver cancer cell line was irradiated, the expression of NONO was temporarily increased, and no significant inhibitory effect was observed in the growth of cancer cells, but when the expression of NONO was suppressed with irradiation, It was confirmed that the cancer cell growth caused by even more reduced.

That is, the present invention can target cancer cells by targeting different signaling pathways and other NONOs, and at the same time improve anticancer drugs and radiation sensitivity, and thus may be usefully used as a new paradigm of cancer treatment technology in the future.

As described above in detail a specific part of the present invention, it is apparent to those skilled in the art that the specific technology is only a preferred embodiment, which is not limited to the scope of the present invention. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

The scope of the present invention is represented by the following claims, and it should be construed that all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present invention.

<110> University of Ulsan Foundation For Industry Cooperation          THE ASAN FOUNDATION <120> Composition for enhancing radiation sensitivity configuring          expression or activity inhibitor of NONO <130> ADP-2018-0237 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> shCon <400> 1 gcaagctgac cctgaagttc at 22 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNONO # 1 / # 562 <400> 2 ccggcaggcg aagtcttcat tcatactcga gtatgaatga agacttcgcc tgtttttg 58 <210> 3 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNONO # 2 / # 628 <400> 3 ccgggctgct acaatggaag gaattctcga gaattccttc cattgtagca gctttttg 58 <210> 4 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNONO # 558 / # 693 <400> 4 ccgggccaga attctaccct ggaaactcga gtttccaggg tagaattctg gctttttg 58 <210> 5 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNONO # 663 <400> 5 ccggtgagca ccaggtcatg ctaatctcga gattagcatg acctggtgct catttttg 58 <210> 6 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shNONO # 1049 <400> 6 ccggtccaga gaagctggtt ataaactcga gtttataacc agcttctctg gatttttg 58 <210> 7 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siCon <400> 7 uucuccgaac gugucacgu 19 <210> 8 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> siNONO <400> 8 gauggaagcu gcacgccau 19

Claims (12)

A composition for enhancing radiation sensitivity comprising an NONO gene expression inhibitor, or an inhibitor of expression or activity of a protein encoded by the gene as an active ingredient. According to claim 1, wherein the NONO gene expression inhibitor is a group consisting of small interfering RNA (siRNA), antisense nucleotides and short hairpin RNA (shRNA) complementary to the mRNA of the NONO gene Radiation sensitivity enhancement composition, characterized in that selected from. The method of claim 1, wherein the expression or activity inhibitor of the protein encoded by the NONO gene is selected from the group consisting of compounds, peptides, peptide mimetics, aptamers, antibodies and natural products that specifically bind to the NONO protein. Radiation sensitivity enhancement composition. The composition of claim 1, wherein the composition enhances sensitivity to radiation in cancer cells. The composition of claim 4, wherein the cancer is selected from the group consisting of breast cancer, liver cancer, lung cancer, and colorectal cancer. A first step of treating a test substance with a sample separated from a cancer patient;
A second step of measuring expression of an NONO gene in the sample treated with the test substance, or expression or activity level of a protein encoded by the gene; And
And a third step of selecting a test substance in which the expression of the NONO gene or the expression or activity level of the protein encoded by the gene is reduced compared to the control sample. Biomarker composition for predicting radiotherapy prognosis of cancer patients comprising NONO gene or protein encoded by the gene as an active ingredient. A composition for predicting the prognosis of a radiotherapy of a cancer patient, comprising as an active ingredient an agent capable of measuring expression of an NONO gene or expression or activity level of a protein encoded by the gene. The method of claim 8, wherein the agent is a primer or probe specifically binding to the NONO gene, or an antibody, peptide, peptide mimetics, aptamers or compounds that specifically bind to the NONO protein, characterized in that A composition for predicting the prognosis of radiation therapy in cancer patients. 10. A kit for predicting the prognosis of a radiation therapy of a cancer patient comprising the composition according to claim 8 or 9. The kit of claim 10, wherein the kit comprises a sense or antisense primer of the NONO gene, a probe complementary to the NONO gene, or an antibody specific for the expression protein encoded by the NONO gene. Kit for predicting the prognosis of radiation therapy in cancer patients. A first step of measuring the expression of NONO gene or the expression or activity level of the protein encoded by the sample separated from cancer patients;
A second step of comparing the expression of the NONO gene or the expression or activity level of the protein encoded by the gene with a control sample; And
Providing the information necessary for predicting the prognosis of the cancer patient, including the third step of determining that the prognosis of the radiotherapy if the expression of the NONO gene, or the expression or activity level of the protein encoded by the gene is higher than the control sample. How to.

Images