KR20230172647A - Use of leucine-zipper protein for diagnosing or treating cancer - Google Patents

Abstract

The present invention relates to the use of leucine zipper protein for diagnosis or treatment of colon cancer. According to the present invention, it has been confirmed that leucine-zipper protein plays an important role in the metabolism of colon cancer cells by regulating the autophagy mechanism and metabolic programming of cancer cells, and the protein of the present invention or a fragment thereof could be used as a target for diagnosis, improvement, or treatment of colon cancer.

Description

{Use of leucine-zipper protein for diagnosing or treating cancer}

The present invention relates to novel uses of small leucine zipper proteins for the diagnosis or treatment of cancer.

The tumor microenvironment is characterized by a lack of supply of nutrients such as glucose required for cell growth due to the rapid proliferation of cancer cells. Inactivation of cellular glycolysis causes metabolic stress, and cancer cells activate the autophagy mechanism to promote redistribution of metabolites. Cancer cells overcome stressful environments by inducing metabolic reprogramming with high metabolic flexibility through the autophagy mechanism, so they quickly become resistant to anticancer treatments using metabolic inhibition and have difficulty in effective treatment. Therefore, discovering and studying substances closely involved in metabolic reprogramming of cancer cells is important for cancer diagnosis and development of anti-cancer drugs.

Human leucine zipper protein (LZIP) is a bZIP transcription factor containing a basic DNA binding domain, a putative transmembrane domain, and a leucine zipper domain (Raggo C, et al., Mol Cell Biol 22:5639-5649, 2002). The ubiquitously expressed human LZIP regulates cell proliferation by binding to the basic glucocorticoid responsive element (CR E) (Freiman RN, et al., Genes Dev 11:3122-3127, 1997). Additionally, LZIP is known to function as a tumor suppressor and ER stress-related protein degradation factor (Jin DY, et al., EMBO J 19:729-740, 2000; Liang G, et al., Mol Cell Biol 26:7999 -8010, 2006). Previously, the present inventors showed that human LZIP binds to CC chemokine receptor 1 (CCR 1) and plays a positive role in cell migration induced by CC chemokine leukotactin (Lkn)-1. It has been reported to be a regulator (Ko J, et al., FASEB J 18:890-892, 2004). Recent studies have reported that LZIP is involved in Tat-mediated transcription of HIV-1 long terminal repeat (LTR) and CCR2 expression (Blot G, et al., J Mol Biol 364:1034-1047, 2006; Sung HJ, et al., Exp Mol Med 40:332-338, 2008). These results indicate that human LZIP functions not only as a transcription factor but also as a cell regulator. Despite these proposed diverse roles for human LZIP, its function is not fully known and its subcellular localization remains controversial.

In addition, a subtype of human LZIP was discovered by the present inventors, and unlike the existing human LZIP, LZIP consists of 354 amino acids lacking a putative transmembrane domain (229-245 amino acid residues) (small leucine zipper protein , hereinafter referred to as sLZIP), unlike human LZIP, is mainly located in the nucleus and has been confirmed to have the function of suppressing the transcriptional activity of GR induced by the ligand (published patent KR10-2011-0044545).

sLZIP is known to be involved in the malignancy of various cancers and metabolic diseases by functioning as a transcription factor in the nucleus of cells and directly regulating the transcription of genes involved in cancer development and intracellular regulatory mechanisms. Its regulatory function regarding reprogramming and activation of autophagic mechanisms is unknown.

Accordingly, the present inventors confirmed that sLZIP contributes to the progression of colon cancer by inducing autophagy in colon cancer cells, and confirmed the possibility of using it as an anticancer agent for the treatment of colon cancer as a candidate biomarker for colon cancer treatment. The invention was completed.

Public patent KR10-2011-0044545

The purpose of the present invention is to provide a use of a small leucine zipper protein for the diagnosis of colon cancer.

The purpose of the present invention is to provide the use of leucine zipper protein as a colon anticancer agent for the treatment of colon cancer.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

In order to achieve the purpose of the present invention as described above,

The present invention provides a pharmaceutical composition for improving or treating colon cancer, comprising as an active ingredient an inhibitor of the activity of a small leucine zipper protein or an inhibitor of the expression of a gene encoding the protein.

The present invention provides a composition for diagnosing colon cancer, including a probe for measuring the activity of a small leucine-zipper protein or the expression level of a gene encoding the protein.

The present invention involves treating cells or tissues isolated from an individual with a candidate material and measuring the expression level of small leucine zipper protein in the cells or tissues,

Provided is a screening method for a drug for improving or treating colon cancer, wherein the candidate substance is identified as a drug for improving or treating colon cancer when it downregulates the expression of a small leucine zipper protein.

According to the present invention, by confirming that the small leucine-zipper protein plays an important role in regulating the autophagy mechanism in colon cancer cells in progress, the small leucine-zipper protein of the present invention or a fragment thereof Can be used as a target for metabolic anticancer drugs for the diagnosis, improvement, or treatment of colon cancer.

Figures 1A-1C show the results of measuring changes in the expression of sLZIP in a glucose- and glutamine-deficient environment.
Figures 1D-1F show the results confirming the relationship between the expression of sLZIP and the expression of LC3B.
Figures 2A-2B show the results confirming the activity of the LC3 promoter according to increased sLZIP expression.
Figures 2C-2E are diagrams of the promoter region and binding site of LC3B to which sLZIP binds.
Figures 3A-3C show the results of confirming whether increasing LC3B expression by sLZIP affects autophagosome formation.
Figures 3D-3E show results confirming that autophagy is promoted through sLZIP overexpression under nutrient-deficient conditions, as the expression of LC3 protein increases and the amount of p62 protein decreases.
Figures 3F-3G show the results confirming the increase in cell death due to nutrient deficiency stress due to inhibition of sLZIP expression in colon cancer cells.
Figures 4A-4G show the results of confirming whether sLZIP induces metabolic reprogramming that promotes mitochondrial respiration through autophagy activation in colon cancer cells.
Figures 5A-5I show the results of confirming whether colon cancer cells are involved in regulating redox homeostasis through autophagy activation.
Figures 6A-6I show the results confirming the increase in cell death due to inhibition of glycolysis due to inhibition of sLZIP expression in colon cancer cells.
Figures 7A-7E show the results of confirming tumor inhibition sensitivity to glycolysis inhibitors in colon cancer cells in which the expression of sLZIP was suppressed.
Figures 7F-7G show the results of comparing the expression levels of CREB3 and LC3B genes in tissues of colon cancer patients and normal people.
Figures 8A-8C show the results of comparing the protein expression levels of CREB3 and LC3B in tissues of colon cancer patients and normal people.
Figure 9 shows the metabolic reprogramming mechanism involved in sLZIP in colon cancer.

Hereinafter, the present invention will be described in detail.

The present invention provides the use of leucine zipper protein for improving or treating colon cancer.

More specifically, the present invention provides a pharmaceutical composition for improving or treating colon cancer, comprising as an active ingredient an inhibitor of the activity of a small leucine zipper protein or an inhibitor of the activity of a gene encoding the protein; and administering a therapeutically effective amount of an activity inhibitor or expression inhibitor of small leucine zipper protein to a subject.

The term “improvement” used in the present invention refers to all actions that suppress or delay the onset of colon cancer disease by administering the pharmaceutical composition according to the present invention.

As used in the present invention, the term “treatment” refers to any action in which the symptoms of colon cancer disease are improved or beneficially changed by administration of the pharmaceutical composition according to the present invention.

In the present invention, leucine zipper protein (LZIP) is a member of the bZIP family and belongs to the CREB/ATF gene family. Leucine zipper protein has a basic DNA-binding domain and a leucine zipper domain, and binds to the cAMP-responsive element (CRE) and AP-1 element. It has also been identified as an HCF-1 binding protein, promotes cell proliferation and cellular transformation, and contains two LxxLL-transcription helper binding motifs. In addition, the leucine zipper protein consists of five members, CREB3 (LZIP, Luman), CREB3L1 (OASIS), CREB3L2 (BBF2H7), CREB3L3 (CREB-H), and CREB3L4 (AIbZIP), and although they have homology, they are not transcribed. Each argument has a different function. The reported functions of the leucine zipper protein include binding to CCR1 to regulate Lkn-1-dependent cell migration and binding to the CCR2 promoter to regulate CCR2 expression. However, as disclosed in the present invention, in colon cancer Nothing is known about the regulation of autophagy and metabolic reprogramming in cancer cells.

Specifically, the leucine zipper protein used in one specific embodiment of the present invention, unlike the existing human LZIP, is composed of 354 amino acids lacking a putative transmembrane domain (229-245 amino acid residues) (GeneBank (accession No FJ263669 )), unlike human LZIP, is characterized by being mainly located in the nucleus. In this specification, it is called small leucine zipper protein (sLZIP) to distinguish it from human LZIP.

The small leucine zipper protein may be composed of the amino acid sequence represented by SEQ ID NO: 1, and the amino acid sequence represented by SEQ ID NO: 1, and at least 70%, preferably at least 80%, more preferably at least 90%, most. Preferably, it may include an amino acid sequence having 95% or more sequence homology.

In addition, the gene encoding the small leucine zipper protein may preferably include all types of base sequences capable of encoding the amino acid shown in SEQ ID NO: 1, and most preferably, the base sequence shown in SEQ ID NO: 2. It may consist of a base sequence having a sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% with the base sequence shown in SEQ ID NO: 2. can do.

In a specific example, the present inventors investigated the autophagy-inducing function of sLZIP in colon cancer and its effect on the survival of colon cancer cells under nutrient-deficient conditions. When nutrients in colon cancer cells are depleted, not only does the transcription amount of sLZIP increase in proportion to the time of nutrient deprivation, but also sLZIP binds directly to the region near the promoter of the LC3B gene, which is known to play an important role in the formation of autophagosomes, thereby increasing the LC3B gene. It was confirmed that the transcription of was increased. Decomposition of autophagosomes induced by sLZIP maintains the ATP production function of mitochondria by supplying glutamine in situations of metabolic stress and maintains redox homeostasis in the cancer cell microenvironment by activating the cell's Nrf2 mechanism in situations of metabolic stress. It was confirmed that In addition, animal experiments confirmed that reducing sLZIP gene expression through an inhibitor lowers the metabolic flexibility of colon cancer cells, thereby increasing their sensitivity to inhibition of cancer cell progression.

In the present invention, the expression inhibitor may be a gene scissors, antisense oligonucleotide, siRNA, shRNA, miRNA, or a vector containing the same that is complementary to the gene coding for the leucine zipper protein. These gene scissors, antisense oligonucleotides, siRNA, shRNA, miRNA, or vectors containing them can be produced using methods known in the art. In the present invention, the “vector” refers to a genetic construct containing foreign DNA inserted into the genome encoding a polypeptide. The vector related to the present invention is a vector in which a nucleic acid sequence that inhibits the gene is inserted into the genome, and examples of these vectors include DNA vectors, plasmid vectors, cosmid vectors, bacteriophage vectors, yeast vectors, or viral vectors.

In addition, in the present invention, an activity inhibitor of a small leucine zipper protein refers to a substance that reduces the function of the leucine zipper protein, preferably, makes detection of the protein function impossible or exists at an insignificant level. More specifically, the activity inhibitor is an antibody that specifically binds to the leucine zipper protein; Antisense oligonucleotides, siRNA, shRNA, miRNA, gene loci for genes encoding specific fragments within the leucine zipper protein, or vectors containing the same; It may inhibit the activity of a specific fragment within the leucine zipper protein, but is not limited to this.

The pharmaceutical composition of the present invention can be prepared using pharmaceutically suitable and physiologically acceptable additives in addition to the active ingredients, and the additives include excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants, and lubricants. Solubilizers such as agents or flavoring agents can be used.

For administration, the pharmaceutical composition of the present invention may be preferably formulated as a pharmaceutical composition containing one or more pharmaceutically acceptable carriers in addition to the active ingredient. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or ingredient using a method disclosed by Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA, as an appropriate method in the field.

Pharmaceutical preparation forms of the pharmaceutical composition of the present invention include granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drops or injectable solutions, and sustained-release preparations of the active compound. It can be.

The pharmaceutical composition of the present invention may be administered in the conventional manner via intravenous, intraarterial, intraperitoneal, intramuscular, intraperitoneal, intrasternal, transdermal, intranasal, inhalation, topical, rectal, oral, intraocular or intradermal routes. can do.

The effective amount of the active ingredient of the pharmaceutical composition of the present invention refers to the amount required to achieve the effect of improving or treating disease or inducing bone growth. Therefore, the type of disease, the severity of the disease, the type and content of the active ingredient and other ingredients contained in the composition, the type of dosage form and the patient's age, weight, general health condition, gender and diet, administration time, administration route and composition. It can be adjusted depending on a variety of factors, including secretion rate, duration of treatment, and concurrent medications. It is not limited thereto, but for example, in the case of adults, when administered once or several times a day, the inhibitor of the present invention is administered once or several times a day, and in the case of a compound, 0.1 ng/kg to 10 g/kg, polypeptide, For proteins or antibodies, it can be administered at a dose of 0.1 ng/kg to 10 g/kg, and for gene scissors, antisense oligonucleotides, siRNA, shRNAi, or miRNA, it can be administered at a dose of 0.01 ng/kg to 10 g/kg.

In the present invention, 'individual' includes humans, orangutans, chimpanzees, mice, rats, dogs, cows, chickens, pigs, goats, sheep, etc., but is not limited to these examples.

Additionally, in another aspect of the present invention, the use of a small leucine zipper protein for diagnosis of colon cancer is provided.

In a specific example, when the present inventors compared gene and protein expression in cancer tissues of colon cancer patients, the expression of CREB3, a subtype of sLZIP of the present invention, was increased compared to normal tissues and was correlated with the progression stage of colon cancer. It was confirmed that there was a relationship. These results indicate that the expression of sLZIP is related to the progression of colon cancer, and sLZIP can be used as a biomarker for the diagnosis of colon cancer.

Accordingly, the present invention provides a composition for diagnosing colon cancer, comprising a probe for measuring the activity of a small leucine zipper protein or the expression level of a gene encoding the protein; and administering to the subject an effective amount of a probe for measuring the activity of a small leucine zipper protein or the expression level of a gene encoding the protein.

Since the diagnostic composition of the present invention also uses the small leucine zipper protein described above, the description of common content between the two is omitted in order to avoid excessive complexity of the present specification.

As used in the present invention, the term “diagnosis” refers to the act of confirming the presence or characteristics of a pathological state, that is, colon cancer, by administering the composition according to the present invention. For the purpose of the present invention, when the expression or activity of small leucine zipper protein or a specific fragment within the small leucine zipper protein is enhanced in biological tissue, it means that it is judged to be colon cancer.

In the present invention, the probe for measuring the expression of the small leucine zipper protein may be an antibody that specifically binds to the small leucine zipper protein, or a nucleic acid probe or primer that specifically binds to the gene encoding the protein, , the probe for measuring the activity of the leucine zipper protein may be an antibody that specifically binds to a specific fragment within the leucine zipper protein, or a nucleic acid probe or primer that specifically binds to the gene encoding the fragment. Any substance that can measure the expression or activity of a zipper protein may be included without limitation.

The antibodies may be polyclonal antibodies, monoclonal antibodies, human antibodies, humanized antibodies, or fragments thereof. Additionally, the antibody fragments include Fab, Fab', F(ab')2 and Fv fragments; diabody; linear antibody; single chain antibody molecule; and multispecific antibodies formed from antibody fragments.

The nucleic acid probe refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, can hybridize specifically to a target nucleotide sequence, and may exist naturally or be artificially synthesized. says what happened The probe according to the present invention may be a single chain, preferably an oligodeoxyribonucleotide. Probes of the invention may include native dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), nucleotide analogs, or derivatives. Additionally, the probe of the present invention may also contain ribonucleotides. For example, the probes of the present invention may contain backbone modified nucleotides, such as peptide nucleic acids (PNAs), phosphorothioate DNA, phosphorodithioate DNA, phosphoroamidate DNA, amide-linked DNA, MMI-linked DNA, 2 '-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexitol DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines ( Substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, ethyl-, propynyl-, alkynyl-, thiazoryl-, imidazoryl- , including pyridyl-), 7-deazapurine with a C-7 substituent (substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, alkali- Nyl-, alkenyl-, thiazoryl-, imidazoryl-, pyridyl-), inosine and diaminopurine.

The primer refers to a single-stranded oligonucleotide that can act as an initiation point for template-directed DNA synthesis under suitable conditions (i.e., four different nucleoside triphosphates and polymerization enzymes) at a suitable temperature and in a suitable buffer. . The appropriate length of the primer may vary depending on various factors, such as temperature and the intended use of the primer. In addition, the sequence of the primer does not need to be completely complementary to a partial sequence of the template; it is sufficient to have sufficient complementarity within the range where the primer can hybridize with the template and perform its original function. Therefore, the primer in the present invention does not need to have a perfectly complementary sequence to the nucleotide sequence of the template gene, but it is sufficient to have sufficient complementarity within the range to hybridize to the gene sequence and function as a primer. Additionally, the primers according to the present invention are preferably used in gene amplification reactions. The amplification reaction refers to a reaction that amplifies a nucleic acid molecule, and amplification reactions of such genes are well known in the art, such as polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), and ligase. These may include enzyme chain reaction (LCR), electron-mediated amplification (TMA), and nucleic acid sequence substrate amplification (NASBA).

The composition for diagnosing colon cancer of the present invention may be included in the form of a kit.

The kit may include antibodies, probes, or primers that can measure the expression or activity of small leucine zipper protein or a specific fragment within the small leucine zipper protein, and their definitions are as described above.

Optionally, when the kit is applied to a PCR amplification process, reagents required for PCR amplification, such as buffers, DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or thermostable DNA polymerase obtained from Pyrococcus furiosus (Pfu), DNA polymerase cofactors, and dNTPs, and when the kit is applied to an immunoassay, the kit of the present invention optionally includes a secondary antibody and a label. It may include the substrate of Furthermore, the kit according to the present invention can be manufactured in a number of separate packaging or compartments containing the above-mentioned reagent components.

Additionally, the composition for diagnosing colon cancer of the present invention may be included in the form of a microarray.

In the microarray of the present invention, antibodies, probes, or primers capable of measuring the expression or activity of the leucine zipper protein or a specific fragment within the leucine zipper protein are used as a hybridizable array element, and a substrate ( It is immobilized on a substrate. Preferred substrates are suitable rigid or semi-rigid supports, which may include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. there is. The hybridization array elements are arranged and immobilized on the substrate, and such immobilization may be performed by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridized array elements can be bonded to a glass surface modified to contain epoxy compounds or aldehyde groups, and can also be bonded by UV to a polylysine coated surface. Additionally, the hybridization array elements can be coupled to a substrate via linkers (eg, ethylene glycol oligomers and diamines).

Meanwhile, if the sample applied to the microarray of the present invention is a nucleic acid, it may be labeled and hybridized with array elements on the microarray. Hybridization conditions may vary, and detection and analysis of the degree of hybridization may be performed in various ways depending on the labeling substance.

In another aspect of the present invention, the present invention provides the use of a leucine zipper protein for the development of a medicine for improving or treating colon cancer.

Since the screening method of the present invention also uses the leucine zipper protein described above, the description of common content between the two is omitted to avoid excessive complexity of the present specification.

In one embodiment, the present invention includes treating cells or tissues expressing a leucine zipper protein with a candidate material in vitro and measuring the expression level of the leucine zipper protein in the cells or tissues, Provided is a screening method for a drug for the improvement or treatment of colon cancer, in which a candidate substance is identified as a drug for the improvement or treatment of colon cancer when it downregulates the expression of the leucine zipper protein.

In another embodiment, the present invention includes treating cells or tissues expressing a leucine zipper protein with a candidate material in vitro, and measuring the expression level of the gene encoding the leucine zipper protein in the cells or tissues. In addition, it provides a screening method for a drug for improving or treating colon cancer, in which the candidate substance is identified as a drug for improving or treating colon cancer when it downregulates the expression of the gene encoding the leucine zipper protein.

The candidate material is a substance that inhibits transcription and translation of a leucine zipper protein or a specific fragment thereof according to a conventional selection method. Alternatively, it may be an individual nucleic acid, protein, peptide, other extract, natural product, compound, etc. that is presumed to have the potential as a medicine that inhibits the function or activity of the leucine zipper protein or a specific fragment thereof, or is randomly selected.

Thereafter, the expression level of the gene, the amount of protein, or the activity of the protein can be measured in cells treated with the candidate substance, and if the measurement results show that the expression level of the gene, the amount of protein, or the activity of the protein is decreased, The candidate substance can be judged as a substance that can improve or treat colon cancer.

The method of measuring the expression level of a gene, the amount of a protein, or the activity of a protein can be performed through various methods known in the art, for example, but not limited thereto, reverse transcription polymerase chain reaction (reverse transcription polymerase chain reaction). transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blot, Northern blot, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion. and immunoprecipitation assay.

Candidate substances that are obtained through the screening method of the present invention and exhibit the activity of inhibiting the expression of leucine zipper protein or a specific fragment thereof or inhibiting the function of the protein may be candidates as an anticancer agent for improving or treating colon cancer. .

Such candidate substances for improving or treating colon cancer serve as leading compounds in the subsequent development of anti-cancer drugs for colon cancer, and the leading compound has an inhibitory effect on the function of the leucine zipper protein or a specific fragment thereof. By modifying and optimizing the structure so that it can be expressed, a new treatment for colon cancer can be developed.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

[Experimental materials and experimental methods]

One. ingredient

RPMI 1640 and DMEM media were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Fetal bovine serum (FBS) was obtained from HyClone Laboratories (Logan, UT, USA). Myco-Guard™ was purchased from Biomax (Seoul, Korea). Mouse monoclonal antibodies recognizing β-actin, α-tubulin, p62/SQSTM1, and green fluorescent protein (GFP) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit monoclonal antibodies against LC3, PARP, Keap1, Nrf2, and cleaved capase-3, and mouse monoclonal NQO1 antibody were obtained from Cell Signaling Technology (Danvers, MA, USA). Rabbit polyclonal Lamin A/C antibody was purchased from GenScript Biotech (Piscataway, NJ, USA). Rabbit polyclonal CREB3 antibody was purchased from Proteintech (Catalog number. 11275-1-AP, Chicago, IL, USA). Rabbit polyclonal CREB3 antibody was used to quantify the expression and amount of sLZIP. Mouse monoclonal Flag-M2 antibody, rabbit polyclonal LC3B antibody, 3-bromopyruvate, bafilomycin A1, brefeldin A, dithiothreitol, hydrogen peroxide solution, thapsigargin, and tunicamycin were from Millipore Sigma ( Burlington, MA, USA). Human small interfering RNA for sLZIP (si-sLZIP) was obtained from GenePharma (Shanghai, China). Specifically, the si-sLZIP consisted of the base sequence 5'-CCAGAUGACUCCACAGCAU-3' (SEQ ID NO: 3).

2. Methods for cell culture, transfection, and stable cell line generation

HCT116, LoVo, SW620, and HEK 293 cells were purchased from ATCC (Manassas, VA, USA). HCT116 and SW620 cells were grown in RPMI 1640 medium. LoVo cells were grown in F12K medium and HEK 293 cells were grown in DMEM. All cell lines were grown in medium containing 10% FBS, 1% penicillin/streptomycin, and mycoplasma removal reagent. Cells were transfected with plasmids using E-fection Plus (Lugen Sci, Seoul, South Korea). Cells were transfected with siRNA using Interferin (Polyplus, New York, NY, USA). To establish sLZIP-overexpressing stable cell lines, HCT116 cells were infected with cLV-CMV-CopGFP or cLV-CMV-3xFlag-sLZIP. After 48 h of infection, the culture medium was replaced and stable populations were selected using 2 μg/ml puromycin. To establish sLZIP-knockout cell lines using the CRISPR/Cas9 system, HCT116 cells were transfected with pRGEN-Cas9-CMV or pRGEN-sgRNA (ToolGen Inc., Seoul, South Korea). Stable populations were selected using 2 μg/ml puromycin. Here, the target sequence of sgRNA in the CRISPR/Cas9 system is CCCAGCGTCGTTGAACATTCTCA among the base sequences encoding sLZIP represented by SEQ ID NO: 2.

3. RNA isolation and quantitative RT-PCR

Total RNA was isolated using the MiniBEST Universal RNA Extraction Kit (Takara, Shiga, Japan), and cDNA was synthesized from total RNA using PrimeScript™ RT Master Mix (Takara, Shiga, Japan). cDNA samples were analyzed in triplicate using EvaGreen Express 2x qPCR Master Mix (Applied Biological Materials) on a QuantStudio3 real-time PCR instrument (Applied Biosystems, Foster City, CA, USA). The primers shown in Tables 1 and 2 below were used for qPCR and semi-qPCR analysis, respectively.

The primer sequences used for qPCR mRNA Primer sequence MAP1LC3B F: AGCAGCATCCAACCAAAATC R: CTGTGTCCGTTTCACCAACAG ATG3 F: GTTGGAAACAGATGAGGCTACC R: TAGCCAAACAACCATAATCGTG ATG4B F: ACTGGGAAGATGGACGCAG R: AGTATCCAAACGGGCTCTGA ATG5 F: GAAAGGGAAGCAGAACCATACTATTTG R: TCAGTGTGTGCCTTCATATTCA BECN1 F: GGAGAGGAGCCATTTATTGAAA R: AGAGTGAAGCTGTTGGCACTTT ATG7 F: AAGCAAGAGAAAGCTGGTCATC R: AGTAGCAGCCAAGCTTGTAACC ATG10 F: CTGAAGGACATATGGGAAGGAG R: GAGGTAGATTCAGCCCAACAAC NQO1 F: AAGAGCACTGATCGTACTGGC R: GGATACTGAAAGTTCGCAGGG CHOP F: ACCAAGGGAGAACCAGGAAACG R: TCACCATTCGGTCAATCAGAGC GSTM1 F: TTCCAATCTGCCCTACTTG R:GGTTGTCCATGGTCTGGTTC HMOX1 F: CCATAGGCTCCTTCCTCCTTTC R: GGCCTTTCTTTCTAGAGAGGGAATT SQSTM1 F: ATCGGAGGATCCGAGTGT R: TGGCTGTGAGCTGCTCTT sLZIP F: AGCAGCAGCATGTACTCCTCT R:AGGCAGCTCCAGCTGGTAAG β-Actin F: AGCGAGCATCCCCCAAAGTT R: GGGCACGAAGGCTCATCATT

The primer sequences used for semi-qPCR mRNA Primer sequence MAP1LC3B F:TCGGAGAAGACCTTCAAGCA R: GGCATAGACCATGTACAGGA BECN1 F: CCAGGATGGTGTCTCTCGCA R: CTGCGTCTGGGCATAACGCA ATG5 F: AGCAACTCTGGATGGGATTG R: CACTGCAGAGTGTTTCCAA XBP-1 F:AAACAGAGTAGCAGCTCAGACTGC R:TCCTTCTGGGTAGACCTCTGGGAG sLZIP F: AGCAGCAGCATGTACTCCTCT R: CTAGCCTGAGTATCTGTCCT β-Actin F: AGCGAGCATCCCCCAAAGTT R: GGGCACGAAGGCTCATCATT

4. Western blot analysis method

Cells were lysed in RIPA buffer for 20 min on ice and centrifuged at 12,000 x g for 20 min at 4˚C. Proteins were probed with specific primary antibodies overnight at 4˚C. Blots were incubated with secondary antibodies for 1 hour at 25˚C. Immune complexes were detected using the West Save Gold western blot detection kit (YoungIn Frontier, Seoul, South Korea).

5. Cell fractionation method

Cells were lysed with cytoplasmic lysis buffer (10mM NaCl HEPES buffer) for 30 min on ice. Cell lysates were centrifuged at 2,000 x g for 20 min at 4˚C to separate cells and cytosolic proteins. The supernatant contains cytosolic proteins. The pellet was dissolved in RIPA buffer and centrifuged at 12,000 x g for 20 minutes at 4˚C, and the fractionated samples were subjected to Western blot analysis.

6. Chromatin immunoprecipitation assay

For ChIP analysis, cells were fixed with formaldehyde and rotated at 25˚C for 15 min. Glycine was added to the medium to a final concentration of 125mM and incubated at 25˚C for 5 minutes with shaking. Chromatin samples were coimmunoprecipitated with protein A/G beads, 5 μg of anti-IgG, and anti-GST antibodies. Samples were treated with 5 μl of proteinase K (20 mg/ml) at 65˚C for 18 h, followed by phenol/chloroform extraction. For ChIP analysis, the primers listed in Table 3 below were used.

Target site Primer sequence CRE
(-267/+11 bp) F: CCCACAACCGTCACCTCA R:AATCCGACTCTGGCGATAGC

7. Luciferase activity assay

For luciferase analysis, the human LC3 promoter was isolated from human genomic DNA. The promoter region was inserted into the pGL4.21 plasmid vector (Promega, Madison, WI, USA). Luciferase activity assay was performed using the Dual-Luciferase Reporter Assay system (Promega). Luciferase activity was measured using Luminometer 20/20n (Turner BioSystems, Sunnyvale, CA, USA) according to the manufacturer's protocol.

8. Immunofluorescence microscopy analysis

Cells were fixed with 4% paraformaldehyde for 10 min and permeabilized with solution I (0.2% Triton-X 100 and 1% BSA) for 15 min at 25°C. Cells were incubated with solution II (1% BSA in PBS) containing anti-LC3 antibody for 24 hours at 4˚C. After washing twice with PBS, cells were incubated with Alexa 488 or 594-conjugated antibodies for 2 h at 25˚C. Cells were imaged using an LSM 700 confocal microscope (Carl Zeiss, Jena, Germany).

9. Cell viability and colony formation assay

To analyze cell viability, Quanti-MAXTM Cell Viability Assay Kit (BIOMAX, Seoul, South Korea) was used according to the manufacturer's instructions. After incubating Quanti-MAXTM reagent with cells for 30 minutes, absorbance was measured at 450 nm using a microplate reader (Molecular Devices, San Jose, CA, USA). For colony formation assay, cells were seeded in 12-well plates and incubated for 5 days. Colonies were fixed with 4% paraformaldehyde at 25˚C and stained using 0.05% crystal violet (Millipore Sigma, Burlington, MA, USA).

10. Oxygen consumption rate measurement

HCT116 cells were seeded in 24-well plates, and the medium was replaced with Seahorse assay medium (Agilent Technologies, Santa Clara, CA, USA). OCR was measured using a Seahorse XF24 analyzer (Agilent Technologies), and data were analyzed using Seahorse Wave.

11. Cell death assay

Apoptotic cells were quantified using the Annexin V apoptosis detection kit (BD Biosciences, San Jose, CA, USA). Briefly, cells were washed with PBS and mixed with binding buffer, Annexin V, and propidium iodide (PI). Killed populations were analyzed within 1 hour using flow cytometry (BD Biosciences).

12. ATP and α-ketoglutarate measurements

Cells were cultured in complete medium or glutamine-free medium for 24 hours. Before measuring cellular components, cells were homogenized with the assay buffer provided with each kit and samples were deproteinized using a 10 kDa molecular weight cutoff spin column (BioVision, Milpitas, CA, USA). Intracellular ATP levels were measured using a colorimetric ATP Assay Kit (BIOMAX, Seoul, South Korea). The concentration of α-KG was measured using a colorimetric α-KG assay kit (BioVision, Milpitas, CA, USA). Absorbance was measured at 570 nm using a microplate reader (Molecular Devices, San Jose, CA, USA).

13. Animal testing methods

Six-week-old male BALB/c nude mice were purchased from ORIENT BIO Animal Center (Seongnam, Korea) and maintained under specific pathogen-free conditions under a 12-h light/dark cycle. The animal study protocol was approved by the Animal Care Committee of Korea University Animal Research Institute. Animal experiments were performed in accordance with the Guide for Use and Care of Laboratory Animals. For the xenograft model, nude mice were subcutaneously inoculated with control or sg-sLZIP stable cells (5 x 10 ⁶ ) in 100 μl of PBS. When the tumor volume reached 100 mm ³ , 3-BP (2 mg/kg/day) was injected intraperitoneally into the mice for 12 days. Tumor volume was measured with digital calipers every 3 days (tumor volume = 0.5 × length × width ² ). After the final drug administration, all mice were killed immediately and dissected for tumor isolation and tumor weight measurement.

14. database analysis

Microarray results from CRC patient samples were obtained from the Gene Expression Omnibus Database (GEO Access number GSE25071; National Center for Biotechnology Information, Bethesda, MD, USA; https://www.ncbi.nlm.nih.gov/geo/).

15. tissue microarray

Human colon tumors and adjacent normal colon tissues were obtained from SuperBioChips Laboratories (Seoul, Korea). Human colon tissue microarray slides containing 40 carcinomas, 10 metastatic carcinomas, and 9 normal tissue specimens were used for IHC staining for IHC-validated specific CREB3 and LC3B antibodies. IHC results were analyzed by calculating the ratio of positive staining area to total tissue area.

[Experiment result]

[Example] Identification of the role of small leucine zipper protein in colon cancer diagnosis and treatment

Example 1. Metabolic stress due to nutrient deficiency confirmed induction of sLZIP expression

Cancer cells proliferate much faster than normal cells, so they do not receive enough nutrients for cell growth. To overcome this tumor microenvironment, cancer cells increase the expression of oncogenes and undergo rapid metabolic reprogramming and redistribution of metabolites through signaling mechanisms. These metabolic characteristics of cancer cells allow them to develop into malignant cancers that acquire drug resistance by acquiring rapid metabolic flexibility after anti-cancer treatment using metabolic inhibition.

As a result of examining changes in the expression of sLZIP in an environment lacking glucose and glutamine, the main energy sources of cells, we found that metabolic stress due to nutrient deficiency induced sLZIP transcription and protein expression in colon cancer cell lines (Figures 1A-C). sLZIP increases the expression of LC3B, a key gene involved in the autophagy mechanism in colon cancer cells (Figure 1D).

In addition, we observed that the amount of LC3B mRNA was regulated in proportion to the amount of sLZIP expression (Figure 1E), and as a result, sLZIP regulated LC3 protein expression (Figure 1F).

Example 2. sLZIP acts as a transcription factor and confirms direct transcriptional induction of LC3

We observed that the activity of the promoter near LC3 was induced by increased sLZIP expression (Figure 2A), and that the LC3 promoter activity increased by nutrient deficiency stress was suppressed by decreased sLZIP expression (Figure 2B). When we examined the region affected by sLZIP by dividing the promoter near LC3 into several lengths, we found that the promoter region closest to the transcription start site and containing two CREB binding sequences was regulated (Figure 2C).

We observed that sLZIP directly bound to the nearby promoter of the LC3 gene (Figure 2D), and sLZIP regulated LC3 promoter activity through the CRE sequence at positions -66/-58 (Figure 2E). These results show that the sLZIP gene is an important transcription factor directly involved in the expression of LC3 in colon cancer cells.

Example 3. Confirmation of relationship between increased LC3 expression by sLZIP and autophagy mechanism

Since LC3 is a major protein that forms autophagosomes, we investigated whether increasing LC3 expression by sLZIP affects the autophagy mechanism. In a nutrient-poor environment, the autophagy mechanism of colon cancer cell lines was activated, and it was observed that sLZIP increased both LC3-I and LC3-II (Figure 3A). As a result, it was confirmed that overexpression of sLZIP promotes autophagosome formation under metabolic stress conditions (Figure 3B-C).

Since activation of the intracellular autophagy mechanism means that the degradation of materials inside the autophagosome is promoted, changes in the amount of p62 protein, which is used as a degradation marker, were observed. Under nutrient starvation conditions, autophagy flux was observed to be promoted by overexpression of sLZIP, as the expression of LC3 protein increased and the amount of p62 protein decreased (Figure 3D). In addition, it was confirmed by treatment with bafilomycin A1, a lysosomal inhibitor, that the decrease in p62 protein amount was due to degradation by autophagosomes (Figure 3E). Accordingly, colon cancer cells with reduced sLZIP expression exhibited relatively increased apoptosis due to nutrient deficiency stress (Figure 3F-G). This confirms that sLZIP is a gene that regulates the autophagy mechanism of cancer cells and inhibits apoptosis in a nutrient-deficient environment.

Example 4. Confirmation of induction of metabolic reprogramming that promotes mitochondrial respiration through autophagy activation of sLZIP.

In a nutrient-deficient environment, cancer cells produce metabolic intermediates and maintain ATP supply through activation of the autophagy mechanism. Among the amino acids produced by autophagosome degradation, glutamine can be converted to α-ketoglutarate (α-KG), an intermediate in the mitochondrial metabolic process, to produce ATP. To confirm the dependence of colon cancer cells on glutamine, cells were cultured in glutamine-deficient medium. As a result, it was confirmed that the concentration of α-KG decreased by about 80% and the ATP concentration decreased by about 30% (Figure 4A). In colon cancer cell lines overexpressing sLZIP, glutamine depletion activated autophagy, and autophagy flux was enhanced by sLZIP overexpression (Figure 4B). To confirm the effect of overexpression of sLZIP on metabolism, when mitochondrial metabolism of cells was measured by oxygen consumption rate (OCR), a correlation between sLZIP expression and OCR was observed (Figure 4C-D). Based on the OCR measurement results, it was observed that OCR associated with ATP production increased due to increased sLZIP expression (Figure 4E). On the other hand, it was confirmed that sLZIP did not affect the ratio of oxygen used for ATP production (Figure 4F). . Since sLZIP induces metabolic reprogramming that increases mitochondrial metabolism, the decrease in α-KG concentration caused by glutamine-deficient medium was alleviated by about 45% in colon cancer cells with reduced expression of sLZIP, and as a result, ATP concentration was complemented by about 20% ( Figure 4G). This means that sLZIP increases LC3 expression in colon cancer cells, activating the autophagy mechanism and inducing metabolic reprogramming that promotes mitochondrial metabolism through glutamine supply.

Example 5. Confirmation of relationship between regulation of redox homeostasis through autophagy activation of sLZIP.

It is known that when nutrient supply is not smooth or intracellular metabolic mechanisms are inhibited, the concentration of active oxygen increases and redox homeostasis is impaired, which causes cell death. The autophagy mechanism activated by metabolic stress decomposes Keap1 protein into autophagosomes, thereby increasing the expression of downstream genes of Nrf2 and alleviating free radicals. It was confirmed that sLZIP increases Keap1 degradation through autophagosomes in an environment lacking glutamine (Figure 5A), and accordingly, nuclear movement of Nrf2 protein was confirmed to increase by overexpression of sLZIP (Figure 5B). As a result, the transcription of NQO1, CHOP, and SQSTM1 (p62), known as downstream genes of Nrf2, was significantly increased (Figure 5C-D), and protein expression of p62 and NQO1 was increased (Figure 5E). When treated with ascorbic acid, which is known to inhibit the nuclear movement of Nrf2, NQO1 protein expression, which was increased by sLZIP overexpression, was decreased, confirming that sLZIP regulates the expression of NQO1 through Nrf2 (Figure 5G).

By confirming that sLZIP regulates the Keap1-Nrf2 mechanism, which is important in controlling reactive oxygen species, by promoting autophagy, it was observed that cell survival rate was significantly increased when exposed to hydrogen peroxide (H ₂ O ₂ ) (Figure 5H). Additionally, cleavage of PARP and caspase-3 proteins involved in apoptosis was reduced in sLZIP overexpressing cell lines under hydrogen peroxide treatment (Figure 5I). These results show that autophagy activation by overexpression of sLZIP in colon cancer cells is important for controlling the reactive oxygen species regulation mechanism and suppressing reactive oxygen species-induced apoptosis.

Example 6. Confirmation of inhibition of sLZIP expression and inhibition of apoptosis and proliferation of colon cancer cells

Cancer cells have the characteristic of excessively utilizing glucose metabolism through glycolysis regardless of the presence or absence of oxygen. When colon cancer cells were cultured in medium containing a low concentration of glucose, sLZIP increased the formation of autophagosomes (Figure 6A-B), and cells with suppressed sLZIP expression suffered apoptosis that occurred in a glucose-deficient environment. It was observed that it increased further (Figure 6C-D).

Since cancer cells use glucose metabolism through glycolysis as their main energy production method, metabolic anti-cancer drugs to suppress this are attracting attention. However, the method of suppressing glucose metabolism causes metabolic stress on cancer cells, resulting in the side effect of activating the autophagy mechanism. When 3-bromopyruvate (3-BP) was treated to inhibit the hexokinase enzyme that acts at the beginning of glycolysis, the autophagy mechanism was activated in proportion to the treatment time (Figure 6E). It was confirmed that the colon cancer cell line in which sLZIP gene expression was suppressed using CRISPR/Cas9 had low LC3 expression, so autophagy activation by 3-BP treatment was not smooth and cell death by 3-BP increased (Figure 6F). Therefore, it was confirmed that reducing sLZIP expression effectively inhibits colon cancer cell proliferation under conditions of glycolysis inhibition caused by 3-BP (Figure 6G). Inhibition of colon cancer cell proliferation due to decreased sLZIP expression was significantly alleviated when LC3, a downstream gene of sLZIP, was overexpressed (Figure 6H), and at the same time, the amount of cleaved PARP protein involved in apoptosis was also decreased (Figure 6I). This indicates that inhibition of sLZIP expression has the effect of preventing activation of the autophagy mechanism and inhibiting cell proliferation in situations where cancer cell metabolism is inhibited by anti-cancer drugs.

In addition, because inhibition of sLZIP expression in colon cancer cell lines increased sensitivity to drugs that inhibit glycolysis, animal experiments using mice were also conducted to confirm whether tumor growth was inhibited. When a colon cancer cell line in which sLZIP expression was suppressed was injected subcutaneously to form a tumor and treated with 3-BP by intraperitoneal injection, the tumor in the control group grew, while the size of the sLZIP knockout tumor did not increase (Figure 7A-B). Tumors were isolated from mice on the 20th day of tumor formation, and the weight of the tumors showed a significant difference. It was confirmed that this animal experiment was conducted under conditions that did not cause changes in individual weight due to tumor formation or treatment with metabolic inhibitors (Figure 7C- E). These experimental results demonstrated that suppressing the expression of sLZIP is important for increasing sensitivity to anticancer drugs and suppressing tumor growth when treating colon cancer with anticancer drugs.

As a result of comparing the gene expression of 46 colon cancer patients with normal tissues, the expression of the CREB3 gene, which includes sLZIP, was high in colon cancer patients, and a significant correlation was shown in patients with high disease stages (Figure 7F). Additionally, when analyzing 25 male colon cancer patients, it was found that CREB3 and LC3B genes were highly expressed in stage III and IV colon cancer patients (Figure 7G).

Example 7. CREB3 and LC3 protein expression is high in colon cancer patients compared to normal tissues.

As a result of examining CREB3 and LC3B protein expression in 40 colon cancer patient tissues using immunohistochemical staining, protein expression was higher than that in normal tissues, and strong staining of CREB3 and LC3B proteins was also observed in liver metastasis tissue derived from colon cancer. (Figure 8A). Additionally, when comparing protein expression patterns in tissues from the same patient, CREB3 and LC3B showed similar expression distribution patterns (Figure 8B). As a result of quantifying the degree of tissue immunostaining, it was found that CREB3 and LC3B protein staining in colorectal cancer patients was significantly higher than normal, and a statistical correlation was shown as the cancer development stage increased (Figure 8C-D). These results mean that CREB3 and LC3B proteins can be candidate proteins for tissue immunostaining for clinicopathological diagnosis and developmental stage differentiation of colon cancer.

<110> Korea University Research and Business Foundation <120> Use of leucine-zipper protein for diagnosing or treating cancer <130>P22U13C0203 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 354 <212> PRT <213> Artificial Sequence <220> <223> sLZIP <400> 1 Met Glu Leu Glu Leu Asp Ala Gly Asp Gln Asp Leu Leu Ala Phe Leu 1 5 10 15 Leu Glu Glu Ser Gly Asp Leu Gly Thr Ala Pro Asp Glu Ala Val Arg 20 25 30 Ala Pro Leu Asp Trp Ala Leu Pro Leu Ser Glu Val Pro Ser Asp Trp 35 40 45 Glu Val Asp Asp Leu Leu Cys Ser Leu Leu Ser Pro Pro Pro Ala Ser Leu 50 55 60 Asn Ile Leu Ser Ser Ser Asn Pro Cys Leu Val His His Asp His Thr 65 70 75 80 Tyr Ser Leu Pro Arg Glu Thr Val Ser Met Asp Leu Glu Ser Glu Ser 85 90 95 Cys Arg Lys Glu Gly Thr Gln Met Thr Pro Gln His Met Glu Glu Leu 100 105 110 Ala Glu Gln Glu Ile Ala Arg Leu Val Leu Thr Asp Glu Glu Lys Ser 115 120 125 Leu Leu Glu Lys Glu Gly Leu Ile Leu Pro Glu Thr Leu Pro Leu Thr 130 135 140 Lys Thr Glu Glu Gln Ile Leu Lys Arg Val Arg Arg Lys Ile Arg Asn 145 150 155 160 Lys Arg Ser Ala Gln Glu Ser Arg Arg Lys Lys Lys Val Tyr Val Gly 165 170 175 Gly Leu Glu Ser Arg Val Leu Lys Tyr Thr Ala Gln Asn Met Glu Leu 180 185 190 Gln Asn Lys Val Gln Leu Leu Glu Glu Gln Asn Leu Ser Leu Leu Asp 195 200 205 Gln Leu Arg Lys Leu Gln Ala Met Val Ile Glu Ile Ser Asn Lys Thr 210 215 220 Ser Ser Ser Ser Met Tyr Ser Ser Asp Thr Arg Gly Ser Leu Pro Ala 225 230 235 240 Glu His Gly Val Leu Ser Arg Gln Leu Arg Ala Leu Pro Ser Glu Asp 245 250 255 Pro Tyr Gln Leu Glu Leu Pro Ala Leu Gln Ser Glu Val Pro Lys Asp 260 265 270 Ser Thr His Gln Trp Leu Asp Gly Ser Asp Cys Val Leu Gln Ala Pro 275 280 285 Gly Asn Thr Ser Cys Leu Leu His Tyr Met Pro Gln Ala Pro Ser Ala 290 295 300 Glu Pro Pro Leu Glu Trp Pro Phe Pro Asp Leu Phe Ser Glu Pro Leu 305 310 315 320 Cys Arg Gly Pro Ile Leu Pro Leu Gln Ala Asn Leu Thr Arg Lys Gly 325 330 335 Gly Trp Leu Pro Thr Gly Ser Pro Ser Val Ile Leu Gln Asp Arg Tyr 340 345 350 Ser Gly <210> 2 <211> 1062 <212> DNA <213> Artificial Sequence <220> <223> sLZIP <400> 2 atggagctgg aattggatgc tggtgaccaa gacctgctgg ccttcctgct agaggaaagt 60 ggagatttgg ggacggcacc cgatgaggcc gtgagggccc cactggactg ggcgctgccg 120 ctttctgagg taccgagcga ctgggaagta gatgatttgc tgtgctccct gctgagtccc 180 ccagcgtcgt tgaacattct cagctcctcc aacccctgcc ttgtccacca tgaccacacc 240 tactccctcc cacgggaaac tgtctccatg gatctagaga gtgagagctg tagaaaagag 300 gggacccaga tgactccaca gcatatggag gagctggcag agcaggagat tgctaggcta 360 gtactgacag atgaggagaa gagtctattg gagaaggagg ggcttattct gcctgagaca 420 cttcctctca ctaagacaga ggaacaaatt ctgaaacgtg tgcggaggaa gattcgaaat 480 aaaagatctg ctcaagagag ccgcaggaaa aagaaggtgt atgttggggg tttagagagc 540 agggtcttga aatacacagc ccagaatatg gagcttcaga acaaagtaca gcttctggag 600 gaacagaatt tgtcccttct agatcaactg aggaaactcc aggccatggt gattgagata 660 tcaaaacaaaa ccagcagcag cagcatgtac tcctctgaca caagggggag cctgccagct 720 gagcatggag tgttgtcccg ccagcttcgt gccctcccca gtgaggaccc ttaccagctg 780 gagctgcctg ccctgcagtc agaagtgccg aaagacagca cacaccagtg gttggacggc 840 tcagactgtg tactccaggc ccctggcaac acttcctgcc tgctgcatta catgcctcag 900 gctcccagtg cagagcctcc cctggagtgg ccattccctg acctcttctc agagcctctc 960 tgccgaggtc ccatcctccc cctgcaggca aatctcacaa ggaagggagg atggcttcct 1020 actggtagcc cctctgtcat tttgcaggac agatactcag gc 1062 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> si-sLZIP <400> 3 ccagaugacu ccacagcau 19

Claims (10)

A pharmaceutical composition for improving or treating colon cancer, comprising an inhibitor of the activity of small leucine-zipper protein or an inhibitor of the expression of a gene encoding the protein.
The method of claim 1, wherein the gene expression inhibitor is an antisense nucleotide, short hairpin RNA (shRNA), or small interfering RNA (siRNA) that binds complementary to a gene encoding a small leucine zipper protein. and a pharmaceutical composition for improving or treating colon cancer, which is selected from the group consisting of gene scissors.
The method of claim 1, wherein the protein activity inhibitor is any one selected from the group consisting of peptides, peptide mimetics, substrate analogs, aptamers, and antibodies that specifically bind to small leucine zipper proteins. Pharmaceutical composition for improving or treating colon cancer.
The pharmaceutical composition for improving or treating colon cancer according to claim 1, wherein the small leucine-zipper protein contains the amino acid sequence of SEQ ID NO: 1.
The pharmaceutical composition for improving or treating colon cancer according to claim 1, wherein the composition inhibits autophagy of colon cancer cells in a nutrient-deficient state.
A composition for diagnosing colon cancer, comprising a probe for measuring the activity of a small leucine-zipper protein or the expression level of a gene encoding the protein.
The method of claim 6, wherein the probe is an antibody that specifically binds to the small leucine zipper protein; Or a composition for diagnosing colon cancer, which is a nucleic acid probe or primer that binds complementary to the gene encoding the small leucine zipper protein.
The composition for diagnosing colon cancer according to claim 6, wherein the small leucine zipper protein contains the amino acid sequence of SEQ ID NO: 1.
It includes treating cells or tissues isolated from an individual with a candidate material and measuring the expression level of small leucine zipper protein in the cells or tissues,
A screening method for a drug for the improvement or treatment of colon cancer, wherein the candidate substance is identified as a drug for the improvement or treatment of colon cancer when it downregulates the expression of the small leucine zipper protein.
According to clause 9,
A method for screening a medicine for improving or treating colon cancer, wherein the small leucine zipper protein contains the amino acid sequence of SEQ ID NO: 1.