KR20120046968A - Method for selecting pigs with excellent shear force trait - Google Patents

Abstract

PURPOSE: A method for selecting pigs with excellent shear force trait is provided to obtain information for meat quality without killing pigs. CONSTITUTION: A method for providing information of pork meat quality comprises: a step of isolating nucleic acid molecules from pork; and a step of identifying base type of 61th nucleotide of a polynucleotide selected among a polynucleotide of sequence numbers 1-5 and complementary polynucleotide thereof. A method for selecting pigs with excellent shear force trait comprises: a step of isolating nucleic acid molecules from pork; and a step of identifying a base type of 61th nucleotide of a polynucleotide selected among a polynucleotide of sequence numbers 1-5 and complementary polynucleotide thereof.

Description

Method for selecting pigs with excellent shear force trait}

The present invention relates to a method for providing information on the quality of pigs and screening pigs having excellent shearing properties. More specifically, the polynucleotides represented by SEQ ID NOs 1 to 5 are isolated from nucleic acid molecules in pigs. And identifying a base type of the 61st nucleotide of at least one polynucleotide selected from the group consisting of polynucleotides complementary thereto, and providing a method for selecting a pig of a trait having excellent shearing force or providing information on the meat quality of the pig. will be.

The genomes of all organisms undergo spontaneous mutations that result in variants in the sequence of progeny during evolution (Gusella, Ann. Rev. Biochem. 55, 831-854, 1986). Variants may be evolutionarily beneficial or disadvantageous or neutral compared to progeny forms.

In some cases, variants may be fatally penalized and not passed on to their offspring. In other cases, it gives evolutionary benefit to the species, and eventually DNA is inserted into most of the species, effectively forming a ancestral form. In many cases, these ancestral forms and variants survive and coexist among species. By coexistence of plural forms of sequences, polymorphism occurs.

Such polymorphisms include restriction fragment length polymorphism (RFLP), short tandem repeats (STR), and single nucleotide polymorphism (SNP). Dual SNPs (monobase polymorphisms) take the form of single nucleotide variations between individuals of the same species. When SNPs occur in the coding region sequence, a defective or mutated protein may be expressed by any of the polymorphic forms. In other cases, SNPs may occur in the non-coding region sequence. Some of these may result in the expression of defective or mutated proteins (eg, as a result of defective splicing). Some SNPs may have no effect on the phenotype.

If these SNPs affect the phenotype, the polynucleotides comprising the single base polymorph can be used as primers or probes to provide information about the phenotype or to select good phenotypes. Currently, several research institutes are conducting research on single base analysis and its functional analysis.

The quality of meat is finally determined by consumers, and in recent years, consumers 'tastes have also diversified with the rapid increase in meat consumption due to the improvement of consumers' living standards. Therefore, the goal of pig improvement is changing from meat-based improvement to meat quality for producing high quality pork, and the improvement of meat quality to meet the various needs of consumers is an important factor in the modern pig industry. have.

Factors affecting meat quality include year, conservatism, meat color, texture, post-pH change, and shear force, and most of these meat traits are not easy to obtain phenotypic results because traits can only be measured by slaughter. Economically expensive. Particularly, in order to select good breeding traits, it is necessary to obtain information on the traits of the livestock without harming the livestock, since the livestock must be kept healthy and obtain information on the traits. .

As one of these means, the discovery of genes related to traits and researches on the relationship between SNPs and traits are being actively conducted. Until now, some genes or markers have been used in the pig industry, but their utilization is insufficient.

Therefore, as a means of obtaining information on the traits of livestock without harming the livestock, it is necessary to discover SNPs that are closely related to the traits for various traits of the livestock.

The present inventors completed the present invention by finding out that a specific SNP is related to the shear force of a pig while studying a method of obtaining information on various traits of pigs in order to select pigs having excellent traits as pigs.

Therefore, the object of the present invention

(a) isolating a nucleic acid molecule of a pig and

(b) identifying the base type of the 61st nucleotide of the at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides thereof from the isolated swine nucleic acid molecule; It is to provide a way to provide information about the meat quality of pigs.

Another object of the present invention

(a) isolating a nucleic acid molecule of a pig and

(b) identifying the base type of the 61st nucleotide of the at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides thereof from the isolated swine nucleic acid molecule; It is to provide a method for screening pigs of traits having excellent shearing force.

Another object of the present invention is a polynucleotide represented by SEQ ID NO: 1 to 5 and a polynucleotide consisting of 10 to 120 consecutive bases, each containing the 61st nucleotide in one or more polynucleotides selected from the group consisting of It is to provide a gene chip (chip) comprising a nucleotide.

The present invention to achieve the above object

(a) isolating a nucleic acid molecule of a pig and

(b) identifying the base type of the 61st nucleotide of at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides thereof from the isolated swine nucleic acid molecule; Provides a way to provide information about the quality of pork.

In order to achieve the other object of the present invention,

(a) isolating a nucleic acid molecule of a pig and

(b) identifying the base type of the 61st nucleotide of the at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides thereof from the isolated swine nucleic acid molecule; Provided are methods for screening pigs of traits with good shearing power.

In order to achieve another object of the present invention, the present invention comprises 10 to 120 nucleotides each of at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and polynucleotides complementary thereto; Provided is a genetic chip comprising a polynucleotide consisting of consecutive bases.

Hereinafter, the present invention will be described in detail.

The present invention is (a) isolating a nucleic acid molecule of a pig and (b) at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NO: 1 to 5 and a polynucleotide complementary thereto from the isolated nucleic acid molecule of the pig Provided is a method of providing information on the meat quality of a pig, including the step of identifying the base type of the 61st nucleotide of the nucleotide, and a method of selecting a pig of a trait having excellent shearing force.

The method of the present invention applies to swine (Sus scrofa) and includes all breeds of pigs used for food. For example, the pig of the present invention may be a Korean native pig, Landrace, Yorkshire, Berkshire, Hampshire and their hybrids. Preferably, it may be F2 of the reference herb constructed by hybridizing Korean native pigs and land race breeds.

In step (a), the nucleic acid molecules of the pig are separated from the pig.

Nucleic acid molecules of the present invention include all genomic DNA, cDNA and RNA molecules, the nucleotides constituting the nucleic acid molecule also includes common nucleotides in nature and analogues in which sugar or base sites are modified.

Nucleic acid molecules of the present invention can be obtained from various tissues of pigs. The tissue from which the nucleic acid molecule can be obtained may be obtained from, for example, muscle, epidermis, blood, bone, or organ tissue, and preferably from muscle or blood. Separation of the nucleic acid molecule of the present invention from pigs can be separated by methods known in the art.

For example, it can be done by directly purifying DNA from tissue or cells or by specifically amplifying and isolating a specific region using an amplification method such as PCR.

In step (b), the base type of the 61st nucleotide of the at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides is identified from the isolated swine nucleic acid molecule.

The base types of SEQ ID NOs 1 to 5 and the 61st nucleotide of the complementary polynucleotide are highly related to the shear force trait of swine.

The inventors have found for the first time that the 61st nucleotide of the polynucleotide represented by SEQ ID NOs: 1 to 5 is highly related to the shear force trait of pigs.

Shear force generally refers to a force acting in parallel along a surface, or to a shearing force, so that the same size and direction are opposite to a surface in the object, and the shear force in the present invention refers to the force felt when chewing pork. The age of the meat is measured and displayed mechanically. In general, pigs are measured by taking a fillet in a semiconductor state.

In an embodiment of the present invention, the DNA of 551 pigs was extracted, and the base type of the 61st nucleotide of the polynucleotide represented by SEQ ID NOs: 1 to 5 of the present invention was examined and compared with the shear force information of the corresponding pig. The change in shear force with the base type was quantified.

As a result, as shown in Table 1, it was confirmed that the base type of the 61st nucleotide of the polynucleotide represented by SEQ ID NOs: 1 to 5 was related to the shear force, and the degree of shear force was excellent according to the type.

Information on the shear force and quality of the 61st nucleotide of the polynucleotides of SEQ ID NOS: 1-5 SEQ ID NO: Possible basetype of the 61st nucleotide Shear Force and Relationship to Meat Quality Influence Figure One A + -2.96 G - 2 A + -2.9 G - 3 T + -2.39 C - 4 T + -2.6 C - 5 T + -2.6 C -

In the above table, + means that the shear force is superior to the corresponding influence value compared to the case of having the base type indicated by-when the base type.

For example, the sequence number 1 was obtained by regression analysis of the additive effects of genes for AA, AG, and GG types. The influence value corresponds to the slope of the regression equation.

Thus, according to the method of the present invention, the nucleic acid molecule of the pig is separated from the isolated nucleic acid molecule of the pig, wherein the polynucleotide represented by SEQ ID NO: 1 to 5 and the polynucleotide complementary to the one or more polynucleotides selected from the 61st Checking the base type of the nucleotide can determine whether the pig's shear force trait is excellent, and the shear force is closely related to the meat quality, and as a result, information about the meat quality of the pig can be known. In addition, since pigs having a lot of positive relations with shearing force and meat quality have excellent shearing force, pigs having excellent shearing force can be selected.

In particular, the method of the present invention can know the meat quality without killing the pig, and can select sows having excellent shear force trait.

The method of identifying the base type of the nucleotide in step (b) may be by a method known in the art. Examples include, but are not limited to, direct sequencing of DNA, TaqMan assays, molecular beacon assays, allele-specific primer extensions (ASPEs), alleles- Specific PCR (AS-PCR), arrayed primer extension (APEX), homogeneous primer extension assays, pyrosequencing, restriction-fragment length polymorphism (RFLP), SBE-Tag assay (single base extension-tag assay), invader assay, ligation-rolling circle amplification (L-RCA) or DNA microarray (nucleotide microarray) method, such as can be confirmed.

The identification of such nucleotide base types is called single nucleotide polymorphism genotyping, and these SNP gene typing methods are described in Chen et al., “Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput”, Pharmacogenomics J. 2003; 3 (2): 77-96; Kwok et al., “Detection of single nucleotide polymorphisms”, Curr Issues Mol. Biol. 2003 April; 5 (2): 43-60; Shi, “Technologies for individual genotyping: detection of genetic polymorphisms in drug targets and endometriosis genes”, Am J Pharmacogenomics. 2002; 2 (3): 197-205; and Kwok, “Methods for genotyping single nucleotide polymorphisms” Annu Rev Genomes Hum Genet 2001; 2: 235-58. Examples of high-throughput SNP gene typing are described in Marnellos, “High-throughput SNP analysis for gene association studies. ”, Curr Opin Drug Discov Devel. 2003 May; 6 (3): 317-21.

Preferably, the method for identifying the base type of the nucleotide of the present invention may be a DNA microarray.

The DNA microarray method detects the formation of hybridized double strands by hybridizing a nucleic acid molecule as a sample to a DNA chip (DNA chip, gene chip) prepared to identify a base type of a specific nucleotide.

Therefore, the step of identifying the base type of step (b) of the present invention comprises the steps of: (i) from one or more polynucleotides selected from the group consisting of polynucleotides represented by SEQ ID NOS: 1 to 5 and complementary polynucleotides Hybridizing the nucleic acid molecules separated in step (a) to a DNA chip prepared to identify the base type of the 61st nucleotide, and (ii) detecting the formation of hybridized double strands. It may include.

A DNA chip is a small number of nucleic acids, such as DNA, DNA fragments, cDNAs, oligonucleotides, etc., that can serve as probes on small solid substrates made of glass, silicon, or nylon. It refers to a biological microchip that can detect the base type of the nucleotides contained in the sample DNA by attaching and arranged at regular intervals up to hundreds of thousands. The nucleic acids contained in the sample and the probes immobilized on the surface are combined to different degrees depending on the degree of complementarity of the nucleotide sequence to form a hybridization state. By simultaneously detecting and interpreting the information, the information on the nucleic acid contained in the sample can be obtained. Can be.

In analysis via DNA microarrays, the DNA chip of the invention comprises one or more probes complementary to a sequence comprising the nucleotide to be identified. The nucleotide to be identified refers to the polynucleotide represented by SEQ ID NO: 1 to 5 and the 61st nucleotide of the polynucleotide complementary thereto.

The hybridization signal of the sequence including the probe and the nucleotide to be identified is detected to directly determine whether the SNP variant is present. By probe is meant a linear oligomer having naturally occurring or modified monomers or bonds, including deoxyribonucleotides and ribonucleotides that can hybridize to a particular nucleotide sequence. The probe is preferably single stranded for optimal hybridization. The probe is preferably deoxy ribonucleotide. As the probe used in the present invention, a sequence that is perfectly complementary to a sequence including a nucleotide to be identified may be used, but a sequence that is substantially complementary to a range that does not prevent specific hybridization is used. May be

Preferably, the probe used in the present invention may include a polynucleotide represented by SEQ ID NO: 1 to 5 and a sequence capable of hybridizing to the 61 nucleotide of the polynucleotide complementary thereto. More preferably, the polynucleotide represented by SEQ ID NO: 1 to 5 and the polynucleotide complementary to the 61 nucleotide, and may be a polynucleotide consisting of 10 to 120 consecutive bases.

Hybridization refers to the formation of a hybrid by sequence-specific binding of two or more complementary base sequences rather than covalent bonds.

Conditions suitable for hybridization include Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC Decisions may be made with reference to those disclosed in (1985).

The formation of the hybridized double strand of step (ii) may be any known detection method used in the DNA microarray method, and may be, for example, laser fluorescence induction.

In addition, the polynucleotide represented by SEQ ID NO: 1 to 5 and at least one polynucleotide selected from the group consisting of polynucleotides consisting of 10 to 120 consecutive bases comprising the 61st nucleotide in the polynucleotide complementary thereto It provides a DNA chip (DNA chip).

The DNA chip of the present invention and the polynucleotide included in the DNA chip of the present invention are as described above.

The DNA chip of the present invention comprises a polynucleotide represented by SEQ ID Nos. 1 to 5 which is highly related to pork meat, in particular shear force, and a polynucleotide composed of 10 to 120 consecutive bases, including the 61st nucleotide in the polynucleotide complementary thereto. Since it includes one or more polynucleotides selected from the group consisting of can be used for pig selection with excellent meat quality and shearing force using the DNA microarray technique.

Therefore, as described above, the present invention provides a method for providing information on the meat quality of pigs and selecting pigs having excellent shear force. According to the method of the present invention, if only a small amount of nucleic acid molecules are obtained from a pig, it is possible to know the information about the meat quality of the pig and to select the pigs having excellent shearing properties, and in particular, the meat quality can be known without killing the pig. Sows with traits can be selected.

1 is a graph showing the chromosomal location of the SNPs and their p-values highly related to the shear force on the chromosome 14 of the pig.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

Genotyping

DNA was extracted from the blood of 551 pigs containing shearing force data using Wizard Genomic DNA Purification Kit (Promega, Madison, Wis., USA). Reference family is widely used to discover genes related to traits. The pigs used were F2 individuals of the reference herb, constructed by hybridizing Korean native pigs and land races. In the measurement, pigs were taken from a sirloin portion, which is generally used for meat analysis, in a semiconductor state after slaughter.

The shear force in this research group, and the lowest is 1.77kg / inch ^2, that is highest 9.3kg / inch ^2. The lower the shear force, the better the meat.

SNP genotyping was performed on the extracted DNA using iSelect Infinium Porcine ArrayChips (Illumina, San Diego, USA) consisting of 62,163 SNP information.

The analysis was performed using the Sentrix BeadChip Array 12-sample HD DNA Analysis BC Porcine SNP60 (Cat. No. WG-410-1001) from Illumina according to the kit's user manual. Chip Scan was performed using Illumina iScan ^TM System.

< Example  2>

Shear force  relation SNP  Excavation-Statistical Analysis

All SNP data obtained were tested using the R / SNPassoc package. Tests that did not match Hardy-Weinberg equilibrium (HWE) and minor allele frequency (MAF) to certain conditions (HWE: P <0.05, MAF: <10%) were excluded from the whole genome association analysis. It was. The association between the shear force phenotype and the SNP marker was tested by single marker regression analysis.

Significant SNPs were selected using an R-association package as shown in Equation 1 for the additive effect of each SNP marker on the shear force phenotype.

<Equation 1> y = Xb + Za + e

y is the phenotype vector for fixed effects (parts that have a fixed effect on analysis, such as sex and age), including gender and age at carcass, X is the incidence matrix for SNP, and b is a single SNP genotype. The regression coefficient vector for, Z is the connection matrix for the animal effect (random effects between objects), a is the vector for the individual effect, and e is the vector for the residual.

In order to find the optimal SNP combination related to the shear force among the significant SNPs selected through Equation 1, the multiple regression analysis including the first significant SNPs as an argument of the equation is performed using the ASReml program. Analyzes according to>.

<Equation 2> y = Xβ + Za + Zqi + e

y is a phenotype vector, β is a regression coefficient for fixed effects, a is a random animal effect, q is all significant SNPs (QTL) detected in Equation 1, and e is a random residual effect.

For statistical inference, Benjamini and Hochberg ("Controlling the false discovery rate: a practical and powerful approach to multiple testing" Journal of the Royal Statistical Society, Series B (Methodological) 57 (1): 289300) presented for complex hypothesis testing. One false discovery rate (FDR) was used for the calculations and all significant values were calculated at the 5% chromosome-wise FDR level.

As a result, as shown in [Table 2], five SNPs existing on chromosome 14 having significant shear force trait among 62,163 SNPs present on the total porcine genome were identified (chromosome-wise P <0.05).

In addition, as a result of measuring the relationship between the changes of the SNP and the shear force traits, it was confirmed that there is a significant relationship with the shear force traits as shown in [Table 3].

The estimated value in Table 3 is the value of the shear force that changes when the SNP changes.

The estimated values (impact values) in [Table 3] are obtained by regression analysis of the additive effects of genes on AA, AG, and GG types through genotyping of each individual (for example, SEQ ID NO: 1). Corresponds to the slope of.

SNP shown in SEQ ID NO: 1 of Chromosome No. 14 decreased AA by 2.96kg / inch2, which improved meat quality, compared with AA (the corresponding SNPs of two No. 14 homologous chromosomes A). Confirmed.

The SNP shown in SEQ ID NO: 2 decreases the shear force value by an average of 2.9 kg / inch ² as compared to the case of AA in GG, and the SNP shown in SEQ ID NO: 3 is 2.39 kg / inch ² compared to the case of CC in TT. SNPs shown in SEQ ID NOs: 4 and 5 were reduced by about 2.6kg / inch ² when compared to the case of TT, respectively, and confirmed that the meat quality was improved.

These genotypes can be used to predict the degree of shear force, which may be effective as a DNA marker for selection of shear force traits.

 Sequence information for each SNP SEQ ID NO: SNPs Sequence One H3GA0039311 TTTCGGTGCAGCACAGAGGGGACAGAGGGCTGTCAGATACCAGCTAGTAAGGAGGGCACC [A / G] TGGCCTGAGTCCACCCTTGGCAGCTGTGGACCCTGAGCTGTGTTTCAATTCCTTAGAACT 2 DRGA0013742 CAATTCACCTTTTGATGGGTATACAGATTGCTTTCAACAGTTAGCTATTATTTTAAATGC [A / G] GAATGAACACTCTTGTACACATCTCTTCATATCCATGGCTACGCTTTTATCTGGAGTGGA 3 ALGA0076426 CATGATGAATGGAGACATAGAAGGCAGAAAACCATGTCCCTGGGGCCCTTCCTGGATGCA [T / C] ACACATTAGCTCTCATTACTGCAAAGGAGATGTAGAAGCCACTGATGCAAATATGACCGC 4 ASGA0062904 GGGGACTCTCTGCCTTCTTGTTTCAGCTCTCATACTGTAAATAAGTCTCTCTCTCTCCTT [T / C] TTTTAAAATAACCCATAAAACAAGTCTTTTTGAGGTCTATTTAGTGCCATTTTTCCCCAT 5 ASGA0062910 ATGCTGAAACTGAGCCAATTCATCTGCATCCAATGGCAATTTTTGTCCTCCAAACTTTTC [T / C] AGACACACAGGCAGCTTAGTTGGTATTCAGGTGGTGGCTGTGCTTGCTGAGGTCATCCAG

In Table 1, the mark in [/] indicates the SNP that the base is mutually substituted. For example, [A / G] means that A is substituted with G, and the estimated value in Table 3 below is a numerical value of the change in shear force that changes when such substitution occurs.

 SNP Information Associated with Pig Shear Force SEQ ID NO: SNPs Chr Pos estimate p-value R2 One H3GA0039311 14 21542849 -2.96 6.21E-09 0.45 2 DRGA0013742 14 25763792 -2.9 1.01E-07 0.45 3 ALGA0076426 14 25823585 -2.39 6.66E-09 0.45 4 ASGA0062904 14 39291288 -2.6 1.05E-09 0.45 5 ASGA0062910 14 39392082 -2.6 1.12E-09 0.45

As described above, the present invention provides a method for providing information on the meat quality of pigs and selecting pigs having excellent shear force. According to the method of the present invention, if only a small amount of nucleic acid molecules are obtained from a pig, it is possible to know the information about the meat quality of the pig and to select the pigs having excellent shearing properties, and in particular, the meat quality can be known without killing the pig. It is possible to select sows with traits, which is highly industrially applicable.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Method for selecting pigs with excellent shear force trait <160> 5 <170> KopatentIn 1.71 <210> 1 <211> 121 <212> DNA <213> Sus scrofa <400> 1 tttcggtgca gcacagaggg gacagagggc tgtcagatac cagctagtaa ggagggcacc 60 rtggcctgag tccacccttg gcagctgtgg accctgagct gtgtttcaat tccttagaac 120 t 121 <210> 2 <211> 121 <212> DNA <213> Sus scrofa <400> 2 caattcacct tttgatgggt atacagattg ctttcaacag ttagctatta ttttaaatgc 60 rgaatgaaca ctcttgtaca catctcttca tatccatggc tacgctttta tctggagtgg 120 a 121 <210> 3 <211> 121 <212> DNA <213> Sus scrofa <400> 3 catgatgaat ggagacatag aaggcagaaa accatgtccc tggggccctt cctggatgca 60 yacacattag ctctcattac tgcaaaggag atgtagaagc cactgatgca aatatgaccg 120 c 121 <210> 4 <211> 121 <212> DNA <213> Sus scrofa <400> 4 ggggactctc tgccttcttg tttcagctct catactgtaa ataagtctct ctctctcctt 60 yttttaaaat aacccataaa acaagtcttt ttgaggtcta tttagtgcca tttttcccca 120 t 121 <210> 5 <211> 121 <212> DNA <213> Sus scrofa <400> 5 atgctgaaac tgagccaatt catctgcatc caatggcaat ttttgtcctc caaacttttc 60 yagacacaca ggcagcttag ttggtattca ggtggtggct gtgcttgctg aggtcatcca 120 g 121

Claims (5)

(a) isolating a nucleic acid molecule of a pig and
(b) identifying the base type of the 61st nucleotide of the at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides thereof from the isolated swine nucleic acid molecule; How to provide information about the quality of pork.
(a) isolating a nucleic acid molecule of a pig and
(b) identifying the base type of the 61st nucleotide of the at least one polynucleotide selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides thereof from the isolated swine nucleic acid molecule; How to select pigs of traits with excellent shear force.
According to claim 1 or 2, wherein the step of identifying the base type of step (b)
(i) a DNA chip (DNA) prepared to identify the base type of the 61st nucleotide of one or more polynucleotides selected from the group consisting of polynucleotides represented by SEQ ID NOs: 1 to 5 and complementary polynucleotides from swine nucleic acid molecules hybridizing the nucleic acid molecules separated in step (a) to the chip);
(ii) detecting the formation of hybridized double strands.
4. The group of claim 3, wherein the DNA chip comprises a polynucleotide represented by SEQ ID NOs: 1 to 5 and a polynucleotide comprising 61 to nucleotides in the polynucleotide complementary thereto and composed of 10 to 120 consecutive bases. A method comprising at least one polynucleotide selected from.
It comprises at least one polynucleotide selected from the group consisting of a polynucleotide represented by SEQ ID NO: 1 to 5 and a polynucleotide comprising a 61 to nucleotide in the polynucleotide complementary thereto and consisting of 10 to 120 consecutive bases DNA chip.

Images