KR20110037379A - Method and kit for detecting avellino corneal dystrophy using real-time pcr and high resolution melting analysis - Google Patents

Abstract

PURPOSE: A method for diagnosing avellino cornea dyslipidemia is provided to simply test the diseases using a sample for testing TGFBi gene codon 124 SNP. CONSTITUTION: A method for diagnosing Avellino cornea dyslipidemia comprises: a step of gene TGFBi of a test sample using a marker and a primer for amplifying TGFBi codon 124; a step of releasing a double strand of TFGBi to single strands to reduce the amount of the marker; a step of determining melting profile; and a step of analyzing normality, mutation, or heterozygote.

Description

Method and kit for detecting Avellino corneal dystrophy using real-time PCR and high resolution melting analysis}

The present invention utilizes Real-time Polymerase Chain Reaction (Real-time PCR) and High Resolution Melting (hereinafter referred to as "HRM") analysis. The present invention relates to an Avelino keratosis test method and a test kit for testing the Avellino corneal dystrophy easily and quickly.

More specifically, the present invention uses real-time polymerase chain reaction and high resolution fusion analysis of single nucleotide polymorphisms (SNPs, hereinafter referred to as "SNPs") present in codon 124 of the avelino corneal dystrophy gene TGFBi . The present invention relates to an avelino corneal dystrophy test method and an inspection kit therefor that can be easily, quickly and at low cost.

In general, corneal dystrophy is an autosomal dominant genetic disease in which the cloudiness occurs in the center of the cornea and the cloudiness increases with age. The most common of these is Avelino corneal dystrophy, which is known as Avellino corneal dystrophy (also called "Avelino corneal dystrophy"). It is a genetic disorder.

Mutations arising from the transforming growth factor beta-induced ( TGFBi ) gene, identified by Munier et al. In the q arm 31 of human chromosome 31, were largely associated with codon 124 and codon 555. It is divided into mutations. Corneal dystrophy caused by mutations in codon 124 include avelino corneal dystrophy (CGC → CAC: Arginine → Histidine: R124H) and lattice keratosis (CGC → TGC: Arginine → Cycteine: R124C), and mutations of codon 555 Corneal dysfunction caused by Rice-Buckler corneal dystrophy (CGG → CAG: Arginine → Glutamine: R555Q), and granular keratosis (CGG → TGG: Arginine → Tryptophan: R555W).

Among the corneal dystrophys caused by TGFBi gene mutations, in particular, avelino corneal dystrophy is an inherited disease with autosomal dominant binocular lesions that cause corneal stromal clouding in the cornea. Heterozygote avelino corneal dystrophy increases in age. As a result, a significant loss of vision is known, and patients with homozygous avelino corneal dystrophy are known to be blind from about 6 years of age.

Recently, 91% of patients with clinically diagnosed granular keratosis have been reported to be avelino corneal dystrophy due to codon 124 mutations, not granulosa keratosis due to codon 555 mutations in the TGFBi gene. Avelino Corneal Dystrophy is a newly named disease isolated from the previously known ocular disease known as granular keratosis. It is known as the world's most common corneal dystrophy. Heterozygotes) are fairly common diseases (Holland, EJ et al., Ophthalmology, 99: 1564, 1992; Kennedy, SM et al., Br. J. Ophthalmol., 80: 489, 1996; Dolmetsch, AM et al., Can. J. Ophthalmol., 31:29, 1996; Afshari, NA et al., Arch.Ophthalmol., 119: 16, 2001; Stewart, HS Hum.Mutat., 14: 126, 1999).

In particular, there have been reports that corneal dysfunction worsens after LASIK procedure. Therefore, it is necessary to test the mutation of TGFBi gene for accurate diagnosis of corneal dystrophy and prevention of corneal dysfunction after LASIK procedure. Therefore, it is necessary to perform accurate diagnosis of patients with Avelino corneal dystrophy before LASIK to prevent symptom progression by LASIK. However, in conventional ophthalmologists, the ophthalmologist diagnoses avelino corneal dystrophy only by examining the ocular turbidity under a microscope, and does not find any patients who do not develop symptoms. It often happens.

SNP test method present in codon 124 of TGFBi , a cause of avelino corneal dystrophy, is widely used.A snapshot is obtained by attaching a primer to a PCR product of TGFBi gene and then extending ddNTPs corresponding to each mutation (SNaPShot). Pyro-analysis of the mutation by attaching a primer to the PCR product of the TGFBi gene and then detecting oxyluciferin released using various enzymes (DNA polymerase, Sulfurylase, Luciferase, Apyrase) with a CCD camera Sequencing (pyrosequencing) methods and the like have been developed and used. However, these methods are not only time-consuming or expensive equipment, but also complicated procedures such as refining PCR products and performing another process again, which leads to many limitations in daily use.

On the other hand, in consideration of the problems of the conventional diagnostic method, Korean Unexamined Patent Publication No. 10-2007-0076532 discloses a technique for easily diagnosing avelino corneal dystrophy using a DNA chip for diagnosing corneal dystrophy. However, the method of diagnosing corneal dystrophy using a DNA chip is a method of hybridizing the product after the PCR reaction to the DNA chip to identify the SNP. Therefore, additional analysis is required after obtaining the PCR product, and false positive results may appear depending on the probe used for the DNA chip. It has the limitation that it can.

Therefore, it can be said that in the technical field to which the present invention belongs, there is a need to provide a new method for detecting Avelino corneal dystrophy that is accurate and close to 100% in sensitivity and specificity while quickly and easily diagnosing Avelino corneal dystrophy.

The present invention overcomes the problems of the conventional Avelino corneal dystrophy test method described above, and it is easy to use, so that the time required for inspection is short, and it is widely used as a routine Avelino corneal dystrophy test method ( TGFBi gene mutation test method). It was designed to develop a test method that can be utilized and a test kit for the same.

Disclosure of Invention An object of the present invention is to provide a primer capable of accurately and efficiently amplifying a region including codon 124 of the avelino corneal dystrophy causing gene TGFBi necessary for the method of testing avelino corneal dystrophy.

Another object of the present invention is real time PCR method and HRM analysis for detecting avelino corneal dystrophy, which detects SNPs of TGFBi gene codon 124 with high efficiency and high sensitivity and specificity to detect avelino corneal dystrophy. To provide a method.

Another object of the present invention is real time PCR method and HRM analysis for detecting avelino corneal dystrophy, which detects SNPs of TGFBi gene codon 124 with high efficiency and high sensitivity and specificity to detect avelino corneal dystrophy. To provide a kit.

In addition, another object of the present invention is to provide a real-time PCR kit for the above-described method for detecting avelino corneal dystrophy.

As a result of resolving the technical problem of the present invention and in accordance with the object of the present invention, the present inventors have used the real-time PCR method and HRM analysis to reduce the cost, speed, accuracy and reproducibility with excellent TGFBi. The SNP test method of the TGFBi gene codon 124 which can read the SNP of the gene codon 124 was completed.

Avelino corneal dystrophy test method of an embodiment of the present invention,

Gene of the subject using a primer for amplifying a region containing codon 124 of the gene of Avelino corneal dystrophy TGFBi and a label that visually shows the amount of gene amplification by interchelating between the double strands of the gene when amplifying the gene TGFBi PCR amplifying TGFBi ,

Temperature was applied to the PCR amplification product to determine the gene TGFBi . Unwinding the double strand into single strands to reduce the amount of marker present between the double strands of gene TGFBi ,

TGFBi gene of the PCR amplification product Determining a melting curve regarding the temperature versus the amount of the label for the gene TGFBi of the subject using a tendency to decrease the amount of the label between the double strands;

And analyzing whether the gene TGFBi , the cause of avelino corneal dystrophy, from the subject TGFBi fusion curve is normal, mutant or heterozygous.

Avelino corneal dystrophy test method of an embodiment of the present invention, the TGFBi fusion curve of the subject of the TGFBi gene codon 124 normal SNP control, TGFBi gene codon 124 mutant SNP control and TGFBi gene codon 124 heterozygosity SNP control fusion curves And analyzing the presence or absence of mutations in the single nucleotide sequence.

Avelino corneal dystrophy test method of an embodiment of the present invention, by analyzing the temperature (Tm) that the gene TGFBi is fused to analyze the presence or absence of a single nucleotide sequence mutation between a normal control and a mutation, or a normal control and heterozygotes It features.

Avelino corneal dystrophy test kit of an embodiment of the present invention,

Gene of the subject using a primer for amplifying a region containing codon 124 of the gene of Avelino corneal dystrophy TGFBi and a label that visually shows the amount of gene amplification by interchelating between the double strands of the gene when amplifying the gene TGFBi Means for PCR amplifying TGFBi ,

Temperature was applied to the PCR amplification product to determine the gene TGFBi . Means for reducing the amount of markers present between the double strands of the gene TGFBi by releasing the double strands into single strands;

TGFBi gene of the PCR amplification product Means for determining a melting curve relating to the temperature versus the amount of the label for the gene TGFBi of the subject using a tendency to decrease the amount of label between the double strands;

And means for analyzing whether the gene TGFBi , the cause of avelino corneal dystrophy, from the subject's gene TGFBi fusion curve is normal, mutant or heterozygous.

Avelino corneal dystrophy cause gene TGFBi PCR amplification kit of an embodiment of the present invention, the upstream primer for amplifying the TGFBi gene of SEQ ID NO: 1, the downstream primer for amplifying the TGFBi gene of SEQ ID NO: 2, and the TGFBi gene It includes a labeling substance which is interchelated between the double strands of the gene at the time of amplification and visually shows the amount of gene amplification, gene polymerase, dNTPs and PCR buffer solution.

On the other hand, in one embodiment of the present invention, the labeling material is preferably a fluorescent material that can be interchelating between the double strands in the PCR process. More preferably, the label may be SYBR Green I, which is a fluorescent material. However, the present invention is not limited thereto, and various labeling materials such as radioactive materials or light emitting materials known in the art may be used.

In addition, in one embodiment of the present invention, the primer for amplification of the site containing the codon 124 of the gene TGFBi may be composed of a primer pair of the upstream primer and the downstream primer. Preferably, the upstream primer has a nucleotide sequence of SEQ ID NO: 1, and the downstream primer has a nucleotide sequence of SEQ ID NO: 2.

Using the avelino corneal dystrophy test method and test kit of the present invention, the real-time PCR method and HRM analysis are exquisitely combined to perform the test from the TGFBi gene codon 124 SNP test sample simply and quickly.

That is, when using the test method and test kit of the present invention, it takes about 1 hour and 30 minutes to analyze the TGFBi gene codon 124 SNP, indicating that the Avelino corneal dystrophy test method of the prior art takes about 3 hours. Given this, it is possible to drastically shorten the examination time and provide the advantage that the same day examination and the same day operation are possible even for patients from fat for LASIK surgery.

In addition, the Avelino corneal dystrophy test method and test kit of the present invention can accurately test the SNP present in codon 124 of the gene TGFBi of the avelino corneal dystrophy close to 100%, and also highly reproducible. There is an advantage.

Hereinafter, it demonstrates in detail based on the Example of this invention. The following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. References cited in the present invention are incorporated herein by reference.

The TGFBi gene codon 124 SNP test method using the real-time PCR method and HRM analysis of the present invention and the method of testing Avelino corneal dystrophy using the same are composed of the following techniques.

Example 1: TGFBi Screening and Synthesis of Primer for Gene Codon 124 SNP Test

According to an object of the present invention, a primer for SNP test in TGFBi gene codon 124 that can amplify a gene region including TGFBi gene codon 124 accurately and has a high binding efficiency with a template was prepared as follows.

1) Selection of a primer for amplifying a gene region including a TGFBi gene codon 124

The entire DNA sequence (NT_034772.5) of the TGFBi gene was obtained from a database of the US National Center for Biotechnology Information (NCBI). The entire DNA nucleotide sequence of the obtained TGFBi gene was finally selected from a region containing codon 124 in exon 4, and the TGFBi-HRMF forward primer (SEQ ID NO: 1) and the TGFBi-HRMR downstream primer (Reverse primer) were selected. (SEQ ID NO: 2), respectively (see Table 1 below).

[Table 1] TGFBi-HRM primer sequence structure

Primer Name Sequence structure (5 '→ 3') TGFBi-HRMF GGATCCACCACCACTCAGC TGFBi-HRMR TCCTTGCCAGCTGTGAGATG

2) Synthesis of Selected TGFBi-HRM Upstream and Downstream Primers

TGFBi-HRM upstream and downstream primers selected in the above procedure were synthesized using an Expedite ™ 8909 nucleic acid synthesizer (ABI) equipped with a solid phase synthesis technique based on oligonucleotide phosphoramidite synthesis chemistry.

Synthesis was carried out on a CPG column immobilized with nucleosides located at the 3 'end of the oligonucleotide, and basically detritylation, coupling, capping, and oxidation were repeated. Oligonucleotide polymerization of the selected PCR primers was performed in cycles.

After completion of the synthesis, 30% ammonia water was added to the CPG column to isolate the oligomer, and then deprotected at 55 ° C. for more than 12 hours, concentrated to dryness with Speed Vac., And then reversed phase liquid chromatography and anion exchange chromatography. The chromatography was performed to purify. The final purified oligomer was quantified by measuring absorbance at 260 nm.

Example 2: TGFBi Construction of codon 124 SNP control gene

A control group comprising a normal SNP, a mutant (homozygote) SNP, and a heterozygous SNP required for analyzing the SNP of codon 124 in the TGFBi gene with accurate and high efficiency by real-time PCR method and HRM analysis according to the object of the present invention. They were produced as follows.

First, PCR was performed using the TGFBi-HRM upstream and downstream primers synthesized in Example 1 on DNA samples in which SNPs of codon 124 in the TGFBi gene were shown as normal, mutant (homozygotes) and heterozygotes. PCR products were obtained.

Then, PCR products comprising normal SNPs, mutant (homozygote) SNPs, and heterozygous SNPs, respectively, are conjugated with 3,929 bp plasmid vector pCR2.1, which is then transformed into plasmid receiving bacterial cells. (transformation).

After culturing the transformed bacteria, plasmid DNA was isolated and purified from the bacteria to obtain a codon 124 SNP control in the TGFBi gene conjugated with a fragment containing the codon 124 site in the 4,957 bp TGFBi gene and the 3,929 bp plasmid vector pCR2.1. It was.

Example 3: Real-Time PCR Method and HRM Analysis TGFBi  Construction of Test Kits Required for the Gene Codon 124 SNP Test Method

To the the amplification primers of the above within the codon TGFBi Gene 124 parts in accordance with the purpose of the present invention, TGFBi gene codon 124 SNP test kit comprising TGFBi my codon 124 SNP control gene and, all reagents necessary for real-time PCR carried out Designed as

The TGFBi gene codon 124 SNP test kit described above is composed of the following reagents and devices.

※ TGFBi Gene Codon 124 SNP Test Kit (FIGS. 1 and 2)

① 0.1 mL of upstream primer TGFBi-HRMF (10 pmol / μl) for amplifying the TGFBi gene codon 124 site

② 0.1 ml of downstream primer TGFBi-HRMR (10 pmol / μl) for amplifying the TGFBi gene codon 124 site

③ 2X premix containing real-time PCR buffer for amplifying the TGFBi gene codon 124 site (usually commercially available), Taq polymerase, dNTPs and the fluorescent HRM Dye (e.g., SYBR Green, etc.) (pre mix) 1.0 ml

④ 0.2 ml of TGFBi gene codon 124 normal SNP control (5 × 10 ⁷ / μl)

⑤ 0.2 ml of TGFBi gene codon mutant SNP control (5 × 10 ⁷ / μl)

⑥ TGFBi gene codon 124 heterozygous SNP control group (5 × 10 ⁷ / μl) 0.2ml

⑦ 3X distilled water 1 ml

Example 4: TGFBi  Real-Time PCR and HRM Analysis for Gene Codon 124 SNP Detection and Avelino Corneal Dystrophy

200 μl PCR of 1 μl of TGFBi gene codon 124 normal SNP control, 1 μl of TGFBi gene codon 124 mutant SNP control and 1 μl of TGFBi gene codon 124 heterozygous SNP control, respectively obtained in Example 2 and kited in Example 3 Put in the tube.

And, as to each of the PCR tubes, the third embodiment of the TGFBi gene codon 124 region amplified upstream primer TGFBi-HRMF 1 ㎕, a third embodiment of the TGFBi gene codon 124 region amplified downstream primer TGFBi-HRMR 1 ㎕ for, carried out Real-time PCR buffer for amplifying the 124 TGFBi gene codon of Example 3, Taq polymerase, dNTPs, and 10 μl of a 2X premix containing the fluorescent substance HRM Dye were added, followed by 3X distilled water of Example 3. Was added to bring the total volume to 20 μl.

Then, after mixing and centrifugation, warmed at 95 ° C. for 10 seconds using a real-time PCR device (Roche's Light cycler 480), then 10 seconds at 95 ° C., 10 seconds at 60 ° C., 72 ° C. 10 A second repeated procedure was performed 45 times, and after completion of the reaction, the SNP of the TGFBi gene codon 124 was read using a high resolutin mealting (HRM) analysis method (see FIGS. 3, 4A, and 4B).

3, the TGFBi gene codon 124 normal SNP control, the TGFBi gene codon 124 mutant SNP control, and the TGFBi gene codon 124 heterozygous SNP control were prepared as in Example 2, followed by real-time PCR as described above. A graph showing is shown. Figure 3 shows amplification plots and melting curves obtained after completion of the real-time PCR reaction.

4A and 4B show the results of reading a normal SNP, a mutant SNP, and a heterozygous SNP of the TGFBi gene codon 124 by performing a real-time PCR method according to the method of the present embodiment and then by HRM analysis. 4A and 4B show high resolution mealting (HRM) curves analyzed after the completion of a real-time PCR reaction. From these curves, normal SNPs, mutant SNPs, and heterozygous SNPs of TGFBi gene codon 124 are separated from each other. SNPs were easily read.

In this regard, in the Avelino corneal dystrophy test method of the present invention, the real-time PCR method is to allow the fluorescent material such as SYBR Green (SYBR Green) to be interchelating (double-stranded) DNA chain in the PCR process (PCR) The amount of amplified product produced can be measured by detecting the amount of fluorescence that develops with the amplification of the product. In addition, HRM analysis increases the temperature after the real-time PCR reaction to release DNA double strands, thereby reducing the amount of fluorescent material present between the DNA double strands, especially the temperature at which the DNA is fused (denatured) (Tm ) To analyze the presence or absence of nucleotide sequence mutations between the normal control group and the mutation, or the normal control group and heterozygotes (see Figure 6). In other words, the Avelino corneal dystrophy test method of the present invention can be easily and quickly detect the TGFBi gene codon 124 SNP by the exquisite combination of real-time PCR method and HRM analysis.

Therefore, using the Avelino corneal dystrophy test method and test kit of the present invention, the real-time PCR method and HRM analysis are exquisitely combined to perform the test from the TGFBi gene codon 124 SNP test sample easily and quickly.

That is, using the method of the present invention takes about 1 hour 30 minutes to analyze the TGFBi gene codon 124 SNP. Considering that the above-described Avelino corneal dystrophy test method of the prior art takes about 3 hours of test time, the avelino corneal dystrophy test method and test kit of the present invention can greatly reduce the test time, and Even patients who come from fat for surgery will provide the advantage of being able to test on the same day, same day surgery.

Example 5: Confirmation of specificity and sensitivity of the test method of the present invention

In Example 4, the nucleotide sequence of the TGFBi codon 124 SNP was analyzed by ABI prism 3100 autosequence analyzer to validate the results of reading the TGFBi codon 124 SNP as normal, mutant (homozygotes) and heterozygotes, respectively. As a result, it was confirmed that the results of sequencing of the TGFBi codon 124 SNP by the ABI prism 3100 automatic base sequence analyzer and the SNP results of the TGFBi codon 124 observed in Example 4 are consistent (see FIG. 5).

Therefore, the Avelino corneal dystrophy test method of the present invention can accurately examine the SNP present in the codon 124 of the gene TGFBi, which is the causative agent of the avelino corneal dystrophy, with close sensitivity and specificity close to 100%, and also highly reproducible. It can be seen that it can be very useful for diagnosing abnormalities.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

1 is a photograph showing the packaging appearance of a real-time PCR kit used for TGFBi codon 124 SNP reading according to the present invention.

Figure 2 is a photograph showing the configuration of a real-time PCR kit used for reading TGFBi codon 124 SNP according to the present invention.

Figure 3 was prepared as TGFBi gene codon 124 normal SNP control, TGFBi gene codon 124 mutant SNP control and TGFBi gene codon 124 heterozygous SNP control as in Example 2, and then subjected to real-time PCR method according to Example 4 It is a figure which shows a result. Figure 3 shows amplification plots and melting curves obtained after completion of the real-time PCR reaction.

4A and 4B show the results of reading normal SNP, mutant SNP, and heterozygous SNP of TGFBi gene codon 124 by performing real-time PCR according to the method of Example 4, followed by HRM analysis.

Figure 5 is an embodiment 4 TGFBi codon 124 SNP that each top in the mutation (homozygous), and analyzing the base sequence of 124 SNP TGFBi codon in ABI prism 3100 automatic base sequence analyzer to verify the validity of the detection results to heterozygous It is a figure which shows one result. A shown in Figure 5 shows the normal codon (CGC Arg124), B is a mutated codon (CAC His124), C is heterozygous codon (CGC Arg124, His124 CAC).

6 is a melting curve graph showing that the amount of fluorescent material present between DNA double strands is reduced by releasing DNA double strands by increasing the temperature after real-time PCR reaction in the HRM analysis method.

<110> Crowngene Co., Ltd.          Babymemories Co., Ltd.          Hnsbio Co., Ltd.          PARK, Se-Hwa <120> Method and kit for detecting Avellino corneal dystrophy using          real-time PCR and high resolution melting analysis <130> P09-0163KR <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> TGFBi-HRMF Forward Primer <400> 1 ggatccacca ccactcagc 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TGFBi-HRMR Reverse Primer <400> 2 tccttgccag ctgtgagatg 20  

Claims (10)

PCR of the subject's gene TGFBi was carried out using a primer for amplifying a region containing codon 124 of the gene TGFBi that causes avelino corneal dystrophy and a label that is bound between the double strands of the gene when amplifying the gene TGFBi and visually shows the amount of gene amplification. Amplifying, Temperature was applied to the PCR amplification product to determine the gene TGFBi . Unwinding the double strand into single strands to reduce the amount of marker present between the double strands of gene TGFBi , TGFBi gene of the PCR amplification product Determining a melting curve regarding the temperature versus the amount of the label for the gene TGFBi of the subject using a tendency to decrease the amount of the label between the double strands; And analyzing whether the gene TGFBi is a normal, mutant, or heterozygotic gene from the subject's gene TGFBi fusion curve. The method of claim 1, Comparing the TGFBi fusion curve of the subject with the fusion curves of the TGFBi gene codon 124 normal SNP control group, the TGFBi gene codon 124 mutant SNP control group, and the TGFBi gene codon 124 heterozygous SNP control group, and analyzed the presence or absence of mutation of a single sequence. Avelino corneal dystrophy test method comprising. The method according to claim 1 or 2, Avelino corneal dystrophy test method characterized in that by analyzing the temperature (Tm) that the gene TGFBi is fused to analyze the presence or absence of a single nucleotide sequence between a normal control and a mutation, or a normal control and heterozygotes. The method according to claim 1 or 2, The marker is an avelino corneal dystrophy test method, characterized in that the fluorescent material that can be coupled between the double strands in the PCR process. The method according to claim 1 or 2, The primer for amplification of the site including the codon 124 of the gene TGFBi consists of a primer pair of an upstream primer and a downstream primer, the upstream primer has a nucleotide sequence of SEQ ID NO: 1, and the downstream primer has a base of SEQ ID NO: 2 Avelino corneal dystrophy test method characterized by having a sequence. PCR of the subject's gene TGFBi was carried out using a primer for amplifying a region containing codon 124 of the gene TGFBi that causes avelino corneal dystrophy and a label that is bound between the double strands of the gene when amplifying the gene TGFBi and visually shows the amount of gene amplification. Means for amplifying, Temperature was applied to the PCR amplification product to determine the gene TGFBi . Means for reducing the amount of markers present between the double strands of the gene TGFBi by releasing the double strands into single strands; TGFBi gene of the PCR amplification product Means for determining a melting curve relating to the temperature versus the amount of the label for the gene TGFBi of the subject using a tendency to decrease the amount of label between the double strands; Avelino corneal dystrophy test kit comprising means for analyzing whether the gene TGFBi causative gene TGFBi from the subject TGFBi fusion curve is normal, mutant or heterozygous. The method of claim 6, The marker is an avelino corneal dystrophy test kit, characterized in that the fluorescent material that can be coupled between the double strands in the PCR process. The method according to claim 6 or 7, The primer for amplification of the site including the codon 124 of the gene TGFBi consists of a primer pair of an upstream primer and a downstream primer, the upstream primer has a nucleotide sequence of SEQ ID NO: 1, and the downstream primer has a base of SEQ ID NO: 2 Avelino corneal dystrophy test kit, characterized in that having a sequence. An upstream primer for amplifying the TGFBi gene of SEQ ID NO: 1, a downstream primer for amplifying the TGFBi gene of SEQ ID NO: 2, and a TGFBi gene TGFBi PCR amplification kit that is coupled between the double strands of the gene at the time of amplification, and visually expresses the amount of gene amplification, and gene for avelino corneal dystrophy, including gene polymerase, dNTPs, and PCR buffer solution. 10. The method of claim 9, The labeling material is TGFBi PCR amplification kit for the cause of Avelino corneal dystrophy, characterized in that the fluorescent material that can be coupled between the double strands in the PCR process.

Images