CN111269978B - Human ApoE genotyping detection kit - Google Patents
Human ApoE genotyping detection kit Download PDFInfo
- Publication number
- CN111269978B CN111269978B CN202010231941.1A CN202010231941A CN111269978B CN 111269978 B CN111269978 B CN 111269978B CN 202010231941 A CN202010231941 A CN 202010231941A CN 111269978 B CN111269978 B CN 111269978B
- Authority
- CN
- China
- Prior art keywords
- detection
- seq
- primer
- final concentration
- combination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the technical field of genetic engineering, and particularly relates to a human ApoE genotyping detection kit. The detection technology provided by the invention combines the asymmetric PCR technology with the dissolution curve technology, and finally realizes that the detection of 2 single nucleotide polymorphisms at 2 sites can be completed in a single-tube PCR system, and the genotype of the sample can be obtained by performing dissolution curve analysis after the PCR amplification is finished.
Description
Technical Field
The invention relates to a primer probe composition for human ApoE genotyping detection, a kit and application, and belongs to the field of gene detection.
Background
Apolipoprotein E (ApoE) is an Apolipoprotein consisting of 299 amino acids, an arginine-rich basic protein, a multifunctional glycoprotein, and is involved in lipid transport, storage, and excretion, as well as in the development of the nervous system and repair after injury. High-grade atherosclerosis and Alzheimer's disease in human are both related to abnormal regulation of lipid metabolism in which ApoE protein is involved. Studies show that the polymorphism of the ApoE gene is also related to the occurrence of coronary heart disease, hyperlipidemia and cerebral infarction.
The amino acid sequence of apolipoprotein E is determined by two SNPs, the base at amino acid position 112 (C.388T > C, Cys130Arg) and the base at amino acid position 158 (C.526C > T, Arg176 Cys). Based on the different combinations of amino acids at positions 112 and 158, three apoes were formed, i.e., E2, E3, and E4, 8%, 78%, and 14% in the population, respectively, where ApoE3 is the wild-type gene, amino acids 112 and 158 of E3 are cysteine and arginine, Apo E2 and E4 are mutant, E2 is cysteine at both amino acids 112 and 158, and amino acids 112 and 158 of E4 are arginine. According to the difference of 2 SNP gene sequences, the ApoE gene can generate 6 common genotypes, including 3 homozygotes (E2/E2, E3/E3, E4/E4) and three heterozygotes (E2/E3, E2/E4, E3/E4). The frequency distribution of the E3 gene is highest in natural population, and the distribution of the ApoE3/E3 phenotype accounts for about 70% in Chinese population.
The polymorphism of the ApoE gene is closely related to diseases such as Alzheimer's Disease (AD), coronary heart disease and the like, so the detection of the ApoE genotype can be used as an index for clinical auxiliary diagnosis and risk rate assessment. ApoE gene is the most closely known genetic marker of Alzheimer's Disease (AD) at present, and in 1993, Rose research shows that the ApoE4 allele frequency of patients with late familial AD is increased, and the affinity of ApoE and small polypeptide A beta derived from amyloid precursor protein is high. Subsequently, it was found that 46.2% of the AD patients carried the ApoE4 allele, while the control group was 13.2%. It was also found that subjects carrying two ApoE4 alleles experienced AD earlier than subjects carrying one E4 allele and earlier than subjects not carrying an ApoE4 allele. The conclusion is that the alleles ApoE2 and ApoE3 reduce the incidence of AD, delay the age of onset, increase the probability of Alzheimer's disease for the ApoE4 carrier, and are about 3.2 times as high as normal at risk of AD for one ApoE4 carrier, and 8-12 times as high as normal at risk of AD for two ApoE4 alleles. The proportion of the ApoE4 allele is approximately 15% in the general population and up to 40% in AD patients. ApoE is an important risk factor of AD, and whether the people are susceptible to AD can be known by detecting the genotype of ApoE, so that the occurrence and development of AD are delayed from the etiology, and the regular examination is carried out, so that the damage caused by the disease can be diagnosed and treated early and reduced to the maximum extent.
In addition, ApoE participates in the regulation of lipid metabolism of the body through various ways, and is an important intrinsic factor influencing the blood lipid level of the body. ApoE gene is closely related to various cardiovascular and cerebrovascular diseases, including hyperlipoproteinemia, atherosclerotic vascular disease, coronary heart disease and the like. According to a large amount of people, the ApoE4 allele is found to be capable of obviously increasing the total cholesterol concentration of healthy people and is more prone to atherosclerosis, and on the contrary, the ApoE2 allele can reduce the cholesterol concentration, and the reduction effect is 2-3 times that of E4 when the cholesterol is increased. Studies have found that the ApoE2 allele is protective against the development of coronary atherosclerosis, whereas the ApoE4/E3 heterozygote is older than the E3/E2 and E3/E3 genotypes in the onset of myocardial infarction. Therefore, the genetic risk of the cardiovascular and cerebrovascular diseases of the examinee can be effectively evaluated through gene detection, and personalized prevention suggestions are provided for the examinee according to the level of the risk. Polymorphisms in the ApoE gene are the major cause of individual variation in the course of the disease progression and therapeutic efficacy of drug therapy.
In addition, because the gene defect is an important factor causing the nervous system diseases, the genetic risk of the examinee suffering from various nervous system diseases can be effectively evaluated through gene detection, personalized prevention suggestions are provided for the examinee according to the level of the risk, and meanwhile, the prevention key point can be found out, so that the nervous system diseases are pertinently and efficiently prevented, the effect of preventing diseases in the future is really played, and the healthy driving and protecting of the examinee are achieved.
In summary, the method of detecting the ApoE gene of a patient to obtain the genotype of a specific site and using the gene detection result as intermediate information is not a diagnostic method of diseases, and the individual administration can be realized by determining the selection of drugs according to the detection result of the genotype.
Currently, common methods for detecting ApoE genes include a direct sequencing method, a gene chip hybridization method, a PCR-Taqman MGB probe typing method and an ARMS-PCR method.
The direct sequencing method is a gold standard for SNP locus analysis, but the detection method is limited by a sequencing instrument, and the sequencing instrument is expensive and difficult to popularize. In addition, the requirement of direct sequencing on the template amount is high, sequencing is usually performed after target fragments are enriched through PCR amplification, the operation is complex, the period is long, and the method is open-tube operation and is easy to cause pollution.
A gene chip hybridization method, apolipoprotein E (ApoE) genotype detection kit (gene chip method) of Zhuhai Saileqi biotechnology limited company, which is a formed detection kit passing CFDA certification, is available on the market at present, and the kit adopts a PCR-gene chip hybridization method to detect, amplifies corresponding ApoE gene segments by a Polymerase Chain Reaction (PCR) technology, and hybridizes with specific nucleic acid probes on a chip to distinguish and determine the genotype of ApoE. The detection method has the advantages of complex operation steps, easy error, more than 4 hours of experiment time and longer time consumption. And the tube opening operation is needed after the PCR is finished, so that the pollution is easily caused. In addition, the detection method can judge the result by naked eyes, the accuracy is influenced, and false positive and false negative result judgment can occur.
The PCR probe typing method is the mainstream SNP typing method at present due to the characteristics of simple operation, accurate typing, whole-course closed-tube operation, short detection period and the like. At present, CFDA-certified typing detection kits are available in the market, such as "human SLCO1B1 and ApoE gene polymorphism detection kit (PCR-fluorescent probe method)" of Wuhan Yongzhiyou Biotechnology Co., Ltd, however, the products thereof only detect bases of two sites of ApoE, only detect ApoE 2526 site and ApoE4388 site, obtain genotype combinations of E2 and E4, and do not detect E3. Moreover, the MGB probe belongs to the technology of the U.S. LIFE patent company and is limited in raw materials.
ARMS-PCR, an allele-specific amplification method, also known as an amplification-hindered mutation system, is used to detect known mutant genes. The method designs two 5 ' end primers, one of which is complementary with normal DNA and the other of which is complementary with mutant DNA, and adds the two primers and a 3 ' end primer respectively for the homozygosity mutation to carry out parallel PCR, only the primer which is completely complementary with the mutant DNA can extend to obtain a PCR amplification product, and the PCR cannot extend due to the mismatching at the 3 ' end of the primer, so the method is called ARMS. The method adopts the electrophoresis after the PCR reaction is finished, and judges the result according to the existence of the projection strip, and although the method does not need expensive operation, the electrophoresis operation increases the convergence of PCR pollution and is time-consuming and labor-consuming.
Patent document 201810478466.0 discloses a primer probe combination for typing human ApoE gene and a method of use thereof, specifically designing allele specific primers for ApoE gene point mutation gene sequences, designing blocking primers for wild type sequences, and performing typing detection on ApoE gene according to Ct value by using mutation enrichment amplification reaction conditions. The kit also comprises a closed primer of the wild type gene, so that the kit has more components and high preparation cost.
Patent document 201810988325.3 discloses a kit suitable for ApoE genotyping detection of blood genomic DNA samples and a PCR method thereof, wherein the kit is characterized in that: the mixed solution for ApoE genotyping detection comprises a specific primer pair, a specific probe pair, Taq HS DNA polymerase, deoxyribonucleoside triphosphate mixed solution, reaction buffer solution and a reaction enhancer, wherein the specific primer pair, the specific probe pair, the Taq HS DNA polymerase, the deoxyribonucleoside triphosphate mixed solution, the reaction buffer solution and the reaction enhancer are used for ApoE genotyping detection. The kit has more complex components, only three positive quality control products are included, and the application range is narrow only aiming at the detection kit of the blood sample.
In conclusion, the analysis shows that the existing ApoE genotyping detection methods have the defects of high reagent detection cost, complex operation, easy pollution generation, certain false negative and false positive generation and the like in the aspect of popularization. In order to improve the defects of the prior art, the invention provides a detection kit for detecting human ApoE gene polymorphism based on an asymmetric PCR dissolution curve method, which combines an asymmetric PCR technology with a dissolution curve technology, and respectively designs a pair of primers and a probe aiming at 2 SNP sites C.388T > C and C.526C > T of an ApoE gene so as to solve the problems of high price of detection instruments, complex operation, easy pollution, high detection cost, difficult clinical application and popularization and the like of the traditional detection technology and the finished product detection kit.
Disclosure of Invention
The invention aims to provide a human ApoE genotyping detection kit and a method for detecting human ApoE genotyping by applying the kit, wherein the detection technology combines an asymmetric PCR technology and a dissolution curve technology, and a pair of primers and a probe are respectively designed aiming at 2 SNP sites C.388T > C and C.526C > T of an ApoE gene. Asymmetric amplification is carried out by using upstream and downstream primers with different concentrations, a small amount of primers are gradually exhausted along with the increase of circulation, and the excessive amount of primers are continuously subjected to linear amplification to enrich a large amount of DNA single strands containing C.388T > C and C.526C > T. The probe designed by the invention is modified by the nucleotide, has stronger SNP distinguishing capability and low fluorescence background, can completely distinguish probes with different fluorescent labels in the same tube of reaction liquid, can finally complete the detection of 2 single nucleotide polymorphisms at 2 sites in a single-tube PCR system, and can know the genotype of a sample by carrying out dissolution curve analysis after the PCR amplification is finished.
The purpose of the invention is realized by the following technical scheme.
In a first aspect, the present invention provides a specific primer probe combination for human ApoE genotyping, the combination includes a primer probe combination for ApoE2 typing detection and a primer probe combination for ApoE4 typing detection, specifically, the primer probe combination for ApoE2 typing detection includes: the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3; the primer probe combination for typing detection of ApoE4 comprises: the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 4, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5, and the nucleotide sequence of the probe is shown as SEQ ID NO. 6.
Preferably, the specific primer probe combination for human ApoE genotyping further comprises an internal reference primer pair and an internal reference probe, wherein the nucleotide sequences of the internal reference primer pair are shown as SEQ ID NO. 7 and SEQ ID NO. 8, and the nucleotide sequence of the internal reference probe is shown as SEQ ID NO. 9.
Preferably, the detection probe and the internal reference probe are labeled with a fluorescent group at the 5 'end and a quenching group at the 3' end. The fluorescent group is selected from one of FAM, JOE, VIC and HEX, and the quenching group is selected from one of BHQ1, BHQ2 and TAMRA.
In a preferred embodiment of the invention, the specific primer probe combinations for human ApoE genotyping are as shown in the following table:
TABLE 1 primer Probe combinations designed according to the invention
| Oligo name | 5’-3’Base sequence |
| ApoE2-F | ACGCGGGCACGGCTGTCCAAGG |
| ApoE2-R | GGCGCTCGCGGATGGCGCTGA |
| ApoE2-Q | FAM-ACATGGAGGACGTGTGCGGCCGCCTG-BHQ1 |
| ApoE4-F | AGGCGGCGCAGGCCCGGCT |
| ApoE4-R | CCCGGCCTGGTACACTGC |
| ApoE4-Q | FAM-TGCCGATGACCTGCAGAAGCGCCTGGC-BHQ1 |
| Internal reference to-F | TCCAAAGCAAGGGCTATCGGG |
| Internal reference to the formula-R | CTCAGCGTATGCCTCATCGTTG |
| Internal reference to Q | JOE-TCCAGTTCAGACCGTGTAGAAACT-BHQ1 |
In a second aspect, the invention provides a kit for typing and detecting human ApoE gene, the kit comprises the primer probe combination and PCR reaction liquid, wherein in the reaction system, the concentration range of the primer and the probe is 0.01-1 mu mol/L, and MgCl is added2The final concentration is 1.5-2.0mM, the final concentration of the mixture of four kinds of deoxyadenosine triphosphate (dNTPs) with equal concentration is 100-120nM, and the concentration of the hot start DNA polymerase is 1-2U/reaction.
The applicant of the present invention finally determined the optimal PCR reaction system by a large number of experimental comparisons using an orthogonal test method as shown in the following table:
TABLE 2 most preferred PCR reaction systems of the present invention
Most preferably, the total reaction volume for PCR is 25. mu.L, and the sample amount of the DNA sample to be detected is 2. mu.L.
The DNA sample which can be used for detection in the invention is genome DNA, and the DNA sample can be derived from blood, saliva and biological tissues. The extraction of DNA from blood, saliva, or biological tissue is performed according to procedures well known to those skilled in the art. To facilitate testing, and to reduce the number of handling steps, the DNA samples of the invention are derived from blood or saliva. The inventor unexpectedly discovers that the effect of carrying out ApoE genotyping detection by taking saliva DNA as a sample can be achieved by adding a group of synergistic compositions in a PCR reaction system, and the detection result is consistent with gene sequencing, has high accuracy and is harmless to human bodies.
In a third aspect, the invention provides a kit for human ApoE genotyping detection of saliva DNA samples, the kit comprises the primer probe combination and PCR reaction solution, and further comprises a synergistic composition.
The synergistic composition is selected from one or more of 1, 6-fructose diphosphate dicalcium salt (with a final concentration of 5-10mmol/L), D-gluconic acid calcium salt (with a final concentration of 5-10mmol/L), D-galacturonic acid (with a final concentration of 10-50mmol/L) and vitamin C (with a final concentration of 10-50 mmol/L).
Preferably, the synergistic composition is selected from one or both of fructose-1, 6-diphosphate dicalcium salt and D-gluconate calcium salt, and D-galacturonic acid in combination.
More preferably, the synergistic composition is a combination of fructose-1, 6-diphosphate dicalcium salt and D-galacturonic acid, and the final concentration of fructose-1, 6-diphosphate dicalcium salt is 5mmol/L and the final concentration of D-galacturonic acid is 20mmol/L in the PCR reaction system.
The applicant of the present invention unexpectedly found that the addition of fructose-1, 6-diphosphate dicalcium salt, D-gluconate calcium salt, D-galacturonic acid, vitamin C can improve the accuracy and sensitivity of the ApoE genotyping detection of saliva DNA samples. The specific action of the synergistic composition in a reaction system needs to be confirmed, and the analysis of the prior art is carried out according to the observed phenomenon, so that on one hand, the synergistic composition can probably improve the stress resistance of a saliva DNA sample in a PCR reaction system and the compliance of the saliva DNA to temperature change in the PCR reaction, and D-galacturonic acid and vitamin C can provide more appropriate reaction conditions for the amplification of the saliva DNA, increase the DNA amplification capacity and improve the genotyping detection sensitivity; on the other hand, the technical personnel think that the synergistic composition can improve the identification degree of a dissolution peak of a dissolution curve, the artificial errors in the aspect of identification of the Tm difference value of the dissolution peak are less, and the detection accuracy is improved. Secondly, we found through many experiments that when two calcium salts are selected for the synergistic composition, the detection result still has errors, and when one calcium salt and one of D-galacturonic acid or vitamin C are selected, the detection accuracy is the best, wherein the effect of D-galacturonic acid is better than that of vitamin C.
In addition, the skilled person is surprised that the synergistic composition does not improve the detection sensitivity when added to the blood DNA sample, the difference may be caused by the DNA source, and the difference between the blood DNA sample and the saliva DNA sample may be caused by other components besides DNA, and the addition of the preferred synergistic composition can well eliminate the interference of other impurities in the saliva DNA sample, thereby improving the accuracy of genotyping detection.
The applicant of the invention considers that the screening of the primers and the probes and the optimization of a PCR reaction system are the key points of the invention, the reaction system of the invention is a multiple asymmetric PCR, the reaction system contains a plurality of primer probes, the content of the ApoE gene GC is high, the amplification is unstable, and if a complex secondary structure is formed between the probes and the primers, the result of a subsequent dissolution curve can be influenced, so that no dissolution peak appears. Finally, through experimental exploration, the optimal application method of the kit provided by the invention is finally determined.
In a fourth aspect, the present invention provides a method for using the above-mentioned human ApoE genotyping detection kit, wherein the method comprises the following steps:
(1) extraction of DNA: extracting genome DNA from a sample to be detected, wherein the concentration is preferably 5-200 ng/mu L;
(2) fluorescent PCR amplification: performing fluorescence PCR amplification by using the extracted genome DNA as a template to obtain a dissolution curve result;
(3) and (4) interpretation of results: and judging whether the sample to be detected contains corresponding gene mutation or not according to the change of the Tm difference value of the dissolution peak of the dissolution curve, wherein the judgment of the specific ApoE genotyping result refers to the following table 3.
TABLE 3 comparison table of ApoE genotyping results of the present inventors
+: dissolution curve peak-off-: no peak appeared in the dissolution curve
The standard control ApoE type plasmid can be used for correcting experimental errors caused by external conditions, the method is simple and convenient to judge the result after the fluorescent PCR reaction, a large amount of data and graphs do not need to be read, and the ApoE genotyping can be judged according to the change of the Tm difference value of the dissolution curve.
Preferably, the optimal reaction conditions for the fluorescent PCR amplification determined by the present invention are shown in the following table:
TABLE 4 optimal reaction conditions for fluorescent PCR amplification
The human ApoE genotyping detection kit provided by the invention has the following beneficial technical effects: (1) the asymmetric PCR technology is combined with the dissolution curve technology, so that the detection of 2 SNP sites in one tube can be realized, the cost is greatly saved, and the time is saved; (2) the kit is simple, convenient and quick, the consumed time is short, only one tube of reaction liquid is needed, only a simple sample is needed to be added and the machine is needed, the operation time of the whole process is within 3h, and the steps are few; (3) the specificity is good, the probes used in the invention are nucleotide modified probes, the discrimination capability on SNP is strong, the fluorescence background is low, one probe can discriminate 1 SNP locus, and 2 probes can discriminate 2 SNP; (4) homogeneous phase detection, closed tube operation: the invention is a homogeneous detection system, PCR amplification and dissolution curve analysis are completed in the same closed reaction tube after adding the template, and the subsequent operation of PCR is not needed, thereby reducing the probability of aerosol pollution; (5) the PCR reaction system is suitable for genotyping detection of saliva DNA samples, is simple and convenient, does not cause wound to human bodies during sample collection, and has better clinical compliance of patients.
The nucleotide sequence related to the invention is shown as follows:
SEQ ID NO:1 ACGCGGGCACGGCTGTCCAAGG
SEQ ID NO:2 GGCGCTCGCGGATGGCGCTGA
SEQ ID NO:3 ACATGGAGGACGTGTGCGGCCGCCTG
SEQ ID NO:4 AGGCGGCGCAGGCCCGGCT
SEQ ID NO:5 CCCGGCCTGGTACACTGC
SEQ ID NO:6 TGCCGATGACCTGCAGAAGCGCCTGGC
SEQ ID NO:7 TCCAAAGCAAGGGCTATCGGG
SEQ ID NO:8 CTCAGCGTATGCCTCATCGTTG
SEQ ID NO:9 TCCAGTTCAGACCGTGTAGAAACT
the technical term "SNP" in the invention refers to single nucleotide polymorphism, and specifically refers to variation of single nucleotide on genome, including substitution, transversion,Deletions and insertions. Theoretically, each SNP site can have 4 different variants, but actually only two variants occur, namely, transition and transversion, with the ratio of 2: 1. SNPs occur most frequently in the CG sequence and are mostly C-to-T, since the C in CG is often methylated and spontaneously deaminated to thymine. Generally, a SNP refers to a single nucleotide variation with a variation frequency of greater than 1%. There is one SNP in about every 1000 bases in the human genome, and the total amount of SNPs in the human genome is about 3X 106And (4) respectively.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 blood DNA samples ApoE genotyping assay
S1: 2mL of blood of 10 subjects is collected, and a conventional DNA extraction kit is adopted for extracting DNA samples of the blood;
s2: adding 2. mu.L of the DNA sample extracted in step S1 to the PCR reaction system shown in Table 2, and carrying out PCR amplification reaction under the following reaction conditions;
s3: and obtaining a dissolution curve after amplification is finished, obtaining the change of the Tm difference value of a dissolution peak, and judging and reading the ApoE genotype of the sample to be detected by contrasting a comparison table shown in the table 3.
Meanwhile, the blood DNA sample of the subject was subjected to gene sequencing, and the genotyping and sequencing results detected by the kit of this example were compared, with the results shown in Table 5. According to the comparison result, the ApoE typing of the subject detected by the kit provided by the invention is consistent with the gene sequencing result, which indicates that the kit provided by the invention has high detection accuracy.
TABLE 5 blood DNA samples ApoE genotyping assay results
Example 2 saliva DNA sample ApoE genotyping assay
S1: 1mL of saliva of 10 healthy volunteers recruited in example 1 was collected, and DNA samples were extracted;
s2: adding 2. mu.L of the DNA sample extracted in step S1 to the PCR reaction system shown in Table 2, and carrying out PCR amplification reaction under the reaction conditions shown in example 1;
s3: the method for obtaining a melting curve after amplification is completed and determining the ApoE genotyping of the sample to be tested is shown in example 1.
In the same manner as in example 1, salivary DNA was subjected to gene sequencing, and the results of the interpretation by the kit of this example were compared with the results of gene sequencing, and the results are shown in Table 6.
TABLE 6 saliva DNA sample ApoE genotyping assay results
According to the comparative data in the table, 3 data of the ApoE genotyping of the saliva DNA sample detected by using the kit and the kit application method provided by the invention are different from gene sequencing, and the accuracy rate in the small sample experiment of the invention is only 70%. Careful comparison of the results the skilled person surprisingly found that the basic error was due to the detection of ApoE2 typing which was incorrect for the reason we have not performed extensive experiments to verify. Next, the technician will have 3 samples with detection errors and will re-test them by adding the kit of synergistic composition, the specific operation is as shown in examples 3-6.
EXAMPLE 3 saliva DNA sample ApoE genotyping assay
S1: taking saliva DNA samples with sample numbers of 5, 6 and 7 for further detection;
s2: adding fructose-1, 6-diphosphate dicalcium salt to the PCR reaction system shown in Table 2 to a final concentration of 5mmol/L, adding D-gluconic acid calcium salt to a final concentration of 5mmol/L, and adding 2 mu LDNA sample to perform PCR amplification reaction under the reaction conditions shown in example 1;
s3: a melting curve is obtained and the ApoE genotype of the sample to be examined is interpreted as described in example 1.
TABLE 7 saliva DNA sample ApoE genotyping assay results
From the above re-detection data, it can be seen that when 1, 6-fructose diphosphate dicalcium salt and D-calcium gluconate salt are added as synergistic compositions in the PCR system, only the 7 re-detection results in the detection results of the 5, 6 and 7 samples are consistent with the gene sequencing, and the other two samples still maintain the original detection results.
Example 4 saliva DNA sample ApoE genotyping assay
S1: taking saliva DNA samples with sample numbers of 5, 6 and 7 for further detection;
s2: adding fructose-1, 6-diphosphate dicalcium salt to the PCR reaction system shown in Table 2 to a final concentration of 5mmol/L, adding D-galacturonic acid to a final concentration of 20mmol/L, and adding 2. mu.L of DNA sample to perform PCR amplification reaction under the conditions shown in example 1;
s3: a melting curve is obtained and the ApoE genotype of the sample to be examined is interpreted as described in example 1.
TABLE 8 saliva DNA sample ApoE genotyping assay results
From the above re-detection data, it can be seen that when 1, 6-fructose diphosphate dicalcium salt and D-galacturonic acid are added to the PCR system as the synergistic composition, 3 samples with errors in the previous detection are re-detected, and the obtained detection results are completely consistent with the gene sequencing results, indicating that the synergistic composition improves the detection accuracy.
Example 5 saliva DNA sample ApoE genotyping assay
S1: taking saliva DNA samples with sample numbers of 5, 6 and 7 for further detection;
s2: adding D-calcium gluconate salt to the PCR reaction system shown in Table 2 to a final concentration of 5mmol/L, adding D-galacturonic acid to a final concentration of 20mmol/L, and adding 2. mu.L of DNA sample to perform PCR amplification reaction under the conditions shown in example 1;
s3: a melting curve is obtained and the ApoE genotype of the sample to be examined is interpreted as described in example 1.
TABLE 9 saliva DNA samples ApoE genotyping assay results
When D-calcium gluconate salt and D-galacturonic acid are added into a PCR system as a synergistic composition, 3 samples with errors in the previous detection are detected again, and the obtained detection result is completely consistent with the gene sequencing result, which shows that the detection accuracy can be improved by the composition of the D-calcium gluconate salt and the D-galacturonic acid.
Example 6 saliva DNA sample ApoE genotyping assay
S1: taking saliva DNA samples with sample numbers of 5, 6 and 7 for further detection;
s2: adding fructose-1, 6-diphosphate dicalcium salt to the PCR reaction system shown in Table 2 to a final concentration of 5mmol/L, adding vitamin C to a final concentration of 20mmol/L, and adding 2. mu.L of a DNA sample to perform PCR amplification reaction under the conditions shown in example 1;
s3: a melting curve is obtained and the ApoE genotype of the sample to be examined is interpreted as described in example 1.
TABLE 10 saliva DNA sample ApoE genotyping assay results
When 1, 6-fructose diphosphate dicalcium salt and vitamin C are added into a PCR system as a synergistic composition, errors still occur in the detection of a No. 5 sample, the gene sequencing result is E4/E2, and the detection result of the kit is E4/E4.
Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
Sequence listing
<110> Shenzhen Tianda biomedical apparatus Limited
<120> human ApoE genotyping detection kit
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
acgcgggcac ggctgtccaa gg 22
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggcgctcgcg gatggcgctg a 21
<210> 3
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
acatggagga cgtgtgcggc cgcctg 26
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aggcggcgca ggcccggct 19
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cccggcctgg tacactgc 18
<210> 6
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgccgatgac ctgcagaagc gcctggc 27
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tccaaagcaa gggctatcgg g 21
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctcagcgtat gcctcatcgt tg 22
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tccagttcag accgtgtaga aact 24
Claims (3)
1. A kit for human ApoE genotyping detection of a saliva DNA sample, the kit comprising a primer probe combination for ApoE2 genotyping detection, a primer probe combination for ApoE4 genotyping detection, an internal reference primer probe combination and PCR reaction liquid, wherein the primer probe combination for ApoE2 genotyping detection comprises: the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2, and the nucleotide sequence of the probe is shown as SEQ ID NO. 3; the primer probe combination for typing detection of ApoE4 comprises: the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 4, the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 5, and the nucleotide sequence of the probe is shown as SEQ ID NO. 6; the nucleotide sequences of the internal reference primer pair are shown as SEQ ID NO. 7 and SEQ ID NO. 8, and the nucleotide sequence of the internal reference probe is shown as SEQ ID NO. 9;
in the reaction system, the concentration range of the primer and the probe is 0.01-1 mu mol/L, and MgCl2The final concentration is 1.5-2.0mM, the final concentration of the mixed solution of four kinds of deoxyadenosine triphosphate (dNTPs) with equal concentration is 100-120nM, and the concentration of the hot start DNA polymerase is 1-2U/reaction;
the system also comprises a synergistic composition which is selected from the group consisting of a combination of fructose-1, 6-diphosphate dicalcium salt and D-gluconate calcium salt in a final concentration of 5-10mmol/L, a combination of fructose-1, 6-diphosphate dicalcium salt and D-galacturonic acid in a final concentration of 5-10mmol/L, a combination of D-gluconate calcium salt and D-galacturonic acid in a final concentration of 10-10 mmol/L, a combination of fructose-1, 6-diphosphate dicalcium salt in a final concentration of 5-10mmol/L and vitamin C in a final concentration of 10-50 mmol/L.
2. The kit according to claim 1, characterized in that the synergistic composition is selected from the group consisting of a combination of fructose-1, 6-diphosphate dicalcium salt and D-galacturonic acid, calcium D-gluconate salt and D-galacturonic acid.
3. The kit according to claim 2, wherein the synergistic composition is a combination of fructose-1, 6-diphosphate dicalcium salt and D-galacturonic acid, and the final concentration of fructose-1, 6-diphosphate dicalcium salt is 5mmol/L and the final concentration of D-galacturonic acid is 20mmol/L in the PCR reaction system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010231941.1A CN111269978B (en) | 2020-03-27 | 2020-03-27 | Human ApoE genotyping detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010231941.1A CN111269978B (en) | 2020-03-27 | 2020-03-27 | Human ApoE genotyping detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111269978A CN111269978A (en) | 2020-06-12 |
| CN111269978B true CN111269978B (en) | 2020-12-08 |
Family
ID=70996174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010231941.1A Active CN111269978B (en) | 2020-03-27 | 2020-03-27 | Human ApoE genotyping detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111269978B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112540179B (en) * | 2020-08-06 | 2023-07-07 | 武汉天德生物科技有限公司 | ELISA kit for testing content of ApoE4 protein |
| CN113943790A (en) * | 2021-10-25 | 2022-01-18 | 北京华夏时代基因科技发展有限公司 | Method for detecting ApoE single nucleotide polymorphism |
| CN114214401A (en) * | 2021-12-27 | 2022-03-22 | 四川大家医学检测有限公司 | Primer and kit for detecting ApoE genotype by PCR enzyme digestion typing and application of primer and kit |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1127120B1 (en) * | 1998-11-04 | 2008-05-28 | Serono Genetics Institute S.A. | Genomic and complete cdna sequences of human adipocyte-specific apm1 and biallelic markers thereof |
| CN103014138A (en) * | 2011-09-23 | 2013-04-03 | 深圳北京大学香港科技大学医学中心 | Method for determining correlation between single nucleotide polymorphism rs6887695 of IL-12b gene of Chinese Han people and systemic lupus erythematosus |
| CN105886608A (en) * | 2015-12-22 | 2016-08-24 | 武汉康昕瑞基因健康科技有限公司 | ApoE gene primer group, detection kit and detection method |
| CN107447030A (en) * | 2017-09-20 | 2017-12-08 | 苏州康吉诊断试剂有限公司 | The kit of Alzheimer's disease APOE genetic tests |
| CN110268269A (en) * | 2016-12-18 | 2019-09-20 | 赛隆特拉有限公司 | Using the gene that APOE4 motif mediates to be used for diagnosing and treating Alzheimer's disease |
-
2020
- 2020-03-27 CN CN202010231941.1A patent/CN111269978B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1127120B1 (en) * | 1998-11-04 | 2008-05-28 | Serono Genetics Institute S.A. | Genomic and complete cdna sequences of human adipocyte-specific apm1 and biallelic markers thereof |
| CN103014138A (en) * | 2011-09-23 | 2013-04-03 | 深圳北京大学香港科技大学医学中心 | Method for determining correlation between single nucleotide polymorphism rs6887695 of IL-12b gene of Chinese Han people and systemic lupus erythematosus |
| CN105886608A (en) * | 2015-12-22 | 2016-08-24 | 武汉康昕瑞基因健康科技有限公司 | ApoE gene primer group, detection kit and detection method |
| CN110268269A (en) * | 2016-12-18 | 2019-09-20 | 赛隆特拉有限公司 | Using the gene that APOE4 motif mediates to be used for diagnosing and treating Alzheimer's disease |
| CN107447030A (en) * | 2017-09-20 | 2017-12-08 | 苏州康吉诊断试剂有限公司 | The kit of Alzheimer's disease APOE genetic tests |
Non-Patent Citations (3)
| Title |
|---|
| Closed-tube genotyping of apolipoprotein E by isolated-probe PCR with multiple unlabeled probes and high-resolution DNA melting analysis;Matthew Dean Poulson et al.;《BioTechniques》;20070730;第43卷(第1期);摘要、第87页左栏第1段、右栏最后一段，第88页左栏第1、3段 * |
| Single tube optimisation of APOE genotyping based on melting curve analysis;Francesc Francés et al.;《Clinical Biochemistry》;20080408(第41期);923-926 * |
| 高分辨率熔解曲线法的非标记探针基因分型技术;丰贵鹏等;《生命的化学》;20101231;第30卷(第2期);314-317 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111269978A (en) | 2020-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111269978B (en) | Human ApoE genotyping detection kit | |
| CN114085903B (en) | Primer pair probe combination product for detecting mitochondria 3243A & gtG mutation, kit and detection method thereof | |
| US8206911B2 (en) | Identification of the gene and mutation responsible for progressive rod-cone degeneration in dog and a method for testing same | |
| CN110387407A (en) | For detecting primer combination of probe object, kit and the detection method of people's SLCO1B1 and ApoE Genotyping | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| CN110408685A (en) | For detecting primer combination of probe object, kit and the detection method of people's mthfr gene parting | |
| US20070275386A1 (en) | Polymorphisms in the Epidermal Growth Factor Receptor Gene Promoter | |
| CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
| CN109234370B (en) | MUT gene mutation detection kit | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN110846409A (en) | Primer combination for detecting TNNI3K gene mutation and application thereof | |
| US8137916B2 (en) | Susceptibility gene for alzheimer's disease | |
| CN114381515B (en) | Kit for detecting abnormal hemoglobin gene mutation | |
| CN116949143A (en) | Sequence composition for detecting MTHFR and MTRR genes, kit and application | |
| CN110863044A (en) | Primer combination for detecting VCL gene mutation and application thereof | |
| CN108504731B (en) | Method for diagnosing lipid metabolism-related diseases or Alzheimer's disease markers | |
| CN113462771A (en) | SNP marker combination, primer probe combination, kit and application in preparation thereof | |
| US20100255468A1 (en) | Method of assessing gene examination data, program therefor and apparatus of the same | |
| DE102017218522B3 (en) | Method for gene-based diagnosis of dyslexia risk | |
| CN107326064A (en) | Gene inversion mutation detection methods | |
| CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
| CN114622013B (en) | Juvenile idiopathic scoliosis detection product | |
| CN115927354B (en) | SH3TC2 gene pathogenic mutant and application thereof in preparation of fibula muscular atrophy 4C type diagnostic kit | |
| CN112553326B (en) | Primer, probe and fluorescent PCR kit for detecting neonatal jaundice UGT1A1 genotype and GST gene deletion type | |
| CN114317727B (en) | Fluorescent quantitative detection reagent for SMN gene copy number analysis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |