RU2798695C1 - Method of diagnosing mucopolysaccharidosis-plus syndrome - Google Patents

Abstract

FIELD: medicine; clinical laboratory diagnostics.

SUBSTANCE: invention can be used to diagnose the carriage of the mutant VPS33A gene with the c.1492C>T mutation leading to the development of mucopolysaccharidosis-plus syndrome with autosomal recessive inheritance in the Yakut population. DNA extraction is carried out. Polymerase chain reaction with fluorescent detection using a pair of primers and hydrolysis probes is conducted. The mutant type c.1492T in the VPS33A gene is diagnosed by the presence of a fluorescence signal through the FAM channel, the wild type c.1492C is diagnosed through the ROX channel, and the carriage of the mutant gene in the heterozygous state is diagnosed through the ROX and FAM channels.

EFFECT: method provides improved accuracy of c.1492C>T mutation detection in exon 12 of VPS33A gene, high sensitivity and specificity at a low cost of research, as well as increasing the availability of such studies through the use of two pairs of primers and hydrolysis probes labeled with fluorescent dyes ROX and FAM.

1 cl, 2 dwg, 1 tbl

Description

The invention relates to the field of medicine and molecular biology and can be used to diagnose a hereditary disease, namely, mucopolysaccharidosis-plus syndrome (MSPS).

Mucopolysaccharidoses (MPS) are a group of hereditary metabolic diseases related to lysosomal storage diseases and associated with a deficiency of enzymes responsible for the breakdown of glycosaminoglycans (GAGs) (see Sun, M. Lysosomal storage disease overview / M. Sun // Ann Transl Med - 2018. - Vol. 6, N 24. - P.476). Previously, a group of children with an MPS-like phenotype was identified in the Republic of Sakha (Yakutia) (Russian Federation). All of them were from Yakut families. The features of these children were the presence of frequent respiratory diseases, early infant mortality, the presence of GAG in the urine, but the absence of a decrease in the activity of lysosomal enzymes.

The conducted scientific research allowed to identify a new, previously not described disease from the group of hereditary metabolic diseases with an autosomal recessive type of inheritance - MSPS. For the first time, clinical manifestations of a new severe hereditary disease leading to mortality in early childhood were described (see Gurinova, E.E., Maksimova, N.R., Sukhomyasova, A.L. Clinical Description of a Rare Autosomal Recessive Syndrome in the Yakut Children / E.E. Gurinova, N.R. Maksimova, A.L. Sukhomyasova // YMJ. - 2014. - Vol. 2. - P. 14-18). Children with MPSS have coarse facial features, skeletal anomalies, heart damage, joint contracture, and psychomotor retardation. The disease is named as a "plus" in view of the fact that in addition to the clinical picture of MPS, patients with MPPS have additional disorders of the kidneys and the hematopoietic system. To date, there is no treatment. The prognosis is unfavorable, most of the MPSPS patients died of cardiorespiratory failure. The average life expectancy of patients with MPSPS is only 20 months (see Vasilev, F., Sukhomyasova, A., Otomo, T. Mucopolysaccharidosis-Plus Syndrome / F. Vasilev, A. Sukhomyasova, T. Otomo // Int J Mol Sci. - 2020. - Vol. 21, N 2. - P. 421). As a result of whole exome sequencing, the only molecular genetic cause of the disease was established - the c.1492C>T (p.R498W, rs767748011) mutation in the VPS33A gene (vacuolar protein sorting 33A) (see Mutation in VPS33A affects metabolism of glycosaminoglycans: a new type of mucopolysaccharidosis with severe systemic symptoms / H. Kondo, N. Maksimova, T. Otomo et al. // Hum Mol Genet. - 2017. - Vol. 26. - P. 173-183). The disease was included in the international database of hereditary diseases OMIM (#617303) in 2017.

The Vps33p protein was first described in the yeast Saccharomyces cerevisiae (see Morphological classification of the yeast vacuolar protein sorting mutants: Evidence for a prevacuolar compartment in class E vps mutants / C.K. Raymond, I. Howald-Stevenson, C.A. Vater et al. // Mol Biol Cell - 1992 - Vol 3 - P 1389-1402). It has been shown that Vps33p in yeast is involved in vacuolar biogenesis and transport of proteins from the Golgi apparatus to the vacuole (see Class C Vps protein complex regulates vacuolar SNARE pairing and is required for vesicle docking/fusion / T.K. Sato, P. Rehling, M.R. Peterson et al. // Mol Cell - 2000. - Vol. 6 - P. 66-71). In multicellular protein VPS33 has two homologues: VPS33A and VPS33B, they are 30% identical to each other (see Comparative evolutionary analysis of VPS33 homologues: Genetic and functional insights / P. Gissen, C.A. Johnson, D. Gentle et al. // Hum Mol Genet. - 2005. - Vol. 14. - P. 1261-1270). The function of the VPS33A protein is Rab-mediated binding and subsequent fusion of early endosomes through the CORVET (class C core vacuole/endosome tethering) complex and late endosomes with lysosomes through the HOPS (homotypic fusion and protein sorting complex) complexes (see Marks, M.S., Heijnen H.F. , Raposo, G. Lysosome-related organelles: Unusual compartments become mainstream / M.S. Marks, H.F. Heijnen, G. Raposo // Curr Opin Cell Biol - 2013. - Vol. 25. - P. 495-505). The VPS33A protein is the main subunit of these complexes. Both complexes are heterohexamers and consist of four common subunits: VPS33A, VPS11, VPS16, VPS18. They interact with Rab GTPases (guanosine triphosphatase) through the VPS3/VPS8 and VPS39/VPS41 subunits (see Balderhaar, H.J., Ungermann, C. CORVET and HOPS tethering complexes-coordinators of endosome and lysosome fusion / H.J. Balderhaar, C. Ungermann // J Cell Sci. - 2013. - Vol. 126. - P. 1307-1316). VPS33A also binds to syntaxin 17 (STX17) and promotes SNARE-mediated autophagosome-lysosome fusion (see The HOPS complex mediates autophagosome-lysosome fusion through interaction with syntaxin 17 / P. Jiang, T. Nishimura, Y. Sakamaki et al. // Mol Biol Cell - 2014 - Vol. 25 - P. 1327-1337). The VPS33A protein consists of 596 amino acids and has a molecular weight of 67.6 kDa. The VPS33A gene encodes the VPS33A protein, which consists of four domains: 1, 2, 3a, and 3b (see Baker, R.W., Jeffrey, P.D., Hughson, F.M. Crystal Structures of the Sec1/Munc18 (SM) Protein Vps33, Alone and Bound to the Homotypic Fusion and Vacuolar Protein Sorting (HOPS) Subunit Vps16 / R. W. Baker, P. D. Jeffrey, F. M. Hughson // PLoS ONE - 2013. - Vol. 8. - P. e67409). Currently, the c.1492C>T mutation in the VPS33A gene is the only cause responsible for the development of MPSPS. The clinical picture of the MPPS disease was detected only in homozygous carriers of the c.1492T allele. In the Yakut population, an extremely high frequency of this pathogenic variant (1:81) was revealed. The predictive value of the incidence rate in the Yakut population was 1:12,000 newborns (see Vasilev, F., Sukhomyasova, A., Otomo, T. Mucopolysaccharidosis-Plus Syndrome / F. Vasilev, A. Sukhomyasova, T. Otomo // Int J Mol Sci. - 2020. - Vol. 21, N 2. - P. 421).

Currently, there are several main methods for determining polymorphisms and mutations: restriction fragment length polymorphism (RFLP), allele-specific PCR, PCR with analysis of high-resolution melting curves (PCR-HRM, High Resolution Melt), direct sequencing, mass parallel sequencing, hybridization on oligonucleotide matrices, real-time PCR with fluorescence detection.

The methods of allele-specific PCR and PCR-RFLP are classical and have such advantages as simplicity and economy. The disadvantages of these methods are time-consuming, low specificity, high level of false positive results due to the accompanying risk of cross-contamination of the studied samples.

The PCR-HRM method is based on the amplification of DNA fragments followed by a high-resolution analysis of their melting curves. The method is express, cheap and easy to perform. The disadvantage of PCR-HRM is the relatively low reliability of the study results due to the possible influence of polymorphisms and other mutations localized in the studied locus on the melting curve. In addition, not all mutations are equally effective for detection by PCR-HRM, mutations of the C/T and G/A types are detected better due to the difference in hydrogen bonds.

Direct sequencing and mass parallel sequencing methods are widely used and provide complete information about the DNA sequence. At the same time, the disadvantages of the known methods are laboriousness, time-consuming, the use of expensive equipment and consumables, and the presence of highly qualified personnel. And the solution based on hybridization is used in high-throughput platforms based on biological microarrays with allele-specific probes. The known solution also requires expensive equipment and consumables, which is rather difficult to interpret.

The real-time PCR method is the simplest and cheapest solution, and allows the quantification of amplicons directly in the PCR process. The well-known method has been successfully used over the past five years in the largest diagnostic and research centers in the developed countries of the world, due to its ease of implementation, high reliability of the results obtained, saving production space, reducing the number of personnel and the demand for DNA/RNA quantification.

resonance energy transfer). Методика позволяет добиться высоких показателей чувствительности и специфичности, является универсальной, ее можно применить для диагностики любых полиморфизмов или мутаций.The real-time PCR method using allele-specific hydrolysis oligonucleotide probes (TaqMan technology) is a recognized standard in DNA research. The diagnostic technology is based on the use of linear oligonucleotides (probes) with a fluorophore and a quencher at the ends: the glow of the fluorophore attached to the desired DNA region will be absent until the DNA polymerase reaches the attachment point of the hybridization probe, after which the probe splits and gives glow. Cleavage of the probe occurs due to the 5'-nuclease activity of DNA polymerase. Fluorescence quenching is based on the phenomenon of resonant fluorescent energy transfer (FRET,

resonance energy transfer). The technique allows to achieve high sensitivity and specificity, is universal, it can be used to diagnose any polymorphisms or mutations.

When analyzing the state of the art, inventions were also identified using the PCR technique with fluorescent detection for diagnosing the carriage (determining the genotype) of other hereditary and multifactorial diseases, for example, see RU No. 2304170 (class C12Q1 / 68, publ. No. 2534817 (class C12N15/11, published 12/10/2014), RU No. 2505608 (class C12Q1/68, G01N33/50, published 01/27/2014), RU No. 2556808 (class C12Q1/68, published 20.07) .2015), RU No. 2518301 (cl. C12Q1/68, pub. 10.06.2014), RU No. 2675324 (cl. G01N33/50, C12Q1/68, pub. 12.18.2018), RU No. 2739943 (cl. C12Q1/ 68, published 12/30/2020), RU No. 2445368 (class C12Q1/68, published 03/20/2012), RU No. 2631824 (class C12Q1/68, published 09/26/2017), RU No. 2451086 (class C12Q1 /68, published on May 20, 2012). At the same time, direct analogues to the method for diagnosing MPSPS by PCR from the prior art have not been identified.

The objective of the claimed invention is to develop an optimal method for determining the human genotype by the c.1492C>T mutation in exon 12 of the VPS33A gene responsible for the development of mucopolysaccharidosis-plus syndrome.

The technical result of the invention is to simplify the method and increase the accuracy of determining the c.1492C>T mutation in exon 12 of the VPS33A gene, providing high sensitivity and specificity at a low cost of research, as well as increasing the availability of such studies, since the claimed solution can be implemented on standard known equipment.

This technical result is achieved by the fact that in the method, which includes isolation of DNA from peripheral blood lymphocytes, amplification is carried out in a mixture of Taq polymerase with 5'-exonuclease activity and two pairs of oligonucleotide sequences (primers and hydrolysis probes) labeled with various fluorescent dyes. The fluorescent dyes ROX and FAM are attached to the C nucleotide at the 5' ends of the hydrolysis probes. The fluorescence quenchers BHQ2 and RTQ1 were fused to the 3'-terminal nucleotide of A. The nucleotide sequences of the hydrolysis probes were chosen to hybridize to the inner region of the amplification product in the region where the target mutation c.1492C>T in the VPS33A gene is located (see Fig. table). The ROX/BHQ2 fluorescent dye/quencher pair probe was complementary to the wild type (c.1492C allele), and the FAM/RTQ1 probe was complementary to the mutant (c.1492T allele). If the probe does not hybridize during amplification, then a resonant energy transfer occurs from the excited fluorophore at the 5'-end of the probe to the quencher located at its 3'-end, as a result of which there will be no luminescence. If the probe is completely complementary to the DNA segment, then it will hybridize with the formation of a duplex. This duplex will then be cleaved by Taq polymerase, as a result of which the fluorophore and quencher molecules will be separated from each other. As a result, an increase in the fluorescence level of the dye will be observed. Measurement of the fluorescence intensity at wavelengths corresponding to the FAM and ROX fluorophores will make it possible to determine the genotype of the sample under study.

A comparative analysis of the features of the claimed solution with the features of analogues indicates the compliance of the claimed solution with the criterion of "novelty". The set of features of the invention provides a solution to the claimed technical problem, namely, obtaining a molecular genetic method for diagnosing a hereditary disease mucopolysaccharidosis-plus syndrome, including the selection of specific original sequences of oligonucleotides (primers), allele-specific hydrolysis probes and optimization of conditions for real-time PCR with fluorescent detection. Brief description of the figures:

The claimed technical solution is illustrated by a drawing, where figure 1 shows the results of amplification on a 3% agarose gel, while the length of the amplification fragments is 266 base pairs (bp) (M - marker pUC19 / MspI; 1, 5 - patients with MPPS, homozygotes c.1492C>T mutation in the VPS33A gene, 2, 6 - parents of MPPS patients, heterozygous carriers of the c.1492C>T mutation in the VPS33A gene, 3, 7 - conditionally healthy individuals, carriers of the wild-type allele (the c.1492C allele in the gene VPS33A); 4, 8 - deionized water); figure 2 - an example of the interpretation of the results obtained using the developed primers and probes for real-time PCR, in the form of a graph of the distribution of genotypes by the studied locus (circles - patients with MPPS, homozygotes for the c.1492C>T mutation in the VPS33A gene; triangles - heterozygous carriers of the c.1492C>T mutation in the VPS33A gene, squares are conditionally healthy individuals carrying the wild-type allele (c.1492C allele in the VPS33A gene), rhombuses are deionized water.

The claimed method is carried out as follows.

Genomic DNA is isolated from biological material. It is recommended to use venous peripheral blood as a material for research. Isolation of DNA from biological material is carried out by the standard method of phenol-chloroform extraction or using commercial reagent kits. The concentration of isolated DNA samples is measured by spectrophotometric method. Then the studied DNA samples are diluted with deionized water to a concentration of 30 ng/µl.

Before amplification, the PCR mixture, primers, probes, and DNA samples are completely thawed, thoroughly mixed on a vortex, followed by centrifugation.

The amplification reaction is carried out on a programmable thermal cycler with an optical fluorescence detection system in a volume of 15 µl of the reaction mixture of the following composition: 1 µl of a mixture of forward and reverse primers (10 pmol/µl of each primer), 1 µl of each probe (10 pmol/µl), 6 µl of 2 5x PCR buffer (KCl, Tris-HCl pH8.8, 6.25 mM MgCl ₂ , Taq DNA polymerase 5u/µl, 2.5 mM dNTP), 5 µl deionized water, 1 µl 30 ng genomic DNA /µl. The figure 1 shows the results of amplification in agarose gel. The real-time PCR reaction was carried out under the following conditions: initial 95°C denaturation for 5 minutes followed by 40 amplification cycles, each consisting of a 95°C denaturation step for 15 seconds and a combined 60°C anneal-elongation step in within 50 seconds.

After passing the PCR, the results should be analyzed using the thermal cycler software with the possibility of real-time PCR (“Allelic Discrimination”). If there is a fluorescence signal through the FAM channel, the sample will be diagnosed as containing the c.1492C>T mutation in the VPS33A gene. A sample positive for the ROX fluorophore is interpreted as normal (wild type). In the presence of two fluorescence signals FAM and ROX, the result should be interpreted as a heterozygous state/carrying of the c.1492C>T mutation in the VPS33A gene (see figure 2).

The developed method for diagnosing a hereditary disease was tested by testing genomic DNA samples from 15 MPPS patients, 15 relatives of MPPS patients, and 15 apparently healthy individuals living in the Republic of Sakha (Yakutia). Molecular genetic studies of the carriage of the c.1492C>T mutation in the VPS33A gene in these samples were examined four times. Previously, the diagnosis of patients with MPSPS and their relatives (carriers of the c.1492C>T mutation in the VPS33A gene) was carried out using the Sanger direct sequencing method. A molecular study using the developed method showed that all MPSPS patients were homozygous for the c.1492C>T mutation in the VPS33A gene, and their relatives (parents) were heterozygous carriers of this pathogenic variant. All controls were carriers of the wild-type allele (allele c.1492C in the VPS33A gene).

Thus, the claimed method for diagnosing mucopolysaccharidosis-plus syndrome makes it possible to make an accurate diagnosis, conduct prenatal DNA diagnostics and prospective medical genetic counseling for those entering into marriage. The technical solution is simple to implement, accurate and affordable for implementation in the conditions of a molecular genetic laboratory.

Table
Oligonucleotide primers and probes for detection of the c.1492C>T mutation in the VPS33A gene Primer / Probe Sequence (5'-3') Primer (straight) CCAAAAGGCCACAGTCAGGT Primer (reverse) TCTGTAGATGCTGGACTGGGA Probe (wild type) ROX-CTCAGTGTGCGGCTGGCCCA-BHQ2 Probe (mutant type) FAM-CTCAGTGTGTGGCTGGCCCA-RTQ1

Claims (1)

A method for diagnosing the carriage of the mutant VPS33A gene with the c.1492C>T mutation, leading to the development of mucopolysaccharidosis-plus syndrome with autosomal recessive inheritance in the Yakut population, including DNA isolation and polymerase chain reaction with fluorescent detection using a pair of primers CCAAAAGGCCACAGTCAGGT; TCTGTAGATGCTGGACTGGGA and hydrolysis probes ROX-CTCAGTGTGCGGCTGGCCCA-BHQ2; FAM-CTCAGTGTGTGGCTGGCCCA-RTQ1, where the mutant type c.1492T in the VPS33A gene is diagnosed by the presence of a fluorescence signal via the FAM channel, the wild type c.1492C in the VPS33A gene is diagnosed via the ROX channel, and carrying the mutant gene in the heterozygous state via the ROX and FAM channels.

Images