KR20110017005A - Ｔｇｆ-베타 수용체 유전자 발현 억제용 조성물 및 방법 - Google Patents

Ｔｇｆ-베타 수용체 유전자 발현 억제용 조성물 및 방법 Download PDF

Info

Publication number
KR20110017005A
KR20110017005A KR1020117000895A KR20117000895A KR20110017005A KR 20110017005 A KR20110017005 A KR 20110017005A KR 1020117000895 A KR1020117000895 A KR 1020117000895A KR 20117000895 A KR20117000895 A KR 20117000895A KR 20110017005 A KR20110017005 A KR 20110017005A
Authority
KR
South Korea
Prior art keywords
base
modified
mod
artificial sequence
dsrna
Prior art date
Application number
KR1020117000895A
Other languages
English (en)
Inventor
버지트 브램라제
마르쿠스 호스바흐
파멜라 탄
한스-피터 보른로쳐
Original Assignee
에프. 호프만-라 로슈 아게
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 에프. 호프만-라 로슈 아게 filed Critical 에프. 호프만-라 로슈 아게
Publication of KR20110017005A publication Critical patent/KR20110017005A/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification

Abstract

본 발명은 길이가 30 뉴클레오타이드 미만이고 TGF-베타 수용체 I형 유전자의 적어도 일부에 실질적으로 상보성인 뉴클레오타이드 서열을 갖는 안티센스 가닥을 포함하는, TGF-베타 수용체 I형 유전자의 발현 억제용 이중-가닥 라이보핵산(dsRNA)에 관한 것이다. 본 발명은 또한 약학적으로 허용가능한 담체와 함께 dsRNA 또는 핵산 분자 또는 이를 암호화하는 벡터를 포함하는 약학 조성물; 약학 조성물을 이용하여 TGF-베타 수용체 I형 유전자의 발현에 의해 야기되는 질병을 치료하는 방법; 및 세포에서 TGF-베타 수용체 I형 유전자의 발현을 억제하는 방법에 관한 것이다.

Description

ＴＧＦ-베타 수용체 유전자 발현 억제용 조성물 및 방법{COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TGF-BETA RECEPTOR GENES}
본 발명은 이중 가닥 라이보핵산(dsRNA), 및 TGF-베타 수용체 유전자의 억제, 특히 TGF-베타 수용체 I형 발현의 억제를 위해 RNA 간섭을 매개하는데 있어 이들의 용도에 관한 것이다. 또한 섬유증 질병/질환, 염증 및 증식성 질환, 예를 들면 암을 치료하는데 있어 상기 dsRNA의 용도 또한 본 발명의 일부이다.
형질전환 성장 인자-베타(TGF-베타; AfCS ID A002271)는 40종 이상인 사이토카인의 TGF-베타 슈퍼패밀리의 일부이다. TGF-베타 그 자체는 TGF-베타1, TGF-베타2 및 TGF-베타3을 비롯한 3가지 이상의 동형체를 갖는다. 각각은 동종이량체이고, TGF-베타 동형체와 TGF-베타 슈퍼패밀리의 다른 부재 사이에서 이종이량체가 또한 형성될 수 있긴 하다. TGF-베타는 잠재성 TGF-베타 결합 단백질(LTBP)과 잠재성-관련된 펩타이드(LAP; Latency-associated peptide)라는 2가지 다른 폴리펩타이드와 복합체를 형성한 잠재성 형태로 대식세포를 비롯한 많은 유형의 세포에 의해 분비된다. 혈청 프로테이나제, 예를 들면 플라스민은 복합체로부터 활성 TGF-베타의 방출을 촉매화한다. 이는 잠재성 TGF-베타 복합체가 이의 리간드인 트롬보스폰딘-1(TSP-1)을 통해 CD36에 결합되는 대식세포의 표면 상에서 일어난다. 대식세포를 활성화시키는 염증 자극은 플라스민의 활성화를 촉진시킴으로써 활성 TGF-베타의 방출을 개선시킨다. 대식세포는 또한 혈장 세포에 의해 분비되는 IgG-결합된 잠재성 TGF-베타 복합체를 세포 내로 흡수한 후, 활성 TGF-베타를 세포외 유체로 방출할 수 있다.
I형 및 II형 TGF-베타 수용체 둘 모두(AfCS ID A002272/A002273) TGF-베타에 대한 신호전달 반응에 관여한다. 둘 모두 세포질 세린-트레오닌 키나제 도메인을 갖는 I형 일체형 막 단백질이다. II형 수용체는 리간드 부재하에서 동종이량체를 형성하고, 서로를 자가인산화시킬 수 있다. II형 수용체는 I형 수용체와는 독립적으로 TGF-베타에 결합할 수 있고, 이들이 리간드 특이성의 주된 결정자이다. I형 수용체는 또한 리간드 없이 동종이량체를 형성할 수 있지만, II형 수용체의 부재하에서는 리간드에 효과적으로 결합하지 않는다. 리간드의 존재 하에서, I형 및 II형 수용체는 높은 결합활성(avidity)의 수용체 복합체를 형성한다. 그런 다음, II형 수용체는 I형 수용체를 인산화시켜, 이들의 활성화를 이끌어낸다.
Smad 전사 인자(하기에 상세히 개시됨)의 직접적 활성화에 추가하여, TGF-베타 수용체가 Ras, RhoA 및 TGF-베타-활성화된 키나제(TAK)를 통해 ERK, JNK 및 p38 MAP 키나제를 활성화시킬 수 있다는 일부 증거가 있다. 다른 보고서는 TGF-베타 수용체가 PI 3-키나제 및 단백질 포스파타제 2A를 통해 신호전달할 수 있다고 제안한다. TGF-베타 수용체가 비-Smad 신호전달 경로를 활성화시키는 기작은 잘 이해되고 있지 않다.
우선, TGF-베타 수용체는 Smad라 불리는 잠재성 세포질 전사 인자를 통해 신호전달한다. 용어 Smad는 상동성 초파리 Mad 단백질("mothers against decapentaplegic"의 약자) 및 카에노하브디티스 엘레간스(C. elegans) Sma 단백질("small"의 약자)의 이름으로부터 유래된다. 리간드 결합시, 인산화된 I형 TGF-베타 수용체는 수용체-조절된 Smad(R-Smad)인 Smad1, 2, 3, 5 및 8에 결합하여 인산화시킨다. R-Smad의 TGF-베타 수용체 복합체로의 결합은 SARA라 불리는 FYVE 도메인-함유 어댑터 단백질에 의해 용이해지고, 수용체가 엔도솜으로 내부화된 후에 일어날 수 있다. 일단 인산화되면, R-Smad는 수용체 복합체로부터 분리되어, 동종삼량체를 형성하여, Smad의 공통 매개자(Co-Smad)인 Smad4에 결합한다. R-Smad/Smad4 복합체는 핵으로 이동하여 조직-특이적 전사 공활성화제 또는 공억제제와의 상호작용에 의해 유전자 전사를 조절한다. R-Smad 및 Smad4의 Mad 상동성 1(MH1) 도메인은 5'-AGACC-3' Smad-결합 요소(SBE)에 결합한다.
TGF-베타 수용체 신호전달은 Smad7 억제성 Smad(I-Smad)에 의해 부정적으로 조절된다. Smad7과 Smurf2 E3 리가제의 복합체는 TGF-베타 수용체로의 결합에 대해 SARA와 경쟁하여 TGF-베타 수용체 복합체의 유비퀴틴화 및 분해를 촉진한다. Ras/ERK 경로는 또한 핵으로의 TGF-베타 신호전달을 약화시킨다. ERK에 의한 R-Smad의 인산화가 이들의 핵 축적을 방해한다.
TGF-베타는 열거하기에는 너무 많은 광범위한 생물학적 활성을 갖고 있다. 이는 많은 유형의 세포의 성장을 억제하지만, 또한 세포의 증식과 활성화를 유도할 수 있다. 최근에는 TGF- 베타 수용체 신호전달의 억제가 래트 경동맥 손상 모델에서 협착증의 형성을 방지할 수 있는 것으로 입증되었다([Fu et al., Arteriosclerosis, Thrombosis, and Vascular Biology 2008, 28:665]). 또한, TGF-베타 수용체 II형의 증가된 발현이 당뇨성 대혈관 합병증의 전개에 중요한 역할을 하는 것을 보인다([Hosomi et al., Atherosclerosis. 2002, 162:69-76]). TGF-베타는 일반적으로 섬유성 조직의 형성에 관여하여왔고, TGF-베타의 TGF-베타 수용체로의 결합을 억제하면 섬유증을 경감시킬 수 있는 것으로 보인다([Yata et al, Hepatology 2003, 35:1022-1030]).
RNA 간섭(RNAi)으로 알려진 매우 보존된 조절 기작에서 이중 가닥 RNA 분자(dsRNA)가 유전자 발현을 차단하는 것으로 나타났다. 제WO99/32619호(파이어(Fire) 등)은 씨. 엘레간스에서 TGF-베타 수용체 유전자의 발현을 억제하기 위해 길이가 25 뉴클레오타이드 이상인 dsRNA의 용도를 개시하고 있다.
간에서, 정상적으로는 비실질 성상 세포에서 생성되는 TGF-베타의 주 기능은 DNA 합성을 억제하고 세포사멸(apoptosis)을 유도함으로써 상처에 대한 반응으로 간세포의 재생성 성장을 제한하는 것이다. 만성 간염에 의해 야기될 수 있는 간세포 암종(HCC) 환자의 간에서는 높은 수준의 TGF-베타가 생성된다. TGF-베타의 수준은 HCC 진행과 잘 관련되어 있다. 그러나, HCC 세포가 TGF-베타 유도된 성장 억제에 민감하지 않도록 TGF-베타-수용체 II가 HCC 세포에서 하향 조절된다. 따라서, HCC에서 TGF-베타의 기능에 대한 현재의 가설은 TGF-베타가 면역계를 억제함으로써 HCC 세포가 면역 세포 공격을 피하는 것을 돕는다는 것이다. HCC 세포는 성장 및 전이를 선호하는 대안적인 TGF-베타 신호전달 경로를 이용할 수 있다. TGF-베타-수용체 I 억제제가 HCC 유래된 간 섬유증에 대한 전임상 연구에 이용되어왔다.
RNAi 분야에서의 상당한 진전 및 섬유증, 및 암과 같은 증식성 질환의 치료에서의 진전에도 불구하고, TGF-베타 수용체 유전자를 선택적 및 효율적으로 침묵시킬 수 있는 약제에 대한 필요성이 남아있다.
RNAi의 이용은 섬유증 질환, 예를 들면 간 섬유증 및 간경변, 신장 섬유증, 비장의 섬유증, 췌장 및 폐의 낭포성 섬유증, 사출 섬유증, 심내막심근 섬유증, 폐의 특발성 폐 섬유증, 종격섬유증, 골수섬유증, 후복막 섬유증, 진행성 괴상 섬유증, 신장기원 전신성 섬유증, 확산성 실질세포 폐 질환, 정관절제후 통증 증후군 및 류마티스 관절염의 치료를 위한 치료 활성 물질의 개발에서 실행가능한 경로이다. 다르게는, TGF-베타 수용체 발현의 억제제, 특히 본 발명의 dsRNA 분자를 이용한 TGF-베타 수용체 I의 발현의 억제가 암, 예를 들면 간암, 예컨대 HCC의 치료에 이용될 수 있다.
본 발명은 이중 가닥 라이보핵산 분자(dsRNA) 및 이런 dsRNA를 이용하여 세포, 조직 또는 포유동물에서 TGF-베타 수용체 유전자의 발현, 특히 TGF-베타 수용체 I형 유전자의 발현을 억제하기 위한 조성물 및 방법을 제공한다. 본 발명은 또한, TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 발현에 의해 야기되는 병리학적 질환 및 질병, 예를 들면 섬유증, 염증 및 증식성 질환을 치료하기 위한 조성물 및 방법을 제공한다. 본 발명의 이중 가닥 라이보핵산 분자는 TGF-베타 수용체 I형 유전자, 특히 포유동물 및 인간의 TGF-베타 수용체 I형 유전자의 발현을 시험관 내에서 80% 이상 억제할 수 있는 능력을 특징으로 한다. 한 바람직한 양태에서, 본 발명의 이중 가닥 라이보핵산 분자는 센스 가닥, 및 상기 센스 가닥에 적어도 부분적으로 상보적인 안티센스 가닥을 포함하며, 여기서, 센스 가닥은 TGF-베타 수용체를 암호화하는 mRNA의 적어도 일부에 대해 90% 이상의 동일성을 갖는 서열을 포함하며, (i) 상기 서열은 안티센스 가닥에 대한 센스 가닥의 상보성 영역에 위치하고, (ii) 상기 서열의 길이가 30개 뉴클레오타이드 미만이다.
본 발명의 dsRNA는 길이가 30개 뉴클레오타이드 미만이고, TGF-베타 수용체 I형 유전자의 mRNA 전사체의 적어도 일부에 실질적으로 상보적인 영역을 갖는 RNA 가닥(안티센스 가닥)을 포함한다. 이들 dsRNA를 이용하면 다른 것들 중에서도 포유동물의 증식성 질환, 예를 들면 간암과 같은 암, 섬유증 반응, 염증 사건에 관여하는 TGF-베타 수용체 I형의 mRNA의 표적화된 분해가 가능해진다. 세포에 근거한 분석법 및 동물 분석법을 이용하여, 본 발명자는 이들 dsRNA의 매우 낮은 투여량이 RNAi를 특이적으로 그리고 효과적으로 매개할 수 있어서, 결과적으로 상기 TGF-베타 수용체 유전자의 발현을 상당히 억제할 수 있음을 입증하였다. 따라서, 이들 dsRNA를 포함하는 본 발명의 방법 및 조성물은 바람직하지 않은 TGF-베타 수용체 I형 발현이 일어나는 질환의 치료에 유용하다. 이런 질환은 섬유증 질환, 염증, 및 암/종양과 같은 증식성 질환을 포함한다.
상응하는 dsRNA 분자가 본 발명에 제공되고, 가장 바람직한 dsRNA 분자는 하기 표 1 및 3에 제공되고, 그 중에서도, 첨부된 서열번호 쌍 1/2, 117/118, 103/104, 31/32, 81/82, 99/100, 23/24, 13/14, 29/30 및 7/8에 제공된다. 본원에 제공된 특이적 dsRNA 분자의 측면에서, 서열번호의 쌍은 첨부되고 포함된 표에 도시된 바와 같이 상응하는 센스 및 안티센스 가닥 서열(5'에서 3')에 관한 것이다.
또한, 개질된 dsRNA 분자가 본원에 제공되고, 특히 본 발명의 이런 "개질된 dsRNA 분자"의 예시적인 예를 제공하는 표 3에 개시되어 있다. 이런 측면에서 바람직한 분자는 서열번호/쌍 151/152, 249/250, 261/262, 231/232, 275/276, 253/254, 211/212, 265/266, 181/182, 185/186, 209/210, 299/300, 295/296, 279/280 및 219/220으로 표현된다. 본 발명의 dsRNA의 이러한 구성의 예시적인 개질이 본원에 개질의 예로서 제공되어 있다. 또한 이들 dsRNA(및 이들의 구성요소)의 추가의 개질이 본 발명의 한 실시양태로서 포함되어 있다. 상응하는 예는 본 발명의 보다 상세한 설명에 제공되어 있다.
한 실시양태에서, 본 발명은 TGF-베타 수용체 유전자의 발현, 특히 포유동물 또는 인간 TGF-베타 수용체 I형 유전자의 발현을 억제하기 위한 이중 가닥 라이보핵산(dsRNA) 분자를 제공한다. 인간 TGF-베타 수용체 I형 유전자의 코딩 서열은 관련 데이터 베이스, 예를 들면 진뱅크(Genebank)/EMBL. NM_004612.2에서 수득될 수 있다. 본원에서 TGF-베타 수용체 I형 유전자를 위한 기준 서열로서 작용하는 한가지 코딩 서열은 첨부된 서열 번호 326에 제공되어 있다.
dsRNA는 서로에 대해 상보적인 2개 이상의 서열을 포함한다. dsRNA는 제 1 서열을 포함하는 센스 가닥을 포함하고, 안티센스 가닥은 제 2 서열을 포함할 수 있으며, 또한 첨부된 표 1 및 3의 특이적 dsRNA 쌍을 참고할 수 있다. 안티센스 가닥은 TGF-베타 수용체를 암호화하는 mRNA의 적어도 일부에 실질적으로 상보적인 뉴클레오타이드 서열을 포함할 수 있고, 상보성 영역은 가장 바람직하게는 30개 미만의 뉴클레오타이드 길이를 갖는다. 또한, 본원에 개시된 본 발명의 dsRNA 분자(듀플렉스(duplex) 길이)의 길이는 약 16 내지 30개 뉴클레오타이드의 범위이고, 특히 약 18 내지 28개 뉴클레오타이드의 범위이다. 약 19, 20, 21, 22, 23 또는 24개 뉴클레오타이드의 듀플렉스 길이가 본 발명에서 특히 유용하다. 19, 21 또는 23개 뉴클레오타이드의 듀플렉스 스트레치가 가장 바람직하다. dsRNA는 TGF-베타 수용체를 발현하는 세포와 접촉하였을 때 TGF-베타 수용체 I형 유전자를 시험관 내에서 80% 이상 억제한다.
이런 시험관내 억제를 시험할 수 있는 비-한정적 분석법이 첨부된 실시예에 제공되어 있고, 실시예에서 본 발명의 siRNA/dsRNA 및 본원에 개시된 siRNA/dsRNA의 활성은 HeLa 세포, 특히 HeLaS3 세포에서 시험되었다. TGF-베타 수용체 특이적 siRNA 분석법을 이용하여 배양된 세포로부터 단리된 총 mRNA중의 분지된 DNA에 의해 배양액중의 이들 HeLa 세포를 TGF-베타 수용체 I형 mRNA의 정량에 이용하였다. 이러한 억제는 특히 시험관 내에서 측정될 수 있다. 상응하는 분석법은 당 분야의 숙련자들에 의해 쉽게 확립될 수 있고, 또한 본원에 제공된다. 예를 들면 첨부된 실시예 또는 본원에 제공된 표에 도시된 바와 같이, 본 발명의 dsRNA는 가장 바람직하게는 30nM의 농도에서 인간 TGF-베타 수용체 I형의 발현을 시험관 내에서 약 80% 이상 억제한다. 본 발명의 특정한 dsRNA 분자는 보다 더 낮은 농도(예를 들면 300pM)에서 TGF-베타 수용체 I형의 발현을 시험관 내에서 약 80% 이상 억제한다. 또다시, 상응하는 예가 표 1 및 2에 제공되어 있고, 상기 표에서, 억제는 분석된 세포에서 남아있는 RNA의 양으로 도시된다.
한 실시양태에서, 센스 가닥은 TGF-베타 수용체 I형을 암호화하는 mRNA의 적어도 일부와 90% 이상의 동일성을 갖는 서열을 포함한다. 상기 서열은 안티센스 가닥에 대한 센스 가닥의 상보성 영역, 바람직하게는 안티센스 가닥의 5' 말단의 뉴클레오타이드 2 내지 7 이내에 위치한다. 한 바람직한 양태에서, dsRNA는 특히 인간 TGF-베타 수용체 I형 유전자를 표적으로 하고, 또다른 실시양태에서, dsRNA는 마우스(Mus musculus) 및 래트(Rattus norvegicus) TGF-베타 수용체 I형 유전자를 표적으로 한다.
한 실시양태에서, 본 발명의 dsRNA 분자는 센스 및 안티센스 가닥으로 구성되며, 여기서 양 가닥은 모두 5시간 이상의 반감기를 갖는다. 한 바람직한 실시양태에서, 본 발명의 dsRNA 분자는 센스 가닥과 안티센스 가닥으로 구성되며, 여기서 양 가닥은 인간의 혈청에서 5시간 이상의 반감기를 갖는다.
다른 실시양태에서, 본 발명의 dsRNA 분자는 비-면역자극성이고, 예를 들면 시험관내에서 INF-알파 및 TNF-알파를 자극하지 않는다.
본 발명의 dsRNA 분자는 자연 발생 뉴클레오타이드로 구성될 수 있거나, 또는 하나 이상의 개질된 뉴클레오타이드, 예를 들면 2'-O-메틸 개질된 뉴클레오타이드, 5'-포스포로티오에이트 기를 포함하는 뉴클레오타이드, 및 콜레스테릴 유도체 또는 도데칸산 비스데실아미드 기에 연결된 말단 뉴클레오타이드로 구성될 수 있다. 2' 개질된 뉴클레오타이드는 본 발명의 dsRNA 분자가 생체 내에서, 예를 들면 의학적 설정에서 이용되는 경우 일부 면역자극성 인자 또는 사이토카인이 억제되는 추가의 이점을 가질 수 있다. 다른, 비-제한적인 개질된 뉴클레오타이드는 2'-데옥시-2'-플루오로 개질된 뉴클레오타이드, 2'-데옥시-개질된 뉴클레오타이드, 락킹된(locked) 뉴클레오타이드, 어베이직(abasic) 뉴클레오타이드, 2'-아미노-개질된 뉴클레오타이드, 2'-알킬-개질된 뉴클레오타이드, 모폴리노 뉴클레오타이드, 포스포르아미데이트 및 비-천연 염기 포함 뉴클레오타이드의 군에서 선택될 수 있다. 한 바람직한 실시양태에서, dsRNA 분자는 하기의 개질된 뉴클레오타이드중 하나를 포함한다: 2'-O-메틸 개질된 뉴클레오타이드, 5'-포스포로티오에이트 기를 포함하는 뉴클레오타이드 및 데옥시티미딘. 다른 바람직한 실시양태에서, 센스 가닥의 모든 피리미딘은 2'-O-메틸 개질된 뉴클레오타이드이고, 안티센스 가닥의 모든 피리미딘은 2'-데옥시-2'-플루오로 개질된 뉴클레오타이드이다. 한 바람직한 실시양태에서, 2개의 데옥시티미딘 뉴클레오타이드중 하나는 dsRNA 분자의 양 가닥의 3'에서 발견된다. 다른 실시양태에서, dsRNA 분자의 양 가닥의 3' 말단에서의 이들 데옥시티미딘 뉴클레오타이드중 하나 이상은 5'-포스포로티오에이트 기를 포함한다. 다른 실시양태에서, 2'-O-메틸 개질된 뉴클레오타이드의 센스 가닥에서 모든 사이토신 다음에는 아데닌이 있고, 모든 우라실 다음에는 아데닌, 구아닌 또는 우라실중 하나가 있고, 2'-O-메틸 개질된 뉴클레오타이드의 안티센스 가닥에서 모든 사이토신 및 우라실 다음에는 아데닌이 있다. 첨부된 표 3에, 예시적인 개질된 이중 가닥 RNA 분자가 제공되어 있다.
본 발명의 dsRNA는 하나 이상의 단일 가닥 뉴클레오타이드 돌출부(overhang)를 추가로 포함할 수 있다. 상기 개시된 바와 같이, 이들 돌출부는 특히 각각의 개별적인 가닥의 3' 말단에 있을 수 있고, 1, 2, 3, 4 또는 5개의 추가 뉴클레오타이드를 포함할 수 있다. 첨부된 실시예에 예시된 바와 같이 0, 1 또는 2개의 추가의 뉴클레오타이드를 갖는 돌출부가 특히 흥미롭다. 일부 실시양태에서, 추가의 뉴클레오타이드는 "T", 바람직하게는 2개의 "T"이고, 즉, 각각의 가닥의 3' 말단 상에 "TT"를 갖는 돌출부이다.
본 발명의 dsRNA 분자는 표 1 또는 3의 센스 가닥으로 구성된 군에서 선택되는 dsRNA의 제 1 서열 및 표 1 또는 3의 안티센스 서열로 구성된 군에서 선택되는 제 2 서열로 구성될 수 있다. 이들 2개의 서열의 바람직한 쌍이 표의 한 줄/열 이내에 제공되어 있다.
바람직하게는, dsRNA는 2개의 올리고뉴클레오타이드를 포함하고, 여기서 하나의 올리고뉴클레오타이드(센스)가 표 1에 개시되어 있고 제 2 올리고뉴클레오타이드(안티센스)가 표 1에 개시되어 있거나, 또는 하나의 개질된 올리고뉴클레오타이드(센스)가 표 3에 개시되어 있고 제 2 올리고뉴클레오타이드(안티센스)가 또한 표 3에 개시되어 있다. 2개의 표 모두 각각의 개별적인 열에 특히 유용한 센스 및 안티센스 가닥 서열을 제공하고, 둘 모두 5'에서 3'의 방향으로 제공되어 있으며, 각각의 개별적인 열에서의 이들 서열이 본 발명의 개별적인 dsRNA에서 이용되는 바람직한 서열이다.
따라서, 본 발명의 dsRNA의 제 1 서열은 표 1(또는 3)의 센스 서열로 구성된 군에서 선택될 수 있고, 제 2 서열은 표 1(또는 3)의 안티센스 서열로 구성된 군에서 선택될 수 있으며, 여기서 표 3은 예시적인 2'-O-메틸-개질된 서열을 제공한다.
본 발명은 또한 본 발명의 dsRNA중 하나 이상을 포함하는 세포를 제공한다. 세포는 바람직하게는 포유동물 세포, 예를 들면 인간 세포이다. 또한, 상기 정의된 dsRNA 분자를 포함하는 조직 및/또는 비-인간 유기체가 본 발명에 포함되며, 이에 의해 비-인간 유기체는 조사 목적 또는 예를 들면 또한 약물 시험에서의 조사 수단으로 특히 유용하다.
본 발명은 또한 본 발명의 dsRNA를 포함하는 약학 조성물에 관한 것이다. 이들 약학 조성물은 세포, 조직 또는 유기체에서 TGF-베타 수용체 I형 유전자의 발현의 억제에 특히 유용하다. 본 발명의 하나 이상의 dsRNA를 포함하는 약학 조성물은 또한 (a) 약학적으로 허용가능한 담체, 희석제 및/또는 부형제를 포함할 수 있다. 따라서, 본 발명의 일부 양태는, 본 발명의 dsRNA를 선택적으로 약학적으로 허용가능한 담체와 함께 포함하는 약학 조성물, 이런 약학 조성물을 이용하여 TGF-베타 수용체 I형 유전자의 발현을 억제하는 방법, 및 TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 발현에 의해 야기되는 질병을 치료하기 위해 약학 조성물을 이용하는 방법을 제공한다.
또한, 본 발명은
(a) 본원에 정의된 바와 같은 이중-가닥 라이보핵산(dsRNA)를 세포, 조직 또는 유기체에 도입하는 단계;
(b) (a) 단계에서 생성된 상기 세포, 조직 또는 유기체를 TGF-베타 수용체 I형 유전자의 mRNA 전사물의 분해를 수득하기에 충분한 시간동안 유지시켜서 주어진 세포에서 TGF-베타 수용체 I형 유전자의 발현을 억제하는 단계
를 포함하는, 세포, 조직 또는 유기체에서 TGF-베타 수용체 유전자, 특히 포유동물 또는 인간 TGF-베타 수용체 I형 유전자의 발현을 억제하는 방법에 관한 것이다.
다른 실시양태에서, 본 발명은 본 발명의 치료 또는 예방 효과량의 하나 이상의 dsRNA를 섬유증 질환/질병, 염증 또는 증식성 질환의 치료, 예방 또는 관리가 필요한 대상에게 투여함을 포함하는, 섬유증 질환/질병, 염증 또는 증식성 질환을 치료, 예방 또는 관리하기 위한 방법을 제공한다.
본 발명은 또한 본원에 정의된 이중 가닥 라이보핵산 분자에 포함된 센스 가닥 및/또는 안티센스 가닥을 암호화하는 핵산 서열을 제공한다. 다른 실시양태에서, 본 발명은 본 발명의 하나의 dsRNA의 하나 이상의 가닥을 암호화하는 뉴클레오타이드 서열에 작용가능하게 연결된 조절 서열을 포함하는, 세포에서 TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 발현을 억제하기 위한 벡터를 제공한다. 이런 본 발명의 핵산 분자 또는 벡터는 세포, 조직 또는 비-인간 유기체에 포함될 수 있다. 이런 비-인간 유기체는 유전자 도입된, 비-인간 동물일 수 있다. 본 발명의 세포, 조직 및 인간이 아닌 유전자 도입 동물이 조사 도구로서 유용할 수 있다. 그러나, 세포 및 조직은 또한 의학적 개입 및 약제로서 이용될 수 있다.
다른 실시양태에서, 본 발명은 세포에서 TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 발현을 억제하기 위한 벡터를 포함하는 세포를 제공한다. 상기 벡터는 본 발명의 dsRNA중 하나의 하나 이상의 가닥을 암호화하는 뉴클레오타이드 서열에 작용가능하게 연결된 조절 서열을 포함한다. 그러나, 상기 벡터가, 상기 조절 서열 외에, 본 발명의 dsRNA의 하나 이상의 "센스 가닥" 및 상기 dsRNA의 하나 이상의 "안티센스 가닥"을 암호화하는 서열을 포함하는 것이 바람직하다. 청구된 세포가 상기 조절 서열 이외에, 본 발명의 dsRNA중 하나의 하나 이상의 가닥을 암호화하는 본원에 정의된 서열을 포함하는 2개 이상의 벡터를 포함하는 것 또한 예상된다.
본 발명은 이중 가닥 라이보핵산(dsRNS), 및 dsRNA를 이용하여 세포 또는 포유동물의 TGF-베타 수용체 I형 유전자의 발현을 억제하기 위한 조성물 및 방법을 제공한다. 본 발명은 또한 dsRNA를 이용하여 TGF-베타 수용체 I형 유전자의 발현에 의해 야기된 포유동물에서의 병리학적 질환 및 질병을 치료하기 위한 조성물 및 방법을 제공한다. dsRNA는 RNA 간섭(RNAi)이라 알려진 과정을 통해 mRNA의 서열-특이적 분해를 지시한다. 이 과정은 포유동물 및 다른 척추동물을 비롯한 광범위한 유기체에서 일어난다.
본 발명의 선택된 dsRNA 분자가 표 1 및 3에 제공되고, 여기서 표 1은 TGFβ 수용체(I형) 유전자의 표적 부위(또한 진뱅크/EMBL. NM_004612.2에 의해 제공됨), 및 또한 관련된 dsRNA의 센스 및 안티-센스 가닥을 한정한다. 또한, 일부 및 특히 바람직한 dsRNA(제공된 센스 및 안티센스 서열)의 경우, 생물학적 및 임상적으로 관련된 유리한 변수가 제공된다(첨부된 표 2 및 4 참조).
표 1은 또한 본 발명에 따른 dsRNA로 이용되는 바람직한 분자에 관한 것이다. I단(제1열 내지 제10열) 및 II단(제11열 내지 제31열)에 제공된 바와 같은 확인된 dsRNA 분자가 특히 바람직하다. 그러나, III단(제32열 내지 제58열) 및 IV단(제59열 내지 제75열) 또한 본 발명에 따른 유용한 dsRNA 분자를 포함한다. 상기에서 명확하듯이, 부분적으로 바람직한 dsRNA 분자는 서열번호 1/2, 117/118, 103/104, 31/32, 81/82, 99/100, 23/24, 13/14, 29/30 및/또는 7/8에 의해 정의된 센스 및 안티센스 쌍으로 제공된다. 표 2는 표 1에 도시된 바와 같은 본 발명의 특이적 dsRNA 분자의 일부 생물학적 및 임상적 특징을 위해 제공된다.
본 발명에서는, 놀랍게도 (인간) TGF-베타 수용체 I형 유전자의 발현 억제에 유용한 특히 바람직한 dsRNA가 TGF-베타 수용체 I형 유전자의 상응하는 mRNA의 특정 영역에 밀집되어 있는 것으로 발견되었다. 첨부된 서열 번호 326(및 또한 진뱅크/EMBL. NM_004612.2에 의해 제공됨)에 제공된 바와 같은 인간 TGF-베타 수용체 I형 유전자와 관련하여, 이러한 밀집부위(cluster)는 인간 TGF-베타 수용체 I형 유전자를 나타내는 첨부된 서열 번호 326의 뉴클레오타이드 250 내지 350 및 1500 내지 1600의 영역, 보다 바람직하게는 뉴클레오타이드 220 내지 320 및 1520 내지 1580의 영역, 보다 바람직하게는 뉴클레오타이드 298 내지 332 및 1522 내지 1569의 영역에 포함된다.
표 3 및 4는 또한 본 발명에서 유용한 추가의 siRNA 분자/dsRNA를 제공하는데, 여기서 표 4는 표 3에 도시된 바와 같은 본 발명의 개질된 siRNA 분자/dsRNA 분자의 일부 관련된 생물학적 및/또는 의학적으로 놀라운 특징들을 제공한다. 보다 유용한, 개질된 분자는 I단(제1열 내지 제15열) 및 II단(제16열 내지 제42열)에 제공된 바와 같은 서열(센스 가닥 및 안티센스 가닥)을 포함한다. 또한 III단(제43열 내지 제75열)에 정의된 바와 같은 dsRNA/siRNA는, TGF-베타 수용체 I형 유전자 발현의 억제(상기 억제는 시험관 내에서 측정되고 약 80% 이상 억제된다)가 달성되는 한, 본 발명에서 사용될 수 있는 유용한 dsRNA 분자를 포함한다. 개질된 dsRNA/siRNA의 측면에서 서열번호 151/152, 249/250, 261/262, 231/232, 275/276, 253/254, 211/212, 265/266, 181/182, 185/186, 209/210, 299/300, 295/296, 279/280, 및/또는 219/220에 제공된 바와 같은 서열이 바람직하다.
정의
편의상, 본 명세서, 실시예 및 첨부된 특허청구범위에서 사용되는 일부 용어와 표현의 의미를 하기에 제공한다. 본 명세서의 다른 부분에서의 용어의 용법과 이 절에서 제공된 정의가 명확하게 상이한 경우, 본 절에서의 정의가 우세하다.
"G," "C," "A", "U" 및 "T" 또는 "dT"는 각각 염기로서 구아닌, 사이토신, 아데닌, 우라실 및 데옥시티미딘을 함유하는 뉴클레오타이드를 나타낸다. 그러나, 용어 "라이보뉴클레오타이드" 또는 "뉴클레오타이드"는 하기에 추가로 설명된 바와 같은 개질된 뉴클레오타이드 또는 대용 대체 잔기를 의미할 수 있다. 이런 대체 잔기를 포함하는 서열도 본 발명의 실시양태이다. 하기 상세하게 설명되는 바와 같이 본원에 개시된 dsRNA 분자는 또한 "돌출부", 즉, "센스 가닥" 및 "안티센스 가닥"의 본원에서 정의된 쌍에 의해 일반적으로 형성되는 RNA 이중 나선 구조에 직접적으로 관련되지 않은 쌍을 이루지 않은 돌출된 뉴클레오타이드를 포함할 수 있다. 종종 이런 돌출부 스트레치는 데옥시티미딘 뉴클레오타이드를 포함하고, 대부분의 실시양태에서는 3' 말단에서 2-데옥시티미딘을 포함한다. 이런 돌출부는 하기에 개시되고 예시될 것이다.
본원에서 이용되는 용어 "TGF-베타 수용체" 또는 "형질전환 성장 인자 베타 수용체"는 특히 TGF-베타 수용체 I형(TGF-베타 수용체 I형, 액티빈 A 수용체 II형 유사 키나제)에 관한 것이고, 상기 용어는 상응하는 유전자, 암호화된 mRNA, 암호화된 단백질/폴리펩타이드 및 또한 이의 작용성 분획에 관한 것이다. 본원에 제공된 바와 같은 분획은 본원에서 정의된 dsRNA 분자가 지시하는 표적 서열 중의 밀집지역의 본원에서 정의된 "핫 스폿(hot spot)"에 관한 것이다. 이런 분획은 첨부된 서열 번호 326의 뉴클레오타이드 250 내지 350 및 1500 내지 1600이다. 용어 "TGF-베타 수용체 I형 유전자/서열"은 야생형 서열에 관한 것일 뿐 아니라 상기 유전자/서열에 포함될 수 있는 돌연변이 및 변형에 관한 것이다. 따라서, 본 발명은 본원에 제공된 특이적 dsRNA 분자로 한정되지 않는다. 본 발명은 또한 이런 돌연변이/변형을 포함하는 TGF-베타 수용체 I형의 RNA 전사물의 상응하는 뉴클레오타이드 스트레치에 85% 이상 상보적인 안티센스 가닥을 포함하는 dsRNS 분자에 관한 것이다.
본원에서 이용되는 "표적 서열"은 1차 전사 생성물의 RNA 가공의 생성물인 mRNA를 비롯한 TGF-베타 수용체 I형 유전자의 전사동안 형성되는 mRNA 분자의 뉴클레오타이드 서열의 인접한 일부를 의미한다.
본원에서 이용되는 용어 "서열을 포함하는 가닥"은 표준 뉴클레오타이드 명명법을 이용하여 언급되는 서열에 의해 개시되는 뉴클레오타이드의 쇄를 포함하는 올리고뉴클레오타이드를 의미한다. 그러나, 본원에서 설명되는 바와 같이, 이런 "서열을 포함하는 가닥"은 또한 개질된 뉴클레오타이드와 같은 변형을 포함할 수 있다.
본원에서 이용되는 용어 "상보성"은 달리 지시되지 않는 한, 제 2 뉴클레오타이드 서열에 대해 제 1 뉴클레오타이드 서열을 개시하기 위해 이용되는 경우, 제1 뉴클레오타이드 서열을 포함하는 올리고뉴클레오타이드 또는 폴리뉴클레오타이드가 일부 조건 하에서 제 2 뉴클레오타이드 서열을 포함하는 올리고뉴클레오타이드 또는 폴리뉴클레오타이드와 하이브리드를 형성하여 듀플렉스 구조를 형성하는 능력을 의미한다. 본원에서 이용되는 "상보적" 서열은 또한, 하이브리드를 형성할 수 있는 이들의 능력에 대한 상기 필요조건이 충족되는 한, 비-왓슨-크릭 염기 쌍 및/또는 비-천연 및 개질된 뉴클레오타이드로부터 형성된 염기 쌍을 포함하거나, 또는 전적으로 이로부터 형성될 수 있다.
"완전히 상보적"인 것으로 언급되는 서열은 제 1 및 제 2 뉴클레오타이드 서열의 전체 길이에 걸친 제 1 뉴클레오타이드를 포함하는 올리고뉴클레오타이드 또는 폴리뉴클레오타이드의 제 2 뉴클레오타이드 서열을 포함하는 올리고뉴클레오타이드 또는 폴리뉴클레오타이드로의 염기쌍을 포함한다.
그러나, 본원에서 제 1 서열이 제 2 서열에 대해 "실질적으로 상보적"인 것으로 언급되는 경우, 2개의 서열은 완전히 상보적일 수 있거나, 이들이 하이브리드를 형성하였을 때, 하나 이상, 하지만, 바람직하게는 13개 이하의 미스매치된 염기 쌍을 형성할 수 있다.
본원에서 용어 "상보적", "완전히 상보적" 또는 "실질적으로 상보적"은, 이의 용법에서 이해되는 바와 같이, dsRNA의 센스 가닥과 안티센스 가닥 사이, 또는 dsRNA의 안티센스 가닥과 표적 서열 사이의 염기 매칭(matching)에 관해 사용될 수 있다.
본원에서 이용되는 용어 "이중 가닥 RNA", "dsRNA 분자" 또는 "dsRNA"는 2개의 역평행하고 실질적으로 상보적인 핵산 가닥을 포함하는 듀플렉스 구조를 갖는 라이보핵산 분자, 또는 라이보핵산 분자의 복합체를 의미한다. 듀플렉스 구조를 형성하는 2개의 가닥은 하나의 더 큰 RNA 분자의 서로 다른 부분들일 수 있거나, 또는 이들은 별개의 RNA 분자일 수 있다. 2개의 가닥이 더 큰 분자의 일부이고, 따라서, 한 가닥의 3'-말단과 듀플렉스 구조를 형성하는 다른 가닥의 5' 말단 사이의 뉴클레오타이드의 방해되지 않는 쇄에 의해 연결되는 경우, 연결되는 RNA 쇄를 "헤어핀 루프(hairpin loop)"라 부른다. 2개의 가닥이 한 가닥의 3' 말단과 듀플렉스 구조를 형성하는 다른 가닥의 5' 말단 사이의 중단되지 않은 뉴클레오타이드의 쇄가 아닌 다른 수단에 의해 공유결합적으로 연결되는 경우, 이 연결 구조는 "링커"라 불린다. RNA 가닥은 동일하거나 상이한 수의 뉴클레오타이드를 가질 수 있다. 듀플렉스 구조에 추가하여, dsRNA는 하나 이상의 뉴클레오타이드 돌출부를 포함할 수 있다. 상기 "돌출부"의 뉴클레오타이드는 0 내지 5개 뉴클레오타이드를 포함할 수 있고, 여기서 "0"은 "돌출부"를 형성하는 추가의 뉴클레오타이드가 없음을 의미하고, "5"는 dsRNA 듀플렉스의 개별적인 가닥 상의 5개의 추가의 뉴클레오타이드를 의미한다. 이들 선택적인 "돌출부"는 개별적인 가닥의 3' 말단에 위치한다. 하기에 상세히 설명되는 바와 같이 2개의 가닥중 하나에만 "돌출부"를 포함하는 dsRNA 분자가 사용될 수 있고, 이는 본 발명의 측면에서 보다 유리하다. "돌출부"는 바람직하게는 0 내지 2개의 뉴클레오타이드를 포함한다. 가장 바람직하게는 2개의 "dT"(데옥시티미딘) 뉴클레오타이드가 dsRNA의 양 가닥 모두의 3' 말단에서 발견된다. 또한 2개의 "U"(우라실) 뉴클레오타이드가 dsRNA의 양 가닥 모두의 3' 말단에서 돌출부로서 이용될 수 있다. 따라서, "뉴클레오타이드 돌출부"는 dsRNA의 한 가닥의 3' 말단이 다른 가닥의 5' 말단 너머로 연장되거나 또는 그 역의 경우 dsRNA의 듀플렉스 구조로부터 돌출되는 쌍을 이루지 않은 뉴클레오타이드 또는 뉴클레오타이드들을 의미한다. 예를 들면 안티센스 가닥은 23개의 뉴클레오타이드를 포함하고, 센스 가닥은 21개의 뉴클레오타이드를 포함하여, 안티센스 가닥의 3' 말단에 2개의 뉴클레오타이드 돌출부를 형성한다. 바람직하게는 2 뉴클레오타이드 돌출부는 표적 유전자의 mRNA에 완전히 상보적이다. "블런트" 또는 "블런트 말단"은 dsRNA의 그 말단에서 쌍을 이루지 않은 뉴클레오타이드가 없음을, 즉, 뉴클레오타이드 돌출부가 없음을 의미한다. "블런트 말단" dsRNA는 그의 전체 길이에 걸쳐 이중 가닥인, 즉, 분자의 어느 한쪽의 말단에 뉴클레오타이드 돌출부가 없는 dsRNA이다.
용어 "안티센스 가닥"은 표적 서열에 실질적으로 상보적인 영역을 포함하는 dsRNA의 가닥을 의미한다. 본원에서 이용되는 "상보성 영역"은 서열, 예를 들면 표적 서열에 실질적으로 상보적인 안티센스 가닥 상의 영역을 의미한다. 상보성 영역이 표적 서열에 완전히 상보적이지 않은 경우, 미스매치는 안티센스 가닥의 5' 단부의 뉴클레오타이드 2 내지 7의 외부에서 가장 허용될 수 있다.
본원에서 이용되는 용어 "센스 가닥"은 안티센스 가닥의 영역에 실질적으로 상보적인 영역을 포함하는 dsRNA의 가닥을 의미한다. "실질적으로 상보적"이란 센스와 안티센스 가닥에서 겹쳐지는 뉴클레오타이드의 바람직하게는 85% 이상이 상보적임을 의미한다.
dsRNA를 언급할 때, "세포로 도입되는"은 당 분야의 숙련자들에게 이해되는 바와 같이 세포로의 섭취 또는 흡수를 용이하게 함을 의미한다. dsRNA의 흡수 또는 섭취는 도움을 받지 않는 확산 또는 능동적 세포 과정을 통해 일어나거나 보조 약물 또는 장치에 의해서 일어날 수 있다. 이 용어의 의미는 시험관 내 세포로 제한되지 않고, dsRNA 또한 살아있는 유기체의 일부인 "세포로 도입"될 수 있으며, 여기서 세포는 살아있는 유기체의 일부이다. 이런 경우, 세포로의 도입은 유기체로의 운반을 포함할 것이다. 예를 들면 생체 내 운반의 경우, dsRNA는 조직 부위로 주입되거나 또는 전신 투여될 수 있다. 예를 들면 본 발명의 dsRNA 분자가 의학적 개입이 필요한 대상에게 투여되는 것을 고려할 수 있다. 이런 투여는 본 발명의 dsRNA, 벡터 또는 세포를 대상에서 질병에 걸린 면, 예를 들면 간 조직/세포 또는 암 조직/세포, 예를 들면 간 암 조직으로 주입하는 것을 포함할 수 있다. 그러나, 질병에 걸린 조직에 매우 인접하게 주입하는 것 또한 고려할 수 있다. 세포로의 시험관내 도입은 전기천공 및 리포펙션(lipofection)과 같은 당 분야에 공지된 방법을 포함한다.
용어 "침묵", "발현 억제" 및 "녹 다운(knock down)"은, 이들이 TGF-베타 수용체 I형 유전자에 관한 것인 한, TGF-베타 수용체 I형 유전자의 발현의 적어도 부분적 억제를 의미하고, 이러한 부분적 억제는 TGF-베타 수용체 I형 유전자가 전사되고 TGF-베타 수용체 I형 유전자의 발현이 억제되도록 처리되는 제 1 세포 또는 일군의 세포로부터 단리된 TGF-베타 수용체 I형 유전자에서 전사된 mRNA의 양이 제 1 세포 또는 세포 군과 실질적으로 동일하지만 발현억제 처리되지 않은 제 2 세포 또는 세포 군(대조군 세포)와 비교하였을 때 감소된 것에 의해 명확해진다. 억제 정도는 일반적으로 {[(대조군 세포의 mRNA)-(처리된 세포의 mRNA)]/(대조군 세포의 mRNA}x100%로 표현된다.
다르게는, 억제 정도는 TGF-베타 수용체 I형 유전자 전사에 기능적으로 연결된 변수, 예를 들면 세포에 의해 분비되는 TGF-베타 수용체 I형 유전자에 의해 암호화되는 단백질의 양, 또는 특정 표현형을 나타내는 세포의 수의 감소 측면으로 제공될 수 있다.
첨부된 실시예 및 첨부된 표에 예시된 바와 같이, 본 발명의 dsRNA 분자는 인간 TGF-베타 수용체 I형 유전자의 발현을 시험관내 분석에서, 즉 시험관 내에서 약 70% 이상, 바람직하게는 80% 이상, 가장 바람직하게는 90% 이상 억제할 수 있다. 본원에서 이용되는 용어 "시험관 내"란 세포 배양 분석을 포함하지만 이로 한정되지는 않는다. 다른 실시양태에서, 본 발명의 dsRNA 분자는 마우스 또는 래트 TGF-베타 수용체 I형 유전자의 발현을 70% 이상, 바람직하게는 80% 이상, 가장 바람직하게는 90% 이상 억제할 수 있다. 당 분야의 숙련자는 특히 본원에 제공된 분석법의 측면에서 이런 억제 속도 및 관련된 효과를 쉽게 측정할 수 있다. 본원에 기록된 바와 같이, 본 발명의 가장 바람직한 dsRNA는 약 30nM의 dsRNA/siRNA 단일 투여 농도가 이용되었을 때 인간 TGF-베타 수용체 I형 유전자의 발현을 시험관 내에서 약 80% 이상 억제할 수 있다. 또한, 약 300pM의 단일 투여 농도에서 인간 TGF-베타 수용체 I형 유전자의 발현을 억제할 수 있는 dsRNA/siRNA 분자가 포함된다. 또한, 본 발명의 측면에서 상응하는 작업 실시예가 본원에 제공되고, 첨부된 표에 또한 도시되어 있다. 특히 바람직한 dsRNA가, 예를 들면 첨부된 표의 I의 제1단, 특히 제1열 내지 제31열, 특히 제1열 내지 제10열(본원에 제공된 센스 가닥 및 안티센스 가닥 서열은 5'에서 3' 방향이다)에 제공되어 있다.
본원에서 이용되는 용어 "오프 타겟(off target)"은 서열 상보성에 근거하여 개시된 dsRNA에 하이브리드를 형성하는 인 실리코(in silico) 방법에 의해 예상되는 전사체(trascriptome)의 모든 비-표적 mRNA를 의미한다. 본 발명의 dsRNA는 바람직하게는 TGF-베타 수용체 I형 유전자의 발현을 특이적으로 억제하고, 즉, 임의의 오프-타켓의 발현을 억제하지 않는다.
특히 바람직한 dsRNA가 예를 들면 첨부된 표 1 및 3에 제공된다(본원에 제공된 센스 가닥 및 안티센스 가닥 서열은 5'에서 3' 방향이다).
본원에서 이용되는 용어 "반감기"는 특히 본원에서 제공된 분석법의 측면에서 당 분야의 숙련자들에게 공지된 방법에 의해 분석될 수 있는 화합물 또는 분자의 안정성의 척도이다.
본원에서 이용되는 용어 "비-면역자극성"은 본 발명의 dsRNA 분자에 의한 면역 반응의 임의의 유도가 없음을 의미한다. 면역 반응을 측정하는 방법은 당 분야의 숙련자들에게 잘 공지되어 있으며, 예를 들면 실시예 절에 개시된 바와 같은 사이토카인의 방출을 측정함으로써 가능하다.
용어 "치료" 등은 본원에서는 섬유증 질환, 염증 또는 간암과 같은 암과 같은 TGF-베타 수용체 I형 발현과 관련된 질환의 경감 또는 이의 제거를 의미한다. 본 발명에서 (섬유증, 염증 또는 암이 아닌) 하기 본원에서 언급된 임의의 다른 질환에 관한 것인 한, 용어 "치료" 등은 이런 질환과 관련된 하나 이상의 증후군의 경감 또는 제거 또는 이런 질환의 진행을 느리게 하거나 역전시키는 것을 의미한다.
본원에서 이용되는 용어 "치료 효과량" 및 "예방적 치료 효과량"은 섬유증 또는 섬유증의 명백한 증후의 치료, 예방 또는 관리에 치료적 이점을 제공하는 양을 의미한다. 치료 효과적인 특정한 양은 당 분야의 의학적 실시자에 의해 쉽게 결정될 수 있고, 당 분야에 공지된 인자, 예를 들면 섬유증, 염증 또는 암의 유형, 환자의 이력 및 연령, 치료되는 질병의 상태 및 소염제, 항-섬유증 제 또는 항암/항종양제와 같은 다른 의약품의 투여에 따라 다양할 수 있다.
본원에서 사용되는 "약학 조성물"은 약학적 효과량의 dsRNA 및 약학적으로 허용가능한 담체를 포함한다. 그러나, 이런 "약학 조성물"은 또한 본 발명의 dsRNA/siRNA에 포함된 센스 또는 안티센스 가닥중 하나 이상의 가닥을 암호화하는 뉴클레오타이드 서열에 작용가능하게 연결된 조절 서열을 포함하는 본원에 개시된 벡터를 포함할 수 있다. 또한, 본원에 정의된 dsRNA/siRNA를 발현하거나 포함하는 세포, 조직 또는 단리된 기관이 예를 들면 이식 접근법을 비롯한 의학적 개입에서 "약학 조성물"로서 사용될 수 있는 것으로 고려된다. 본원에서 이용되는 "약학적 효과량", "치료 효과량" 또는 단순히 "효과량"은 의도된 약학적, 치료적 또는 예방적 결과를 생성하는데 효과적인 RNA의 양을 의미한다. 예를 들면 질병 또는 질환과 관련된 측정가능한 변수에서 25% 이상의 감소가 있을 때 주어진 임상적 치료가 효과적인 것으로 간주되는 경우, 그 질병 또는 질환의 치료를 위한 약물의 치료 효과량은 그 변수를 25% 이상 감소시키는데 필요한 양이다.
용어 "약학적으로 허용가능한 담체"는 치료제 투여용 담체를 의미한다. 이런 담체는 염수, 완충된 염수, 덱스트로스, 물, 글리세롤, 에탄올 및 이의 조합을 포함하지만, 이로 한정되지는 않는다. 이 용어는 명확하게 세포 배양 배지를 제외한다. 경구 투여되는 약물의 경우, 약학적으로 허용가능한 담체는 약학적으로 허용가능한 부형제, 예를 들면 불활성 희석제, 분해제, 결합제, 윤활제, 감미제, 향료, 착색제 및 방부제를 포함하지만, 이로 한정되지는 않는다. 적합한 불활성 희석제는 탄산나트륨, 탄산칼슘, 인산나트륨, 인산칼슘 및 락토즈를 포함하며, 옥수수 전분 및 알긴산이 적합한 분해제이다. 결합제는 전분 및 젤라틴을 포함할 수 있고, 윤활제는 존재하는 경우, 일반적으로 마그네슘 스테아레이트, 스테아르산 또는 활석일 것이다. 필요한 경우, 정제는 예를 들면 글리세릴 모노스테아레이트 또는 글리세릴 다이스테아레이트와 같은 물질로 코팅되어 위장내장관에서의 흡수를 지연시킬 수 있다. 그러나, 본 발명에서 사용되고자 하는 약학적으로 허용가능한 담체는 본 발명의 dsRNA, 벡터 또는 세포의 전신 투여를 허용하는 것으로 파악된다. 장내 투여가 또한 고려되지만, 비경구 투여, 피하 또는 점막관통(예를 들면 취입, 협측, 질, 항문) 투여 및 약물의 흡입이 의학적 개입이 필요한 환자에게 본 발명의 화합물을 투여하는 편리한 방법이다. 비경구 투여가 이용되는 경우, 이는 본 발명의 화합물을 병에 걸린 조직 또는 적어도 가깝게 인접한 조직에 직접 주입하는 것을 포함할 수 있다. 그러나, 또한, 본 발명의 화합물의 정맥내, 동맥내, 피하, 근육내, 복강내, 피내, 경막내 등의 투여가 당 업자, 예를 들면 담당 의사의 기술 범위 이내이다.
특히 약학적으로 허용가능한 담체가 본 발명의 dsRNA, 벡터 또는 세포의 전신 투여를 허용하는 것으로 파악된다. 장내 투여가 또한 고려되지만, 약물의 비경구 투여 및 또한 경피 또는 점막 통과(예를 들면 취입, 협측, 질, 항문) 투여 및 또한 흡인이 의학적 개입이 필요한 환자에게 본 발명의 화합물을 투여하는 실행가능한 방법이다. 비경구 투여가 사용되면, 이는 본 발명의 화합물을 질병에 걸린 조직 또는 적어도 근접한 부위에 직접 주입하는 것을 포함할 수 있다. 그러나, 본 발명의 화합물의 정맥내, 동맥내, 피하, 근육내, 복강내, 경피, 경막내 및 다른 투여가 당 분야의 숙련자, 예를 들면 담당 의사의 기술 범위 이내이다.
근육내, 피하 및 정맥내 용도의 경우, 본 발명의 약학 조성물은 일반적으로 적절한 pH 및 등장성으로 완충된 멸균 수용액 또는 현탁액으로 제공될 것이다. 바람직한 실시양태에서, 담체는 배타적으로 수성 완충액으로 구성된다. 본원에서, "배타적으로"는 TGF-베타 수용체 I형 유전자를 발현하는 세포에서 dsRNA의 섭취에 영향을 미치거나 이를 매개할 수 있는 보조제 또는 캡슐화 물질이 존재하지 않는다는 것을 의미한다. 본 발명에 따른 수성 현탁액은 셀룰로스 유도체, 나트륨 알기네이트, 폴리비닐-피롤리돈 및 트라가칸트 검과 같은 현탁제, 및 레시틴과 같은 습윤제를 포함할 수 있다. 수성 현탁에 적합한 방부제는 에틸 및 n-프로필 p-하이드록시벤조에이트를 포함한다. 본 발명에 따라 유용한 약학 조성물은 또한 신체로부터의 신속한 제거로부터 dsRNA를 보호하기 위한 캡슐화된 제제, 예를 들면 이식물 및 마이크로캡슐화된 운반 시스템을 비롯한 제어 방출 제제를 포함한다. 생분해가능한, 생물적합성 중합체, 예를 들면 에틸렌 비닐 아세테이트, 다가무수물, 폴리글리콜산, 콜라겐, 폴리오르토에스터 및 폴리락트산을 이용할 수 있다. 이런 제제를 제조하는 방법은 당 분야의 숙련자들에게 공지되어 있다. 또한 리포솜 현탁액을 약학적으로 허용가능한 담체로서 이용할 수 있다. 이들은 당 분야의 숙련자들에게 공지된 방법에 따라 제조될 수 있다.
본원에서 이용되는 "형질전환된 세포"는 이로부터 dsRNA 분자 또는 이런 dsRNA 분자의 하나 이상의 가닥이 발현될 수 있는 하나 이상의 벡터가 도입된 세포를 의미한다. 이런 벡터는 바람직하게는 본 발명의 dsRNA에 포함된 센스 가닥 또는 안티센스 가닥중 하나 이상을 암호화하는 뉴클레오타이드 서열에 작동가능하게 연결된 조절 서열을 포함하는 벡터이다.
한쪽 또는 양쪽 말단 상의 단지 몇개의 뉴클레오타이드만이 없는 표 1 및 표 3의 서열중 하나를 포함하는 더 짧은 dsRNA가 상기 개시된 dsRNA와 비교되었을 때 유사하게 효과적일 수 있을 것으로 합리적으로 예상될 수 있다. 상기 지적된 바와 같이, 본 발명의 대부분의 실시양태에서, 본원에 제공된 dsRNA 분자는 약 16 내지 약 30 뉴클레오타이드의 듀플렉스 길이(즉, "돌출부" 없음)를 포함한다. 특히 유용한 dsRNA 듀플렉스 길이는 약 19 내지 약 25 뉴클레오타이드이다. 19 뉴클레오타이드의 길이를 갖는 듀플렉스 구조가 가장 바람직하다. 본 발명의 dsRNA 분자에서는, 안티센스 가닥이 적어도 부분적으로는 센스 가닥에 상보적이다.
본 발명의 dsRNA는 표적 서열에 대해 하나 이상의 미스매치를 함유할 수 있다. 바람직한 실시양태에서, 본 발명의 dsRNA는 13개 이하의 미스매치를 함유한다. dsRNA의 안티센스 가닥이 표적 서열에 대한 미스매치를 함유한다면, 미스매치 영역이 안티센스 가닥의 5' 단부의 뉴클레오타이드 2 내지 7 이내에 위치하지 않는 것이 바람직하다. 다른 실시양태에서는, 미스매치 영역이 안티센스 가닥의 5' 단부의 뉴클레오타이드 2 내지 9 이내에 위치하지 않는 것이 바람직하다. 특히 TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 특정한 상보성 영역이 모집단 내부에서 다형성 서열 변이를 갖고 있는 것으로 알려져 있다면, TGF-베타 수용체 유전자의 발현을 억제하는데 있어 미스매치를 갖는 dsRNA의 효율을 고려하는 것이 중요하다.
상기 언급된 바와 같이, dsRNA의 하나 이상의 말단/가닥은 1 내지 5개, 바람직하게는 1 또는 2개 뉴클레오타이드의 단일-가닥 뉴클레오타이드 돌출부를 가질 수 있다. 하나 이상의 뉴클레오타이드 돌출부를 갖고 있는 dsRNA는 블런트-말단 대응물에 비해 예상치못하게 탁월한 억제 성질을 갖고 있다. 더욱이, 본 발명자는 단지 1개의 뉴클레오타이드 돌출부의 존재가 dsRNA의 전반적인 안정성에 영향을 미치지 않으면서도 이의 간섭 활성을 강화한다는 것을 발견하였다. 단지 하나의 돌출부를 갖는 dsRNA는 생체 내, 및 또한 다양한 세포, 세포 배양 배지, 혈액 및 혈청에서 특히 안정하고 효과적인 것으로 입증되었다. 바람직하게는, 단일-가닥 돌출부가 안티센스 가닥의 3'-단부 말단에 위치하거나, 다르게는 센스 가닥의 3'-단부 말단에 위치한다. 또한 dsRNA는 블런트 말단을 가질 수 있고, 바람직하게는 안티센스 가닥의 5'-말단에 위치한 블런트 말단을 갖는다. 바람직하게는 dsRNA의 안티센스 가닥은 3'-말단에 하나의 뉴클레오타이드 돌출부를 갖고, 5'-말단이 블런트이다. 다른 실시양태에서는, 돌출부에서의 하나 이상의 뉴클레오타이드가 뉴클레오사이드 티오포스페이트로 대체된다.
본 발명의 dsRNA는 또한 안전성을 개선시키기 위해 화학적으로 개질될 수 있다. 본 발명의 핵산은 당 분야에서 잘 확립된 방법, 예를 들면 본원에 참고로 혼입된 ["Current protocols in nucleic acid chemistry", Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA]에 개시된 방법에 의해 합성되고/되거나 개질될 수 있다. 화학적 개질은 2'-개질, 비-천연 염기의 도입, 리간드로의 공유결합적 부착, 및 포스페이트 연결기의 티오포스페이트 연결기로의 대체를 포함하지만, 이로 한정되지는 않는다. 이 실시양태에서, 듀플렉스 구조의 일체성은 하나 이상, 바람직하게는 두개의 화학적 연결기에 의해 강화된다. 화학적 연결은 임의의 다양한 잘 공지된 기법, 예를 들면 공유결합, 이온 또는 수소 결합의 도입; 소수성 상호작용, 반 데르 발스 또는 적층 상호작용; 금속-이온 배위를 이용하거나 퓨린 동족체를 이용하여 달성될 수 있다. 바람직하게는, dsRNA를 개질하는데 이용될 수 있는 화학적 기는 메틸렌 블루; 2작용성 기, 바람직하게는 비스-(2-클로로에틸)아민; N-아세틸-N'-(p-글리옥실벤조일)시스타민; 4-티오우라실; 및 소랄렌을 포함하지만, 이로 한정되지는 않는다. 한 바람직한 실시양태에서, 연결기는 헥사-에틸렌 글리콜 연결기이다. 이 경우, dsRNA는 고상 합성에 의해 생성되고, 헥사-에틸렌 글리콜 연결기는 표준 방법에 따라 혼입된다(예를 들면 [Williams, D.J., and K.B. Hall, Biochem. (1996) 35:14665-14670]). 특정한 실시양태에서, 안티센스 가닥의 5'-말단 및 센스 가닥의 3'-말단은 헥사에틸렌 글리콜 연결기를 통해 화학적으로 연결된다. 다른 실시양태에서, dsRNA의 하나 이상의 뉴클레오타이드는 포스포로티오에이트 또는 포스포로다이티오에이트 기를 포함한다. dsRNA의 말단에서의 화학적 결합은 바람직하게는 삼중-나선 결합에 의해 형성된다. 표 3 및 4는 본 발명의 개질된 RNAi 시약의 예를 제공한다.
일부 실시양태에서, 화학적 결합은 하나 또는 여러 결합 기를 이용하여 형성될 수 있고, 여기서, 이런 결합 기는 바람직하게는 폴리-(옥시포스피니코옥시-1,3-프로판다이올)- 및/또는 폴리에틸렌 글리콜 쇄이다. 다른 실시양태에서, 화학적 결합은 또한 퓨린 대신 이중 가닥 구조로 도입된 퓨린 유사체를 이용하여 형성될 수 있다. 또다른 실시양태에서, 화학적 결합은 이중 가닥 구조로 도입된 아자벤젠 유니트에 의해 형성될 수 있다. 또다른 실시양태에서, 화학적 결합은 이중 가닥 구조로 도입된 뉴클레오타이드 대신 분지된 뉴클레오타이드 유사체에 의해 형성될 수 있다. 일부 실시양태에서, 화학적 결합은 자외선에 의해 도입될 수 있다.
또다른 실시양태에서, 2개의 단일 가닥중 하나 또는 둘 모두에서 뉴클레오타이드는 세포 효소, 예를 들면 일부 뉴클레아제의 활성화를 방지하거나 억제하도록 개질될 수 있다. 세포 효소의 활성화를 억제하기 위한 기법은 당 분야에 잘 공지되어 있고, 2'-아미노 개질, 2'-아미노 당 개질, 2'-F 당 개질, 2'-F 개질, 2'-알킬 당 개질, 하전되지 않은 주쇄 개질, 모폴리노 개질, 2'-O-메틸 개질 및 포스포르아미데이트([Wagner, Nat . Med. (1995) 1:1116-8])를 포함하지만 이로 제한되지는 않는다. 따라서, dsRNA 상의 뉴클레오타이드의 하나 이상의 2'-하이드록실 기는 화학적 기, 바람직하게는 2'-아미노 또는 2'-메틸 기에 의해 대체된다. 또한, 하나 이상의 뉴클레오타이드는 잠긴(locked) 뉴클레오타이드를 형성하도록 개질될 수 있다. 이런 잠긴 뉴클레오타이드는 리보스의 2'-산소를 리보스의 4'-탄소와 연결하는 메틸렌 가교를 함유한다. 잠긴 뉴클레오타이드의 올리고뉴클레오타이드로의 도입은 상보성 서열에 대한 친화성을 개선시키고, 융점을 몇도 증가시킨다.
본원에 제공된 dsRNA 분자의 개질은 생체 내 및 시험관내의 이들의 안정성에 긍정적인 영향을 미칠 수 있고, 또한 (질병에 걸린) 표적 측면으로의 이동을 개선시킨다. 또한, 이런 구조적 및 화학적 개질은 투여시 dsRNA 분자에 대한 생리학적 반응, 예를 들면 바람직하게는 억제되어야만 하는 사이토카인 방출에 긍정적인 영향을 미칠 수 있다. 이런 화학적 및 구조적 개질은 당 분야에 공지되어 있고, 그 중에서도 [Nawrot (2006) Current Topics in Med Chem, 6, 913-925]에 예시되어 있다.
리간드를 dsRNA에 컨쥬게이트시키는 것은 특정한 조직으로의 표적화 뿐만 아니라 이의 세포 흡수를 개선시킬 수 있다. 일부 경우, 세포 막의 직접 투과가 용이해지도록 소수성 리간드가 dsRNA에 컨쥬게이트될 수 있다. 다르게는, dsRNA에 컨쥬게이트된 리간드는 수용체-매개된 엔도시토시스(endocytosis)를 위한 기질이다. 안티센스 올리고뉴클레오타이드의 세포 투과가 용이하도록 이러한 접근법이 이용되어 왔다. 예를 들면 콜레스테롤을 다양한 안티센스 올리고뉴클레오타이드에 컨쥬게이트시켜서 이의 비-컨쥬게이트된 유사체와 비교하였을 때 실질적으로 보다 활성인 화합물을 생성하여왔다. [M. Manoharan Antisense & Nucleic Acid Drug Development 2002, 12, 103]를 참조할 수 있다. 올리고뉴클레오타이드에 컨쥬게이트된 다른 친유성 화합물은 1-피렌 부티르산, 1,3-비스-O-(헥사데실)글리세롤 및 멘톨을 포함한다. 수용체-매개된 엔도시토시스를 위한 리간드의 한 예는 엽산이다. 엽산은 폴레이트-수용체-매개된 엔도시토시스에 의해 세포로 들어간다. 엽산을 갖고 있는 dsRNA 화합물은 폴레이트-수용체-매개된 엔도시토시스를 통해 세포로 효과적으로 전달된다. 엽산의 올리고뉴클레오타이드의 3'-단부로의 부착은 결과적으로 올리고뉴클레오타이드의 세포 섭취를 증가시킨다([Li, S.; Deshmukh, H. M.; Huang, L. Pharm . Res . 1998, 15, 1540]). 올리고뉴클레오타이드에 컨쥬게이트되어온 다른 리간드로는 폴리에틸렌 글리콜, 탄화수소 클러스터(cluster), 가교결합제, 포피린 컨쥬게이트 및 전달 펩타이드가 있다.
일부 경우, 양이온성 리간드의 올리고뉴클레오타이드로의 컨쥬게이션은 종종 뉴클레아제에 대한 개선된 내성을 생성한다. 양이온성 리간드의 대표적인 예는 프로필암모늄 및 다이메틸프로필암모늄이다. 흥미롭게도, 양이온성 리간드가 올리고뉴클레오타이드 전체에 걸쳐 분산되어 있을 때 안티센스 올리고뉴클레오타이드가 mRNA에 대한 이들의 높은 결합 친화성을 유지하는 것으로 보고되었다. [M. Manoharan Antisense & Nucleic Acid Drug Development 2002, 12, 103 ] 및 상기 문헌의 참고문헌을 참고할 수 있다.
본 발명의 리간드-컨쥬게이트된 dsRNA는 매달린 반응성 작용기, 예를 들면 dsRNA 상으로의 연결 분자의 부착으로부터 유래된 것들을 갖고 있는 dsRNA를 이용함으로써 합성될 수 있다. 이 반응성 올리고뉴클레오타이드는 상업적으로 이용가능한 리간드, 임의의 다양한 보호기를 갖고 있는 합성된 리간드, 또는 이에 부착된 연결 잔기를 갖고 있는 리간드와 직접 반응될 수 있다. 본 발명의 방법은 일부 바람직한 양태에서는 리간드로 적절하게 컨쥬게이트되어 왔고 추가로 고형-지지 물질에 부착될 수 있는 뉴클레오사이드 단량체를 이용함으로써 리간드-컨쥬게이트된 dsRNA의 합성을 용이하게 한다. 선택적으로 고형-지지체 물질에 부착되어 있는 이런 리간드-뉴클레오사이드 컨쥬게이트는, 선택된 혈청-결합 리간드와 뉴클레오사이드 또는 올리고뉴클레오타이드의 5' 위치 상에 위치한 연결 잔기와의 반응을 통해 본 발명의 발법의 일부 바람직한 실시양태에 따라 제조된다. 일부 예에서, dsRNA의 3'-단부에 부착된 아르알킬 리간드를 갖는 dsRNA는 먼저 장쇄 아미노알킬 기를 통해 단량체 구축 블록을 제어된-다공성-유리에 공유결합으로 부착함으로써 제조된다. 그런 다음, 뉴클레오타이드를 표준 고형 상 합성 기법을 통해 고형 지지체에 결합된 단량체 구축-블록으로 결합시킨다. 단량체 구축 블록은 고형 상 합성과 상용성인 뉴클레오사이드 또는 다른 유기 화합물일 수 있다.
본 발명의 컨쥬게이트에서 이용되는 dsRNA는 고상 합성의 잘 공지된 기법을 통해 편리하고 일상적으로 제조될 수 있다. 다른 올리고뉴클레오타이드, 예를 들면 포스포로티오에이트 및 알킬화된 유도체를 제조하기위해 유사한 기법을 이용하는 것 또한 알려져 있다.
특정한 개질된 올리고뉴클레오타이드의 합성에 대한 개시 내용이 하기 미국 특허에서 발견될 수 있다: 폴리아민 컨쥬게이트된 올리고뉴클레오타이드에 대한 미국 특허 제5,218,105호; 개질된 주쇄를 갖는 올리고뉴클레오타이드에 대한 미국 특허 제5,541,307호; 키랄성 인 연결기를 갖는 올리고뉴클레오타이드를 제조하는 방법에 관한 미국 특허 제5,521,302호; 펩타이드 핵산에 관한 미국 특허 제5,539,082호; β-락탐 주쇄를 갖는 올리고뉴클레오타이드에 대한 미국 특허 제5,554,746호; 올리고뉴클레오타이드의 합성을 위한 방법 및 물질에 관한 미국 특허 제5,571,902호; 뉴클레오사이드의 임의의 다양한 위치에 결합된 다른 잔기에 대한 연결기로서 이용될 수 있는 알킬티오 기를 갖는 뉴클레오사이드에 대한 미국 특허 제 5,578,718호; 높은 키랄 순도의 포스포로티오에이트 연결기를 갖는 올리고뉴클레오타이드에 대한 미국 특허 제5,587,361호; 2'-O-알킬 구아노신 및 2,6-다이아미노퓨린 화합물을 비롯한 관련 화합물의 제조 방법에 관한 미국 특허 제5,506,351호; N-2 치환된 퓨린을 갖는 올리고뉴클레오타이드에 대한 미국 특허 제5,587,469호; 3-데아자퓨린을 갖는 올리고뉴클레오타이드에 관한 미국 특허 제5,587,470호; 컨쥬게이트된 4'-데스메틸 뉴클레오사이드 유사체에 관한 미국 특허 제5,608,046호; 주쇄-개질된 올리고뉴클레오타이드 유사체에 관한 미국 특허 제5,610,289호; 2'-플루오로-올리고뉴클레오타이드의 합성 방법에 관한 미국 특허 제6,262,241호.
본 발명의 리간드-컨쥬게이트된 dsRNA 및 리간드-분자를 갖고 있는 서열 특이적으로 연결된 뉴클레오사이드에서, 올리고뉴클레오타이드 및 올리고뉴클레오사이드는 표준 뉴클레오타이드 또는 뉴클레오사이드 전구체, 또는 이미 연결 잔기를 갖고 있는 뉴클레오타이드 또는 뉴클레오사이드 전구체, 이미 리간드 분자를 갖고 있는 리간드-뉴클레오타이드 또는 뉴클레오사이드-컨쥬게이트 전구체, 또는 비-뉴클레오사이드 리간드를 갖고 있는 구축 블럭을 이용하여 적합한 DNA 합성기에서 조립될 수 있다.
이미 연결 잔기를 갖고 있는 뉴클레오타이드-컨쥬게이트 전구체를 이용하는 경우, 서열-특이적 연결된 뉴클레오사이드의 합성이 전형적으로 완료되고, 그런 다음, 리간드 분자를 연결 잔기와 반응시켜 리간드-컨쥬게이트된 올리고뉴클레오타이드를 형성한다. 스테로이드, 비타민, 지질 및 리포터(reporter) 분자와 같은 다양한 분자를 갖는 올리고뉴클레오타이드 컨쥬게이트가 이전에 개시되어 왔다(마노하란(Manoharan) 등의 PCT 국제 출원 공개 공보 제WO93/07883호 참조). 바람직한 실시양태에서, 본 발명의 올리고뉴클레오타이드 또는 연결된 뉴클레오사이드는 상업적으로 이용가능한 포스포르아미다이트에 추가하여 리간드-뉴클레오사이드 컨쥬게이트로부터 유래된 포스포르아미다이트를 이용한 자동화 합성기에 의해 합성된다.
올리고뉴클레오타이드의 뉴클레오사이드에서 2'-O-메틸, 2'-O-에틸, 2'-O-프로필, 2'-O-알릴, 2'-O-아미노알킬 또는 2'-데옥시-2'-플루오로 기의 도입은 올리고뉴클레오타이드에 대한 개선된 하이브리드 형성 성질을 부여한다. 또한, 포스포로티오에이트 주쇄를 함유하는 올리고뉴클레오타이드는 개선된 뉴클레아제 안정성을 갖는다. 따라서, 본 발명의 작용화된, 연결된 뉴클레오사이드는 포스포로티오에이트 주쇄 또는 2'-O-메틸, 2'-O-에틸, 2'-O-프로필, 2'-O-아미노알킬, 2'-O-알릴 또는 2'-데옥시-2'-플루오로 기중 하나 또는 둘 모두를 포함하도록 확대될 수 있다.
일부 바람직한 실시양태에서, 5'-단부에 아미노 기를 갖는 본 발명의 작용화된 뉴클레오사이드 서열은 DNA 합성기를 이용하여 제조된 후, 선택된 리간드의 활성 에스터 유도체와 반응된다. 활성 에스터 유도체는 당 분야의 숙련자들에게 잘 공지되어 있다. 대표적인 활성 에스터에는 N-하이드로석신이미드 에스터, 테트라플루오로페놀 에스터, 펜타플루오로페놀 에스터 및 펜타클로로페놀 에스터가 포함된다. 아미노기와 활성 에스터의 반응은 선택된 리간드가 연결기를 통해 5'-위치에 부착되어 있는 올리고뉴클레오타이드를 생성한다. 5'-단부에서의 아미노기는 5'-아미노-개질제 C6 시약을 이용하여 제조될 수 있다. 바람직한 실시양태에서, 리간드 분자는 리간드-뉴클레오사이드 포스포르아미다이트를 이용함으로써 5'-위치에서 올리고뉴클레오타이드에 컨쥬게이트될 수 있고, 여기서 리간드는 5'-하이드록시 기에 직접적으로 또는 연결기를 통해 간접적으로 연결된다. 이런 리간드-뉴클레오사이드 포스포르아미다이트는 전형적으로 자동화된 합성 과정의 끝에 이용되어 5'-단부에서 리간드를 갖는 리간드-컨쥬게이트된 올리고뉴클레오타이드를 제공한다.
본 발명의 방법의 한 바람직한 실시양태에서, 리간드 컨쥬게이트된 올리고뉴클레오타이드의 제조는 리간드 분자가 구축될 적절한 전구체 분자를 선택하는 것으로 시작된다. 전형적으로, 전구체는 흔히 이용되는 뉴클레오사이드의 적절히 보호된 유도체이다. 예를 들면 본 발명의 리간드-컨쥬게이트된 올리고뉴클레오타이드의 합성을 위한 합성 전구체는 분자의 뉴클레오베이스 부분에서 보호될 수 있는 2'-아미노알콕시-5'-ODMT-뉴클레오사이드, 2'-아미노알킬아미노-5'-ODMT-뉴클레오사이드, 5'-6-아미노알콕시-2'-데옥시-뉴클레오사이드, 5'-6-아미노알콕시-2-보호된-뉴클레오사이드, 3'-6-아미노알콕시-5'-ODMT-뉴클레오사이드 및 3'-아미노알킬아미노-5'-ODMT-뉴클레오사이드를 포함하지만 이로 한정되지는 않는다. 이런 아미노-연결된 보호된 뉴클레오사이드 전구체의 합성 방법은 당 분야의 숙련자들에게 공지되어 있다.
많은 경우, 보호기는 본 발명의 화합물의 제조 동안 이용된다. 본원에서 이용되는 용어 "보호된"은 개시된 잔기가 이에 부가된 보호기를 갖고 있음을 의미한다. 본 발명의 일부 바람직한 실시양태에서, 화합물은 하나 이상의 보호기를 함유한다. 광범위한 보호기가 본 발명의 방법에서 이용될 수 있다. 일반적으로, 보호기는 화학적 작용기가 특정한 반응조건에 대해 불활성이도록 하고, 분자의 나머지를 실질적으로 손상시키지 않으면서 분자에서 이런 작용기에 부착되고 이로부터 제거될 수 있다.
대표적인 하이드록실 보호기 및 다른 대표적인 보호기는 [Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed., John Wiley & Sons, New York, 1991] 및 [Oligonucleotides And Analogues A Practical Approach, Ekstein, F. Ed., IRL Press, N.Y, 1991]에 개시되어 있다.
산 처리에 대해 안정한 아미노-보호기는 염기 처리를 이용하여 선택적으로 제거되고 치환에 선택적으로 이용가능한 반응성 아미노기를 제조하는데 이용된다. 이런 기의 예는 Fmoc([E. Atherton and R. C. Sheppard in The Peptides, S. Udenfriend, J. Meienhofer, Eds., Academic Press, Orlando, 1987, volume 9, p.1]) 및 Nsc 기로 예시되는 다양한 치환된 설폰일에틸 카밤에이트([Samukov et al., Tetrahedron Lett., 1994, 35:7821])이다.
추가의 아미노-보호기는 카밤에이트 보호기, 예를 들면 2-트라이메틸실릴에톡시카본일(Teoc), 1-메틸-1-(4-바이페닐일)에톡시카본일(Bpoc), t-부톡시카본일(BOC), 알릴옥시카본일(Alloc), 9-플루오렌일메틸옥시카본일(Fmoc) 및 벤질옥시카본일(Cbz); 아미드 보호기, 예를 들면 폼일, 아세틸, 트라이할로아세틸, 벤조일 및 니트로페닐아세틸; 설폰아미드 보호기, 예를 들면 2-니트로벤젠설폰일; 및 이민 및 환상 이미드 보호기, 예를 들면 프탈이미드 및 다이티아석신오일을 포함하지만, 이로 한정되지는 않는다. 이들 아미노-보호기의 등가물 또한 본 발명의 화합물 및 방법에 포함된다.
많은 고형 지지체가 상업적으로 이용가능하고, 당 분야의 숙련자는 고형-상 합성 단계에서 이용되는 고형 지지체를 쉽게 선택할 수 있다. 일부 실시양태에서는, 보편적인 지지체가 이용된다. 보편적인 지지체는 올리고뉴클레오타이드의 3'-단부에 위치한 비정상적 또는 개질된 뉴클레오타이드를 갖는 올리고뉴클레오타이드의 제조를 허용한다. 보편적 지지체에 대한 추가의 상세 내용에 대해서는 [Scott et al., Innovations and Perspectives in solid-phase Synthesis, 3 rd International Symposium, 1994, Ed. Roger Epton, Mayflower Worldwide, 115-124]를 참조할 수 있다. 또한, 올리고뉴클레오타이드가 보다 손쉽게 염기성 가수분해되는 (syn)-1,2-아세톡시포스페이트 기를 통해 고형 지지체에 결합되어 있는 경우, 더 온화한 반응 조건 하에서 올리고뉴클레오타이드가 보편적인 지지체로부터 분해될 수 있는 것으로 보고되어왔다. [Guzaev, A. I.; Manoharan, M. J. Am . Chem . Soc . 2003, 125, 2380]를 참조할 수 있다.
뉴클레오사이드는 인-함유 또는 비-인-함유 공유결합 뉴클레오사이드간 연결기에 의해 연결된다. 확인 목적으로, 이런 컨쥬게이트된 뉴클레오사이드는 리간드를 갖는 뉴클레오사이드 또는 리간드-뉴클레오사이드 컨쥬게이트로서 특징화될 수 있다. 서열 내부에서 뉴클레오사이드에 컨쥬게이트된 아르알킬 리간드를 갖는 연결된 뉴클레오사이드는 컨쥬게이트되지 않은 dsRNA 화합물과 비교하였을 때 개선된 dsRNA 활성을 입증할 것이다.
본 발명의 아르알킬-리간드-컨쥬게이트된 올리고뉴클레오타이드는 또한 올리고뉴클레오타이드 및 연결된 뉴클레오사이드의 컨쥬게이트를 포함하고, 여기서 리간드는 연결기의 개입없이 뉴클레오사이드 또는 뉴클레오타이드에 직접 부착된다. 리간드는 바람직하게는 리간드의 카복시, 아미노 또는 옥소 기에서 연결기를 통해 부착될 수 있다. 전형적인 연결기는 에스터, 아미드 또는 카밤에이트 기일 수 있다.
본 발명의 리간드-컨쥬게이트된 올리고뉴클레오타이드에서 사용되기 위한 것으로 고려되는 바람직한 개질된 올리고뉴클레오타이드의 구체적인 예는 개질된 주쇄 또는 비-천연 뉴클레오사이드간 연결을 함유하는 올리고뉴클레오타이드를 포함한다. 본원에서 정의된 바와 같이, 개질된 주쇄 또는 뉴클레오사이드간 연결을 갖는 올리고뉴클레오타이드는 주쇄에서 인 원자를 보유한 것들 및 주쇄에 인 원자를 갖지 않는 것들을 포함한다. 본 발명의 목적에서, 당간(intersugar)의 주쇄에 인 원자를 갖지 않는 개질된 올리고뉴클레오타이드도 또한 올리고뉴클레오사이드로서 간주될 수 있다.
특이적 올리고뉴클레오타이드 화학적 개질이 하기 개시되어 있다. 주어진 화합물의 모든 위치가 균일하게 개질될 필요는 없다. 반대로, 하나 이상의 개질이 단일 dsRNA 화합물 또는 심지어는 이의 하나의 뉴클레오타이드에 혼입될 수 있다.
바람직한 개질된 뉴클레오사이드간 연결 또는 주쇄는 예를 들면 정상적인 3'-5' 연결을 갖는 포스포로티오에이트, 키랄 포스포로티오에이트, 포스포로다이티오에이트, 포스포트라이에스터, 아미노알킬포스포트라이에스터, 메틸 및 다른 알킬 포스포네이트(3'-알킬렌 포스포네이트 포함) 및 키랄 포스포네이트, 포스피네이트, 포스포르아미데이트(3'-아미노 포스포르아미데이트 및 아미노알킬포스포르아미데이트 포함), 티오노포스포르아미데이트, 티오노알킬포스포네이트, 티오노알킬포스포트라이에스터 및 보라노포스페이트, 이들의 2'-5' 연결된 유사체, 및 극성이 뒤집힌 것들(여기서 뉴클레오사이드 유니트의 인접한 쌍은 3'-5'에서 5'-3'으로, 또는 2'-5'에서 5'-2'으로 연결된다)을 포함한다. 다양한 염, 혼합된 염 및 유리 산 형태가 또한 포함된다.
상기 인-원자 함유 연결기의 제조에 관한 대표적인 미국 특허는 미국 특허 제4,469,863호; 제5,023,243호; 제5,264,423호; 제5,321,131호; 제5,399,676호; 제5,405,939호; 제5,453,496호; 제5,455,233호 및 제5,466,677호를 포함하지만, 이로 한정되지는 않고, 이들 각각은 본원에 참고로 혼입되어 있다.
내부에 인 원자를 포함하지 않는(즉, 올리고뉴클레오사이드) 바람직한 개질된 뉴클레오사이드간 연결 또는 주쇄는 단쇄 알킬 또는 사이클로알킬 당간 연결, 혼합된 헤테로원자 및 알킬 또는 사이클로알킬 당간 연결, 또는 하나 이상의 단쇄 헤테로원자 또는 헤테로사이클릭 당간 연결을 갖는다. 이들은 모폴리노 연결(뉴클레오사이드의 당 부분으로부터 부분적으로 형성됨); 실록산 주쇄; 설파이드, 설폭사이드 및 설폰 주쇄; 포름아세틸 및 티오포름아세틸 주쇄; 메틸렌 포름아세틸 및 티오포름아세틸 주쇄; 알켄 함유 주쇄; 설파메이이트 주쇄; 메틸렌이미노 및 메틸렌하이드라지노 주쇄; 설포네이트 및 설폰아미드 주쇄; 아미드 주쇄; 및 혼합된 N, O, S 및 CH2 성분 부분을 갖는 것들에 의해 형성되는 주쇄를 갖는다.
상기 올리고뉴클레오사이드의 제조에 관한 대표적인 미국 특허는 제5,034,506호; 제5,214,134호; 제5,216,141호; 제5,264,562호; 제5,466,677호; 제5,470,967호; 제5,489,677호; 제5,602,240호 및 제5,663,312호를 포함하지만, 이로 한정되지는 않고, 이들 각각은 본원에 참고로 혼입되어 있다.
다른 바람직한 올리고뉴클레오타이드 모방체에서는, 뉴클레오사이드 유니트의 당 및 뉴클레오사이드간 연결기 둘 모두 즉 주쇄가 신규한 기로 대체된다. 뉴클레오베이스 유니트는 적절한 핵산 표적 화합물을 이용한 하이브리드화를 위해 유지된다. 탁월한 하이브리드 성질을 갖고 있는 것으로 나타난 하나의 이런 올리고뉴클레오타이드, 올리고뉴클레오타이드 모방체는 펩타이드 핵산(PNA)으로 언급된다. PNA 화합물에서, 올리고뉴클레오타이드의 당-주쇄는 아미드-함유 주쇄, 특히 아미노에틸글라이신 주쇄로 대체된다. 뉴클레오베이스가 유지되고, 주쇄의 아미드 부분의 원자에 직접적으로 또는 간접적으로 결합된다. PNA 화합물의 개시는 예를 들면 미국 특허 제5,539,082호에서 발견될 수 있다.
본 발명의 일부 바람직한 실시양태는 포스포로티오에이트 연결기를 갖는 올리고뉴클레오타이드 및 헤테로원자 주쇄를 갖는 올리고뉴클레오사이드, 특히 상기 언급된 미국 특허 제5,489,677호의 --CH2--NH--O--CH2--, --CH2--N(CH3)--O--CH2-- [메틸렌(메틸이미노) 또는 MMI 주쇄로 공지됨], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, 및 --O--N(CH3)--CH2--CH2-- [여기서, 천연 포스포다이에스터 주쇄는 --O--P--O--CH2--로서 표현된다], 및 상기 언급된 미국 특허 제5,602,240호의 아미드 주쇄를 갖는 것들을 이용한다. 또한 상기 언급된 미국 특허 제5,034,506호의 모폴리노 주쇄 구조를 갖는 올리고뉴클레오타이드가 바람직하다.
본 발명의 리간드-컨쥬게이트된 올리고뉴클레오타이드에서 이용되는 올리고뉴클레오타이드는 부가적으로 또는 다르게는 뉴클레오베이스(종종 당 분야에서는 단순히 "염기"로 언급된다) 개질 또는 치환을 포함할 수 있다. 본원에서 이용되는 "개질되지 않은" 또는 "천연" 뉴클레오베이스는 퓨린 염기인 아데닌(A) 및 구아닌(G), 및 피리미딘 염기인 티민(T), 사이토신(C) 및 우라실(U)을 포함한다. 개질된 뉴클레오베이스는 다른 합성 및 천연 뉴클레오베이스, 예를 들면 4-메틸사이토신(5-me-C), 5-하이드록시메틸 사이토신, 잔틴, 하이포잔틴, 2-아미노아데닌, 아데닌과 구아닌의 6-메틸 및 다른 알킬 유도체, 아데닌과 구아닌의 2-프로필 및 다른 알킬 유도체, 2-티오우라실, 2-티오티민 및 2-티오사이토신, 5-할로우라실 및 사이토신, 5-프로피닐 우라실 및 사이토신, 6-아조 우라실, 사이토신 및 티민, 5-우라실(슈도우라실), 4-티오우라실, 8-할로, 8-아미노, 8-티올, 9-티오알킬, 8-하이드록실 및 다른 8-치환된 아데닌 및 구아닌, 5-할로 특히 5-브로모, 5-트라이플루오로메틸 및 다른 5-치환된 우라실 및 사이토신, 7-메틸구아닌 및 7-메틸아데닌, 8-아자구아닌 및 8-아자아데닌, 7-데스아자구아닌 및 7-데아자아데닌 및 3-데아자구아닌 및 3-데아자아데닌을 포함한다.
추가의 뉴클레오베이스는 미국 특허 제3,687,808호에 개시된 것들, [Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990]에 개시된 것들, [Englisch et al., Angewandte Chemie , International Edition, 1991, 30, 613]에 개시된 것들 및 [Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993]에 개시된 것들을 포함한다. 이들 뉴클레오베이스의 일부는 본 발명의 올리고뉴클레오타이드의 결합 친화성을 증가시키는데 특히 유용하다. 이들은 2-아미노프로필아데닌, 5-프로피닐우라실 및 5-프로피닐사이토신을 비롯한 5-치환된 피리미딘, 6-아자피리미딘 및 N-2, N-6 및 O-6 치환된 퓨린을 포함한다. 5-메틸사이토신 치환체는 핵산 듀플렉스 안정성을 0.6 내지 1.2℃(Id., 제276면 내지 제278면)만큼 증가시키는 것으로 보이고, 현재 바람직한 염기 치환제이며, 2'-메톡시에틸 당 개질과 조합되면 보다 더 특히 바람직하다.
상기 언급된 개질된 뉴클레오베이스의 일부 및 또한 다른 개질된 뉴클레오베이스의 제조에 관한 대표적인 미국 특허는 미국 특허 제3,687,808호, 및 또한 미국 특허 제5,134,066호; 제5,459,255호; 제5,552,540호; 제5,594,121호 및 제5,596,091호를 포함하지만, 이로 한정되지는 않는다.
일부 실시양태에서, 리간드-컨쥬게이트된 올리고뉴클레오타이드에서 이용되는 올리고뉴클레오타이드는 부가적으로 또는 다르게는 하나 이상의 치환된 당 잔기를 포함한다. 바람직한 올리고뉴클레오타이드는 2' 위치에서 하기중 하나를 포함한다: OH; F; O-, S-, 또는 N-알킬, O-, S-, 또는 N-알켄일, 또는 O, S- 또는 N-알킨일(여기서, 알킬, 알켄일 및 알킨일은 치환되거나 비치환된 C1 내지 C10 알킬 또는 C2 내지 C10 알켄일 및 알킨일일 수 있다). O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2 및 O(CH2)nON[(CH2)nCH3)]2(여기서, n 및 m은 1 내지 약 10이다)가 특히 바람직하다. 다른 바람직한 올리고뉴클레오타이드는 2' 위치에서 하기중 하나를 포함한다: C1 내지 C10 저급 알킬, 치환된 저급 알킬, 알크아릴, 아르알킬, O-알크아릴 또는 O-아르알킬, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, ONO2, NO2, N3, NH2, 헤테로사이클로알킬, 헤테로사이클로알크아릴, 아미노알킬아미노, 폴리알킬아미노, 치환된 실릴, RNA 분해기, 리포터 기, 인터칼레이터(intercalator), 올리고뉴클레오타이드의 약물동력학적 성질을 개선시키기 위한 기, 올리고뉴클레오타이드의 약역학적 성질을 개선시키기 위한 기, 유사한 성질을 갖는 다른 치환기. 바람직한 개질은 2'-메톡시에톡시[2'-O--CH2CH2OCH3, 이는 또한 2'-O-(2-메톡시에틸) 또는 2'-MOE로 알려져 있다], 즉, 알콕시알콕시 기를 포함한다. 추가의 바람직한 개질은 그 내용이 본원에 참고로 혼입되어 있는 1998년 1월 30일자로 출원된 미국 특허 제6,127,533호에 개시된 바와 같은 2'-다이메틸아미노옥시에톡시, 즉, O(CH2)2ON(CH3)2(이는 또한 2'-DMAOE로도 알려져 있다)를 포함한다.
다른 바람직한 개질은 2'-메톡시(2'-O--CH3), 2'-아미노프로폭시(2'-OCH2CH2CH2NH2) 및 2'-플루오로 (2'-F)를 포함한다. 올리고뉴클레오타이드의 다른 위치, 특히 3' 단부 뉴클레오타이드 또는 2'-5' 연결된 올리고뉴클레오타이드 상의 당의 3' 위치에서 유사한 개질이 만들어질 수 있다.
본원에서 이용되는 용어 "당 치환체 기" 또는 2'-치환체 기"는 산소 원자가 있거나 없는 라이보푸라노실 잔기의 2'-위치에 부착되는 기를 포함한다. 당 치환체 기는 플루오로, O-알킬, O-알킬아미노, O-알킬알콕시, 보호된 O-알킬아미노, O-알킬아미노알킬, O-알킬 이미다졸 및 화학식 (O-알킬)m(여기서 m은 1 내지 약 10이다)의 폴리에터를 포함하지만, 이로 한정되지는 않는다. 이들 폴리에터중에서 선형 및 환상 폴리에틸렌 글리콜(PEG) 및 (PEG)-함유 기, 예를 들면 크라운 에터, 및 그중에서도 특히 본원에 전체가 참고로 혼입되어 있는 [Delgardo et. al., Critical Reviews in Therapeutic Drug Carrier Systems 1992, 9:249]에 개시된 것들이 바람직하다. 또한 당 개질은 [Cook, Anti - fibrosis Drug Design, 1991, 6:585-607]에 개시되어 있다. 플루오로, O-알킬, O-알킬아미노, O-알킬 이미다졸, O-알킬아미노알킬 및 알킬 아미노 치환이 본원에 전체가 참고로 혼입되어 있는 발명의 명칭이 "2' 및 5' 치환을 갖는 피리미딘 뉴클레오타이드를 갖는 다량체 화합물"인 미국 특허 제6,166,197호에 개시되어 있다.
본 발명에 이용가능한 추가의 당 치환기는 2'-SR 및 2'-NR2 기(여기서, 각각의 R은 독립적으로 수소, 보호기 또는 치환되거나 비치환된 알킬, 알켄일 또는 알킨일이다)를 포함한다. 2'-SR 뉴클레오사이드는 본원에 전체가 참고로 혼입되어 있는 미국 특허 제5,670,633호에 개시되어 있다. 2'-SR 단량체 신톤(synthon)의 혼입이 [Hamm et al. J. Org . Chem., 1997, 62:3415-3420]에 개시되어 있다. 2'-NR 뉴클레오사이드가 [Goettingen, M., J. Org . Chem., 1996, 61, 6273-6281]; 및 [Polushin et al., Tetrahedron Lett., 1996, 37, 3227-3230]에 개시되어 있다. 본 발명에 적용가능한 추가의 대표적인 2'-치환체 기는 하기 화학식 I 또는 II를 갖는 것들을 포함한다:
[화학식 I]
Figure pct00001
[화학식 II]
Figure pct00002
상기 식에서,
E는 C1-C10 알킬, N(Q3)(Q4) 또는 N=C(Q3)(Q4)이고; 각각의 Q3 및 Q4는 독립적으로 H, C1-C10 알킬, 다이알킬아미노알킬, 질소 보호기, 테더된(tethered) 컨쥬게이트 기, 테더되지 않은(untethered) 컨쥬게이트기, 고형 지지체에 대한 연결기이거나; 또는 Q3 및 Q4는 함께 질소 보호기 또는 N 및 O에서 선택된 하나 이상의 추가의 헤테로원자를 선택적으로 포함하는 고리 구조이고;
q1은 1 내지 10의 정수이고;
q2는 1 내지 10의 정수이고;
q3은 0 또는 1이고;
q4는 0, 1 또는 2이고;
각각의 Z1, Z2 및 Z3은 독립적으로 C4-C7 사이클로알킬, C5-C14 아릴 또는 C3-C15 헤테로사이클릴이고, 여기서, 상기 헤테로사이클릴 기의 헤테로원자는 산소, 질소 및 황에서 선택되고;
Z4는 OM1, SM1, 또는 N(M1)2이고; 각각의 M1은 독립적으로 H, C1-C8 알킬, C1-C8 할로알킬, C(=NH)N(H)M2, C(=O)N(H)M2 또는 OC(=O)N(H)M2이고; M2는 H 또는 C1-C8 알킬이고;
Z5는 C1-C10 알킬, C1-C10 할로알킬, C2-C10 알켄일, C2-C10 알킨일, C6-C14 아릴, N(Q3)(Q4), OQ3, 할로, SQ3 또는 CN이다.
화학식 I의 대표적인 2'-O-당 치환기는 본원에 전체가 참고로 혼입되어 있는 발명의 명칭이 "캡핑된 2'-옥시에톡시 올리고뉴클레오타이드"인 미국 특허 제6,172,209호에 개시되어 있다. 화학식 II의 대표적인 환상 2'-O-당 치환기는 본원에 그 전체가 혼입되어 있는 발명의 명칭이 "RNA 표적화된 2'-개질된 올리고뉴클레오타이드"인 미국 특허 제6,271,358호에 개시되어 있다.
라이보실 고리 상에 O-치환체를 갖는 당 또한 본 발명에 적용될 수 있다. 고리 O에 대해 대표적인 치환체는 S, CH2, CHF 및 CF2를 포함하지만, 이로 한정되지는 않는다.
올리고뉴클레오타이드는 또한 펜토푸라노실 당 대신 당 모방체, 예를 들면 사이클로부틸 잔기를 가질 수 있다. 이런 개질된 당의 제조와 관련된 대표적인 미국 특허는 제5,359,044호; 제5,466,786호; 제5,519,134호; 제5,591,722호; 제5,597,909호; 제5,646,265호 및 제5,700,920호(이들 모두는 본원에 참고로 혼입되어 있다)를 포함하지만, 이로 한정되지 않는다.
또한 올리고뉴클레오타이드 상의 다른 위치, 특히 3' 단부 뉴클레오타이드 상의 당의 3' 위치에서 추가로 개질될 수 있다. 예를 들면 본 발명의 리간드-컨쥬게이트된 올리고뉴클레오타이드의 하나의 추가의 개질은 올리고뉴클레오타이드에 올리고뉴클레오타이드의 활성, 세포 분포 또는 세포 섭취를 개선시키는 하나 이상의 추가의 비-리간드 잔기 또는 컨쥬게이트를 화학적으로 연결시킴을 포함한다. 이런 잔기는 지질 잔기, 예를 들면 콜레스테롤 잔기([Letsinger et al., Proc . Natl . Acad . Sci . USA, 1989, 86, 6553]), 콜산 ([Manoharan et al., Bioorg . Med . Chem . Lett ., 1994, 4, 1053]), 티오에터, 예를 들면 헥실-S-트라이틸티올([Manoharan et al., Ann . N.Y. Acad . Sci., 1992, 660, 306]; [Manoharan et al., Bioorg . Med . Chem . Let ., 1993, 3, 2765]), 티오콜레스테롤([Oberhauser et al., Nucl . Acids Res., 1992, 20, 533]), 지방족 쇄, 예를 들면 도데칸다이올 또는 운데실 잔기([Saison-Behmoaras et al., EMBO J., 1991, 10, 111]; [Kabanov et al., FEBS Lett., 1990, 259, 327]; [Svinarchuk et al., Biochimie, 1993, 75, 49]), 인지질, 예를 들면 다이-헥사데실-rac-글리세롤 또는 트라이에틸암모늄 1,2-다이-O-헥사데실-rac-글리세로-3-H-포스포네이트([Manoharan et al., Tetrahedron Lett ., 1995, 36, 3651]; [Shea et al., Nucl . Acids Res ., 1990, 18, 3777]), 폴리아민 또는 폴리에틸렌 글리콜 쇄([Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969]), 또는 아다만탄 아세트산([Manoharan et al., Tetrahedron Lett ., 1995, 36, 3651]), 팔미틸 잔기([Mishra et al., Biochim. Biophys . Acta, 1995, 1264, 229]), 또는 옥타데실아민 또는 헥실아미노-카본일-옥시콜레스테롤 잔기([Crooke et al., J. Pharmacol . Exp . Ther ., 1996, 277, 923])를 포함하지만, 이로 한정되지는 않는다.
본 발명은 또한 올리고뉴클레오타이드 내부의 특정한 위치에 대해 실질적으로 키랄 순수한 올리고뉴클레오타이드를 이용하는 조성물을 포함한다. 실질적으로 키랄 순수한 올리고뉴클레오타이드의 예는 75% 이상이 Sp 또는 Rp인 포스포로티오에이트 연결기를 갖는 것들(쿡(Cook) 등의 미국 특허 제5,587,361호) 및 실질적으로 키랄 순수한 (Sp 또는 Rp) 알킬포스포네이트, 포스포르아미데이트 또는 포스포트라이에스터 연결기(쿡의 미국 특허 제5,212,295호 및 제5,521,302호)를 갖는 것들을 포함하지만, 이로 한정되지는 않는다.
일부 경우, 올리고뉴클레오타이드는 비-리간드 기에 의해 개질될 수 있다. 올리고뉴클레오타이드의 활성, 세포 분포 또는 세포 섭취를 개선시키기 위해 다수의 비-리간드 분자가 올리고뉴클레오타이드에 컨쥬케이트되어 왔고, 이런 컨쥬게이트 형성 방법은 과학 문헌에서 이용가능하다. 이런 비-리간드 잔기는 지질 잔기, 예를 들면 콜레스테롤 잔기([Letsinger et al., Proc . Natl . Acad . Sci . USA, 1989, 86, 6553]), 콜산([Manoharan et al., Bioorg . Med . Chem . Lett ., 1994, 4, 1053]), 티오에터, 예를 들면 헥실-S-트라이틸티올([Manoharan et al., Ann . N.Y. Acad. Sci., 1992, 660, 306]; [Manoharan et al., Bioorg . Med . Chem . Let ., 1993, 3, 2765]), 티오콜레스테롤([Oberhauser et al., Nucl . Acids Res., 1992, 20, 533]), 지방족 쇄, 예를 들면 도데칸다이올 또는 운데실 잔기([Saison-Behmoaras et al., EMBO J., 1991, 10, 111]; [Kabanov et al., FEBS Lett., 1990, 259, 327]; [Svinarchuk et al., Biochimie, 1993, 75, 49]), 인지질, 예를 들면 다이-헥사데실-rac-글리세롤 또는 트라이에틸암모늄 1,2-다이-O-헥사데실-rac-글리세로-3-H-포스포네이트([Manoharan et al., Tetrahedron Lett ., 1995, 36, 3651]; [Shea et al., Nucl . Acids Res ., 1990, 18, 3777]), 폴리아민 또는 폴리에틸렌 글리콜 쇄([Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969]), 또는 아다만탄 아세트산([Manoharan et al., Tetrahedron Lett ., 1995, 36, 3651]), 팔미틸 잔기([Mishra et al., Biochim . Biophys . Acta, 1995, 1264, 229]), 또는 옥타데실아민 또는 헥실아미노-카본일-옥시콜레스테롤 잔기([Crooke et al., J. Pharmacol . Exp. Ther ., 1996, 277, 923])를 포함하지만, 이로 한정되지는 않는다. 전형적인 컨쥬게이션 프로토콜은 서열의 하나 이상의 위치에서 아미노연결기를 갖는 올리고뉴클레오타이드의 합성을 포함한다. 그런 다음, 아미노기를 적절한 커플링 또는 활성화 시약을 이용하여 컨쥬게이트된 분자와 반응시킨다. 컨쥬게이트 반응은 고형 지지체에 여전히 결합되어 있는 올리고뉴클레오타이드와 수행되거나 또는 용액 상에서 올리고뉴클레오타이드의 분해 후에 수행될 수 있다. HPLC에 의한 올리고뉴클레오타이드 컨쥬게이트의 정제는 순수한 컨쥬게이트를 제공한다. 콜레스테롤 컨쥬게이트의 이용이 특히 바람직한데, 이는 이런 잔기가 인자 V 단백질 생산 부위인 간 조직으로의 표적화를 증가시킬 수 있기 때문이다.
다르게는, 분자중에 존재하는 알콜 기를 통해서 또는 인산화될 수 있는 알콜 기를 갖는 연결기의 부착에 의해 컨쥬게이트된 분자를 구축 블록, 예를 들면 포스포르아미다이트로 전환시킬 수 있다.
중요하게는, 이들 접근법 각각은 리간드 컨쥬게이트된 올리고뉴클레오타이드의 합성을 위해 이용될 수 있다. 아미노 연결된 올리고뉴클레오타이드는 커플링제의 이용을 통해 리간드에 직접 커플링될 수 있거나, NHS 또는 펜트플루오로페놀레이트 에스터와 같은 리간드의 활성화 후에 커플링될 수 있다. 리간드 포스포르아미다이트는 아미노헥산올 연결기를 카복실 기중 하나에 부착시킨 후 단부 알콜 작용기를 포스파이트화시킴으로써 합성될 수 있다. 다른 연결기, 예를 들면 시스테아민을 또한 합성된 올리고뉴클레오타이드 상에 존재하는 클로로아세틸 연결기에 대한 컨쥬게이트화를 위해 이용할 수 있다.
본 발명의 주된 요지중 하나는 본 발명의 dsRNA 분자를 포함하는 약학 조성물의 제공이다. 이런 약학 조성물은 또한 이런 RNA 분자의 개별적인 가닥, 또는 본 발명의 dsRNA 분자를 구성하는 센스 가닥 또는 안티센스 가닥중 하나 이상을 암호화하는 뉴클레오타이드 서열에 작용가능하게 연결된 조절 서열을 포함하는 벡터를 포함할 수 있다. 또한, 본원에 정의된 dsRNA 분자를 발현 또는 포함하는 세포 및 조직을 약학 조성물로서 이용할 수 있다. 이런 세포 또는 조직은 이식 접근법에서 특히 유용할 수 있다. 이런 접근법은 또한 이종 이식을 포함할 수 있다.
한 실시양태에서, 본 발명은 본원에 개시된 바와 같은 dsRNA 및 약학적으로 허용가능한 담체를 포함하는 약학 조성물을 제공한다. dsRNA를 포함하는 약학 조성물은 TGF-베타 수용체 I형 유전자의 발현 또는 활성과 관련된 질병 또는 질환, 예를 들면 섬유증 질환, 암, 또는 염증의 치료에 유용하다.
본 발명의 약학 조성물은 TGF-베타 수용체 I형 유전자를 억제하기에 충분한 투여양으로 투여된다. 본 발명은 이들의 개선된 효능으로 인해, 본 발명의 dsRNA를 포함하는 조성물이 낮은 투여량으로 투여될 수 있는 것으로 발견되었다. 하루에 수용자의 체중 1kg당 5mg의 dsRNA의 최대 투여량이 TGF-베타 수용체 I형 유전자의 발현을 억제 또는 완전히 억제하기에 충분하다.
일반적으로, dsRNA의 적합한 투여량은 하루에 수용자의 체중 1kg당 0.01 내지 5.0mg의 범위, 바람직하게는 하루에 수용자의 체중 1kg당 0.1 내지 200㎍의 범위, 보다 바람직하게는 하루에 수용자의 체중 1kg당 0.1 내지 100㎍의 범위, 보다 더 바람직하게는 하루에 수용자의 체중 1kg당 1.0 내지 50㎍의 범위, 가장 바람직하게는 하루에 수용자의 체중 1kg당 1.0 내지 25㎍의 범위일 것이다. 약학 조성물은 매일 1회 투여될 수 있거나, 또는 dsRNA는 하루에 걸쳐 적절한 간격으로 2회, 3회, 4회, 5회, 6회 또는 그 이상의 하부 투여량으로 또는 심지어는 연속 주입을 이용하여 투여될 수 있다. 이런 경우, 각각의 하부 투여량에 함유된 dsRNA는 총 1일 투여량이 달성되도록 상응하게 더 작아야만 한다. 투여 단위는 또한 예를 들면 며칠의 기간동안 dsRNA의 지속 방출을 제공하는 종래의 지속 방출 제제를 이용하여 며칠 동안의 전달을 위해 배합될 수 있다. 지속 방출 제제는 당 분야에 잘 공지되어 있다. 이 실시양태에서, 투여 단위는 1일 투여량의 상응하는 몇배를 함유한다.
당 분야의 숙련자는 질병 또는 질환의 심각성, 이전 치료법, 대상의 일반적인 건강 및/또는 연령 및 존재하는 다른 질병을 포함하지만 이로 한정되지 않는 일부 인자가 대상을 효과적으로 치료하는데 요구되는 투여량 및 시기에 영향을 미칠 수 있음을 인식할 것이다. 또한, 치료 효과량의 조성물을 이용한 대상의 치료는 단일 치료 또는 연속 치료를 포함할 수 있다. 본 발명에서 예상되는 개별적인 dsRNA에 대한 효과적 투여량 및 생체내 반감기는 종래의 방법학 또는 적절한 동물 모델을 이용한 생체내 시험에 근거하여 추정될 수 있다.
마우스 유전학의 진보로 인해 다양한 인간의 질환, 예를 들면 섬유증, 암 또는 염증의 연구를 위한 다수의 마우스 모델이 만들어졌다. 이런 모델은 dsRNA의 생체 내 시험, 및 또한 치료 효과량의 측정에 유용하다.
본 발명에 의한 약학 조성물은 정맥내, 근육내, 복강내, 피하, 경피, 기도(에어로졸), 직장, 질 및 국소(협측 및 설하 포함) 투여를 비롯한 경구 또는 비경구 경로를 포함하지만 이로 한정되지는 않는 당 분야에 공지된 임의의 수단에 의해 투여될 수 있다. 바람직한 실시양태에서, 약학 조성물은 정맥내 투여된다.
근육내, 피하 및 정맥내 용도의 경우, 본 발명의 약학 조성물은 일반적으로 적절한 pH 및 등장성으로 완충되는 멸균 수용액 또는 현탁액으로 제공될 것이다. 적합한 수성 비히클은 링거 용액 및 등장성 염화나트륨을 포함한다. 바람직한 실시양태에서, 담체는 배타적으로 수성 완충액으로 구성된다. 본원에서 "배타적으로"란 TGF-베타 수용체 유전자를 발현하는 세포에서 dsRNA의 섭취에 영향을 미치거나 이를 매개할 수 있는 보조제 또는 캡슐화 물질이 존재하지 않음을 의미한다. 이런 물질은 예를 들면 하기 개시된 바와 같은 마이셀 구조, 예를 들면 리포솜 또는 캡시드를 포함한다. 비록 dsRNA를 세포 배양액으로 도입하는데 미세주입, 리포펙션, 바이러스, 바이로이드, 캡시드, 캡소이드 또는 다른 보조제가 요구되지만, 놀랍게도 dsRNA의 생체 내 섭취에 이들 방법 및 시약이 필수적이지 않다. 본 발명에 따른 수성 현탁액은 현탁제, 예를 들면 셀룰로스 유도체, 나트륨 알기네이트, 폴리비닐-피롤리돈 및 트라가칸트 검, 및 습윤화제, 예를 들면 레시틴을 포함할 수 있다. 수성 현탁액에 적합한 방부제는 에틸 및 n-프로필 p-하이드록시벤조에이트를 포함한다.
본 발명에 유용한 약학 조성물은 또한 신체로부터의 신속한 제거로부터 dsRNA를 보호하는 캡슐화된 제형, 예를 들면 이식물 및 마이크로캡슐화된 전달 시스템을 비롯한 제어 방출 제형을 포함한다. 생분해성, 생물학적 상용성 중합체, 예를 들면 에틸렌 비닐 아세테이트, 다가무수물, 폴리글리콜산, 콜라겐, 폴리오르토에스터 및 폴리락트산을 이용할 수 있다. 이런 제형의 제조 방법은 당업자에게 공지되어 있다. 물질을 또한 알자 코포레이션(Alza Corporation) 및 노바 파마슈티칼스 인코포레이티드(Nova Pharmaceuticals, Inc.)에서 상업적으로 수득할 수 있다. 또한 리포솜 현탁액(바이러스 항원에 대한 모노클론 항체를 이용하여 감염된 세포로 표적화되는 리포솜 포함)을 약학적으로 허용가능한 담체로서 이용할 수 있다. 이들은 예를 들면 본원에 참고로 혼입되어 있는 미국 특허 제4,522,811호; PCT 공개 공보 제WO91/06309호 및 유럽 특허 공개공보 제EP-A-43075호에 개시된 바와 같이 당 분야의 숙련자들에게 공지된 방법에 따라 제조될 수 있다.
본 발명은 또한 본 발명의 RNAi 시약을 함유하는 디바이스, 예를 들면 혈액과 접촉하는 디바이스를 제공한다. 혈액과 접촉하는 디바이스의 예는 혈관 이식체, 스텐트, 정형외과 인공 보철물, 심장 인공 보철물, 및 체외 순환 시스템을 포함한다.
이런 화합물의 독성 및 치료 효능을 예를 들면 LD50(모집단의 50%가 죽는 투여량) 및 ED50(모집단의 50%에서 치료 효과적인 투여량)을 측정하기 위해 세포 배양액 또는 실험 동물에서 표준 약학 과정에 의해 측정할 수 있다. 독성 효과와 치료 효과 사이의 투여 비가 치료 지수이고, 이는 비 LC50/ED50으로 표현될 수 있다. 높은 치료 지수를 나타내는 화합물이 바람직하다.
세포 배양 분석 및 동물 연구에서 수득한 자료를 인간에서 이용하기 위한 투여 범위의 제형에서 이용할 수 있다. 본 발명의 조성물의 투여량은 바람직하게는 독성이 거의 없거나 전혀 없는 ED50을 포함하는 순환 농도의 범위 이내이다. 사용되는 투여 형태 및 이용되는 투여 경로에 따라 투여량이 이 범위 이내에서 다양할 수 있다. 본 발명의 방법에서 이용되는 임의의 화합물의 경우, 치료 효과 투여량은 먼저 세포 배양 분석으로부터 추정될 수 있다. 투여량은 세포 배양액에서 측정된 바와 같은 IC50(즉, 증후의 최대 억제의 50%를 달성하는 시험 화합물의 농도)을 비롯한 순환 혈장 농도 범위의 화합물, 또는 적절하게는 표적 서열의 폴리펩타이드 생성물을 달성하기 위해 동물 모델에서 배합될 수 있다. 이런 정보는 인간에서 유용한 투여량을 보다 정확하게 측정하기 위해 이용될 수 있다. 혈장에서의 수준은 예를 들면 고성능 액체 크로마토그래피에 의해 측정될 수 있다.
상기 논의된 바와 같은 개별적인 또는 다수의 투여에 추가하여, 본 발명의 dsRNA는 섬유증, 염증 또는 증식성 질환, 예를 들면 암, 특히 간암의 치료에 효과적인 다른 공지된 시약과 조합되어 투여될 수 있다. 어떤 경우든, 투여하는 의사가 당 분야에 공지되어 있거나 본원에 개시된 효능의 표준 측정치를 이용하여 관찰된 결과에 근거하여 dsRNA 투여의 양과 시기를 조절할 수 있다.
본 발명의 RNAi 시약은 또한 (예를 들면 혈관 형성술후의 재결찰 및 재협착을 방지하거나, 불안정한 협심증을 치료 또는 예방하기 위한) 피브리노겐 수용체 길항제를 포함하지만 이로 한정되지는 않는 적합한 항-혈소판제, 다양한 혈관 건강 이상의 치료에서 상승효과를 달성하기 위한 항응고제, 예를 들면 아스피린, 혈전용해제, 예를 들면 플라스미노겐 활성화제 또는 스트렙토키나제, 또는 죽상경화증을 치료 또는 예방하기 위한 항고콜레스테롤혈증제를 비롯한 지질 저하제(예를 들면 HMG CoA 환원효소 억제제, 예를 들면 로바스타틴 및 심바스타틴, HMG CoA 합성효소 억제제 등)와 함께 공동 투여될 수 있다. 예를 들면 관상 동맥 질환으로 고통받는 환자, 및 혈관성형술 수술을 받은 환자는 피브리노겐 수용체 길항제와 본 발명의 RNAi 시약의 공동 투여로 인해 이익을 얻을 것이다.
한 실시양태에서, 본 발명은 TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 발현에 의해 매개되는 병리학적 질환을 갖는 대상의 치료 방법을 제공한다. 이런 질환은 예를 들면 섬유증 질환, 바람직하지 않은 염증 사건 또는 증식 질환을 포함한다. 이 실시양태에서, dsRNA는 TGF-베타 수용체 단백질의 발현을 제어하기 위한 치료제로서 작용한다. 이 방법은 TGF-베타 수용체 유전자, 특히 TGF-베타 수용체 I형 유전자의 발현이 침묵되도록 본 발명의 약학 조성물을 환자(예를 들면 인간)에게 투여함을 포함한다. 이의 높은 특이성으로 인해, 본 발명의 dsRNA는 TGF-베타 수용체 I형 유전자의 mRNA를 특이적으로 목표로 한다.
본 발명의 화합물은 하기의 것들을 포함하는 항응집 치료 또는 예방이 지시되는 질환에 특히 유용하다.
본 발명의 화합물은 섬유증 질병, 예를 들면 간 섬유증 및 간경변, 신장 섬유증, 비장의 섬유증, 췌장 및 폐의 낭포성 섬유증, 사출 섬유증, 심내막심근 섬유증, 폐의 특발성 폐 섬유증, 종격섬유증, 골수섬유증, 후복막 섬유증, 진행성 괴상 섬유증, 신장기원 전신성 섬유증, 확산성 실질세포 폐 질환, 정관절제후 통증 증후군 및 류마티스 관절염을 치료 또는 예방하는데 유용하다. 다르게는 본 발명의 TGF-베타 수용체 발현, 특히 TGF-베타 수용체 I형의 발현 억제제를 암, 예를 들면 간암, 및 예를 들면 간세포 암종 HCC의 치료에 이용할 수 있다. 그러나, 또한 암 또는 증식성 질환이 본원에 제공된 수단 및 방법으로 치료될 수 있다. 이런 증식성 질환은 1차 암/종양만을 포함하는 것이 아니라 또한 2차 종양(즉, 전이로 인해 발전된 종양)을 포함한다. 본 발명의 특히 바람직한 실시양태에서, 본 발명의 화합물로 치료되는 종양/암은 뇌암, 유방암, 폐암, 전립선암 또는 간암이다.
따라서 본 발명은 섬유증, 바람직하지 않은 염증 사건 및/또는 바람직하지 않은 세포 성장의 치료를 위해 특히 정맥내 투여에 의해 인간에 투여되는 항-TGF-베타 수용체 dsRNA의 용도를 제공한다.
본 발명에 포함되는 약학 조성물은 정맥내, 근육내, 복강내, 피하, 경피, 기도(에어로졸), 비강, 직장, 질 및 국소(협측 및 설하 투여 포함) 투여 및 경막외 투여를 비롯한 경구 또는 비경구 경로를 포함하지만 이로 한정되지는 않는 당 분야에 공지된 임의의 수단에 의해 투여될 수 있다. 바람직한 실시양태에서, 약학 조성물은 주입 또는 주사에 의해 정맥내 투여된다.
또다른 양태에서, 본 발명은 포유동물에서 TGF-베타 수용체 I형 유전자의 발현을 억제하는 방법을 제공한다. 이 방법은 표적 TGF-베타 수용체 유전자의 발현이 침묵되도록 본 발명의 조성물을 포유동물에 투여함을 포함한다. 이의 높은 특이성으로 인해, 본 발명의 dsRNA는 표적 TGF-베타 수용체 유전자의 RNA(1차 또는 가공된)를 특이적으로 표적화한다. 본 발명의 dsRNA를 이용하여 이들 TGF-베타 수용체 I형 유전자의 발현을 억제하기 위한 조성물 및 방법을 본원의 다른 곳에서 개시된 바와 같이 수행할 수 있다.
본 발명의 다른 양태에서, TGF-베타 수용체 유전자 발현 활성을 조절하는 TGF-베타 수용체 특이적 dsRNA 분자를 DNA 또는 RNA 벡터로 삽입되는 잔사 유니트로부터 발현시킨다. 이들 트랜스유전자(transgene)는 또한 염색체외 플라스미드로서 유전되는 것이 허용되도록 구축될 수 있다.
dsRNA의 개별적인 가닥은 2개의 개별적인 발현 벡터 상의 프로모터에 의해 전사되고 표적 세포로 동시 형질감염될 수 있다. 다르게는, dsRNA의 각각의 개별적인 가닥은 둘 모두 동일한 발현 플라스미드 상에 위치한 프로모터에 의해 전사될 수 있다. 바람직한 실시양태에서는, dsRNA가 줄기와 루프 구조(stem and loop structure)를 갖도록 연결기 폴리뉴클레오타이드 서열에 의해 연결된 뒤집힌 반복체로서 dsRNA가 발현된다.
재조합 dsRNA 발현 벡터는 바람직하게는 DNA 플라스미드 또는 바이러스 벡터이다. dsRNA 발현 바이러스 벡터는 아데노-관련 바이러스; 아데노바이러스 또는 알파바이러스, 및 또한 당 분야에 공지된 다른 것들에 근거하지만, 이로 제한되지 않도록 구축될 수 있다. 레트로바이러스를 이용하여 다양한 유전자를 상피 세포를 비롯한 많은 상이한 세포 유형에 시험관 내 및/또는 생체 내 도입할 수 있다. 세포의 게놈 내로 삽입된 유전자를 도입 및 발현할 수 있는 재조합 레트로바이러스 벡터는 재조합 레트로바이러스 게놈을 적합한 패키징 세포주, 예를 들면 PA317 및Psi-CRIP로 형질전환시킴으로써 생성될 수 있다. 재조합 아데노바이러스 벡터를 이용하여 민감성 숙주(예를 들면 래트, 햄스터, 개 및 침팬지)의 광범위한 세포 및 조직을 감염시킬 수 있고, 이들은 또한 감염을 위해 유사분열적으로 활성 세포를 요구하지 않는 이점을 갖는다.
본 발명의 DNA 플라스미드 또는 바이러스 벡터중 하나에서의 dsRNA 발현을 구동하는 프로모터는 진핵세포 RNA 폴리머라제 I(예를 들면 리보솜 RNA 프로모터), RNA 폴리머라제 II(예를 들면 CMV 초기 프로모터 또는 액틴 프로모터, 또는 U1 snRNA 프로모터), 또는 바람직하게는 RNA 폴리머라제 III 프로모터(예를 들면 U6 snRNA 또는 7SK RNA 프로모터) 또는 원핵세포 프로모터, 예를 들면 T7 프로모터(단, 발현 플라스미드는 또한 T7 프로모터로부터의 전사에 요구되는 T7 RNA 폴리머라제를 암호화한다)일 수 있다. 프로모터는 또한 췌장에 대한 직접적 트랜스유전자 발현일 수 있다(예를 들면 췌장에 대한 인슐린 조절 서열)([Bucchini et al., 1986, Proc. Natl. Acad. Sci. USA 83:2511-2515]).
또한, 트랜스유전자의 발현은 예를 들면 유도성 조절 서열 및 발현 시스템, 예를 들면 일부 생리학적 조절자, 예를 들면 순환 글루코스 수준 또는 호르몬에 민감한 조절 서열을 이용함으로써 정확하게 조절될 수 있다. 세포 또는 포유동물에서 트랜스유전자 발현의 조절에 적합한 이런 유도성 발현 시스템은 엑디손, 에스트로겐, 프로게스테론, 테트라사이클린, 이량체화의 화학적 유도제, 및 아이소프로필-베타-D1-티오갈락토피라노사이드(EPTG)에 의한 조절을 포함한다. 당 분야의 숙련자는 dsRNA 트랜스유전자의 의도된 용도에 근거하여 적절한 조절/프로모터 서열을 선택할 수 있을 것이다.
바람직하게는, dsRNA 분자를 발현할 수 있는 재조합 벡터는 하기 개시된 바와 같이 전달되고, 표적 세포에서 살아남는다. 다르게는, dsRNA 분자의 일시적 발현을 제공하는 바이러스 벡터가 이용될 수 있다. 이런 벡터는 필요에 따라 반복 투여될 수 있다. 일단 발현되면, dsRNA가 표적 RNA에 결합하고, 이의 기능 또는 발현을 조절한다. dsRNA 발현 벡터의 전달은 전신성일 수 있고, 예를 들면 정맥내 또는 근육내 투여하거나, 환자로부터 외식된 표적 세포를 투여한 후 환자에게 다시 도입하거나, 또는 바람직한 표적 세포로의 도입을 허용하는 임의의 다른 수단에 의한 것일 수 있다.
dsRNA 발현 DNA 플라스미드는 전형적으로 양이온성 지질 담체(예를 들면 올리고펙타민(Oligofectamine) 또는 비-양이온성 지질계 담체(예를 들면 트랜짓(Transit)-TKO(등록상표))와의 복합체로서 표적 세포로 형질전환된다. 한 주 이상의 기간동안 단일 TGF-베타 수용체 유전자 또는 다중 TGF-베타 수용체 유전자의 상이한 영역을 표적으로하는 dsRNA-매개된 녹다운을 위한 다중 지질 형질감염 또한 본 발명에 의해 예상된다. 본 발명의 벡터의 숙주 세포로의 성공적인 도입은 다양한 공지된 방법을 이용하여 모니터링될 수 있다. 예를 들면 일시적 형질감염은 리포터, 예를 들면 형광 마커, 예를 들면 녹색 형광 단백질(GFP)를 이용하여 신호전달될 수 있다. 생체 외 세포의 적합한 형질감염은 하이그로마이신 B 저항성과 같은 특이적 환경 인자(예를 들면 항생제 및 약물)에 대한 저항성을 갖는 형질감염된 세포를 제공하는 마커를 이용하여 보증될 수 있다.
한 실시양태에서, 방법은 dsRNA를 포함하는 조성물을 투여함을 포함하고, 여기서, dsRNA는 치료되는 포유동물의 TGF-베타 수용체 I형 유전자의 RNA 전사체의 적어도 일부에 상보적인 뉴클레오타이드 서열을 포함한다. 상기 지적된 바와 같이, 본원에 정의된 dsRNA 분자의 하나 이상의 가닥을 암호화하는 핵산 분자를 포함하는 벡터 및 세포 또한 약학 조성물로서 이용될 수 있고, 따라서, 본원에 개시된 의학적 개입이 필요한 대상의 치료 방법에 또한 이용될 수 있다. 치료될 유기체/대상이 포유동물, 예를 들면 인간인 경우, 조성물은 정맥내, 근육내, 두개내, 피하, 경피, 기도(에어로졸), 비강, 직장, 질 및 국소(협측 및 설하 포함) 투여를 포함하지만 이로 한정되지는 않는 당 분야에 공지된 임의의 수단에 의해 투여될 수 있다. 바람직한 실시양태에서, 조성물은 정맥내 주입 또는 주사에 의해 투여된다. 투여하기 위한 추가의 수단이 비제한적인 방식으로 상기에 제공되어 있다. 약학 조성물 및 상응하는 (인간) 대상의 치료 방법에 대한 이들 실시양태 또한 유전자 치료 접근법과 같은 접근법에 관한 것임에 또한 유의해야한다. 본원에 제공된 바와 같은 TGF-베타 수용체 I형 특이적 dsRNA 분자 또는 이들 본 발명의 dsRNA 분자의 개별적인 가닥을 암호화하는 핵산 분자 또한 벡터에 삽입될 수 있고, 인간 환자를 위한 유전자 치료 벡터로서 이용될 수 있다. 유전자 치료 벡터는 예를 들면 정맥내 주사, 국소 투여(미국 특허 제5,328,470호 참조) 또는 접촉 주성 주사(예를 들면 [Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91:3054-3057])에 의해 대상으로 전달될 수 있다. 유전자 치료 벡터의 약학 제제는 허용가능한 희석제 중의 유전자 치료 벡터를 포함할 수 있거나, 또는 유전자 전달 비히클이 매립된 서방성 매트릭스를 포함할 수 있다. 다르게는, 완전한 유전자 전달 벡터, 예를 들면 레트로바이러스 벡터가 재조합 세포로부터 손상되지 않고 생성될 수 있는 경우, 약학 제제는 유전자 전달 시스템을 생성하는 하나 이상의 세포를 포함할 수 있다.
또한 dsRNA 분자의 도입을 위한 수단 및 방법이 제공되어 왔다. 예를 들면, 리간드, 예를 들면 갈락토스 및 락토스를 갖는 중합성 담체의 이용 또는 엽산의 다양한 거대분자로의 부착을 비롯한 글리코실화된 분자 및 폴레이트-개질된 분자에 의한 표적 전달은 전달되는 분자의 폴레이트 수용체로의 결합을 허용한다. 예를 들면 siRNA의 생체내 전달을 위한 RGD-개질된 나노입자, 또는 짧은 사이클로덱스트린, 아다만틴-PEG을 비롯한 다성분(비바이러스성) 전달 시스템을 포함하는 펩타이드 및 항체가 아닌 단백질에 의한 표적화된 전달이 공지되어 있다. 그러나, 항체, 또는 항체의 (1가) Fab-절편(또는 이런 항체의 다른 절편)을 비롯한 항체 절편 또는 단쇄 항체를 이용한 표적화된 전달이 예상된다. 표적 지향적 전달을 위한 주입 접근법은 그중에서도 유체역학적, 정맥내 주사를 포함한다. 또한 dsRNA의 콜레스테롤 컨쥬게이트를 표적화된 전달을 위해 이용할 수 있고, 이에 의해 친유성 기로의 컨쥬게이트가 세포 섭취를 개선시키고, 올리고뉴클레오타이드의 약물동력학 및 조직 생물분포를 개선시킨다. 또한, 전체 양전하(양이온)를 갖는 합성 벡터가 다가음이온성 핵산과의 복합체 형성 및 음전하를 띤 세포 막과의 상호작용을 용이하게 하는 양이온성 전달 시스템이 공지되어 있다. 이런 양이온 전달 시스템은 또한 양이온 리포솜 전달 시스템, 양이온 중합체 및 펩타이드 전달 시스템을 포함한다. dsRNA/siRNA의 세포 섭취를 위한 다른 전달 시스템은 앱타머(aptamer)-ds/siRNA이다. 또한 본 발명의 dsRNa 분자 또는 이를 암호화하는 핵산 분자를 전달하기 위해 유전자 치료 접근법이 이용될 수 있다. 이런 시스템은 비-병원성 바이러스, 개질된 바이러스 벡터, 및 또한 나노입자 또는 리포솜을 이용한 전달의 이용을 포함한다. dsRNA의 세포 섭취를 위한 다른 전달 방법은 체외이고, 예를 들면 세포, 기관 또는 조직의 생체 외 처리이다. 이들 기법중 일부는 문헌, 예를 들면, [Akhtar (2007), Journal of Clinical Investigation 117, 3623-3632], [Nguyen et al . (2008), Current Opinion in Moleculare Therapeutics 10, 158-167], [Zamboni (2005), Clin Cancer Res 11, 8230-8234] 또는 [Ikeda et al . (2006), Pharmaceutical Research 23, 1631-1640]에 개시되고 요약되어 있다.
달리 정의되지 않는 한, 본원에서 이용되는 모든 기술적 및 과학적 용어는 본 발명이 속하는 기술 분야의 숙련자에 의해 흔히 이해되는 것과 동일한 의미를 갖는다. 비록 본원에 개시된 것들과 유사하거나 등가인 방법 및 재료를 본 발명의 실시 또는 시험에 이용할 수 있지만, 적합한 방법 및 재료가 하기 개시되어 있다. 본원에서 언급되는 모든 문헌, 특허 문헌, 특허 및 다른 참고문헌은 전체가 본원에 참고로 혼입되어 있다. 상충하는 경우, 정의를 비롯한 본 발명의 명세서가 우선할 것이다. 또한, 재료, 방법 및 실시예는 단지 예시일 뿐 제한하고자 하는 것이 아니다.
본 발명의 상기 제공된 실시양태 및 항목은 이제 하기의 제한되지 않은 실시예를 이용하여 예시된다.
첨부된 표의 설명
표 1 - 인간 TGF-베타 수용체 I 유전자를 표적으로하는 dsRNA. "mRNA에서의 위치" 컬럼의 첫번째 수는 23머 서열의 출발점에 상응한다. 회색으로 표시되거나 볼드체로 쓰여진 상기 컬럼의 수는 핫스폿(회색 = 핫스폿 1; 볼드체 = 핫스폿 2)을 나타낸다. 듀플렉스의 길이는 모든 서열에 대해 19개 뉴클레오타이드이다.
표 2 - 인간 TGF-베타 수용체 I을 표적으로하는 dsRNA의 특징: 단일 투여에 대한 활성 시험, HeLaS3 세포에서의 투여 반응, 특이성, 안정성 및 사이토카인 유도. ID50: 50% 억제 농도. t1 /2: 실시예에서 정의된 바와 같은 가닥의 반감기. PBMC: 인간 말초 혈액 단핵 세포.
표 3 - 핵산 개질을 포함하는 인간 TGF-베타 수용체 I 유전자를 표적으로하는 dsRNA. 회색으로 표시되거나 볼드체로 쓰여진 상기 컬럼의 수는 핫스폿(회색 = 핫스폿 1; 볼드체 = 핫스폿 2)을 나타낸다. 대문자로 쓰여진 문자는 RNA 뉴클레오타이드를 나타내고, 소문자 "c", "g", "a" 및 "u"는 2' O-메틸-개질된 뉴클레오타이드를 나타내고, "s"는 포스포로티오에이트를 나타낸다.
표 4 - 뉴클레오타이드 개질을 포함하는 인간 TGF-베타 수용체 I을 표적으로하는 dsRNA의 특성화. 단일 투여에 대한 활성 시험, HeLaS3 세포에서의 투여 반응, 특이성, 안정성 및 사이토카인 유도. ID50: 50% 억제 농도. t1 /2: 실시예에서 정의된 바와 같은 가닥의 반감기. PBMC: 인간 말초 혈액 단핵 세포.
표 5 - 인간 TGF-베타 수용체 I의 측정을 위한 bDNA 프로브의 서열; LE = 라벨 증량제, CE = 캡쳐 증량제, BL = 블록킹 프로브.
표 6 - 인간 GAPDH의 측정을 위한 bDNA 프로브의 서열; LE = 라벨 증량제, CE = 캡쳐 증량제, BL= 블록킹 프로브.
실시예
TGF -베타 수용체 유전자의 유전자 워킹( gene walking )
인간 TGF-베타 수용체 I을 표적으로하는 siRNA를 확인하기 위해 siRNA 디자인을 수행하였다. 먼저, 인간(homo sapience)의 TGF-베타 수용체 I의 공지된 mRNA 서열(NM_004612.2, L11695.1)을 컴퓨터 분석에 의해 조사하여 이들 서열사이에 교차반응성인 RNAi 시약을 생성하는 19개 뉴클레오타이드의 동종 서열을 확인하였다.
RNAi 시약의 확인에서, 선택은 인간 RefSeq 데이터베이스(릴리즈 24)(이는 패스트A(fastA) 알고리듬을 이용한 포괄적인 인간 트랜스크립톰(transcriptome)을 나타내는 것으로 가정된다)에서의 임의의 다른 서열에 대해 2개 이상의 미스매치를 갖는 19머 서열로 제한되었다.
이렇게 확인된 서열이 표 1 및 표 3에서 RNAi 시약의 합성을 위한 근거를 형성하였다.
dsRNA 합성
시약 공급원
시약의 공급원이 본원에서 특정하게 주어져 있지 않은 경우, 이런 시약은 분자생물학 분야에서 표준 품질/순도인 분자생물학용 시약의 임의의 공급원으로부터 수득될 수 있다.
siRNA 합성
단일 가닥 RNA는 엑스페다이트(Expedite) 8909 합성기(어플라이드 바이오시스템스(Applied Biosystems), 독일 다름스타트 소재의 어플레라 도이칠란트 게엠베하) 및 고형 지지체로서 제어된 공극 유리(CPG, 500Å, 프롤리고 바이오케미 게엠베하(Proligo Biochemie GmbH), 독일 함부르크)를 이용하여 1μ몰의 규모에서 고형상 합성에 의해 생성되었다. 상응하는 포스포르아미다이트 및 2'-O-메틸 포스포르아미다이트(프롤리고 바이오케미 게엠베하, 독일 함부르크) 각각을 이용한 고형 상 합성에 의해 RNA 및 2'-O-메틸 뉴클레오타이드 함유 RNA를 생성하였다. [Current protocols in nucleic acid chemistry, Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA]에 개시된 바와 같은 표준 뉴클레오사이드 포스포르아미다이트 화학을 이용하여 올리고라이보뉴클레오타이드 쇄의 서열 이내에서의 선택된 위치에서 이들 구축 블록을 혼입시켰다. 요드 산화제 용액을 아세토니트릴(1%) 중의 보케이지(Beaucage) 시약(츠루아켐 리미티드(Chruachem Ltd.), 영국 글래스고 소재)으로 대체함으로써 포스포로티오에이트 연결기를 도입하였다. 추가의 보조 시약을 말린크로트 베이커(Mallinckrodt Baker)(독일 그라이사임 소재)에서 수득하였다.
음이온 교환 HPLC에 의한 조질 올리고라이보뉴클레오타이드의 탈보호 및 정제를 확립된 방법에 따라 수행하였다. 분광 광도계(DU 640B, 독일 운터슐레이쓰하임 소재의 벡크만 쿨터 게엠베하(Beckman Coulter GmbH))를 이용하여 260nm의 파장에서 각각의 RNA 용액의 UV 흡광에 의한 수율 및 농도를 측정하였다. 어닐링 완충액(20mM 나트륨 포스페이트, pH 6.8; 100mM 염화 나트륨) 중의 상보적 가닥의 동몰량 용액을 혼합하고, 85 내지 90℃에서 3분동안 수욕에서 가열하고, 3 내지 4시간동안 실온으로 냉각시킴으로써 이중 가닥 RNA를 생성하였다. 어닐링된 RNA 용액을 사용할 때까지 -20℃에서 저장하였다.
활성 시험
상기 개시된 siRNA의 활성을 HeLaS3 세포에서 시험하였다.
TGF베타-수용체-특이적 siRNA 분석법을 이용하여 항온처리된 세포로부터 단리된 총 mRNA 중의 분지된 DNA에 의해 TGF베타-수용체 I형 mRNA를 정량하는데 배양액중의 HeLa 세포를 이용하였다.
아메리칸 타입 컬쳐 콜렉션(메릴랜드주 록빌 소재, 카탈로그 번호 CCL-2.2)로부터 HeLaS3 세포를 수득하고, 가습된 인큐베이터(헤라에우스 헤라셀(Heraeus HERAcell) 켄드로 래보레이토리 프로덕츠, 독일 랑겐셀볼드 소재)에서 5% CO2를 갖는 대기 중에서 37℃에서 10% 우태 혈청(FCS: fetal calf serum)(바이오크롬 아게(Biochrom AG), 독일 베를린 소재, 카탈로그 번호 S0115), 페니실린 100U/ml, 스트렙토마이신 100mg/ml(바이오크롬 아게, 독일 베를린 소재, 카탈로그 번호 A2213)을 함유하도록 보충된 햄(Ham's) F12(바이오크롬 아게, 독일 베를린 소재, 카탈로그 번호 FG 0815)에서 배양하였다. 세포 시딩 및 siRNA의 형질감염을 동시에 수행하였다. siRNA의 형질감염을 위해, HeLaS3 세포를 96웰 플레이트에서 1.5x104 세포/웰의 농도로 시딩하였다. siRNA의 형질감염을 제조자에 의해 개시된 바와 같이 리포펙타민 2000(인비트로겐 게엠베하(Invitrogen GmbH), 독일 칼스루헤 소재, 카탈로그 번호 11668-019)를 이용하여 수행하였다. 제 1 단일 투여 실험에서 siRNA를 30nM의 농도로 형질감염시켰다. 제 2 단일 투여 실험에서 대부분의 활성 siRNA를 300pM에서 재분석하였다. 300pM에서의 단일 투여 스크린에서 나온 TGF베타-수용체에 대해 가장 효과적인 siRNA는 투여 반응 곡선에 의해 추가로 특성화되었다. 투여 반응 곡선의 경우, 형질감염을 상기 단일 투여 스크린에 대해서와 같이 수행하였고, 단 하기 농도의 siRNA(nM)를 이용하였다: 24, 6, 1.5, 0.375, 0.0938, 0.0234, 0.0059, 0.0015, 0.0004 및 0.0001 nM. 형질감염후에, 세포를 가습된 인큐베이터(헤라에우스 게엠베하, 독일 하나우 소재)에서 37℃ 및 5% CO2에서 24시간동안 배양하였다. TGF베타-수용체 mRNA의 측정을 위해서, mRNA의 bDNA 정량용 콴티진 스크린 어세이 키트(QuantiGene Screen Assay Kit)(카탈로그 번호: QG0004, 파노믹스 인코포레이티드(Panomics, Inc.), 미국 프레몬트 소재)의 제조자에 의해 추천되는 방법에 따라 세포를 수확하고, 53℃에서 용균시켰다. 그런 다음, 50㎕의 용균물을 인간 TGF베타-수용체 및 인간 GAPDH에 특이적인 프로브 세트(프로브세트의 서열에 대해서는 첨부된 표 5 및 6을 참조할 수 있다)와 항온처리하고, 콴티진에 대한 제조자의 프로토콜에 따라 처리하였다. 화학발광을 빅터2-라이트(Victor2-Light)(퍼킨 엘머(Perkin Elmer), 독일 바이스바덴 소재)에서 RLU(상대 광 유닛)으로서 측정하고, 인간 TGF베타-수용체 프로브세트에 대해 수득된 값을 각각의 웰에 대한 개별적인 인간 GAPDH 값에 대해 정상화시켰다. 무관한 대조군 siRNA를 음성 대조군으로 이용하였다.
siRNA 의 안정성
각각의 단일 가닥의 반감기를 측정함으로써 인간 또는 마우스 혈청을 이용하여 siRNA의 안정성을 시험관내 분석으로 측정하였다.
30㎕의 인간 또는 마우스 혈청(시그마 알드리치)과 혼합된 3㎕의 50μM siRNA 시료를 이용하여 각각의 시점에서 3벌씩 측정하였다. 혼합물을 37℃에서 0분, 30분, 1시간, 3시간, 6시간, 24시간 또는 48시간동안 항온처리하였다. 비특이적 분해에 대한 대조군으로서 siRNA를 30㎕의 1XPBS pH 6.8과 함께 48시간동안 항온처리하였다. 4㎕의 프로테이나제 K(20mg/ml), 25㎕의 프로테이나제 K 완충액 및 33㎕의 밀리포어 물을 65℃에서 20분동안 첨가함으로써 반응을 중단시켰다. 그런 다음, 3000rpm에서 20분동안 0.2㎛ 96웰 필터 플레이트를 통해 시료를 스핀 여과하고, 50㎕의 밀리포어 물로 2회 세척하고, 다시 스핀 여과하였다.
단일 가닥의 분리 및 남아있는 전체 길이 제품(FLP)의 분석을 위해, 용출액 A로서 10% ACN pH 11 중의 20mM Na3PO4 및 용출액 B로서 용출액 A 중의 1M NaBr을 이용한 변성 조건 하에서 시료를 이온 교환 다이오넥스 서밋(Dionex Summit) HPLC하였다. 하기 농도구배를 적용하였다:
Figure pct00003
모든 주입에 대해, 크로마토그램을 디오넥스 크로멜레온 6.60 HPLC 소프트웨어에 의해 자동적으로 통합하였고, 필요에 따라 수동으로 조적하였다. 모든 피크 면적은 내부 표준(IS) 피크에 대해 보정되었고, t=0분에서의 항온처리에 대해 정상화되었다. 피크 하에서의 면적 및 생성된 나머지 FLP를 각각의 단일 가닥에 대해 세벌씩 계산하였다. 가닥의 반감기(t1 /2)는 FLP의 절반이 분해되는 세벌에 대한 평균 시점[h]에 의해 정의되었다.
사이토카인 유도
siRNA의 잠재적인 사이토카인 유도를 시험관내 PBMC 분석에서 INF-a 및 TNF-a의 방출을 측정함으로써 측정하였다.
형질감염일에 피콜(Ficoll) 원심분리에 의해 2명의 기증자의 버피 코트(buffy coat) 혈액으로부터 인간 말초 혈액 단핵 세포(PBMC)를 단리하였다. 진 포터 2(Gene Porter 2)(GP2) 또는 DOTAP중 하나를 이용하여 옵티-MEM(Opti-MEM)중에서 세포를 4벌씩 37℃에서 24시간동안 130nM의 최종 농도의 siRNA로 형질감염시켰다. INF-알파 및 TNF-알파를 유도하는 것으로 알려진 siRNA 서열, 및 또한 CpG 올리고를 500nM의 농도에서 양성 대조군으로서 이용하였다.
INF-알파 및 TNF-알파를 샌드위치 ELISA에 의해 각각 2회씩 수집된 4벌의 상층액에서 측정하였다. 유도 정도를 양성 대조군에 대한 상대값으로 표현하고, 최고 점수가 5이었다.
siRNA 의 특이성
siRNA의 특이성을 이 오프-타겟 가능성의 인 실리코 예측에서 측정하였다.
오프-타겟 가능성을 가장 관련된 오프-타겟 유전자에 대해 측정하고, 수치 특이성 점수로 표현하였다. 대부분의 관련된 오프-타겟 유전자는 siRNA의 안티센스 가닥에 대한 미스매치 수 및 분포에 근거하여 확인되었다. 모든 잠재적 오프-타겟 유전자를 측정하기 위해, 패스트A 알고리듬을 이용하여 모든 인간 전사체(RefSeq 데이타베이스, 릴리즈 24)를 안티센스 서열에 대해 가장 높은 상보성을 갖는 잠재적 표적 영역에 대해 조사하였다.
가장 낮은 특이성 점수를 특징으로하는 가장 관련된 오프-타겟 유전자를 확인하기 위해 패스트A 산출 파일을 펄 스크립트(perl script)에 의해 추가로 분석하였다. 높은 특이성 점수를 가장 바람직한 것으로 정의하고, 3 이상의 점수를 특이적인 것으로 간주하였다.
[표 1]
Figure pct00004
Figure pct00005
Figure pct00006
Figure pct00007
Figure pct00008
Figure pct00009
[표 2]
Figure pct00010
Figure pct00011
Figure pct00012
Figure pct00013
[표 3]
Figure pct00014
Figure pct00015
Figure pct00016
[표 4]
Figure pct00017
Figure pct00018
Figure pct00019
Figure pct00020
[표 5]
Figure pct00021
[표 6]
Figure pct00022
<110> F. Hoffmann-La Roche AG <120> Compositions and Methods for Inhibiting Expression of TGF-Beta Receptor Genes <130> Case 25214 <140> PCT/EP2009/058660 <141> 2009. 07. 08 <150> EP 08012777.2 <151> 2008. 07. 15. <160> 326 <210> 1 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 1 ggaccagugu gcuucgucut t 21 <210> 2 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 2 agacgaagca cacuggucct t 21 <210> 3 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 3 ggacccuuca uuagaucgct t 21 <210> 4 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 4 gcgaucuaau gaagggucct t 21 <210> 5 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 5 accucauaua guagugaggt t 21 <210> 6 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 6 ccucacuacu auaugaggut t 21 <210> 7 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 7 gaacguucgu gguuccgugt t 21 <210> 8 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 8 cacggaacca cgaacguuct t 21 <210> 9 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 9 aauuccucga gauaggccgt t 21 <210> 10 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 10 cggccuaucu cgaggaauut t 21 <210> 11 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 11 uuccucgaga uaggccguut t 21 <210> 12 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 12 aacggccuau cucgaggaat t 21 <210> 13 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 13 gaacaauugc gagaacuaut t 21 <210> 14 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 14 auaguucucg caauuguuct t 21 <210> 15 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 15 gagaagaacg uucgugguut t 21 <210> 16 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 16 aaccacgaac guucuucuct t 21 <210> 17 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 17 aagaacguuc gugguuccgt t 21 <210> 18 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 18 cggaaccacg aacguucuut t 21 <210> 19 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 19 uugcucgacg auguuccaut t 21 <210> 20 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 20 auggaacauc gucgagcaat t 21 <210> 21 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 21 aaacauuauc gcaacucagt t 21 <210> 22 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 22 cugaguugcg auaauguuut t 21 <210> 23 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 23 aacuguaaug uuacgucaut t 21 <210> 24 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 24 augacguaac auuacaguut t 21 <210> 25 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 25 gacccuucau uagaucgcct t 21 <210> 26 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 26 ggcgaucuaa ugaaggguct t 21 <210> 27 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 27 guccacggcg agcggucuut t 21 <210> 28 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 28 aagaccgcuc gccguggact t 21 <210> 29 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 29 cgagauaggc cguuuguaut t 21 <210> 30 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 30 auacaaacgg ccuaucucgt t 21 <210> 31 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 31 cuuacagcau ugcggauuat t 21 <210> 32 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 32 uaauccgcaa ugcuguaagt t 21 <210> 33 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 33 gcuuacagca uugcggauut t 21 <210> 34 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 34 aauccgcaau gcuguaagct t 21 <210> 35 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 35 uccucgagau aggccguuut t 21 <210> 36 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 36 aaacggccua ucucgaggat t 21 <210> 37 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 37 cucgagauag gccguuugut t 21 <210> 38 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 38 acaaacggcc uaucucgagt t 21 <210> 39 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 39 acccuucauu agaucgccct t 21 <210> 40 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 40 gggcgaucua augaagggut t 21 <210> 41 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 41 uucagagggu acuacguugt t 21 <210> 42 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 42 caacguagua cccucugaat t 21 <210> 43 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 43 ucagagggua cuacguugat t 21 <210> 44 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 44 ucaacguagu acccucugat t 21 <210> 45 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 45 cagaggguac uacguugaat t 21 <210> 46 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 46 uucaacguag uacccucugt t 21 <210> 47 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 47 agaagaacgu ucgugguuct t 21 <210> 48 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 48 gaaccacgaa cguucuucut t 21 <210> 49 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 49 acguucgugg uuccgugagt t 21 <210> 50 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 50 cucacggaac cacgaacgut t 21 <210> 51 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 51 aaacuguaau guuacgucat t 21 <210> 52 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 52 ugacguaaca uuacaguuut t 21 <210> 53 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 53 cuguauugca gacuuaggat t 21 <210> 54 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 54 uccuaagucu gcaauacagt t 21 <210> 55 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 55 uuacuccugg uuaguacaut t 21 <210> 56 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 56 auguacuaac caggaguaat t 21 <210> 57 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 57 ugaccucaua uaguagugat t 21 <210> 58 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 58 ucacuacuau augaggucat t 21 <210> 59 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 59 gguacuacgu ugaaagacut t 21 <210> 60 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 60 agucuuucaa cguaguacct t 21 <210> 61 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 61 cauuaucgca acucagucat t 21 <210> 62 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 62 ugacugaguu gcgauaaugt t 21 <210> 63 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 63 gcgagaacua uuguguuact t 21 <210> 64 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 64 guaacacaau aguucucgct t 21 <210> 65 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 65 cgacggcguu acaguguuut t 21 <210> 66 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 66 aaacacugua acgccgucgt t 21 <210> 67 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 67 agaacguucg ugguuccgut t 21 <210> 68 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 68 acggaaccac gaacguucut t 21 <210> 69 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 69 ccucgagaua ggccguuugt t 21 <210> 70 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 70 caaacggccu aucucgaggt t 21 <210> 71 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 71 gaucgcccuu uuauuucagt t 21 <210> 72 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 72 cugaaauaaa agggcgauct t 21 <210> 73 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 73 ucgcaacuca gucaacaggt t 21 <210> 74 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 74 ccuguugacu gaguugcgat t 21 <210> 75 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 75 acuaugaacg cuucuuucct t 21 <210> 76 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 76 ggaaagaagc guucauagut t 21 <210> 77 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 77 guacuauacc aguaagugct t 21 <210> 78 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 78 gcacuuacug guauaguact t 21 <210> 79 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 79 aauugacuua auuccucgat t 21 <210> 80 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 80 ucgaggaauu aagucaauut t 21 <210> 81 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 81 uugacuuaau uccucgagat t 21 <210> 82 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 82 ucucgaggaa uuaagucaat t 21 <210> 83 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 83 cugggucugu gacuacaact t 21 <210> 84 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 84 guuguaguca cagacccagt t 21 <210> 85 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 85 cugcaaucag gaccauugct t 21 <210> 86 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 86 gcaauggucc ugauugcagt t 21 <210> 87 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 87 gaccagugug cuucgucugt t 21 <210> 88 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 88 cagacgaagc acacugguct t 21 <210> 89 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 89 cuauaucugc cacaaccgct t 21 <210> 90 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 90 gcgguugugg cagauauagt t 21 <210> 91 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 91 aaccgcacug ucauucacct t 21 <210> 92 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 92 ggugaaugac agugcgguut t 21 <210> 93 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 93 cauucaccau cgagugccat t 21 <210> 94 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 94 uggcacucga uggugaaugt t 21 <210> 95 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 95 agaggguacu acguugaaat t 21 <210> 96 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 96 uuucaacgua guacccucut t 21 <210> 97 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 97 auuuaugaua ugacaacgut t 21 <210> 98 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 98 acguugucau aucauaaaut t 21 <210> 99 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 99 cauuggcaaa ggucgauuut t 21 <210> 100 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 100 aaaucgaccu uugccaaugt t 21 <210> 101 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 101 ugguuggugu cagauuauct t 21 <210> 102 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 102 gauaaucuga caccaaccat t 21 <210> 103 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 103 gguugguguc agauuaucat t 21 <210> 104 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 104 ugauaaucug acaccaacct t 21 <210> 105 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 105 uuaucaugag cauggaucct t 21 <210> 106 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 106 ggauccaugc ucaugauaat t 21 <210> 107 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 107 agcauggauc ccuuuuugat t 21 <210> 108 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 108 ucaaaaaggg auccaugcut t 21 <210> 109 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 109 caaugggcuu aguauucugt t 21 <210> 110 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 110 cagaauacua agcccauugt t 21 <210> 111 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 111 cugggaaauu gcucgacgat t 21 <210> 112 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 112 ucgucgagca auuucccagt t 21 <210> 113 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 113 cucgacgaug uuccauuggt t 21 <210> 114 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 114 ccaauggaac aucgucgagt t 21 <210> 115 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 115 ucgacgaugu uccauuggut t 21 <210> 116 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 116 accaauggaa caucgucgat t 21 <210> 117 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 117 cgacgauguu ccauuggugt t 21 <210> 118 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 118 caccaaugga acaucgucgt t 21 <210> 119 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 119 gacgauguuc cauugguggt t 21 <210> 120 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 120 ccaccaaugg aacaucguct t 21 <210> 121 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 121 gaaaacauua ucgcaacuct t 21 <210> 122 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 122 gaguugcgau aauguuuuct t 21 <210> 123 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 123 aaaacauuau cgcaacucat t 21 <210> 124 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 124 ugaguugcga uaauguuuut t 21 <210> 125 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 125 uaucgcaacu cagucaacat t 21 <210> 126 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 126 uguugacuga guugcgauat t 21 <210> 127 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 127 cuacagcuuu gccugaacut t 21 <210> 128 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 128 aguucaggca aagcuguagt t 21 <210> 129 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 129 uucugugcac uaugaacgct t 21 <210> 130 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 130 gcguucauag ugcacagaat t 21 <210> 131 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 131 ugcacuauga acgcuucuut t 21 <210> 132 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 132 aagaagcguu cauagugcat t 21 <210> 133 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 133 ugauuuacuc cugguuagut t 21 <210> 134 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 134 acuaaccagg aguaaaucat t 21 <210> 135 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 135 uuuacuccug guuaguacat t 21 <210> 136 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 136 uguacuaacc aggaguaaat t 21 <210> 137 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 137 ccugguuagu acauucucat t 21 <210> 138 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 138 ugagaaugua cuaaccaggt t 21 <210> 139 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 139 gagucuaaaa augaccucat t 21 <210> 140 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 140 ugaggucauu uuuagacuct t 21 <210> 141 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 141 gaccucauau aguagugagt t 21 <210> 142 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 142 cucacuacua uaugagguct t 21 <210> 143 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 143 auaguaguga ggaacauaat t 21 <210> 144 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 144 uuauguuccu cacuacuaut t 21 <210> 145 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 145 gggauuguac uauaccagut t 21 <210> 146 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 146 acugguauag uacaauccct t 21 <210> 147 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 147 ggauuguacu auaccaguat t 21 <210> 148 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 148 uacugguaua guacaaucct t 21 <210> 149 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 149 ggaaaugagu agaauugcut t 21 <210> 150 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1..19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 150 agcaauucua cucauuucct t 21 <210> 151 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 8, 10, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 7, 9, 11, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 151 ggaccagugu gcuucgucut t 21 <210> 152 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 152 agacgaagca cacuggucct t 21 <210> 153 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 6, 7, 8, 9, 11, 12, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 10, 13, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 153 ggacccuuca uuagaucgct t 21 <210> 154 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 154 gcgaucuaau gaagggucct t 21 <210> 155 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 5, 7, 9, 12, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 6, 8, 10, 11, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 155 accucauaua guagugaggt t 21 <210> 156 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 7, 10, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 156 ccucacuacu auaugaggut t 21 <210> 157 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 6, 7, 8, 10, 13, 14, 15, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 9, 11, 12, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 157 gaacguucgu gguuccgugt t 21 <210> 158 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 158 cacggaacca cgaacguuct t 21 <210> 159 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 13, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 9, 10, 11, 12, 14, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 159 aauuccucga gauaggccgt t 21 <210> 160 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 160 cggccuaucu cgaggaauut t 21 <210> 161 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 11, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 7, 8, 9, 10, 12, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 161 uuccucgaga uaggccguut t 21 <210> 162 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 162 aacggccuau cucgaggaat t 21 <210> 163 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 7, 8, 10, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 9, 11, 12, 13, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 163 gaacaauugc gagaacuaut t 21 <210> 164 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 164 auaguucucg caauuguuct t 21 <210> 165 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 11, 12, 13, 15, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 14, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 165 gagaagaacg uucgugguut t 21 <210> 166 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 166 aaccacgaac guucuucuct t 21 <210> 167 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 8, 9, 10, 12, 15, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 11, 13, 14, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 167 aagaacguuc gugguuccgt t 21 <210> 168 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 168 cggaaccacg aacguucuut t 21 <210> 169 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 9, 12, 14, 15, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 7, 8, 10, 11, 13, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 169 uugcucgacg auguuccaut t 21 <210> 170 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 170 auggaacauc gucgagcaat t 21 <210> 171 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 6, 7, 9, 10, 12, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 8, 11, 13, 14, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 171 aaacauuauc gcaacucagt t 21 <210> 172 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 172 cugaguugcg auaauguuut t 21 <210> 173 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 9, 11, 12, 14, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 7, 8, 10, 13, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 173 aacuguaaug uuacgucaut t 21 <210> 174 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 10, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 174 augacguaac auuacaguut t 21 <210> 175 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 10, 11, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 9, 12, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 175 gacccuucau uagaucgcct t 21 <210> 176 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 176 ggcgaucuaa ugaaggguct t 21 <210> 177 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 6, 9, 13, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 5, 7, 8, 10, 11, 12, 14, 15 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 177 guccacggcg agcggucuut t 21 <210> 178 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 178 aagaccgcuc gccguggact t 21 <210> 179 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 6, 10, 11, 13, 14, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 7, 8, 9, 12, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 179 cgagauaggc cguuuguaut t 21 <210> 180 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 180 auacaaacgg ccuaucucgt t 21 <210> 181 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 8, 10, 11, 13, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 6, 7, 9, 12, 14, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 181 cuuacagcau ugcggauuat t 21 <210> 182 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 8, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 182 uaauccgcaa ugcuguaagt t 21 <210> 183 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 6, 9, 11, 12, 14, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 5, 7, 8, 10, 13, 15, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 183 gcuuacagca uugcggauut t 21 <210> 184 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 184 aauccgcaau gcuguaagct t 21 <210> 185 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 10, 14, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 6, 7, 8, 9, 11, 12, 13, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 185 uccucgagau aggccguuut t 21 <210> 186 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 186 aaacggccua ucucgaggat t 21 <210> 187 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 8, 12, 13, 15, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 6, 7, 9, 10, 11, 14, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 187 cucgagauag gccguuugut t 21 <210> 188 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 188 acaaacggcc uaucucgagt t 21 <210> 189 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 10, 14, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 8, 11, 12, 13, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 189 acccuucauu agaucgccct t 21 <210> 190 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 190 gggcgaucua augaagggut t 21 <210> 191 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 10, 12, 13, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 6, 7, 8, 9, 11, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 191 uucagagggu acuacguugt t 21 <210> 192 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 6, 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 192 caacguagua cccucugaat t 21 <210> 193 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 9, 11, 12, 14, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 10, 13, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 193 ucagagggua cuacguugat t 21 <210> 194 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 7, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 194 ucaacguagu acccucugat t 21 <210> 195 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 8, 10, 11, 13, 15, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 9, 12, 14, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 195 cagaggguac uacguugaat t 21 <210> 196 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 8, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 196 uucaacguag uacccucugt t 21 <210> 197 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8, 10, 11, 12, 14, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 13, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 197 agaagaacgu ucgugguuct t 21 <210> 198 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 198 gaaccacgaa cguucuucut t 21 <210> 199 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 6, 8, 11, 12, 13, 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 7, 9, 10, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 199 acguucgugg uuccgugagt t 21 <210> 200 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 200 cucacggaac cacgaacgut t 21 <210> 201 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 7, 10, 12, 13, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 8, 9, 11, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 201 aaacuguaau guuacgucat t 21 <210> 202 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 9, 12, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 10, 11, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 202 ugacguaaca uuacaguuut t 21 <210> 203 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 6, 7, 9, 13, 14, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 8, 10, 11, 12, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 203 cuguauugca gacuuaggat t 21 <210> 204 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 12, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 204 uccuaagucu gcaauacagt t 21 <210> 205 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 11, 12, 15, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 9, 10, 13, 14, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 205 uuacuccugg uuaguacaut t 21 <210> 206 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 7, 11, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 8, 9, 10, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 206 auguacuaac caggaguaat t 21 <210> 207 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 6, 7, 9, 11, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 8, 10, 12, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 207 ugaccucaua uaguagugat t 21 <210> 208 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 8, 10, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 208 ucacuacuau augaggucat t 21 <210> 209 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5, 6, 8, 10, 11, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 7, 9, 12, 13, 14, 15, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 209 gguacuacgu ugaaagacut t 21 <210> 210 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8, 13, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 210 agucuuucaa cguaguacct t 21 <210> 211 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 6, 7, 9, 12, 13, 14, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 8, 10, 11, 15, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 211 cauuaucgca acucagucat t 21 <210> 212 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 212 ugacugaguu gcgauaaugt t 21 <210> 213 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 8, 9, 11, 12, 14, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 10, 13, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 213 gcgagaacua uuguguuact t 21 <210> 214 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 7, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 214 guaacacaau aguucucgct t 21 <210> 215 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 7, 9, 10, 12, 15, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 6, 8, 11, 13, 14, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 215 cgacggcguu acaguguuut t 21 <210> 216 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 9 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 216 aaacacugua acgccgucgt t 21 <210> 217 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 7, 8, 9, 11, 14, 15, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 10, 12, 13, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 217 agaacguucg ugguuccgut t 21 <210> 218 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 218 acggaaccac gaacguucut t 21 <210> 219 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 9, 13, 14, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 6, 7, 8, 10, 11, 12, 15, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 219 ccucgagaua ggccguuugt t 21 <210> 220 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 220 caaacggccu aucucgaggt t 21 <210> 221 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 13, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 221 gaucgcccuu uuauuucagt t 21 <210> 222 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 222 cugaaauaaa agggcgauct t 21 <210> 223 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 9, 12, 13, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 10, 11, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 223 ucgcaacuca gucaacaggt t 21 <210> 224 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 224 ccuguugacu gaguugcgat t 21 <210> 225 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 5, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 4, 6, 7, 8, 10 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 225 acuaugaacg cuucuuucct t 21 <210> 226 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 14, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 226 ggaaagaagc guucauagut t 21 <210> 227 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 4, 5, 7, 9, 10, 13, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 6, 8, 11, 12, 14, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 227 guacuauacc aguaagugct t 21 <210> 228 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 6, 12, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 7, 8, 9, 10, 11, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 228 gcacuuacug guauaguact t 21 <210> 229 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 7, 8, 9, 12, 13, 14, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 10, 11, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 229 aauugacuua auuccucgat t 21 <210> 230 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 230 ucgaggaauu aagucaauut t 21 <210> 231 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 5, 6, 7, 10, 11, 12, 13, 14, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 8, 9, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 231 uugacuuaau uccucgagat t 21 <210> 232 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 12, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 232 ucucgaggaa uuaagucaat t 21 <210> 233 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 6, 7, 8, 10, 13, 14, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 9, 11, 12, 15, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 233 cugggucugu gacuacaact t 21 <210> 234 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 9, 11, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 10, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 234 guuguaguca cagacccagt t 21 <210> 235 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 13, 14, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 9, 10, 11, 12, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 235 cugcaaucag gaccauugct t 21 <210> 236 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 236 gcaauggucc ugauugcagt t 21 <210> 237 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 7, 9, 11, 12, 13, 14, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 8, 10, 15, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 237 gaccagugug cuucgucugt t 21 <210> 238 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 10, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 7, 8, 9, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 238 cagacgaagc acacugguct t 21 <210> 239 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 6, 7, 8, 10, 11, 13, 16, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 9, 12, 14, 15, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 239 cuauaucugc cacaaccgct t 21 <210> 240 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 240 gcgguugugg cagauauagt t 21 <210> 241 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 6, 8, 9, 11, 12, 14, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 7, 10, 13, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 241 aaccgcacug ucauucacct t 21 <210> 242 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 242 ggugaaugac agugcgguut t 21 <210> 243 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 5, 7, 8, 10, 11, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 6, 9, 12, 13, 14, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 243 cauucaccau cgagugccat t 21 <210> 244 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 244 uggcacucga uggugaaugt t 21 <210> 245 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 9, 10, 12, 14, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 11, 13, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 245 agaggguacu acguugaaat t 21 <210> 246 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 9, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 246 uuucaacgua guacccucut t 21 <210> 247 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 3, 4, 6, 9, 11, 14, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 5, 7, 8, 10, 12, 13, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 247 auuuaugaua ugacaacgut t 21 <210> 248 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 8, 10, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 9, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 248 acguugucau aucauaaaut t 21 <210> 249 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 7, 13, 14, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 6, 8, 9, 10, 11, 12, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 249 cauuggcaaa ggucgauuut t 21 <210> 250 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 250 aaaucgaccu uugccaaugt t 21 <210> 251 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 8, 10, 11, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 6, 7, 9, 12, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 251 ugguuggugu cagauuauct t 21 <210> 252 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 11, 14, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 252 gauaaucuga caccaaccat t 21 <210> 253 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 7, 9, 10, 14, 15, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 5, 6, 8, 11, 12, 13, 16, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 253 gguugguguc agauuaucat t 21 <210> 254 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 12, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 254 ugauaaucug acaccaacct t 21 <210> 255 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 11, 13, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 6, 8, 9, 10, 12, 14, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 255 uuaucaugag cauggaucct t 21 <210> 256 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 12, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 256 ggauccaugc ucaugauaat t 21 <210> 257 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 5, 9, 10, 11, 12, 13, 14, 15, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 6, 7, 8, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 257 agcauggauc ccuuuuugat t 21 <210> 258 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 258 ucaaaaaggg auccaugcut t 21 <210> 259 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 8, 9, 10, 13, 15, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 6, 7, 11, 12, 14, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 259 caaugggcuu aguauucugt t 21 <210> 260 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 6, 9, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 7, 8, 10, 11, 12, 13, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 260 cagaauacua agcccauugt t 21 <210> 261 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 9, 10, 12, 13, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 5, 6, 7, 8, 11, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 261 cugggaaauu gcucgacgat t 21 <210> 262 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 262 ucgucgagca auuucccagt t 21 <210> 263 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 6, 9, 11, 12, 13, 14, 16, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 7, 8, 10, 15, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 263 cucgacgaug uuccauuggt t 21 <210> 264 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 264 ccaauggaac aucgucgagt t 21 <210> 265 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 5, 8, 10, 11, 12, 13, 15, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 4, 6, 7, 9, 14, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 265 ucgacgaugu uccauuggut t 21 <210> 266 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 266 accaauggaa caucgucgat t 21 <210> 267 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 7, 9, 10, 11, 12, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 6, 8, 13, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 267 cgacgauguu ccauuggugt t 21 <210> 268 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 12 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 268 caccaaugga acaucgucgt t 21 <210> 269 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 6, 8, 9, 10, 11, 13, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 12, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 269 gacgauguuc cauugguggt t 21 <210> 270 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 270 ccaccaaugg aacaucguct t 21 <210> 271 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 8, 9, 11, 12, 14, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 10, 13, 15, 16 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 271 gaaaacauua ucgcaacuct t 21 <210> 272 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 10 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 272 gaguugcgau aauguuuuct t 21 <210> 273 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 7, 8, 10, 11, 13, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 9, 12, 14, 15, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 273 aaaacauuau cgcaacucat t 21 <210> 274 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 274 ugaguugcga uaauguuuut t 21 <210> 275 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 4, 6, 9, 10, 11, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 5, 7, 8, 12, 13, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 275 uaucgcaacu cagucaacat t 21 <210> 276 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 276 uguugacuga guugcgauat t 21 <210> 277 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 4, 7, 8, 9, 10, 12, 13, 14, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 3, 5, 6, 11, 15, 16, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 277 cuacagcuuu gccugaacut t 21 <210> 278 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 9, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 278 aguucaggca aagcuguagt t 21 <210> 279 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 4, 6, 8, 10, 11, 13, 17, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 5, 7, 9, 12, 14, 15, 16, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 279 uucugugcac uaugaacgct t 21 <210> 280 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 8, 13, 15 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 9, 10, 11, 12, 14, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 280 gcguucauag ugcacagaat t 21 <210> 281 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 3, 5, 6, 8, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 4, 7, 9, 10, 11, 13 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 281 ugcacuauga acgcuucuut t 21 <210> 282 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 11, 13, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 282 aagaagcguu cauagugcat t 21 <210> 283 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 4, 5, 6, 8, 9, 10, 11, 12, 15, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 7, 13, 14, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 283 ugauuuacuc cugguuagut t 21 <210> 284 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 7, 13, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 284 acuaaccagg aguaaaucat t 21 <210> 285 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 5, 6, 7, 8, 9, 12, 13, 16, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 10, 11, 14, 15, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 285 uuuacuccug guuaguacat t 21 <210> 286 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 6, 10, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 286 uguacuaacc aggaguaaat t 21 <210> 287 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 2, 3, 6, 7, 10, 12, 14, 15, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 4, 5, 8, 9, 11, 13, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 287 ccugguuagu acauucucat t 21 <210> 288 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 9, 12, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 13, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 288 ugagaaugua cuaaccaggt t 21 <210> 289 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 6, 12, 15, 16, 17, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 7, 8, 9, 10, 11, 13, 14, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 289 gagucuaaaa augaccucat t 21 <210> 290 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 7, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 6, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 290 ugaggucauu uuuagacuct t 21 <210> 291 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 4, 5, 6, 8, 10, 13, 16 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 7, 9, 11, 12, 14, 15, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 291 gaccucauau aguagugagt t 21 <210> 292 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 6, 9, 11 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 7, 8, 10, 12, 13, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 292 cucacuacua uaugagguct t 21 <210> 293 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 5, 8, 15, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 293 auaguaguga ggaacauaat t 21 <210> 294 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 2, 11, 14, 17 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 15, 16, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 294 uuauguuccu cacuacuaut t 21 <210> 295 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 5, 6, 8, 10, 11, 13, 15, 16, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 7, 9, 12, 14, 17, 18 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 295 gggauuguac uauaccagut t 21 <210> 296 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 8, 11, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 9, 10, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 296 acugguauag uacaauccct t 21 <210> 297 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 4, 5, 7, 9, 10, 12, 14, 15, 18 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 6, 8, 11, 13, 16, 17, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 297 ggauuguacu auaccaguat t 21 <210> 298 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 1, 7, 9, 12, 14 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 2, 3, 4, 5, 6, 8, 10, 11, 13, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 298 uacugguaua guacaaucct t 21 <210> 299 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: sense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 6, 10, 15, 16, 18, 19 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 3, 4, 5, 7, 8, 9, 11, 12, 13, 14, 17 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 299 ggaaaugagu agaauugcut t 21 <210> 300 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: antisense strand of dsRNA <220> <221> modified_base <222> 1 <223> /mod_base = "nucleoside: lacks 5'-phosphate group" <220> <221> modified_base <222> 3, 9, 13 <223> /mod_base = "2'-O-methyl corresponding nucleoside" <220> <221> modified_base <222> 21 <223> /mod_base = "5'-phosphorothioate thymidine" <220> <221> modified_base <222> 1, 2, 4, 5, 6, 7, 8, 10, 11, 12, 14, 15, 16, 17, 18, 19 <223> /mod_base = "2'-hydroxy corresponding nucleoside" <400> 300 agcaauucua cucauuucct t 21 <210> 301 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 301 cgtcgggcaa tttcccagaa tatttttctc ttggaaagaa agt 43 <210> 302 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 302 tggggtattt ggccttaact tctgtttttt ctcttggaaa gaaagt 46 <210> 303 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 303 cgatgctgta agcctagctg cttttttctc ttggaaagaa agt 43 <210> 304 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 304 ttgcggtaat gttttcttaa tccgtttttc tcttggaaag aaagt 45 <210> 305 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 305 tggtgccttc ctgttgactg agtttttctc ttggaaagaa agt 43 <210> 306 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 306 ctgagcccat tgcatagatg tcagttttta ggcataggac ccgtgtct 48 <210> 307 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 307 tcgcaaacaa cttttctcat ttcttctttt taggcatagg acccgtgtct 50 <210> 308 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 308 cttcgcagct ctgccatctg tttttttagg cataggaccc gtgtct 46 <210> 309 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 309 cgtaatttta gccattactc tcaaggtttt taggcatagg acccgtgtct 50 <210> 310 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 310 cgtgaattcc accaatggaa cat 23 <210> 311 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 311 gtcataataa ggcagttggt aatctt 26 <210> 312 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 312 gactgatggg tcagaaggta caag 24 <210> 313 <211> 23 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 313 ccgttggcat accaacattc tct 23 <210> 314 <211> 24 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for TGF-beta 1 receptor <400> 314 gactgatggg tcagaaggta caag 24 <210> 315 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 315 gaatttgcca tgggtggaat tttttctctt ggaaagaaag t 41 <210> 316 <211> 41 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 316 ggagggatct cgctcctgga tttttctctt ggaaagaaag t 41 <210> 317 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 317 ccccagcctt ctccatggtt ttttctcttg gaaagaaagt 40 <210> 318 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 318 gctcccccct gcaaatgagt ttttctcttg gaaagaaagt 40 <210> 319 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 319 agccttgacg gtgccatgtt tttaggcata ggacccgtgt ct 42 <210> 320 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 320 gatgacaagc ttcccgttct ctttttaggc ataggacccg tgtct 45 <210> 321 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 321 agatggtgat gggatttcca tttttttagg cataggaccc gtgtct 46 <210> 322 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 322 gcatcgcccc acttgatttt tttttaggca taggacccgt gtct 44 <210> 323 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 323 cacgacgtac tcagcgccat ttttaggcat aggacccgtg tct 43 <210> 324 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 324 ggcagagatg atgacccttt tgtttttagg cataggaccc gtgtct 46 <210> 325 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: bDNA probes for h-GAPDH <400> 325 ggtgaagacg ccagtggact c 21 <210> 326 <211> 6475 <212> DNA <213> Homo Sapiens <300> <308> NM_004612.2 <309> 2008-05-18 <400> 326 ggcgaggcgaggtttgctggggtgaggcagcggcgcggccgggccgggccgggccacagg 60 cggtggcggcgggaccatggaggcggcggtcgctgctccgcgtccccggctgctcctcct 120 cgtgctggcggcggcggcggcggcggcggcggcgctgctcccgggggcgacggcgttaca 180 gtgtttctgccacctctgtacaaaagacaattttacttgtgtgacagatgggctctgctt 240 tgtctctgtcacagagaccacagacaaagttatacacaacagcatgtgtatagctgaaat 300 tgacttaattcctcgagataggccgtttgtatgtgcaccctcttcaaaaactgggtctgt 360 gactacaacatattgctgcaatcaggaccattgcaataaaatagaacttccaactactgt 420 aaagtcatcacctggccttggtcctgtggaactggcagctgtcattgctggaccagtgtg 480 cttcgtctgcatctcactcatgttgatggtctatatctgccacaaccgcactgtcattca 540 ccatcgagtgccaaatgaagaggacccttcattagatcgcccttttatttcagagggtac 600 tacgttgaaagacttaatttatgatatgacaacgtcaggttctggctcaggtttaccatt 660 gcttgttcagagaacaattgcgagaactattgtgttacaagaaagcattggcaaaggtcg 720 atttggagaagtttggagaggaaagtggcggggagaagaagttgctgttaagatattctc 780 ctctagagaagaacgttcgtggttccgtgaggcagagatttatcaaactgtaatgttacg 840 tcatgaaaacatcctgggatttatagcagcagacaataaagacaatggtacttggactca 900 gctctggttggtgtcagattatcatgagcatggatccctttttgattacttaaacagata 960 cacagttactgtggaaggaatgataaaacttgctctgtccacggcgagcggtcttgccca 1020 tcttcacatggagattgttggtacccaaggaaagccagccattgctcatagagatttgaa 1080 atcaaagaatatcttggtaaagaagaatggaacttgctgtattgcagacttaggactggc 1140 agtaagacatgattcagccacagataccattgatattgctccaaaccacagagtgggaac 1200 aaaaaggtacatggcccctgaagttctcgatgattccataaatatgaaacattttgaatc 1260 cttcaaacgtgctgacatctatgcaatgggcttagtattctgggaaattgctcgacgatg 1320 ttccattggtggaattcatgaagattaccaactgccttattatgatcttgtaccttctga 1380 cccatcagttgaagaaatgagaaaagttgtttgtgaacagaagttaaggccaaatatccc 1440 aaacagatggcagagctgtgaagccttgagagtaatggctaaaattatgagagaatgttg 1500 gtatgccaatggagcagctaggcttacagcattgcggattaagaaaacattatcgcaact 1560 cagtcaacaggaaggcatcaaaatgtaattctacagctttgcctgaactctccttttttc 1620 ttcagatctgctcctgggttttaatttgggaggtcaattgttctacctcactgagaggga 1680 acagaaggatattgcttccttttgcagcagtgtaataaagtcaattaaaaacttcccagg 1740 atttctttggacccaggaaacagccatgtgggtcctttctgtgcactatgaacgcttctt 1800 tcccaggacagaaaatgtgtagtctacctttattttttattaacaaaacttgttttttaa 1860 aaagatgattgctggtcttaactttaggtaactctgctgtgctggagatcatctttaagg 1920 gcaaaggagttggattgctgaattacaatgaaacatgtcttattactaaagaaagtgatt 1980 tactcctggttagtacattctcagaggattctgaaccactagagtttccttgattcagac 2040 tttgaatgtactgttctatagtttttcaggatcttaaaactaacacttataaaactctta 2100 tcttgagtctaaaaatgacctcatatagtagtgaggaacataattcatgcaattgtattt 2160 tgtatactattattgttctttcacttattcagaacattacatgccttcaaaatgggattg 2220 tactataccagtaagtgccacttctgtgtctttctaatggaaatgagtagaattgctgaa 2280 agtctctatgttaaaacctatagtgtttgaattcaaaaagcttatttatctgggtaaccc 2340 aaactttttctgttttgtttttggaagggtttttgtggtatgtcatttggtattctattc 2400 tgaaaatgcctttctcctaccaaaatgtgcttaagccactaaagaaatgaagtggcatta 2460 attagtaaattattagcatggtcatgtttgaatattctcacatcaagcttttgcatttta 2520 attgtgttgtctaagtatacttttaaaaaatcaagtggcactctagatgcttatagtact 2580 ttaatatttgtagcatacagactaatttttctaaaagggaaagtctgtctagctgcttgt 2640 gaaaagttatgtggtattctgtaagccatttttttctttatctgttcaaagacttatttt 2700 ttaagacatgaattacatttaaaattagaatatggttaatattaaataataggccttttt 2760 ctaggaaggcgaaggtagttaataatttgaatagataacagatgtgcaagaaagtcacat 2820 ttgttatgtatgtaggagtaaacgttcggtggatcctctgtctttgtaactgaggttaga 2880 gctagtgtggttttgaggtctcactacactttgaggaaggcagcttttaattcagtgttt 2940 ccttatgtgtgcgtacattgcaactgcttacatgtaatttatgtaatgcattcagtgcac 3000 ccttgttacttgggagaggtggtagctaaagaacattctgagtataggtttttctccatt 3060 tacagatgtctttggtcaaatattgaaagcaaacttgtcatggtcttcttacattaagtt 3120 gaaactagcttataataactggtttttacttccaatgctatgaagtctctgcagggcttt 3180 tacagttttcgaagtccttttatcactgtgatcttattctgaggggagaaaaaactatca 3240 tagctctgaggcaagacttcgactttatagtgctatcagttccccgatacagggtcagag 3300 taacccatacagtattttggtcaggaagagaaagtggccatttacactgaatgagttgca 3360 ttctgataatgtcttatctcttatacgtagaataaatttgaaagactatttgatcttaaa 3420 accaaagtaattttagaatgagtgacatattacataggaatttagtgtcaatttcatgtg 3480 tttaaaaacatcatgggaaaaatgcttagaggttactattttgactacaaagttgagttt 3540 ttttctgtagttaccataatttcattgaagcaaatgaatgagtttgagaggtttgttttt 3600 atagttgtgttgtattacttgtttaataataatctctaattctgtgatcaggtacttttt 3660 ttgtgggggttttttttttgtttttttttttttgttgttgtttttgggccatttctaagc 3720 ctaccagatctgctttatgaaatccaggggaccaatgcattttatcactaaaactatttt 3780 tatataattttaagaatataccaaaagttgtctgatttaaagttgtaatacatgatttct 3840 cactttcatgtaaggttatccacttttgctgaagatattttttattgaatcaaagattga 3900 gttacaattatacttttcttacctaagtggataaaatgtacttttgatgaatcagggaat 3960 ttttttaaagttggagtttagttctaaattgactttacgtattactgcagttaattcctt 4020 ttttggctagggatggtttgataaaccacaattggctgatattgaaaatgaaagaaactt 4080 aaaaggtgggatggatcatgattactgtcgataactgcagataaatttgattagagtaat 4140 aattttgtcatttaaaaacacagttgtttatactgcccatcctaggatgctcaccttcca 4200 agattcaacgtggctaaaacatcttctggtaaattgtgcgtccatattcattttgtcagt 4260 agccaggagaaatggggatgggggaaatacgacttagtgaggcatagacatccctggtcc 4320 atcctttctgtctccagctgtttcttggaacctgctctcctgcttgctggtccctgacgc 4380 agagaccgttgcctcccccacagccgtttgactgaaggctgctctggagacctagagtaa 4440 aacggctgatggaagttgtgggacccacttccatttccttcagtcattagaggtggaagg 4500 gaggggtctccaagtttggagattgagcagatgaggcttgggatgcccctgctttgactt 4560 cagccatggatgaggagtgggatggcagcaaggtggctcctgtggcagtggagttgtgcc 4620 agaaacagtggccagttgtatcgcctataagacagggtaaggtctgaagagctgagcctg 4680 taattctgctgtaataatgatagtgctcaagaagtgccttgagttggtgtacagtgccat 4740 ggccatcaagaatcccagatttcaggttttattacaaaatgtaagtggtcacttggcgat 4800 tttgtagtacatgcatgagttaccttttttctctatgtctgagaactgtcagattaaaac 4860 aagatggcaaagagatcgttagagtgcacaacaaaatcactatcccattagacacatcat 4920 caaaagcttatttttattcttgcactggaagaatcgtaagtcaactgtttcttgaccatg 4980 gcagtgttctggctccaaatggtagtgattccaaataatggttctgttaacactttggca 5040 gaaaatgccagctcagatattttgagatactaaggattatctttggacatgtactgcagc 5100 ttcttgtctctgttttggattactggaatacccatgggccctctcaagagtgctggactt 5160 ctaggacattaagatgattgtcagtacattaaacttttcaatcccattatgcaatcttgt 5220 ttgtaaatgtaaacttctaaaaatatggttaataacattcaacctgtttattacaactta 5280 aaaggaacttcagtgaatttgtttttattttttaacaagatttgtgaactgaatatcatg 5340 aaccatgttttgatacccctttttcacgttgtgccaacggaatagggtgtttgatatttc 5400 ttcatatgttaaggagatgcttcaaaatgtcaattgctttaaacttaaattacctctcaa 5460 gagaccaaggtacatttacctcattgtgtatataatgtttaatatttgtcagagcattct 5520 ccaggtttgcagttttatttctataaagtatgggtattatgttgctcagttactcaaatg 5580 gtactgtattgtttatatttgtaccccaaataacatcgtctgtactttctgttttctgta 5640 ttgtatttgtgcaggattctttaggctttatcagtgtaatctctgccttttaagatatgt 5700 acagaaaatgtccatataaatttccattgaagtcgaatgatactgagaagcctgtaaaga 5760 ggagaaaaaaacataagctgtgtttccccataagtttttttaaattgtatattgtatttg 5820 tagtaatattccaaaagaatgtaaataggaaatagaagagtgatgcttatgttaagtcct 5880 aacactacagtagaagaatggaagcagtgcaaataaattacatttttcccaagtgccagt 5940 ggcatattttaaaataaagtgtatacgttggaatgagtcatgccatatgtagttgctgta 6000 gatggcaactagaacctttgagttacaagagtctttagaagttttctaaccctgcctagt 6060 gcaagttacaatattatagcgtgttcggggagtgccctcctgtctgcaggtgtgtctctg 6120 tgcctgggggcttttctccacatgcttaggggtgtgggtcttccattggggcatgatgga 6180 cctgtctacaggtgatctctgttgcctttgggtcagcacatttgttagtctcctgggggt 6240 gaaaacttggcttacaagagaactggaaaaatgatgagatgtggtccccaaacccttgat 6300 tgactctggggaggggctttgtgaataggattgctctcacattaaagatagttacttcaa 6360 tttgaaggctggatttagggatttttttttttccttataacaaagacatcaccaggatat 6420 gaagcttttgttgaaagttggaaaaaaagtgaaattaaagacattcccagacaaa 6475

Claims (20)

  1. 인간 TGF-베타 수용체 I형 유전자의 발현을 시험관 내에서 80% 이상 억제할 수 있는 이중 가닥 라이보핵산 분자.
  2. 제 1 항에 있어서,
    이중 가닥 라이보핵산 분자가 센스 가닥 및 안티센스 가닥을 포함하고, 안티센스 가닥이 적어도 부분적으로 센스 가닥에 상보적이며, 여기서 센스 가닥이 TGF-베타 수용체를 암호화하는 mRNA의 적어도 일부에 90% 이상의 동일성을 갖는 서열을 포함하며, (i) 상기 서열이 상기 안티센스 가닥에 대한 센스 가닥의 상보성 영역에 위치하고, (ii) 상기 서열의 길이가 30개 뉴클레오타이드 미만인 이중 가닥 라이보핵산 분자.
  3. 제 1 항 또는 제 2 항에 있어서,
    센스 가닥이 서열번호 1, 117, 103, 31, 81, 99, 23, 13, 29 및 7에 개시된 핵산 서열로 구성된 군에서 선택되고, 안티센스 가닥이 서열번호 2, 118, 104, 32, 82, 100, 24, 14, 30 및 8에 개시된 핵산 서열로 구성된 군에서 선택되거나, 또는 상기 이중 가닥 라이보핵산 분자가 서열번호 1/2, 117/118, 103/104, 31/32, 81/82, 99/100, 23/24, 13/14, 29/30 및 7/8로 구성된 군에서 선택되는 서열 쌍을 포함하는 이중 가닥 라이보핵산 분자.
  4. 제 1 항 내지 제 3 항중 어느 한 항에 있어서,
    이중 가닥 라이보핵산 분자가 하나 이상의 개질된 뉴클레오타이드를 포함하는 이중 가닥 라이보핵산 분자.
  5. 제 4 항에 있어서,
    개질된 뉴클레오타이드가 2'-O-메틸 개질된 뉴클레오타이드, 5'-포스포로티오에이트기를 포함하는 뉴클레오타이드, 및 콜레스테릴 유도체 또는 도데칸산 비스데실아미드 기에 연결된 말단 뉴클레오타이드, 2'-데옥시-2'-플루오로 개질된 뉴클레오타이드, 2'-데옥시-개질된 뉴클레오타이드, 락킹된(locked) 뉴클레오타이드, 어베이직(abasic) 뉴클레오타이드, 2'-아미노-개질된 뉴클레오타이드, 2'-알킬-개질된 뉴클레오타이드, 모폴리노 뉴클레오타이드, 포스포르아미데이트 및 비-천연 염기 포함 뉴클레오타이드로 구성된 군에서 선택되는 이중 가닥 라이보핵산 분자.
  6. 제 4 항 또는 제 5 항에 있어서,
    센스 가닥이 서열번호 151, 249, 261, 231, 275, 253, 211, 265, 181, 185, 209, 299, 295, 279 및 219에 개시된 핵산 서열로 구성된 군에서 선택되고, 안티센스 가닥이 서열번호 152, 250, 262, 232, 276, 254, 212, 266, 182, 186, 210, 300, 296, 280 및 220에 개시된 핵산 서열로 구성된 군에서 선택되거나, 이중 가닥 라이보핵산 분자가 서열번호 151/152, 249/250, 261/262, 231/232, 275/276, 253/254, 211/212, 265/266, 181/182, 185/186, 209/210, 299/300, 295/296, 279/280 및 219/220으로 구성된 군에서 선택되는 서열 쌍을 포함하는, 이중 가닥 라이보핵산 분자.
  7. 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자에 포함된 센스 가닥 및/또는 안티센스 가닥을 암호화하는 핵산 서열.
  8. 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자에 포함된 센스 가닥 또는 안티센스 가닥중 하나 이상을 암호화하는 뉴클레오타이드 서열에 작동가능하게 연결된 조절 서열을 포함하거나, 제 7 항의 핵산 서열을 포함하는 벡터.
  9. 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자, 제 7 항의 핵산 분자 또는 제 8 항의 벡터를 포함하는 세포, 조직 또는 비-인간 유기체.
  10. 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자, 제 7 항의 핵산 분자, 제 8 항의 벡터 또는 제 9 항의 세포 또는 조직을 포함하는 약학 조성물.
  11. 제 10 항에 있어서,
    약학적으로 허용가능한 담체, 안정화제 및/또는 희석제를 추가로 포함하는 약학 조성물.
  12. (a) 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자, 제 7 항의 핵산 분자 또는 제 8 항의 벡터를 세포, 조직 또는 유기체에 도입하는 단계; 및
    (b) TGF-베타 수용체 유전자의 mRNA 전사체가 분해되기에 충분한 시간동안 단계 (a)에서 생성된 세포, 조직 또는 유기체를 유지시키고, 세포에서 TGF-베타 수용체 유전자의 발현을 억제하는 단계
    를 포함하는, 세포, 조직 또는 유기체에서 TGF-베타 수용체 유전자의 발현을 억제하는 방법.
  13. 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자, 제 7 항의 핵산 분자, 제 8 항의 벡터 및/또는 제 10 항 또는 제 11 항의 약학 조성물의 치료 또는 예방적 치료 효과량을 섬유증 질병, 염증 또는 증식성 질병의 치료, 예방 또는 관리가 필요한 대상에게 투여함을 포함하는, 섬유증 질병, 염증 또는 증식성 질병을 치료, 예방 또는 관리하는 방법.
  14. 제 13 항에 있어서,
    대상이 인간인 방법.
  15. 섬유증 질병, 염증 또는 증식성 질병의 치료에 유용한 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자, 제 7 항의 핵산 분자, 제 8 항의 벡터 및/또는 제 10 항 또는 제 11 항의 약학 조성물.
  16. 섬유증 질병, 염증 또는 증식성 질병 치료용 약학 조성물을 제조하기 위한, 제 1 항 내지 제 6 항중 어느 한 항의 이중 가닥 라이보핵산 분자, 제 7 항의 핵산 분자, 제 8 항의 벡터 및/또는 제 9 항의 세포 또는 조직의 용도.
  17. 섬유증 질병이 간 섬유증, 간경변, 신장 섬유증, 비장의 섬유증, 췌장 및 폐의 낭포성 섬유증, 사출 섬유증, 심내막심근 섬유증, 폐의 특발성 폐 섬유증, 종격섬유증, 골수섬유증, 후복막 섬유증, 진행성 괴상 섬유증, 신장기원 전신성 섬유증, 확산성 실질세포 폐 질환, 정관절제후 통증 증후군 및 류마티스 관절염으로 구성된 군에서 선택되는, 제 12 항 내지 제 14 항중 어느 한 항의 방법, 제 15 항의 이중-가닥 라이보핵산 분자, 제 15 항의 세포, 제 10 항의 약학 조성물 또는 제 16 항의 용도.
  18. 증식성 질병이 암 질병인 제 12 항 내지 제 14 항중 어느 한 항의 방법, 제 15 항의 이중-가닥 라이보핵산 분자, 제 9 항의 세포, 제 10 항의 약학 조성물 또는 제 16 항의 용도.
  19. 제 18 항에 있어서,
    암 질병이 간암, 뇌암, 유방암, 폐암 및 전립선암으로 구성된 군에서 선택되는, 방법, 이중 가닥 라이보핵산 분자, 세포, 약학 조성물 또는 용도.
  20. 제 19 항에 있어서,
    간암이 간세포 암종(HCC), 간아세포종, 혼합 간암(mixed liver cancer), 중간엽 조직에서 유래된 암, 간 육종 및 담관암종으로 구성된 군에서 선택되는 방법, 이중 가닥 라이보핵산 분자, 세포, 약학 조성물 또는 용도.
KR1020117000895A 2008-07-15 2009-07-08 Ｔｇｆ-베타 수용체 유전자 발현 억제용 조성물 및 방법 KR20110017005A (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP08012777 2008-07-15
EP08012777.2 2008-07-15

Publications (1)

Publication Number Publication Date
KR20110017005A true KR20110017005A (ko) 2011-02-18

Family

ID=41172326

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020117000895A KR20110017005A (ko) 2008-07-15 2009-07-08 Ｔｇｆ-베타 수용체 유전자 발현 억제용 조성물 및 방법

Country Status (11)

Country Link
US (1) US20110119781A1 (ko)
EP (1) EP2313505A2 (ko)
JP (1) JP2011527893A (ko)
KR (1) KR20110017005A (ko)
CN (1) CN102089429A (ko)
AU (1) AU2009272841A1 (ko)
BR (1) BRPI0916440A2 (ko)
CA (1) CA2728467A1 (ko)
IL (1) IL209110A0 (ko)
MX (1) MX2011000227A (ko)
WO (1) WO2010006973A2 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150140703A (ko) * 2013-03-27 2015-12-16 이사르나 테라퓨틱스 게엠베하 변형된 tgf-베타2 올리고뉴클레오타이드
KR20150140701A (ko) * 2013-03-27 2015-12-16 이사르나 테라퓨틱스 게엠베하 변형된 tgf-베타 올리고뉴클레오타이드

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2009293658A1 (en) 2008-09-22 2010-03-25 James Cardia Reduced size self-delivering RNAi compounds
KR101852210B1 (ko) * 2010-03-24 2018-04-25 알엑스아이 파마슈티칼스 코포레이션 진피 및 섬유증성 적응증에서의 ｒｎａ 간섭
EP2550001B1 (en) * 2010-03-24 2019-05-22 Phio Pharmaceuticals Corp. Rna interference in ocular indications
CA2831827A1 (en) * 2011-04-05 2012-10-11 Academisch Ziekenhuis Leiden H.O.D.N. Lumc Compounds and methods for altering activin receptor-like kinase signalling
US20150368648A1 (en) * 2014-06-20 2015-12-24 Yale University Compositions and methods of inhibiting gene expression in a lung
EP3020813A1 (en) * 2014-11-16 2016-05-18 Neurovision Pharma GmbH Antisense-oligonucleotides as inhibitors of TGF-R signaling
AU2022301058A1 (en) * 2021-06-28 2024-01-04 Alnylam Pharmaceuticals, Inc. Compositions and methods for silencing myoc expression

Family Cites Families (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) * 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4522811A (en) * 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US5034506A (en) * 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5264423A (en) * 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
JP2828642B2 (ja) * 1987-06-24 1998-11-25 ハワード フローレイ インスティテュト オブ イクスペリメンタル フィジオロジー アンド メディシン ヌクレオシド誘導体
US4924624A (en) * 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5278302A (en) * 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) * 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5328470A (en) * 1989-03-31 1994-07-12 The Regents Of The University Of Michigan Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor
US5134066A (en) * 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) * 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5399676A (en) * 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) * 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
EP0497875B1 (en) * 1989-10-24 2000-03-22 Isis Pharmaceuticals, Inc. 2' modified oligonucleotides
US5177198A (en) * 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5506351A (en) * 1992-07-23 1996-04-09 Isis Pharmaceuticals Process for the preparation of 2'-O-alkyl guanosine and related compounds
US5459255A (en) * 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5670633A (en) * 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5646265A (en) * 1990-01-11 1997-07-08 Isis Pharmceuticals, Inc. Process for the preparation of 2'-O-alkyl purine phosphoramidites
US5578718A (en) * 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5587361A (en) * 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5212295A (en) * 1990-01-11 1993-05-18 Isis Pharmaceuticals Monomers for preparation of oligonucleotides having chiral phosphorus linkages
US5587470A (en) * 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5321131A (en) * 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) * 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5541307A (en) * 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5218105A (en) * 1990-07-27 1993-06-08 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5608046A (en) * 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5610289A (en) * 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5602240A (en) * 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US6262241B1 (en) * 1990-08-13 2001-07-17 Isis Pharmaceuticals, Inc. Compound for detecting and modulating RNA activity and gene expression
US5214134A (en) * 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5539082A (en) * 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5594121A (en) * 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5359044A (en) * 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
EP0577558A2 (de) * 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclische Nukleoside mit bicyclischen Ringen, Oligonukleotide daraus, Verfahren zu deren Herstellung, deren Verwendung und Zwischenproduckte
GB9304618D0 (en) * 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
JPH08508491A (ja) * 1993-03-31 1996-09-10 スターリング ウインスロップ インコーポレイティド ホスホジエステル結合をアミド結合に置き換えたオリゴヌクレオチド
US5571902A (en) * 1993-07-29 1996-11-05 Isis Pharmaceuticals, Inc. Synthesis of oligonucleotides
US5519134A (en) * 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) * 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5554746A (en) * 1994-05-16 1996-09-10 Isis Pharmaceuticals, Inc. Lactam nucleic acids
US5597909A (en) * 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
US6166197A (en) * 1995-03-06 2000-12-26 Isis Pharmaceuticals, Inc. Oligomeric compounds having pyrimidine nucleotide (S) with 2'and 5 substitutions
US6127533A (en) * 1997-02-14 2000-10-03 Isis Pharmaceuticals, Inc. 2'-O-aminooxy-modified oligonucleotides
US6271358B1 (en) * 1998-07-27 2001-08-07 Isis Pharmaceuticals, Inc. RNA targeted 2′-modified oligonucleotides that are conformationally preorganized
US20050287128A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of TGF-beta and TGF-beta receptor gene expression using short interfering nucleic acid (siNA)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150140703A (ko) * 2013-03-27 2015-12-16 이사르나 테라퓨틱스 게엠베하 변형된 tgf-베타2 올리고뉴클레오타이드
KR20150140701A (ko) * 2013-03-27 2015-12-16 이사르나 테라퓨틱스 게엠베하 변형된 tgf-베타 올리고뉴클레오타이드

Also Published As

Publication number Publication date
US20110119781A1 (en) 2011-05-19
BRPI0916440A2 (pt) 2018-06-05
WO2010006973A2 (en) 2010-01-21
MX2011000227A (es) 2011-02-24
CN102089429A (zh) 2011-06-08
CA2728467A1 (en) 2010-01-21
JP2011527893A (ja) 2011-11-10
EP2313505A2 (en) 2011-04-27
WO2010006973A3 (en) 2010-03-18
IL209110A0 (en) 2011-01-31
AU2009272841A1 (en) 2010-01-21

Similar Documents

Publication Publication Date Title
AU2019240625B2 (en) Compositions and methods for inhibiting gene expression of Hepatitis B virus
KR20110017005A (ko) Ｔｇｆ-베타 수용체 유전자 발현 억제용 조성물 및 방법
WO2011073218A1 (en) Compositons and methods for inhibiting expression of il-18 genes
WO2011054939A2 (en) Compositions and methods for inhibiting expression of kif10 genes
EP2851426B1 (en) Compositions and methods for inhibiting expression of RRM2 genes
KR20110100316A (ko) Ｐｔｐ1ｂ 유전자의 발현을 억제하기 위한 조성물 및 방법
WO2012082894A1 (en) Compositions and methods for inhibiting expression of mll genes
WO2011095495A1 (en) Compositions and methods for inhibiting expression of ikk2 genes
EA045398B1 (ru) Композиции и способы ингибирования экспрессии генов вируса гепатита в

Legal Events

Date Code Title Description
A201 Request for examination
E601 Decision to refuse application