KR20100107866A - Polymorphic markers of vcan for predicting susceptibility to gastric cancer and the prediction method using the same - Google Patents

Abstract

PURPOSE: A polymorphism marker for predicting gastric cancer susceptibility and a method for predicting gastric cancer susceptibility are provided to predict and analyze risk of gastric cancer by confirming haplotype marker. CONSTITUTION: A kit for predicting gastric cancer susceptibility contains: a polynucleotide having 20-100 serial nucleic acid molecules with +301th base, G or A of rs1888703(sequence number 64), or complementary nucleic acid molecule thereof; a polynucleotide having 20-100 serial nucleic acid molecules with +301th base, G or T of rs160277(sequence number 65), or complementary nucleic acid molecule thereof; probe or primer pair which is able to detect gastric cancer-associated polymorphism site. A biochip for predicting gastric cancer susceptibility contains an antibody which specifically recognizes 10-30 serial polypeptide having 1826th amino acid, histidine of versican(VCAN), or 10-30 serial polypeptide having 2937th amino acid, tyrosine.

Description

Polymorphic markers of VCAN for predicting susceptibility to gastric cancer and the prediction method using the same}

The present invention relates to a polymorphic marker for gastric cancer susceptibility prediction, a haplotype marker, and a method for predicting gastric cancer susceptibility using the same.

All humans have about 99.9% identical genetic sequences between individuals and show about 0.1% genetic differences between individuals due to a nucleotide difference of about 0.1%. This genetic difference is called academic genetic variation, which is caused by mutations caused by errors in DNA replication. In particular, in order to identify genetic risk factors for diseases, genetic markers that can classify the genetic polymorphism of the diseased gene are essential. The term polymorphism refers to a difference in base pairs present in DNA between an individual and an individual, and refers to a case in which alleles in the general population have a low frequency of alleles of 1% or more.

Polymorphisms are largely divided into recurrent polymorphism and unique polymorphism, depending on the molecular nature of the genetic variation. Recurrent polymorphisms are those in which the same allele (gene) is independently repeated by a relatively constant mutation rate, such as restriction fragment length polymorphism (RFLP), microsatellite (STR), and minisatellite. In contrast, unique polymorphism refers to a case of only one mutation so far, and refers to single nucleotide polymorphism (SNP) and ins / del polymorphism (Ins / Del polymorphism). In particular, studies using unique polymorphisms can be used more appropriately to understand the history of disease-related genetic polymorphisms in a population. SNPs are the most frequently observed, with more than 90% of the various genetic variations present in the human genome. Much attention has been paid to disease genome research, suggesting that the genetic factors that determine individual differences in the incidence and progression of high incidence of chronic disease will be determined by these SNPs appearing at a relatively common frequency in the human genome. Is accepted (common disease common allele; CDCA).

SNP is defined as a genetic variation in which one nucleotide sequence is substituted in a DNA nucleotide sequence, and refers to a case where a certain allele frequency (MAF) of a certain allele irradiated in a population is 1% or more. At the time of the first analysis, it was estimated that there would be about 10 million SNPs in the human genome, but recently, with the development of genome analysis technology, the SNPs were discovered more than expected. The number of validated SNPs is more than 6.5 million, and the number is expected to increase further through continuous excavation.

Regulatory SNP (rSNP) is located in the promoter region of the gene to regulate gene expression, coding SNP (cSNP) if located in the exon region coding the gene, intron SNP (iSNP) is located in the intron, and SNPs present in genes and intergenic regions between genes are called genomic SNPs (gSNPs). In particular, cSNPs are classified into nonsynonymous SNPs (nsSNPs) in which amino acid sequences are altered by nucleotide sequences and synonymous SNPs in which amino acid sequences do not change even if nucleotide sequences are changed.

Extracellualr matrix (ECM), on the other hand, is a highly organized structure that provides mechanical strength to support tissues and regulates various life activities of cells (Theocharis AD.Connect Tissue Res. 2008, Vol. 49, 230-234). Vertican protein (Versican, VCAN) is a major component of the extracellular matrix and supports the morphological changes of cells to help cells divide and migrate (Evanko SP, et al. Arterioscler Thromb Vasc Biol. 1999, 19, 1004-1013; Wight TN. Curr Opin Cell Biol. 2002, Vol. 14, 617-623).

The Versican gene is located at the 5q14.3 locus of the human genome and consists of 15 exons. Vertican proteins are structurally divided into three domains, specifically, the G1 domain at the N terminus, the G3 domain at the C terminus, and a central portion located between G1 and G3. The amino acid terminal G1 domain contains hyaluronic acid binding sites, and the carboxyl terminal G3 domain contains epidermal growth factor-like repeats, lectin-like sequences, and complements. It consists of sequences such as complement regulatory protein-like motifs (Zimmermann DR. Embo J. 1989, Vol. 8, 2975-2981). On the other hand, there are two glycosaminoglycan attachment sites in the central part of the protein, and the glycosaminoglycan is

It consists of the GAG-α domain and GAG-β. Alternative splicing occurs here, resulting in four isoforms (Dours-Zimmermann MT. J Biol Chem. 1994, Vol. 269, 32992-32998). The V0 heteroprotein contains all domains, whereas the V1 heterologous protein lacks a GAG-α domain, the V2 heterologous protein lacks a GAG-β domain, and the V3 heterologous protein has both GAG domains removed.

Versican overexpression has been observed in various cancers including melanoma, prostate cancer, breast cancer, and gastric cancer. In particular, experimental overexpression of the V1 heterologous protein comprising the GAG-β domain promotes cell division, tumor growth and angiogenesis, and has been observed to reduce apoptosis (Sheng W, et al. Mol Biol Cell. 2005, Vol. 16, 1330-1340; LaPierre DP, et al. Cancer Res. 2007, Vol. 67, 4742-4750). V1 is known to enhance the expression of EGFR, which promotes carcinogenesis, kinase activity of CDK2, and inhibit the expression of Bad genes that induce apoptosis (Sheng W, et al. Mol Biol Cell. 2005, Vol. 16). , 1330-1340). In contrast, V2 heterologous proteins without GAG-β were found to inhibit cell proliferation and EGFR expression (Sheng W, et al. Mol Biol Cell. 2005, Vol. 16, 1330-1340). These reports indicate that Versican plays an important role in carcinogenesis, and in particular the GAG-β domain is involved in cell division and EGFR signaling.

However, no genetic link between Versican and cancer has been reported. Therefore, the present inventors first presented the genetic relationship between the Versican gene and gastric cancer through a patient-control study, and the genetic mutations that alter the amino acid sequence of the Versican protein GAG-β domain may be used for The present invention has been completed by confirming that it can be used to predict.

It is an object of the present invention to provide a kit for predicting gastric cancer sensitivity using the monobasic polymorphism marker for predicting gastric cancer sensitivity.

Another object of the present invention is to provide a gastric cancer susceptibility prediction microarray integrated with the single nucleotide polymorphism marker for gastric cancer susceptibility prediction.

Another object of the present invention is to provide a haplotype marker for predicting gastric cancer susceptibility in the human genome 5q14.3 region.

Another object of the present invention is to provide a method for predicting gastric cancer sensitivity using the monobasic polymorphism marker for gastric cancer sensitivity prediction.

In order to achieve the above object, the present invention provides a kit for predicting gastric cancer susceptibility comprising a probe or primer pair capable of detecting gastric cancer-related monobasic polymorphism markers present in the 5q14.3 region of the human genome.

The present invention also provides a microarray for predicting gastric cancer susceptibility in which oligonucleotides complementary to the gastric cancer-related monobasic polymorphism markers are integrated.

In addition, the present invention provides a haplotype marker for gastric cancer susceptibility prediction, comprising a single nucleotide polymorphism marker present in the human genome 5q14.3 region.

In addition, the present invention provides a method for detecting the gastric cancer-related single nucleotide polymorphism marker for gastric cancer prediction.

Hereinafter, the term used by this invention is demonstrated.

Single Nucleotide Polymorphism (SNP) is the most frequent polymorph present in the human genome at a rate of about 0.1% (about 1 base to about 1000 bases). In other words, this monobasic polymorphism means a state in which a polymorphism is an AT base pair in the polymorphism, for example, when one base of the genomic gene is replaced with another base. In addition, there exist cases where each allele of the double-stranded chromosome is polymorphic (homogenous conjugation polymorphism) and when one side is wild type and the other is polymorphic (heterozygotic polymorphism). Such a single base variation may cause synthesis (nonsense variation) of incomplete protein due to codon mutation (synthesis of missed amino acid) or termination codon. Therefore, it is clear that the presence or absence of monobasic polymorphism is related to various diseases (eg SNP of p53 gene for lung cancer: Biros et. al ., Neoplasma 48 (5): 407-11, 2001) The importance of accurately determining the presence or absence of monobasic polymorphisms (SNP typing) is strongly recognized for purposes of diagnosis and genetic therapy. In addition, this monobasic polymorphism is also a useful polymorphic marker when searching for genes related to disease-prone properties or drug reactivity, and attracts attention as important genetic information for tailor-made medicine.

Haplotypes are a combination of single-base polymorphisms found in a population based on statistical probability, and are known to provide more accurate and reliable functional genetic information than each single base polymorphism.

5q14.3 is the 14.3rd band of the long arm (q) below chromosome 5, the centromere.

Hereinafter, the present invention will be described in detail.

The present invention provides a kit for predicting gastric cancer susceptibility comprising a probe or primer pair capable of amplifying a polymorphic site of rs188703 (SEQ ID NO: 64) and a polymorphic site of rs160277 (SEQ ID NO: 65) in the human genome 5q14.3 region. to provide.

According to the Polymorphic Database (dbSNP) of the National Center for Biotechnology Information (NCBI), there are a total of 21 functional genetic variations in the vertican gene. Nineteen of these are synonymous single nucleotide polymorphisms (nsSNPs), and two are frameshift mutations. We analyzed the association between 21 genetic mutations and gastric cancer in a case-control study.

First, as a result of verifying the polymorphism of the 21 functional genetic variants registered in the database using a DNA pool (see Table 1), only 6 nsSNPs showed polymorphism with a frequency of 5% or more. (See Table 3). Six validated genetic mutations were analyzed in 430 gastric cancer patients and 406 normal genomic DNAs.The 1826th amino acid sequence of the Versican protein was converted from arginine to histidine (R1826H), and the 2937th amino acid from aspartic acid to tyrosine. (D2937Y) It was confirmed that the two nsSNPs that change were significantly associated with gastric cancer susceptibility. Both polymorphisms were located in the GAG-β domain, which is thought to play an important role in carcinogenesis. In the recessive model, the recessive allele homozygote was significantly associated with decreased gastric cancer susceptibility, particularly with susceptibility to intestinal-type gastric cancer (Table 4). And 5).

Both polymorphisms specifically exist at position +301 of rs188703 (SEQ ID NO: 64) and the amino acid sequence may be G or A, and also at position +301 of rs160277 (SEQ ID NO: 65) and G or T is present. Can be. This conversion of nucleotides causes rs188703 to replace arginine encoded by CGU with histidine encoded by CAU, and aspartic acid encoded by GAU in tyrosine encoded by UAU in rs160277.

The two polymorphisms showed a very strong correlation with each other (R ² = 0.99), and haplotype analysis was performed. The haplotype (H1826-Y2937), in which the 1826th amino acid was histidine and the 2937 amino acid tyrosine, was found to significantly reduce gastric cancer susceptibility. Diplotype analysis also showed a significant association with gastric cancer susceptibility in recessive models.

In summary, the recessive alleles of R1826H and D2937Y, located in the GAG-β domain of the Versican gene, significantly reduced gastric cancer susceptibility, and this association was more pronounced in intestinal gastric cancer.

Therefore, the present invention provides a probe and a primer capable of determining the polymorphic site, and a kit including the same.

Specifically, the present invention relates to 1) a polymorphic site of rs188703 (SEQ ID NO: 64), wherein the +301 th amino acid sequence is G or A, and 20 to 100 consecutive nucleic acid molecules or complementary nucleic acids comprising the +301 th base. Stomach cancer related polynucleotides composed of molecules; or,

2) Gastric cancer-related polynucleotide consisting of 20 to 100 consecutive nucleic acid molecules or complementary nucleic acid molecules of which the +301 th base, which is the polymorphic site of rs160277 (SEQ ID NO: 65), is G or T and comprises the +301 th base; ;

By amplifying, a gastric cancer susceptibility prediction kit comprising a probe or primer pair capable of detecting a gastric cancer-related polymorphism site is provided.

The probe of the kit is preferably designed to specifically bind to the polynucleotide under stringent hybridization conditions, and 15 to 50 selected within the polynucleotide to contain 20 to 100 consecutive bases comprising the polymorphic site. Any complementary to oligonucleotides of mer length, preferably 15-30 mer, more preferably 18-25 mer, may be used.

The specific binding means that non-specific hybrids are not formed, but specific hybrids are formed, and the strict hybridization conditions can be determined based on the melting temperature (Tm) of the nucleic acid forming the hybrids according to a conventional method. have. As a washing condition that can maintain a specific hybridization state, it is usually a condition of about 1 × SSC, 0.1% SDS, 37 ° C., more strictly, a condition of about 0.5 × SSC, 0.1% SDS, 42 ° C., and more stringent. For example, "0.1 x SSC, 0.1% SDS, 65" can be mentioned.

The probe can also be used by immobilization on any solid substrate. The solid substrate also includes a gene tip, cDNA micro array, oligo DNA array, membrane filter (membrane filter).

The primer pair of the kit is preferably used as the following primer pair 1 or 2, but is not limited thereto. The length is 15 to 50mers, preferably 15 to 30mers, and more preferably 18 to 25mers. Both forward and reverse primer pairs can be used.

Alternatively, the primer pair may consist of 15 to 50 consecutive bases including the polymorphic site, and may have at least one oligonucleotide having the base of the polymorphic site at the 3 ′ end. By having a polymorphic site at the 3 'end, it is apparent to those skilled in the art that the amplification reaction does not occur in genomic DNA samples obtained from an individual in which the polymorphic site is not mutated by mutation of the single nucleic acid molecule. Primer pairs are specifically as follows:

Primer pair 1: forward primer set forth in SEQ ID NO: 28 and reverse primer set forth in SEQ ID NO: 29; or

Primer pair 2: forward primer set forth in SEQ ID NO: 52 and reverse primer set forth in SEQ ID NO: 53.

In this case, the kit may further include a deoxynucleotide mixture (dNTP mixture) and a buffer as a component of the PCR reaction, and may further include a thermostable DNA polymerase such as Taq DNA polymerase. In addition, the kit of the present invention may further include a fluorescent material such as 6-FAM, NED or HEX, agarose and electrophoresis buffer solution required to confirm the PCR results. In addition, the kit of the present invention may be provided in the form of a premix of the amplification reaction element with the primer pair.

The present invention also provides a microarray for dispersing gastric cancer susceptibility prediction integrated with any one or more oligonucleotides selected from the following group:

1) gastric cancer-related oligonucleotides consisting of 5-25 consecutive nucleic acid molecules or nucleic acid molecules complementary thereto comprising the +301 th base, which is the polymorphic site of rs188703 (SEQ ID NO: 64); or,

2) Gastric cancer-related oligonucleotides consisting of 5 to 25 consecutive nucleic acid molecules or nucleic acid molecules complementary thereto, including the +301 th base which is the polymorphic site of rs160277 (SEQ ID NO: 65).

The oligonucleotide is not hybridized when there is a mismatch with an amplified product labeled with a fluorescent material while amplifying the DNA contained in the sample, and when the match is hybridized, the fluorescence is detected. It can be predicted. At this time, it is apparent to those skilled in the art that hybridization is not performed even by mismatch of a single nucleic acid molecule on the oligonucleotide.

The microarray of the present invention can be produced by methods known to those skilled in the art. The method of manufacturing the microarray is as follows. In order to immobilize the oligonucleotide as a probe DNA molecule on a microarray substrate, a micropipetting method using a piezoelectric method or a method using a pin-shaped spotter, etc. It is preferable to use but is not limited thereto. The substrate of the microarray is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It is not. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto.

In addition, the present invention provides a polymorphic site of the rs188703 (SEQ ID NO: 64) of the single nucleotide polymorphism marker (1) rs188703 (SEQ ID NO: 64) in the human genome 5q14.3 region is G; ② Provide a haplotype marker for gastric cancer susceptibility prediction in which the +301 th base, the polymorphic site of rs160277 (SEQ ID NO: 65), is G.

In addition, the present invention provides a polymorphic site of the rs188703 (SEQ ID NO: 64) of the single nucleotide polymorphism marker (1) rs188703 (SEQ ID NO: 64) in the human genome 5q14.3 region A; ② Provide a haplotype marker for gastric cancer susceptibility prediction in which the +301 th base, the polymorphic site of rs160277 (SEQ ID NO: 65), is T.

The haplotype marker is preferably used as a marker for predicting susceptibility of intestinal gastric cancer because its sensitivity is particularly reduced in the case of intestinal gastric cancer among gastric cancer (see Tables 4 and 5).

In addition, the present invention is a stomach cancer invention is a genomic DNA isolated from blood samples of individuals (experimental group) and control group

1) separating DNA from a sample of the test subject;

2) detecting a gastric cancer-related polymorphic site of the DNA:

Gastric cancer-related polynucleotide consisting of 10-100 consecutive nucleic acid molecules or complementary nucleic acid molecules thereof, wherein the +301 th amino acid sequence of the polymorphic site of rs188703 (SEQ ID NO: 64) is G or A, and the +301 th base is included; And / or

Gastric cancer-related polynucleotide consisting of 10-100 consecutive nucleic acid molecules or complementary nucleic acid molecules comprising the +301 th base, which is the polymorphic site of rs160277 (SEQ ID NO: 65), is G or T, and the +301 th base

3) providing a polymorphism detection method for predicting gastric cancer susceptibility, comprising detecting a gastric cancer-related polymorphism gene to predict gastric cancer, comprising the step of identifying the genotype of the polymorphic site in step 2). do.

In addition, 4) if the genotype of the polymorphic site is AA in rs188703 in step 3), it is determined that the stomach cancer susceptibility is low, and if the genotype of the polymorphic site is rs160277 in TT, the stomach cancer susceptibility further comprising the step of determining that the stomach cancer susceptibility is low. Provided are a polymorphism detection method for prediction.

The detection method of step 2) includes sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele-specific hybridization (DASH), PCR extension analysis, restriction Restriction fragment length polymorphisms (RFLP), MALDI-TOF mass spectrometry or TaqMan techniques can be performed.

PCR detection and quantification using double labeled fluorogenic oligonucleotide probes, commonly referred to as "TaqMan ™" probes, can also be performed in accordance with the present invention. Such probes consist of short (eg, 20-25 bases) oligodeoxynucleotides labeled with two different fluorescent dyes. There is a reporter dye at the 5 'end of each probe and a quenching dye at the 3' end. Oligonucleotide probe sequences are complementary to internal target sequences present in PCR amplicons. If the probe is not damaged, energy transfer occurs between the two fluorophores and the emission from the reporter is quenched by FRET. During the elongation phase of PCR, the probe is cleaved by the 5 'nuclease activity of the polymerase used in the reaction so that the reporter is released from the oligonucleotide-quencher and an increase in reporter release intensity occurs. Thus, TaqMan ™ probes are oligonucleotides with labels and quencher, where the labels are released by the exonuclease action of the polymerase used in the amplification during amplification. This provides a real time measurement of amplification during synthesis. A variety of TaqMan ™ reagents are commercially available from Applied Biosystems (USA) as well as from various specialist vendors such as Biosearch Technologies (eg black hole quencher probes). Further details regarding double-labeled probe strategies are described in WO92 / 02638.

Since polymorphic markers and haplotype markers consisting of rs188703 (R1826H) and rs160277 (D2937Y) are closely related to gastric cancer susceptibility, it can be usefully used to prevent stomach cancer by predicting the sensitivity of gastric cancer before gastric cancer by measuring this. It can be used to analyze the genetic predisposition of gastric cancer.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> Research subject

The present invention used 430 gastric cancer patients and 406 normal genomic DNA. Blood and tissue samples from gastric cancer patients and normal people were collected from Seoul National University Hospital, Hanyang University Guri Hospital, Inje University Paik Hospital, Chungnam National University Hospital, and Eulji University Hospital with the approval of the internal ethics committee of each institution. The control group included only those who were found to be normal by a medical examination, including gastroscopy or gastrointestinal angiography.

The age at diagnosis of gastric cancer patients was 57.3 ± 12.9 years (mean ± standard deviation), and normal subjects were 52.1 ± 8.4 years. The proportion of males was 66.5% in the patient group and 69.5% in the normal group, which was higher in both groups.

Gastric cancer patients were classified according to Lauren's classification. There were 178 enteric gastric cancer patients and 252 diffuse gastric cancer patients, and the mixed type was not included in the analysis. The stages of gastric cancer were composed of 42 patients in stage 1A, 66 patients in stage IB, 86 patients in stage II, 106 patients in stage IIIA, 58 patients in stage IIIB, and 72 patients in stage IV.

Genomic DNA was extracted from frozen gastric tissues or blood samples obtained from the study using Puregene ^™ DNA purification kit (Gentra, Minneapolis, MN) or DNeasy® tissue kit (Qiagen, GmbH, Germany). The extracted DNA was measured using PicoGreen® (Molecular Probes, Eugene, OR) fluorescent dye that specifically quantifies only double-stranded DNA, and then stored at a concentration of 2.5-10 ng / ul suitable for genotyping. In addition, a DNA pool containing all sample DNAs of the same amount was constructed and used for validation of polymorphism.

< Example  2> Selection of Polymorphism

According to the polymorphic database (dbSNP) of the National Center for Biotechnology Information (NCBI), a total of 21 functional genetic variations exist in versican genes (Table 1). Nineteen of these are nsSNPs (non-synonymous SNPs) that change the amino acid sequence, and two are frameshift mutations. We analyzed all 21 functional genetic variants of Versican. The location of the polymorphism in Table 1 is shown as a reference sequence NC_000005, the change in amino acid sequence is shown based on NP_004376.

Genetic variation of the Versican gene Polymorphism Nucleic acid position Allele function rs36065652 40354 C> T L255F rs2652098 40490 C> T S300L rs12651836 40589 G> T G333V rs2287926 47826 G> A G428D rs11745614 48993 C> G S817C rs309559 65787 A> G K1516R rs35443373 65970 G> A S1577N rs3813671 66248 A> G T1670A rs34469464 66610..66611 -> C Frameshift rs188703 66717 G> A R1826H rs35949614 66811 G> T E1857D rs34050047 66816 C> A A1859E rs1061380 67886 A> C I2216L rs34421683 67922 A>- Frameshift rs160278 68142 T> A F2301Y rs3734094 68183 G> C V2315L rs59948995 69293 G> A V2685I rs160277 70049 G> T D2937Y rs16900532 70273 C> A N3011K rs13184139 81601 A> T D3165V rs13166485 81602 T> A D3165E

< Example  3> Genotyping ( Genotyping )

Genotypes of polymorphisms were determined by MassARRAY ^TM using MALDI-TOF mass spectrometry. The analysis was conducted using the system (Sequenom, San Diego, CA). Table 2 provides the polymerase chain reaction (PCR) primer and extension reaction primer sequences used for the analysis. Primers used for genotyping were designed using Assay Design 3.1 (Sequenom, San Diego, CA) program.

Primer Sequences for Versican Polymorphism Analysis Polymorphism Amplification_Forward Amplification Prolonged reaction rs36065652 ACGTTGGATGCCCTTCTTTTTTTTCCAGGTG (SEQ ID NO: 1) ACGTTGGATGTCACACTCTTTTGCAGCCTC (SEQ ID NO: 2) tttATTTACTGGGGACAGTGA
(SEQ ID NO: 3) rs2652098 ACGTTGGATGTTTGACCAGTGCGATTACGG (SEQ ID NO: 4) ACGTTGGATGAGTAGACCACCTCCACACTG (SEQ ID NO: 5) CGCACGCTGGCATCC
(SEQ ID NO: 6) rs12651836 ACGTTGGATGCGTTTAAAGCAGTAGGCATC (SEQ ID NO: 7) ACGTTGGATGGAGAACCCTGTATCGTTTTG (SEQ ID NO: 8) GTTTTGAGAACCAGACAG
(SEQ ID NO: 9) rs2287926 ACGTTGGATGCTGAAGCAGAAGGTGAGTAG (SEQ ID NO: 10) ACGTTGGATGAGCCACCAAATTACCCACAC (SEQ ID NO: 11) tAAATTACCCACACCTACTG
(SEQ ID NO: 12) rs11745614 ACGTTGGATGGGGCAATTTTGAAGAGGCTG (SEQ ID NO: 13) ACGTTGGATGGCCACTGTATCAAAATGGTC (SEQ ID NO: 14) CATCCAAGCCTTTAGAGT
(SEQ ID NO: 15) rs309559 ACGTTGGATGCCCATTCCATGAGGAATTTG (SEQ ID NO: 16) ACGTTGGATGTGTGCCTGATGACCAACTTC (SEQ ID NO: 17) CTGATTCTGCCCCTTTT
(SEQ ID NO: 18) rs35443373 ACGTTGGATGGCTGATGCAGAACTTGGAAC (SEQ ID NO: 19) ACGTTGGATGGCAAGGGCTACAGAAGTAAC (SEQ ID NO: 20) aATTTGGTGAAGAGGTAGAAAAAA (SEQ ID NO: 21) rs3813671 ACGTTGGATGCAATGTTCACCATGGTAACTG (SEQ ID NO: 22) ACGTTGGATGCTGTGATTATCCTGCTAGTG (SEQ ID NO: 23) TCCTGCTAGTGTCTAAAG
(SEQ ID NO: 24) rs34469464 ACGTTGGATGCACCAACACAGTCTGAAAGG (SEQ ID NO: 25) ACGTTGGATGGTCTGTGCCCCCAAATTTTC (SEQ ID NO: 26) TTGTTTCTGTAAAGACAGG
(SEQ ID NO 27) rs188703 ACGTTGGATGGAGCCCTGCTCCATAAAGAC (SEQ ID NO 28) ACGTTGGATGAGCAGTATCCATCAACCTGG (SEQ ID NO: 29) GGCTGACCACTCTCCCAC
(SEQ ID NO: 30) rs35949614 ACGTTGGATGGAAACCACCACTGTTTCTTC (SEQ ID NO: 31) ACGTTGGATGGACAAAGTGCCAGCTACTTC (SEQ ID NO: 32) TTCGGCTTGAATTGCATA
(SEQ ID NO: 33) rs34050047 ACGTTGGATGGAAACCACCACTGTTTCTTC (SEQ ID NO 34) ACGTTGGATGGACAAAGTGCCAGCTACTTC (SEQ ID NO: 35) ccGCTACTTCCTTTTCGGCTTGAATT (SEQ ID NO: 36) rs1061380 ACGTTGGATGCTTAGCTACTGCATTAGTAAC (SEQ ID NO: 37) ACGTTGGATGTTGATTGGTGAATCTGTGAC (SEQ ID NO: 38) CTACATGTTCAGCTGGTA
(SEQ ID NO: 39) rs34421683 ACGTTGGATGCCAGCTGAACATGTAGTCAC (SEQ ID NO: 40) ACGTTGGATGTGTTGGTCTCATGCCTTTCG (SEQ ID NO: 41) TGTTTTGTACTTTCTTCCTTTT
(SEQ ID NO: 42) rs160278 ACGTTGGATGGGTCCAACTTCTTTTGCCAC (SEQ ID NO: 43) ACGTTGGATGATCCCCACACTTCTCAAGTG (SEQ ID NO: 44) CTCAAGTGACAAAATTGAAGACT (SEQ ID NO: 45) rs3734094 ACGTTGGATGGTTACTGACCCACTACCTTC (SEQ ID NO: 46) ACGTTGGATGAACAGAATGGAAAATGTGGC (SEQ ID NO: 47) gggtAAAAGAAGTTGGACCACTC (SEQ ID NO 48) rs59948995 ACGTTGGATGTGCTCCTAGCACAGAAACAG (SEQ ID NO: 49) ACGTTGGATGAACTGTGGCAGACTTACGAG (SEQ ID NO: 50) TGCCGTGGGAAGTAAAA
(SEQ ID NO: 51) rs160277 ACGTTGGATGCATCTTGATTGCTTCTCCAG (SEQ ID NO: 52) ACGTTGGATGTTGCTGTGGAAGGAACTGAG (SEQ ID NO: 53) cttaTCCAAGATTTCCAAAACAAAACC (SEQ ID NO: 54) rs16900532 ACGTTGGATGGATGCTGCTATCGTGGAATC (SEQ ID NO: 55) ACGTTGGATGCACGCTTTCTTCTTCTCCAG (SEQ ID NO: 56) cactCTTTCTTCTTCTCCAGAAATAAA (SEQ ID NO: 57) rs13184139 ACGTTGGATGGCGTTTAATAAGCTCCTGCC (SEQ ID NO 58) ACGTTGGATGAGCACTGCCCTTGGAATTTG (SEQ ID NO: 59) AGTCACATGTCTCGGTA
(SEQ ID NO: 60) rs13166485 ACGTTGGATGGCGTTTAATAAGCTCCTGCC (SEQ ID NO: 61) ACGTTGGATGAGCACTGCCCTTGGAATTTG (SEQ ID NO: 62) TAGTCACATGTCTCGGT
(SEQ ID NO: 63)

PCR reactions were performed in a 5 ul solution in which 200 nM of the above PCR primers were added to 2.5 ng genomic DNA, 1 × buffer, 1 mM MgCl ₂ , 200 uM dNTP mixture, and 0.1 unit HotStart Taq polymerase mixture. The reaction conditions consist of a final extension step of 72 ° C. 3 minutes after a cycle of 94 ° C. 15 minutes initial denaturation, followed by a cycle of 94 ° C. 20 seconds, 56 ° C. 30 seconds, and 72 ° C. for 1 minute. After the PCR reaction, 0.3 unit of SAP (shrimp alkaline phosphatase) was added and incubated at 37 ° C. for 20 minutes and 85 ° C. for 5 minutes to remove residual dNTP. The hME extension reaction was performed by adding 50 uM d / ddNTP terminator mix, 600 nM extension primer, and 0.576 unit thermo sequenase enzyme to the reaction product. After performing initial denaturation at 94 ° C. for 2 minutes, a short cycle of 94 ° C. 5 seconds, 52 ° C. 5 seconds, and 72 ° C. 5 seconds is repeated 40 times. After addition of 16 ul of distilled water and 3 mg of Clean Resin, the final reaction product was transferred to SpectroChip (Sequenom, San Diego, CA) and genotyped with an Analyzer Compact mass spectrometer.

< Example  4> Polymorphism Verification ( Validation )

First, in order to verify the polymorphism of 21 functional mutations of the versican gene, the allele frequency of each polymorphism was measured using a DNA pool. As a result, only 6 out of 21 polymorphisms showed a minor allele frequency of more than 5% (rs2652098, rs2287926, rs309559, rs188703, rs160278, rs160277). Indivudal genotyping was performed.

< Example  5> Statistical Analysis

Chi-square independence test was used to analyze the relationship between Hardy-Weinberg equilibrium (HWE) and gastric cancer susceptibility. Logistic regression analysis was used to correct for gender and age differences between the patient and control groups. All statistical analyzes were conducted using the SPSS 11.5 program.

< Example  6> Versican  Gastric cancer association of polymorphism

No significant difference was found between the predicted and observed frequencies of genotypes in all six polymorphisms (HWE P> 0.05; see Table 3). Of the six polymorphisms, rs188703 (R1826H), which changes the 1826th amino acid of the versican protein from arginine to histidine, and rs160277 (D2937Y), which changes the 2937th amino acid from aspartic acid to tyrosine, were significantly associated with gastric cancer susceptibility (P < 0.05; Table 3). Both polymorphisms were located in the GAG-β domain of the Versican protein.

 Gastric Cancer Association of Vertican Polymorphism Polymorphism Allele function Control
minor allele  frequency Stomach cancer
Relevance (P) HWE  (P) rs2652098 C> T  S300L  0.13  0.83  0.12 rs2287926 G> A  G428D  0.20  0.37  0.23 rs309559 A> G  K1516R  0.46  0.096  0.10 rs188703 G> A  R1826H  0.42 0.019  0.19 rs160278 T> A  F2301Y  0.46  0.083  0.083 rs160277 G> T  D2937Y  0.42 0.027  0.15

The A allele (H1826) of rs188703 (R1826H) showed about 20% lower gastric cancer sensitivity than the G allele (R1826) (OR = 0.79, 95% CI = 0.65-0.96, P = 0.019). The AA genotype also reduced gastric cancer susceptibility by 35% compared to GG + GA genotype (OR = 0.65, 95% CI = 0.44-0.95, P = 0.028, see Table 4). T allele (Y2937) and TT genotypes of rs160277 (D2937Y) and TT genotypes were similar to those of rs188703. The relationship between gastric cancer susceptibility of both polymorphisms was statistically significant.

< Example  7> Versican  Association of Polymorphism with Gastric Cancer Types

According to Lauren's taxonomy, gastric cancer is divided into intestinal-type and diffuse-type gastric cancer, both of which are known to be histologically and pathologically unique. Therefore, the present inventors divided the patient group into an intestinal gastric cancer group and an diffuse gastric cancer group to analyze the relationship between gastric cancer susceptibility of rs188703 (R1826H) and rs160277 (D2937Y) (Table 4).

 Association between intestinal gastric and diffuse gastric cancer and versican polymorphism Allele, genotype Control Stomach cancer patient group Intestinal gastric cancer Industrial Gastric Cancer N = 406 N = 430 OR (95% CI) P N = 178 OR (95% CI) P N = 252 OR (95% CI) P rs188703 (R1826H) G (R) 468 (0.58) 545 (0.64) One 230 (0.65) One 315 (0.63) One A (H) 340 (0.42) 313 (0.36) 0.79
(0.65-0.96) 0.019 126 (0.35) 0.75
(0.58-0.98) 0.032 187 (0.37) 0.82
(0.65-1.03) 0.083 GG + GA 326 (0.81) 373 (0.87) One 160 (0.90) One 213 (0.85) One AA 78 (0.19) 56 (0.13) 0.65
(0.44-0.95) 0.028 18 (0.10) 0.44
(0.24-0.80) 0.0075 38 (0.15) 0.76
(0.50-1.17) 0.22 rs160277 (D2937Y) G (D) 467 (0.58) 545 (0.64) One 230 (0.65) One 315 (0.63) One T (Y) 335 (0.42) 313 (0.36) 0.80
(0.66-0.98) 0.027 126 (0.35) 0.76
(0.59-0.99) 0.041 187 (0.37) 0.83
(0.66-1.04) 0.11 GG + GT 324 (0.81) 373 (0.87) One 160 (0.90) One 213 (0.85) One TT 77 (0.19) 56 (0.13) 0.64
(0.43-0.94) 0.024 18 (0.10) 0.43
(0.23-0.78) 0.0057 38 (0.15) 0.76
(0.50-1.17) 0.21

As a result, both rs188703 and rs160277 polymorphisms were found to be more significant in intestinal gastric cancer. A allele of rs188703 and T allele of rs160277 reduced the susceptibility of enteric gastric cancer by about 25% (rs188703, OR = 0.75, 95% CI = 0.58-0.98, P = 0.032; rs160277, OR = 0.76, 95 % CI = 0.59-0.99, P = 0.041), AA genotype and TT genotype were found to lower intestinal gastric cancer susceptibility by more than 56% (rs188703, OR = 0.44, 95% CI = 0.24-0.80, P = 0.0075; rs160277, OR = 0.43, 95% CI = 0.23-0.78, P = 0.0057; age, gender correction).

In disseminated gastric cancer, a similar phenomenon was observed in which the frequency of A allele of rs188703 and T allele of rs160277 was reduced than that of normal group, but the difference was not significant.

< Example  8> Haplotype  analysis

The linkage disequilibrim of the two polymorphisms was analyzed using the Haploview 4.1 program, indicating a strong correlation (R ² = 0.99). The present inventors reconstructed haplotypes using the PHASE 2.1 program and analyzed the relationship between haplotypes and gastric cancer susceptibility (Table 5).

Haploid and Diploid Analysis division Control Stomach cancer patient group Intestinal gastric cancer Industrial Gastric Cancer OR  (95% CI ) P OR  (95% CI ) P OR  (95% CI ) P Haplotype 2N = 812 2N = 860 2N = 356 2N = 504 GG
(RD) 470 (0.58) 545 (0.63) One 230 (0.65) One 315 (0.63) One AT
(HY) 339 (0.42) 315 (0.37) 0.80
(0.66-0.98) 0.027 126 (0.35) 0.76
(0.59-0.98) 0.037 189 (0.38) 0.83
(0.66-1.04) 0.11 Diploid type N = 404 N = 430 N = 178 N = 252 GG / GG +
GG / AT 327 (0.81) 373 (0.87) One 160 (0.90) One 213 (0.85) One A-T / A-T 77 (0.19) 57 (0.13) 0.67
(0.45-0.98) 0.040 18 (0.10) 0.44
(0.24-0.81) 0.0079 39 (0.15) 0.79
(0.52-1.22) 0.29

Haplotypes of allele of rs188703-rs160277 with AT (H1826-Y2937) showed 20% lower gastric cancer sensitivity than GG (R1826-D2937) (OR = 0.80, 95% CI = 0.66-0.98, P = 0.027) In particular, it was confirmed that the sensitivity of intestinal gastric cancer was reduced by 24% (OR = 0.76, 95% CI = 0.59-0.98, P = 0.037). However, there was no significant difference from diffuse gastric cancer.

The age- and sex-adjusted diplotype analysis showed that A-T / A-T was significantly associated with decreased gastric cancer sensitivity (OR = 0.67, 95% CI = 0.45-0.98, P = 0.040). In particular, the sensitivity of intestinal gastric cancer was analyzed to be 56% lower (OR = 0.44, 95% CI = 0.24-0.81, P = 0.0079).

In conclusion, the haplotype (H1826-Y2937) with histidine and histidine as the 1826th amino acid of the versican protein significantly reduced the sensitivity of gastric cancer, particularly intestinal gastric cancer.

<110> Korea Advanced Institute of Science and Technology <120> Polymorphic markers of VCAN for predicting sussusceptibility to          gastric cancer and the prediction method using the same <130> 9p-03-21 <160> 65 <170> KopatentIn 1.71 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> rs36065652 forward primer <400> 1 acgttggatg cccttctttt ttttccaggt g 31 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs36065652 reverse primer <400> 2 acgttggatg tcacactctt ttgcagcctc 30 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs36065652 Ext. primer <400> 3 tttatttact ggggacagtg a 21 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs2652098 forward primer <400> 4 acgttggatg tttgaccagt gcgattacgg 30 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs2652098 reverse primer <400> 5 acgttggatg agtagaccac ctccacactg 30 <210> 6 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> rs2652098 Ext. primer <400> 6 cgcacgctgg catcc 15 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs12651836 Forward primer <400> 7 acgttggatg cgtttaaagc agtaggcatc 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs12651836 reverse primer <400> 8 acgttggatg gagaaccctg tatcgttttg 30 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs12651836 ext. primer <400> 9 gttttgagaa ccagacag 18 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs2287926 forward primer <400> 10 acgttggatg ctgaagcaga aggtgagtag 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs2287926 reverse primer <400> 11 acgttggatg agccaccaaa ttacccacac 30 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2287926 ext. primer <400> 12 taaattaccc acacctactg 20 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs11745614 forward primer <400> 13 acgttggatg gggcaatttt gaagaggctg 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs11745614 reverse primer <400> 14 acgttggatg gccactgtat caaaatggtc 30 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs11745614 ext. primer <400> 15 catccaagcc tttagagt 18 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs309559 forward primer <400> 16 acgttggatg cccattccat gaggaatttg 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs309559 reverse primer <400> 17 acgttggatg tgtgcctgat gaccaacttc 30 <210> 18 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs309559 ext. primer <400> 18 ctgattctgc ccctttt 17 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs35443373 forward primer <400> 19 acgttggatg gctgatgcag aacttggaac 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs35443373 reverse primer <400> 20 acgttggatg gcaagggcta cagaagtaac 30 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs35443373 ext. primer <400> 21 aatttggtga agaggtagaa aaaa 24 <210> 22 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> rs3813671 forward primer <400> 22 acgttggatg caatgttcac catggtaact g 31 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs3813671 reverse primer <400> 23 acgttggatg ctgtgattat cctgctagtg 30 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs3813671 ext. primer <400> 24 tcctgctagt gtctaaag 18 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs34469464 forward primer <400> 25 acgttggatg caccaacaca gtctgaaagg 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs34469464 reverse primer <400> 26 acgttggatg gtctgtgccc ccaaattttc 30 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs34469464 ect. primer <400> 27 ttgtttctgt aaagacagg 19 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs188703 forward primer <400> 28 acgttggatg gagccctgct ccataaagac 30 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs188703 reverse primer <400> 29 acgttggatg agcagtatcc atcaacctgg 30 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs188703 ext. primer <400> 30 ggctgaccac tctcccac 18 <210> 31 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs35949614 forward primer <400> 31 acgttggatg gaaaccacca ctgtttcttc 30 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs35949614 reverse primer <400> 32 acgttggatg gacaaagtgc cagctacttc 30 <210> 33 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs35949614 ext. primer <400> 33 ttcggcttga attgcata 18 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs34050047 forward primer <400> 34 acgttggatg gaaaccacca ctgtttcttc 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs34050047 reverse primer <400> 35 acgttggatg gacaaagtgc cagctacttc 30 <210> 36 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> rs34050047 ext. primer <400> 36 ccgctacttc cttttcggct tgaatt 26 <210> 37 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> rs1061380 forward primer <400> 37 acgttggatg cttagctact gcattagtaa c 31 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs1061380 reverse primer <400> 38 acgttggatg ttgattggtg aatctgtgac 30 <210> 39 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs1061380 ext. primer <400> 39 ctacatgttc agctggta 18 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs34421683 forward primer <400> 40 acgttggatg ccagctgaac atgtagtcac 30 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs34421683 reverse primer <400> 41 acgttggatg tgttggtctc atgcctttcg 30 <210> 42 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs34421683 ext. primer <400> 42 tgttttgtac tttcttcctt tt 22 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs160278 forward primer <400> 43 acgttggatg ggtccaactt cttttgccac 30 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs160278 reverse primer <400> 44 acgttggatg atccccacac ttctcaagtg 30 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs160278 ext. primer <400> 45 ctcaagtgac aaaattgaag act 23 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs3734094 forward primer <400> 46 acgttggatg gttactgacc cactaccttc 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs3734094 reverse primer <400> 47 acgttggatg aacagaatgg aaaatgtggc 30 <210> 48 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs3734094 ext. primer <400> 48 gggtaaaaga agttggacca ctc 23 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs59948995 forward primer <400> 49 acgttggatg tgctcctagc acagaaacag 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs59948995 reverse primer <400> 50 acgttggatg aactgtggca gacttacgag 30 <210> 51 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs59948995 ext. primer <400> 51 tgccgtggga agtaaaa 17 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs160277 forward primer <400> 52 acgttggatg catcttgatt gcttctccag 30 <210> 53 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs160277 reverse primer <400> 53 acgttggatg ttgctgtgga aggaactgag 30 <210> 54 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> rs160277 ext. primer <400> 54 cttatccaag atttccaaaa caaaacc 27 <210> 55 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs16900532 forward primer <400> 55 acgttggatg gatgctgcta tcgtggaatc 30 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs16900532 reverse primer <400> 56 acgttggatg cacgctttct tcttctccag 30 <210> 57 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> rs16900532 ext. primer <400> 57 cactctttct tcttctccag aaataaa 27 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs13184139 forward primer <400> 58 acgttggatg gcgtttaata agctcctgcc 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs13184139 reverse primer <400> 59 acgttggatg agcactgccc ttggaatttg 30 <210> 60 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs13184139 ext. primer <400> 60 agtcacatgt ctcggta 17 <210> 61 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs13166485 forward primer <400> 61 acgttggatg gcgtttaata agctcctgcc 30 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> rs13166485 reverse primer <400> 62 acgttggatg agcactgccc ttggaatttg 30 <210> 63 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> rs13166485 ext. primer <400> 63 tagtcacatg tctcggt 17 <210> 64 <211> 601 <212> DNA <213> Homo sapiens <220> <221> allele <222> (301) <223> R is A or G <400> 64 gtggaaaagc cccttatttc tgccccataa tttggttctc ctaatcgctc tgaaatcact 60 atttccctgg atgtttgggt tatattttca gcaactactc tgtccattac tgtactcaaa 120 accagtcctg ttggctcagt ggagaatgta gtttccacat gcggagacaa agtgccagct 180 acttcctttt cggcttgaat tgcatactct acgtttaatg aaaatgaaga aacagtggtg 240 gtttctgggt cggcagcagc ttctccagag ccctgctcca taaagacaga ggcaggacta 300 rgtgggagag tggtcagccc ttcctgaacc ccaggttgat ggatactgct gtgctcagtg 360 gtctgtgccc ccaaattttc taatgtattt gtttctgtaa agacaggagt agaatctgtc 420 atttcccttt cagactgtgt tggtgttgtc aaggacataa aacttttcct ggtacctgaa 480 tcactagatg tagctacatt tggactttct aattcaaagg gtaaaattaa ttgatccgat 540 ctctgtgtag atgaatatac ctcaaatgta gaagccgtac ctgtagttcc ctcctcctcc 600 t 601 <210> 65 <211> 601 <212> DNA <213> Homo sapiens <220> <221> allele <222> (301) <223> K is G or T <400> 65 ttctcgctgc cacttgctgt tctgatgctg ctatcgtgga atcctgccct ctgattaaag 60 ctgcttgagt ttcagggttt atttctggag aagaagaaag cgtgggcctc tcagaagtct 120 gtggacttag ccaaggcacc acacctgcct cgaccccata ggtggcagaa gcagaagtag 180 agtgtggcca ctgtgtagca ccttctaatt caatttcatc ggcagttgta ataacagttc 240 cagcctcagg tgttttaatg gtgggaaaca tcttgattgc ttctccagaa acttgaccat 300 kggttttgtt ttggaaatct tggagaatct cagttccttc cacagcaata agttctgtgg 360 gagaagcttc catttcttct aataactcag gtttaccatc atcttctgaa ggttctaatt 420 ttgtgtcagg agataaagag ggaggctcag ttatgtgaag gtattcctca cttgatggtt 480 tgaaagtcgc ttcaatattt acatgaattt ccttaaaaga atcctgtggg gacattacag 540 atgagccgac gtctattcct ggcagagcac tgggctgggg gatctctgtg tgtccagagg 600 c 601  

Claims (14)

1) a polynucleotide consisting of 20 to 100 consecutive nucleic acid molecules or complementary nucleic acid molecules having a +301 th amino acid sequence which is the polymorphic site of rs188703 (SEQ ID NO: 64) of G or A and comprising the +301 th base; or, 2) a polynucleotide consisting of 20 to 100 consecutive nucleic acid molecules or complementary nucleic acid molecules comprising a +301 th base, which is a polymorphic site of rs160277 (SEQ ID NO: 65), which is G or T, and which comprises the +301 th base; Gastric cancer susceptibility prediction kit, characterized in that it comprises a probe or primer pair that can detect the gastric cancer-related polymorphism site. The gastric cancer susceptibility prediction kit according to claim 1, wherein the gastric cancer is enteric gastric cancer. The kit for predicting gastric cancer susceptibility according to claim 1, wherein the probe is 15 to 50mers long selected from the polynucleotide to include 15 to 50 consecutive bases including the polymorphic site. The kit for predicting gastric cancer sensitivity according to claim 1, wherein the primer is 15 to 50mers long selected from the polynucleotide to include 15 to 50 consecutive bases including the polymorphic site. The method of claim 1, wherein the primer pair is Primer pair 1: forward primer set forth in SEQ ID NO: 28 and reverse primer set forth in SEQ ID NO: 29; or Primer pair 2: Gastric cancer susceptibility prediction kit comprising a forward primer set forth in SEQ ID NO: 52 and a reverse primer set forth in SEQ ID NO: 53. The method of claim 1, wherein the primer pair is composed of 15 to 50 consecutive bases comprising the polymorphic site, characterized in that it comprises at least one or more oligonucleotide having the base of the polymorphic site 3 'end Gastric cancer susceptibility prediction kit. 1) gastric cancer-related oligonucleotides consisting of 5-25 consecutive nucleic acid molecules or nucleic acid molecules complementary thereto comprising the +301 th base, which is the polymorphic site of rs188703 (SEQ ID NO: 64); or, 2) gastric cancer-related oligonucleotides consisting of 5 to 25 consecutive nucleic acid molecules or nucleic acid molecules complementary thereto comprising the +301 th base, the polymorphic site of rs160277 (SEQ ID NO: 65); Integrated microarray for gastric cancer susceptibility prediction. The gastric cancer susceptibility prediction microarray according to claim 7, wherein the gastric cancer is enteric gastric cancer. The +301 base, which is the polymorphic site of 1 rs188703 (SEQ ID NO: 64), a single nucleotide polymorphism marker in the human genome 5q14.3 region, is G; A haplotype marker for gastric cancer susceptibility prediction, characterized in that the +301 th base, which is the polymorphic site of rs160277 (base sequence 65), is G. The + 301th base, which is the polymorphic site of 1 rs188703 (SEQ ID NO: 64), a single nucleotide polymorphism marker present in the human genome 5q14.3 region, is A; A haplotype marker for gastric cancer susceptibility prediction, characterized in that the +301 th base, which is the polymorphic site of rs160277 (base sequence 65), is T. 1) separating DNA from a sample of the test subject; 2) detecting a gastric cancer-related polymorphic site of the DNA: Gastric cancer-related polynucleotide consisting of 10-100 consecutive nucleic acid molecules or complementary nucleic acid molecules thereof, wherein the +301 th amino acid sequence of the polymorphic site of rs188703 (SEQ ID NO: 64) is G or A, and the +301 th base is included; And / or Gastric cancer-related polynucleotide consisting of 10-100 consecutive nucleic acid molecules or complementary nucleic acid molecules comprising the +301 th base, which is the polymorphic site of rs160277 (SEQ ID NO: 65), is G or T, and the +301 th base 3) Genetic polymorphism detection method for gastric cancer susceptibility prediction comprising the method of detecting gastric cancer-related polymorphism gene to predict gastric cancer, comprising the step of identifying the genotype of the polymorphic site in step 2). The method of claim 11, 4) If the genotype of the polymorphic site in step 3) is AA in rs188703, it is determined that gastric cancer susceptibility is low, and if the genotype of the polymorphic site is rs160277 in TT, it is determined that the stomach cancer susceptibility is low. Genetic polymorphism detection method for gastric cancer susceptibility prediction further comprising. The method of claim 11, wherein the detection method of step 1) comprises sequencing analysis, hybridization by microarray, allele specific PCR, dynamic allele-specific hybridization method (DASH). Gene polymorphism detection for gastric cancer susceptibility prediction, characterized in that it is selected from the group consisting of PCR extension analysis, restriction fragment length polymorphism (RFLP), mass spectrometry (MALDI-TOF mass spectrometry) and TagMan technique. Way. ①1826th amino acid of the Vertican protein is histidine and 10-30 consecutive polypeptides containing the 1826th amino acid, or ②2937th amino acid is tyrosine and 2937th amino acid A biochip for gastric cancer susceptibility prediction comprising 10-30 consecutive polypeptide-specific antibodies.