KR20100018237A - Biomarkers for identification of exposure to phenanthrene and the method of identification using the same - Google Patents

Biomarkers for identification of exposure to phenanthrene and the method of identification using the same Download PDF

Info

Publication number
KR20100018237A
KR20100018237A KR1020080076917A KR20080076917A KR20100018237A KR 20100018237 A KR20100018237 A KR 20100018237A KR 1020080076917 A KR1020080076917 A KR 1020080076917A KR 20080076917 A KR20080076917 A KR 20080076917A KR 20100018237 A KR20100018237 A KR 20100018237A
Authority
KR
South Korea
Prior art keywords
gene
accession
genebank accession
genebank
accession number
Prior art date
Application number
KR1020080076917A
Other languages
Korean (ko)
Other versions
KR100994996B1 (en
Inventor
류재천
김연정
전희경
송미경
Original Assignee
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술연구원 filed Critical 한국과학기술연구원
Priority to KR20080076917A priority Critical patent/KR100994996B1/en
Priority to PCT/KR2008/005022 priority patent/WO2010016634A2/en
Publication of KR20100018237A publication Critical patent/KR20100018237A/en
Application granted granted Critical
Publication of KR100994996B1 publication Critical patent/KR100994996B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00Libraries per se, e.g. arrays, mixtures
    • C40B40/04Libraries containing only organic compounds
    • C40B40/06Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)

Abstract

PURPOSE: A biomarker for confirming phenanthrene exposure is provided to monitor and determine phenanthrene pollution and to find a toxicity mechanism. CONSTITUTION: A biomarker for confirming phenanthrene contains a gene of which an expression is increased or decreased due to exposure to phenanthrene. A DNA microarray chip for confirming phenanthrene exposure contains oligotide having an entire or partial gene sequence or its complementary oligonuecleotide. A method for detecting the biomarker for confirming phenanthrene exposure comprises: a step of isolating RNA from a test person's somatic cells as an experimental group and normal somatic cells as a control group; a step of synthesizing cDNA of the experimental group and control group and labeling with different fluorescences; a step of hybridizing the labeled cDNA on a microarray chip; a step of analyzing DNA microarray chip; and a step of comparing expression level between control group and experimental group.

Description

페난트렌 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법{Biomarkers for identification of exposure to phenanthrene and the method of identification using the same}Biomarkers for identifying phenanthrene exposure and identification method using the same {Biomarkers for identification of exposure to phenanthrene and the method of identification using the same}

본 발명은 페난트렌(phenanthrene)에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 더욱 상세하게는 다환 방향족 탄화수소류 중의 하나인 페난트렌에 의해 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 페난트렌에 대한 노출 여부를 확인하는 방법에 관한 것이다. The present invention relates to a biomarker for confirming exposure to phenanthrene and a method of identifying the same, and more particularly, to a biomarker in which gene expression is increased or decreased by phenanthrene, which is one of polycyclic aromatic hydrocarbons, and It relates to a method for checking the exposure to phenanthrene using the same.

다환 방향족 탄화수소류의 하나인 페난트렌은 광택이 나고 청색의 형광이 있는 무색의 판상(板狀) 결정으로 3개의 벤젠고리가 축합고리를 이룬 구조를 가지며, 안트라센(anthracene)과 이성질체의 관계에 있다. 1872년 독일 R. 피티히가 콜타르(coal tar) 속에서 발견하였고, 주로 석탄타르에서 얻는 안트라센유 속에 함유되어 있으며 정밀 증류로 분리한다. 페난트렌은 크롬산으로 산화하면 페난트라퀴논을 생성하며, 환원하면 각 단계의 수소화 화합물이 된다. 페난트렌은 염료, 플라 스틱, 살충제, 및 의약품의 합성원료로서 사용되었으나 상업적인 목적으로 제조 또는 사용되지 않으며, 주로 유기물 합성이나 화학적 연구목적으로 이용되고 있다.Phenanthrene, one of the polycyclic aromatic hydrocarbons, is a glossy, blue, fluorescent, colorless plate-like crystal with a structure in which three benzene rings are condensed with each other, and are related to anthracene and isomers. . It was discovered in coal tar in 1872 by R. Pitich (Germany) and is contained in anthracene oil, mainly from coal tar, separated by precision distillation. When phenanthrene is oxidized to chromic acid, phenanthrene is produced, and when it is reduced, it becomes a hydrogenated compound in each step. Phenanthrene has been used as a synthetic raw material for dyes, plastics, insecticides, and pharmaceuticals, but is not manufactured or used for commercial purposes. It is mainly used for organic synthesis or chemical research.

환경 중 페난트렌의 노출 정도를 살펴보면, 산업장 연돌 가스의 방향족 탄화수소류(PAHs) 분포 조사 연구에서 배출이 예상되는 주요시설을 선정하여 조사한 결과, 용선로에서는 페난트렌이 1.2 ppb가 검출되었으며, 보일러에서도 페난트렌이 검출되는 것으로 조사되었다(환경연구원보, 1996). 또한, 국내 도시 대기에서의 PAH 농도 조사에서는 서울 주택가에서 0.31 ng/m3, 대전 태평동에서 0.36 ng/m3로 검출되었다(환경부, 1997). 국외의 연구에 의하면, 도시대기 중의 PAH 농도조사에서 페난트렌이 미국의 뉴욕에서 0.4 ng/m3(1974년), 일본 오사카에서 100 ng/m3(1977~1978년), 프랑스 파리에서 28 ng/m3(1981~1982)으로 나타났다(Edoardo, The Science of the Total Environment, 116:119~135, 1992).In terms of the exposure level of phenanthrene in the environment, 1.2 ppb of phenanthrene was detected in the molten iron in a survey of major facilities expected to be released in the research on the distribution of aromatic hydrocarbons (PAHs) in industrial flue gas. Phenanthrene was also detected in the study (Environmental Research Institute, 1996). In addition, the concentration of PAH in the urban atmosphere of Korea was 0.31 ng / m 3 in Seoul residential area and 0.36 ng / m 3 in Taepyeong-dong, Daejeon (Ministry of Environment, 1997). International studies have shown that phenanthrene was found to be 0.4 ng / m 3 (1974) in New York, 100 ng / m 3 ( 1977-1978) in Osaka, Japan, and 28 ng in Paris, France. / m 3 (1981-1982) (Edoardo, The Science of the Total Environment , 116: 119-135, 1992).

페난트렌의 대사는 에폭시화 반응(epoxidation)을 거쳐 페난트렌-9,10-옥사이드(phenanthrene-9,10-oxide)와 페난트렌-1,2-다이올-3,4-에폭사이드(phenanthrene-1,2-diol-3,4-epoxide)를 생성하는 것으로 보고되고 있다. 페난트렌은 피부에 민감하며 피부염, 기관지염, 기침, 호흡곤란, 기관지 종양, 신장 종양 등의 인체 유해성을 가지고 있으며, UN 기구인 국제 암연구소(IARC)의 발암성에 따른 분류에 의하면 그룹 3(Group 3)으로 인체 비발암성물질(사람에 대해 발암성이 있다고 분류할 수 없는 화학물질)로 구분하고 있다.Metabolism of phenanthrene is through epoxidation and phenanthrene-9,10-oxide and phenanthrene-1,2-diol-3,4-epoxide. 1,2-diol-3,4-epoxide). Phenanthrene is sensitive to the skin and has human health hazards such as dermatitis, bronchitis, cough, dyspnea, bronchial tumors, and kidney tumors. ) Are classified as non-carcinogenic substances (chemicals that cannot be classified as carcinogenic to humans).

다환방향족 탄화수소류의 발암성 정도와 유전자 발현 변화에 대한 연구는 일 부 보고되고 있지만, 대표적인 다환방향족 탄화수소류로 알려진 벤조에이파이렌(Benzo[a]pyrene)에 대한 연구에 거의 국한되어 있다. 이처럼 페난트렌의 인간에 대한 발암 가능성에도 불구하고 인체에서의 위해도 평가 데이터가 충분하지 않고, 노출에 대한 검색 방법 역시 GC-MS(Gas Chromatography-Mass Spectrometer) 또는 HPLC(High Performance Liquid Chromatography) 등의 고전적인 방법에 국한되어 있다. GC-MS 또는 HPLC 방법 등을 이용하면 정량은 가능하나 분석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 보다 빠르고 간편한스크리닝(screening) 방법, 예를 들면 프라이머(primer)를 이용하는 실시간 PCR(Real-time reverse transcript polymerase chain reaction)또는 DNA 마이크로어레이 칩 등으로 신속한 위해성 평가를 통해 인체에서의 독성작용을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 페난트렌의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다.Although some studies on the degree of carcinogenicity and gene expression of polyaromatic hydrocarbons have been reported, they are almost limited to studies on Benzo [a] pyrene, which is known as a representative polycyclic aromatic hydrocarbons. Despite the possibility of phenanthrene carcinogenesis in humans, there is not enough risk assessment data in humans, and the detection method for exposure is also known as Gas Chromatography-Mass Spectrometer (GC-MS) or High Performance Liquid Chromatography (HPLC). It is limited to the classical method. Quantification is possible using GC-MS or HPLC methods, but appropriate conditions for analysis are required and expensive equipment is required. Therefore, faster and easier screening methods, such as real-time reverse transcript polymerase chain reaction (PCR) or DNA microarray chips using primers, can be used to detect toxic effects in humans through rapid risk assessment. It is an important task to identify and utilize the molecular indicators that can be used to implement appropriate measures and management for phenanthrene exposure.

포유류 6종, 미생물 292종 등 여러 종의 게놈(genome) 염기서열 프로젝트가 완성되어 NCBI(National Center for Biotechnology Information)에 보고되었다. 이렇게 얻어진 막대한 양의 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 한번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 DNA 마이크로어레이(microarray) 분석을 수행한다(Schena, M., et al., Proc . Natl . Acad . Sci . USA 93:10614-10619, 1996). Several genome sequencing projects, including six mammals and 292 microbes, have been completed and reported to the National Center for Biotechnology Information (NCBI). Genome-wide expression studies are being conducted to study the function of genes based on the vast amount of data obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment (Schena, M., et al. , Proc . Natl . Acad . Sci . USA) . 93: 10614-10619, 1996).

마이크로어레이는 cDNA(complementary DNA)나 20 ~ 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 Agilent, Genomic Solutions 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화 하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(Sellheyer K. et. al., J. Am . Acad . Dermatol. 51:681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 Affymetrix사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어 지고 있으며, Agillent사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(Sellheyer, K. et. al., J. Am . Acad . Dermatol. 51:681-692, 2004).Microarrays integrate cDNA (complementary DNA) or sets of oligonucleotides 20 to 25 base pairs in length on glass. cDNA microarrays are produced by labs in schools or companies such as Agilent, Genomic Solutions, etc., by mechanically immobilizing cDNA collections on chips or by using ink jetting (Sellheyer K. et. al., J. Am). . Acad Dermatol 51:.. 681-692 , 2004). Oligonucleotide microarrays are made by Affymetrix by direct synthesis on a chip using photolithography, and Agillent et al. Are produced by immobilizing synthesized oligonucleotides (Sellheyer, K.). et. al., J. Am . Acad . Dermatol . 51: 681-692, 2004).

유전자의 발현을 분석을 위해서는 조직 등 시료에서 RNA를 얻어 DNA 마이크로어레이에 있는 올리고뉴클레오티드와 교잡반응을 수행한다. 얻어진 RNA는 형광이나 동위원소로 표지화하며 cDNA로 전환시킨다. 올리고 마이크로어레이는 주로 두개의 다른 형광(예: Cye3 및 Cye5)으로 대조군과 실험군을 각각 표지화하여 같은 칩 상에서 동시에 교잡 반응을 수행한 후 광학적으로 이미지를 스캔하여 형광의 세기를 얻고 그 결과를 분석한다. 두 개의 형광 세기의 비율에 따라 유전자의 발현 여부를 결정한다(Somasundaram, K. et al., Genomics Proteomics I:1-10, 2002).To analyze gene expression, RNA is obtained from samples such as tissues and hybridized with oligonucleotides in DNA microarrays. The resulting RNA is labeled with fluorescence or isotope and converted to cDNA. Oligo microarrays are mainly labeled with two different fluorescences (eg, Cye3 and Cye5) to perform hybridization reactions on the same chip at the same time. . Gene expression is determined by the ratio of the two fluorescence intensities (Somasundaram, K. et al. , Genomics Proteomics I: 1-10, 2002).

최근 DNA 마크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신 의약 후보물질은 물론 대표적인 환경오염물질을 비롯해 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 유전자들의 발현 패턴의 분석, 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 유전자의 발현 빈도를 분석함으로써 약물의 부작용 및 환경오염물질의 유해작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 환경오염물질의 유해작용과 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색 및 확인이 가능하게 될 것이다. In combination with recent research on toxic genomics (Toxicogenomics), an advanced technique using DNA macroarray technology, high-throughput expression in specific tissues or cell lines by all chemicals, including pharmaceuticals and new drug candidates, as well as representative environmental pollutants Analysis and quantitative analysis of expression patterns of genes are now possible. Accordingly, by analyzing the frequency of expression of specific genes in specific cells, it is possible to discover genes related to adverse effects of drugs and harmful effects of environmental pollutants, and through this, molecules according to the harmful effects of environmental pollutants, drugs, and side effects. It will be possible to understand the mechanisms and further search and identify substances that cause toxicity and side effects.

이에, 본 발명자들은 인간 유전자 4만 4천개가 집적된 올리고마이크로어레이를 이용하여 페난트렌의 유전자 발현 프로파일을 인간 간암 세포인 HepG2 세포주에서 관찰 및 분석함으로써 페난트렌에 의해 과발현 또는 저발현 되는 유전자를 발굴하고, 실시간(real-time) RT-PCR 방법에 의해 상기 유전자들의 발현 양상을 확인함으로써 페난트렌을 검출할 수 있는 바이오마커 및 이를 이용한 노출 여부를 확인하는 방법을 확립하여 본 발명을 완성하였다.Accordingly, the present inventors have discovered and analyzed gene expression profiles of phenanthrene in HepG2 cell line, which is human liver cancer cells, using oligomicroarrays in which 44,000 human genes were accumulated, thereby discovering genes overexpressed or underexpressed by phenanthrene. The present invention was completed by establishing a biomarker capable of detecting phenanthrene and an exposure method using the same by confirming expression of the genes by real-time RT-PCR method.

본 발명의 목적은 페난트렌의 노출에 의해 과발현 또는 저발현되는 바이오마커 및 상기 바이오마커를 이용한 페난트렌에 대한 노출 여부를 확인하는 방법을 제공하는 것이다.It is an object of the present invention to provide a biomarker that is overexpressed or underexpressed by exposure of phenanthrene and a method for identifying exposure to phenanthrene using the biomarker.

상기 목적을 달성하기 위하여, 본 발명은 페난트렌(phenanthrene)의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 페난트렌에 대한 노출 여부 확인용 바이오마커를 제공한다.In order to achieve the above object, the present invention provides a biomarker for confirming the exposure to phenanthrene, characterized in that the expression changes by the exposure of phenanthrene (phenanthrene).

또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 이의 상보적인 올리고뉴클레오티드가 집적된 페난트렌 노출 여부 확인용 DNA 마이크로어레이 칩을 제공한다.In addition, the present invention provides a DNA microarray chip for confirming whether phenanthrene is exposed to an oligonucleotide including all or a part of the biomarker gene sequence or its complementary oligonucleotide.

또한, 본 발명은 상기 바이오마커를 이용한 페난트렌에 대한 노출 여부를 확인하기 위해 상기 바이오마커를 검출하는 방법을 제공한다.In addition, the present invention provides a method for detecting the biomarker to determine whether the biomarker is exposed to phenanthrene.

아울러, 본 발명은 페난트렌에 대한 노출 여부 확인용 검색 키트를 제공한다.In addition, the present invention provides a search kit for confirming exposure to phenanthrene.

본 발명의 페난트렌에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확 인방법은 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 페난트렌의 모니터링 및 위해성을 판정하는데 유용하며, 페난트렌에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있다.The biomarker for confirming the exposure to phenanthrene of the present invention and a method of confirming the same using the same are useful for determining phenanthrene's monitoring and risk by using reaction genes selected through DNA microarray chips as biomarkers. It can be used as a tool to identify the mechanism of toxic effects caused by.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 페난트렌의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 페난트렌에 대한 노출 여부 확인용 바이오마커를 제공한다.The present invention provides a biomarker for confirming exposure to phenanthrene, which is characterized by causing a change in expression by exposure of phenanthrene.

상기 바이오마커는 2배 이상 발현이 증가 또는 감소한 유전자로써, MAPKinase 신호 경로(MAPKinase Signaling Pathway), MAPKKK 캐스케이드(MAPKKK cascade), 아팝토시스(apoptosis), 유사분열 세포주기(Mitotic cell cycle), 세포 주기(cell cycle), 세포 분화(Cell differentiation), 세포 운동성(Cell motility), 세포 골격(Cytoskeleton), 형태 발생(Morphogenesis), DNA 손상 반응(response to DNA damage stimulus), 화학자극에 대한 반응(Response to chemical stimulus), 외부자극에 대한 반응(Response to external stimulus), 스트레스에 대한 반응(Response to stress), 면역반응(immune response), 사이토크롬 p450에 의한 대사(Metabolism of xenobiotics by cytochrome p450), 알코올 대사(Alcohol metabolism), 지질 대사(lipid metabolism), 인산염 대사(Phosphate metabolism), DNA 대사(DNA metabolism), 금속원소 결합(metal binding) 또는 전 달(Transport) 등의 관련 유전자로 구성되어 있다.The biomarker is a gene whose expression is increased or decreased more than two times, and includes MAPKinase Signaling Pathway, MAPKKK cascade, apoptosis, Mitotic cell cycle, and cell cycle. cell cycle, cell differentiation, cell motility, cytoskeleton, morphogenesis, response to DNA damage stimulus, response to chemical stimulation chemical stimulus, Response to external stimulus, Response to stress, immune response, Metabolism of xenobiotics by cytochrome p450, alcohol metabolism (Alcohol metabolism), lipid metabolism, phosphate metabolism (Phosphate metabolism), DNA metabolism (DNA metabolism), metal binding or transport (transport) related genes All.

본 발명은 하기와 같이 구성된 군에서 선택되어지는 것을 특징으로 하는 바이오마커를 제공한다: The present invention provides a biomarker which is selected from the group consisting of:

유전자 등록번호(GeneBank accession No.) NM_004420(DUSP8, Dual specificity phosphatase 8), 유전자 등록번호(GeneBank accession No.) L11329(DUSP2, Dual specificity phosphatase 2), 유전자 등록번호(GeneBank accession No.) BC094766(PKN1, Protein kinase N1), 유전자 등록번호(GeneBank accession No.) AY247738(TRIB3, Tribbles homolog 3(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(GeneBank accession No.) AB208849(SHC1, SHC(Src homology 2 domain containing) transforming protein 1), 유전자 등록번호(GeneBank accession No.) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)),유전자 등록번호(GeneBank accession No.) NM_198951(TGM2, Transglutaminase 2(C polypeptide, protein-glutamine-gamma-glutamyltransferase)), 유전자 등록번호(GeneBank accession No.) NM_147780(CTSB, Cathepsin B), 유전자 등록번호(GeneBank accession No.) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(GeneBank accession No.) NM_033027(AXUD1, AXIN1 up-regulated 1), 유전자 등록번호(GeneBank accession No.) NM_032797(AMID, Apoptosis-inducing factor(AIF)-like mitochondrion-associated inducer of death), 유전자 등록번호(GeneBank accession No.) NM_021960(MCL1, Myeloid cell leukemia sequence 1(BCL2-related)), 유전자 등록번호(GeneBank accession No.) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(GeneBank accession No.) NM_016222(DDX41, DEAD(Asp-Glu-Ala-Asp) box polypeptide 41), 유전자 등록번호(GeneBank accession No.) NM_013246(CLC, Cardiotrophin-like cytokine factor 1), 유전자 등록번호(GeneBank accession No.) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004281(BAG3, BCL2-associated athanogene 3), 유전자 등록번호(GeneBank accession No.) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(GeneBank accession No.) NM_003806(HRK, Harakiri, BCL2 interacting protein(contains only BH3 domain)), 유전자 등록번호(GeneBank accession No.) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(GeneBank accession No.) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(GeneBank accession No.) NM_002737(PRKCA, Protein kinase C, alpha), 유전자 등록번호(GeneBank accession No.) NM_002648(PIM1, Pim-1 oncogene), 유전자 등록번호(GeneBank accession No.) NM_002507(NGFR, Nerve growth factor receptor(TNFR superfamily, member 16)), 유전자 등록번호(GeneBank accession No.) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(GeneBank accession No.) NM_001013398(IGFBP3, Insulin-like growth factor binding protein 3), 유전자 등록번호(GeneBank accession No.) BX640923(MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein(mouse)), 유전자 등록번호(GeneBank accession No.) BX537586(STK17A, Serine/threonine kinase 17a(apoptosis-inducing)), 유전자 등록번호(GeneBank accession No.) BG284742(P8, P8 protein(candidate of metastasis 1)), 유전자 등록번호(GeneBank accession No.) BE903247(PDCD6IP, Programmed cell death 6 interacting protein), 유전자 등록번호(GeneBank accession No.) BC027949(P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), 유전자 등록번호(GeneBank accession No.) BC006365(PSEN2, Presenilin 2(Alzheimer disease 4)), 유전자 등록번호(GeneBank accession No.) AY869712(PPP1R13L, Protein phosphatase 1, regulatory(inhibitor) subunit 13 like), 유전자 등록번호(GeneBank accession No.) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(GeneBank accession No.) AK122614(PPARD, Peroxisome proliferative activated receptor, delta), 유전자 등록번호(GeneBank accession No.) AK092872(ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2(xeroderma pigmentosum D)), 유전자 등록번호(GeneBank accession No.) AK092808(RRAGC, Ras-related GTP binding C), 유전자 등록번호(GeneBank accession No.) AJ001898(GDNF, Glial cell derived neurotrophic factor), 유전자 등록번호(GeneBank accession No.) AF220656(PHLDA1, Pleckstrin homology-like domain, family A, member 1), 유전자 등록번호(GeneBank accession No.) AF055634(UNC5C, Unc-5 homolog C(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB209485(VEGF, Vascular endothelial growth factor), 유전자 등록번호(GeneBank accession No.) AB096256(UNC5B, Unc-5 homolog B(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB007960(SH3GLB1, SH3-domain GRB2-like endophilin B1), 유전자 등록번호(GeneBank accession No.) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(GeneBank accession No.) S62138(DDIT3, DNA-damage-inducible transcript 3), 유전자 등록번호(GeneBank accession No.) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(GeneBank accession No.) NM_005883(APC2, Adenomatosis polyposis coli 2), 유전자 등록번호(GeneBank accession No.) NM_004196(CDKL1, Cyclin-dependent kinase-like 1(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_003236(TGFA, Transforming growth factor, alpha), 유전자 등록번호(GeneBank accession No.) NM_001261(CDK9, Cyclin-dependent kinase 9(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(GeneBank accession No.) CR749511(PARC, P53-associated parkin-like cytoplasmic protein), 유전자 등록번 호(GeneBank accession No.) CR623038(ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(GeneBank accession No.) CR618371(EGFR, Epidermal growth factor receptor(erythroblastic leukemia viral(v-erb-b) oncogene homolog, avian)), 유전자 등록번호(GeneBank accession No.) BF965144(IFITM1, Interferon induced transmembrane protein 1(9-27)), 유전자 등록번호(GeneBank accession No.) AK127679(DUSP1, Dual specificity phosphatase 1), 유전자 등록번호(GeneBank accession No.) AK096276(CCND3, Cyclin D3), 유전자 등록번호(GeneBank accession No.) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(GeneBank accession No.) AB209465(PCTK1, PCTAIRE protein kinase 1), 유전자 등록번호(GeneBank accession No.) Z19588(SKIL, SKI-like), 유전자 등록번호(GeneBank accession No.) NM_020429(SMURF1, SMAD specific E3 ubiquitin protein ligase 1), 유전자 등록번호(GeneBank accession No.) NM_014767(SPOCK2, Sparc/osteonectin, cwcv and kazal-like domains proteoglycan(testican) 2), 유전자 등록번호(GeneBank accession No.) NM_005979(S100A13, S100 calcium binding protein A13), 유전자 등록번호(GeneBank accession No.) NM_005187(CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), 유전자 등록번호(GeneBank accession No.) NM_004364(CEBPA, CCAAT/enhancer binding protein(C/EBP), alpha), 유전자 등록번호(GeneBank accession No.) NM_001769(CD9, CD9 antigen(p24)), 유전자 등록번호(GeneBank accession No.) NM_001718(BMP6, Bone morphogenetic protein 6), 유전자 등록번호(GeneBank accession No.) NM_000641(IL11, Interleukin 11), 유전자 등록번호(GeneBank accession No.) BX647459(SERPINE2, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 2), 유전자 등록번호(GeneBank accession No.) BQ066037(RPS19, Ribosomal protein S19), 유전자 등록번호(GeneBank accession No.) BE791300(EDF1, Endothelial differentiation-related factor 1), 유전자 등록번호(GeneBank accession No.) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(GeneBank accession No.) AL832287(ZAP70, Zeta-chain(TCR) associated protein kinase 70kDa), 유전자 등록번호(GeneBank accession No.) AK125742(PCGF1, Polycomb group ring finger 1), 유전자 등록번호(GeneBank accession No.) AK124709(NDRG1, N-myc downstream regulated gene 1), 유전자 등록번호(GeneBank accession No.) AB011157(PTDSR, Phosphatidylserine receptor), 유전자 등록번호(GeneBank accession No.) NM_013255(MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), 유전자 등록번호(GeneBank accession No.) NM_006572(GNA13, Guanine nucleotide binding protein(G protein), alpha 13), 유전자 등록번호(GeneBank accession No.) NM_002211(ITGB1, Integrin, beta 1(fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), 유전자 등록번호(GeneBank accession No.) CR601067(PLAUR, Plasminogen activator, urokinase receptor), 유전자 등록번호(GeneBank accession No.) BC050456(THBS4, Thrombospondin 4), 유전자 등록번 호(GeneBank accession No.) AK027389(CXCL16, Chemokine(C-X-C motif) ligand 16), 유전자 등록번호(GeneBank accession No.) AJ132099(VNN1, Vanin 1), 유전자 등록번호(GeneBank accession No.) XM_371354(FLJ10157, Hypothetical protein FLJ10157), 유전자 등록번호(GeneBank accession No.) XM_208313(TPM3, Similar to tropomyosin 4), 유전자 등록번호(GeneBank accession No.) XM_208270(ACR, Acrosin-like protease), 유전자 등록번호(GeneBank accession No.) NM_203353(PDLIM7, PDZ and LIM domain 7(enigma)), 유전자 등록번호(GeneBank accession No.) NM_201382(PLEC1, Plectin 1, intermediate filament binding protein 500kDa), 유전자 등록번호(GeneBank accession No.) NM_182961(SYNE1, Spectrin repeat containing, nuclear envelope 1), 유전자 등록번호(GeneBank accession No.) NM_181826(NF2, Neurofibromin 2(bilateral acoustic neuroma)), 유전자 등록번호(GeneBank accession No.) NM_172069(PLEKHH2, Pleckstrin homology domain containing, family H(with MyTH4 domain) member 2), 유전자 등록번호(GeneBank accession No.) NM_022648(TNS, Tensin 1), 유전자 등록번호(GeneBank accession No.) NM_017556(FBLP-1, Filamin binding LIM protein 1), 유전자 등록번호(GeneBank accession No.) NM_016081(KIAA0992, Palladin, cytoskeletal associated protein), 유전자 등록번호(GeneBank accession No.) NM_006617(NES, Nestin), 유전자 등록번호(GeneBank accession No.) NM_006262(PRPH, Peripherin), 유전자 등록번호(GeneBank accession No.) NM_005100(AKAP12, A kinase(PRKA) anchor protein(gravin) 12), 유전자 등록번 호(GeneBank accession No.) NM_004368(CNN2, Calponin 2), 유전자 등록번호(GeneBank accession No.) NM_003388(CYLN2, Cytoplasmic linker 2), 유전자 등록번호(GeneBank accession No.) NM_003370(VASP, Vasodilator-stimulated phosphoprotein), 유전자 등록번호(GeneBank accession No.) NM_003128(SPTBN1, Spectrin, beta, non-erythrocytic 1), 유전자 등록번호(GeneBank accession No.) NM_002705(PPL, Periplakin), 유전자 등록번호(GeneBank accession No.) NM_002475(MLC1SA, Myosin light chain 1 slow a), 유전자 등록번호(GeneBank accession No.) NM_002018(FLII, Flightless I homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_001465(FYB, FYN binding protein(FYB-120/130)), 유전자 등록번호(GeneBank accession No.) NM_001069(TUBB2, Tubulin, beta 2A), 유전자 등록번호(GeneBank accession No.) CR625172(MGC8685, Tubulin, beta 2B), 유전자 등록번호(GeneBank accession No.) CR616919(KRT18, Keratin 18), 유전자 등록번호(GeneBank accession No.) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(GeneBank accession No.) CB240572(MYH11, Myosin, heavy polypeptide 11, smooth muscle), 유전자 등록번호(GeneBank accession No.) BX648253(PTPN3, Protein tyrosine phosphatase, non-receptor type 3), 유전자 등록번호(GeneBank accession No.) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(GeneBank accession No.) BX641076(ACTN1, Actinin, alpha 1), 유전자 등록번호(GeneBank accession No.) BX537978(EPB41L1, Erythrocyte membrane protein band 4.1-like 1), 유전자 등록번호(GeneBank accession No.) BG121847(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(GeneBank accession No.) BC068013(MYO1C, Myosin IC), 유전자 등록번호(GeneBank accession No.) BC065499(MAST2, Microtubule associated serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) BC051890(TUBG2, Tubulin, gamma 2), 유전자 등록번호(GeneBank accession No.) BC041874(MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), 유전자 등록번호(GeneBank accession No.) BC012597(ACTA1, Actin, alpha 1, skeletal muscle), 유전자 등록번호(GeneBank accession No.) AY484427(KIF17, Kinesin family member 17), 유전자 등록번호(GeneBank accession No.) AK130546(STOML2, Stomatin(EPB72)-like 2), 유전자 등록번호(GeneBank accession No.) AK124711(CORO2B, Coronin, actin binding protein, 2B), 유전자 등록번호(GeneBank accession No.) AK123974(MYL5, Myosin, light polypeptide 5, regulatory), 유전자 등록번호(GeneBank accession No.) AK092792(LOC389833, Similar to hypothetical protein MGC27019), 유전자 등록번호(GeneBank accession No.) AK026518(MYOHD1, Myosin head domain containing 1), 유전자 등록번호(GeneBank accession No.) AK024500(NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), 유전자 등록번호(GeneBank accession No.) AF085886(FLJ46675, Ribosomal protein L29 pseudogene 2), 유전자 등록번호(GeneBank accession No.) AB209997(MYO9B, Myosin IXB), 유전자 등록번호(GeneBank accession No.) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(GeneBank accession No.) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(GeneBank accession No.) X17033(ITGA2, Integrin, alpha 2(CD49B, alpha 2 subunit of VLA-2 receptor)), 유전자 등록번호(GeneBank accession No.) U41763(CLTCL1, Clathrin, heavy polypeptide-like 1), 유전자 등록번호(GeneBank accession No.) NM_153609(TMPRSS6, Transmembrane protease, serine 6), 유전자 등록번호(GeneBank accession No.) NM_031483(ITCH, Itchy homolog E3 ubiquitin protein ligase(mouse)), 유전자 등록번호(GeneBank accession No.) NM_024342(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(GeneBank accession No.) NM_017555(EGLN2, Egl nine homolog 2(C. elegans)), 유전자 등록번호(GeneBank accession No.) NM_016569(TBX3, T-box 3(ulnar mammary syndrome)), 유전자 등록번호(GeneBank accession No.) NM_004148(NINJ1, Ninjurin 1), 유전자 등록번호(GeneBank accession No.) NM_003377(VEGFB, Vascular endothelial growth factor B), 유전자 등록번호(GeneBank accession No.) NM_001983(ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1(includes overlapping antisense sequence)), 유전자 등록번호(GeneBank accession No.) NM_001552(IGFBP4, Insulin-like growth factor binding protein 4), 유전자 등록번호(GeneBank accession No.) NM_001430(EPAS1, Endothelial PAS domain protein 1), 유전자 등록번호(GeneBank accession No.) NM_001300(KLF6, Kruppel-like factor 6), 유전자 등록번호(GeneBank accession No.) NM_001012661(SLC3A2, Solute carrier family 3(activators of dibasic and neutral amino acid transport), member 2), 유전자 등록번호(GeneBank accession No.) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(GeneBank accession No.) NM_000474(TWIST1, Twist homolog 1(acrocephalosyndactyly 3; Saethre-Chotzen syndrome)(Drosophila)), 유전자 등록번호(GeneBank accession No.) BX649103(ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), 유전자 등록번호(GeneBank accession No.) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(GeneBank accession No.) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(GeneBank accession No.) BM556279(EMP3, Epithelial membrane protein 3), 유전자 등록번호(GeneBank accession No.) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(GeneBank accession No.) AY258066(OKL38, Pregnancy-induced growth inhibitor), 유전자 등록번호(GeneBank accession No.) AK126729(NDRG4, NDRG family member 4), 유전자 등록번호(GeneBank accession No.) AK090459(NFE2L1, Nuclear factor(erythroid-derived 2)-like 1), 유전자 등록번호(GeneBank accession No.) AK074163(ROBO4, Roundabout homolog 4, magic roundabout(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK024680(FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), 유전자 등록번호(GeneBank accession No.) AF176422(HEY1, Hairy/enhancer-of-split related with YRPW motif 1), 유전자 등록번호(GeneBank accession No.) AF003837(JAG1, Jagged 1(Alagille syndrome)), 유전자 등록번호(GeneBank accession No.) AB209322(SEMA3B, Sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3B), 유전자 등록번호(GeneBank accession No.) AB011150(NRXN1, Neurexin 1), 유전자 등록번호(GeneBank accession No.) NM_201589(MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A(avian)), 유전자 등록번호(GeneBank accession No.) NM_052999(CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), 유전자 등록번호(GeneBank accession No.) NM_006644(HSPH1, Heat shock 105kDa/110kDa protein 1), 유전자 등록번호(GeneBank accession No.) NM_005438(FOSL1, FOS-like antigen 1), 유전자 등록번호(GeneBank accession No.) NM_004996(ABCC1, ATP-binding cassette, sub-family C(CFTR/MRP), member 1), 유전자 등록번호(GeneBank accession No.) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(GeneBank accession No.) NM_001353(AKR1C1, Aldo-keto reductase family 1, member C1(dihydrodiol dehydrogenase 1; 20-alpha(3-alpha)-hydroxysteroid dehydrogenase)), 유전자 등록번호(GeneBank accession No.) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) DR004094(HAMP, Hepcidin antimicrobial peptide), 유전자 등록번호(GeneBank accession No.) BC082272(KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), 유전자 등록번호(GeneBank accession No.) BC040494(DNAJB2, DnaJ(Hsp40) homolog, subfamily B, member 2), 유전자 등록번 호(GeneBank accession No.) BC018064(ATF6, Activating transcription factor 6), 유전자 등록번호(GeneBank accession No.) BC006523(SGK2, Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(GeneBank accession No.) AK090482(CXCL12, Chemokine(C-X-C motif) ligand 12(stromal cell-derived factor 1)), 유전자 등록번호(GeneBank accession No.) AF219946(TULP4, Tubby like protein 4), 유전자 등록번호(GeneBank accession No.) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(GeneBank accession No.) NM_005242(F2RL1, Coagulation factor II(thrombin) receptor-like 1), 유전자 등록번호(GeneBank accession No.) NM_001002029(C4A, Complement component 4B, telomeric), 유전자 등록번호(GeneBank accession No.) NM_000539(RHO, Rhodopsin(opsin 2, rod pigment)(retinitis pigmentosa 4, autosomal dominant)), 유전자 등록번호(GeneBank accession No.) BX649164(PAI, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(GeneBank accession No.) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(GeneBank accession No.) AB209647(NCF2, Neutrophil cytosolic factor 2(65kDa, chronic granulomatous disease, autosomal 2)), 유전자 등록번호(GeneBank accession No.) NM_152221(CSNK1E, Casein kinase 1, epsilon), 유전자 등록번호(GeneBank accession No.) NM_017999(RNF31, Ring finger protein 31), 유전자 등록번호(GeneBank accession No.) NM_016819(OGG1, 8-oxoguanine DNA glycosylase), 유 전자 등록번호(GeneBank accession No.) NM_016816(OAS1, 2',5'-oligoadenylate synthetase 1, 40/46kDa), 유전자 등록번호(GeneBank accession No.) NM_012235(SCAP, SREBP cleavage-activating protein), 유전자 등록번호(GeneBank accession No.) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(GeneBank accession No.) NM_001779(CD58, CD58 antigen,(lymphocyte function-associated antigen 3)), 유전자 등록번호(GeneBank accession No.) CB055213(ICOSLG, Inducible T-cell co-stimulator ligand), 유전자 등록번호(GeneBank accession No.) BX641029(MASP1, Mannan-binding lectin serine peptidase 1(C4/C2 activating component of Ra-reactive factor)), 유전자 등록번호(GeneBank accession No.) BQ053419(BATF, Basic leucine zipper transcription factor, ATF-like), 유전자 등록번호(GeneBank accession No.) BC039299(STIP1, Stress-induced-phosphoprotein 1(Hsp70/Hsp90-organizing protein)), 유전자 등록번호(GeneBank accession No.) AY055760(DAF, Decay accelerating factor for complement(CD55, Cromer blood group system)), 유전자 등록번호(GeneBank accession No.) AK130188(FGR, Gardner-Rasheed feline sarcoma viral(v-fgr) oncogene homolog), 유전자 등록번호(GeneBank accession No.) AK095326(MUS81, MUS81 endonuclease homolog(yeast)), 유전자 등록번호(GeneBank accession No.) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(GeneBank accession No.) NM_003004(SECTM1, Secreted and transmembrane 1), 유전자 등록번호(GeneBank accession No.) NM_002309(LIF, Hypothetical protein MGC20647), 유전자 등록번호(GeneBank accession No.) NM_001421(ELF4, E74-like factor 4(ets domain transcription factor)), 유전자 등록번호(GeneBank accession No.) NM_000418(IL4R, Interleukin 4 receptor), 유전자 등록번호(GeneBank accession No.) BI909222(FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), 유전자 등록번호(GeneBank accession No.) BF569086(NK4, Interleukin 32), 유전자 등록번호(GeneBank accession No.) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(GeneBank accession No.) BC020744(AKR1C4, Aldo-keto reductase family 1, member C4(chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol),dehydrogenase 4), 유전자 등록번호(GeneBank accession No.) BQ939577(AKR1C3, Aldo-keto reductase family 1, member C3(3-alpha hydroxysteroid dehydrogenase, type II)), 유전자 등록번호(GeneBank accession No.) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_030622(CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_184041(ALDOA, Aldolase A, fructose-bisphosphate), 유전자 등록번호(GeneBank accession No.) NM_024307(MGC4171, Hypothetical protein LOC283901), 유전자 등록번호(GeneBank accession No.) NM_005336(HDLBP, High density lipoprotein binding protein(vigilin)), 유전자 등록번호(GeneBank accession No.) NM_002627(PFKP, Phosphofructokinase, platelet), 유전자 등록번 호(GeneBank accession No.) BX648281(LDLR, Low density lipoprotein receptor(familial hypercholesterolemia)), 유전자 등록번호(GeneBank accession No.) BC069201(FLJ22761, Hexokinase domain containing 1), 유전자 등록번호(GeneBank accession No.) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(GeneBank accession No.) AL833069(KIAA1434, Hypothetical protein KIAA1434), 유전자 등록번호(GeneBank accession No.) AK124656(ENO2, Enolase 2(gamma, neuronal)), 유전자 등록번호(GeneBank accession No.) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(GeneBank accession No.) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(GeneBank accession No.) AB053232(GAL3ST3, Galactose-3-O-sulfotransferase 3), 유전자 등록번호(GeneBank accession No.) AB045292(TMEM8, Transmembrane protein 8(five membrane-spanning domains)), 유전자 등록번호(GeneBank accession No.) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(GeneBank accession No.) NM_002900(RBP3, Retinol binding protein 3, interstitial), 유전자 등록번호(GeneBank accession No.) NM_001995(ACSL1, Acyl-CoA synthetase long-chain family member 1), 유전자 등록번호(GeneBank accession No.) NM_000018(ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), 유전자 등록번호(GeneBank accession No.) BC094756(CRA, Myotubularin related protein 11), 유전자 등록번호(GeneBank accession No.) BC050553(NTE, Neuropathy target esterase), 유전자 등록번호(GeneBank accession No.) BC033110(HSD17B1, Hydroxysteroid(17-beta) dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AY268890(TPP1, Tripeptidyl peptidase I), 유전자 등록번호(GeneBank accession No.) AK172798(CPT1A, Carnitine palmitoyltransferase 1A(liver)), 유전자 등록번호(GeneBank accession No.) AK096809(CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), 유전자 등록번호(GeneBank accession No.) AK000600(SIAT7D, ST6(alpha-N-acetyl-neuraminyl-2,3-beta- galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), 유전자 등록번호(GeneBank accession No.) AB002454(CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), 유전자 등록번호(GeneBank accession No.) Z29093(DDR1, Discoidin domain receptor family, member 1), 유전자 등록번호(GeneBank accession No.) Z25424(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) XM_291277(DKFZp761P0423, Hypothetical protein DKFZp761P0423), 유전자 등록번호(GeneBank accession No.) XM_038150(MAST3, Microtubule associated serine/threonine kinase 3), 유전자 등록번호(GeneBank accession No.) U88357(ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3(avian)), 유전자 등록번호(GeneBank accession No.) NM_025195(TRIB1, Tribbles homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020639(RIPK4, Receptor-interacting serine-threonine kinase 4), 유전자 등록 번호(GeneBank accession No.) NM_014172(PHPT1, Phosphohistidine phosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_006254(PRKCD, Protein kinase C, delta), 유전자 등록번호(GeneBank accession No.) NM_005415(SLC20A1, Solute carrier family 20(phosphate transporter), member 1), 유전자 등록번호(GeneBank accession No.) NM_005026(PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004431(EPHA2, EPH receptor A2), 유전자 등록번호(GeneBank accession No.) NM_004419(DUSP5, Dual specificity phosphatase 5), 유전자 등록번호(GeneBank accession No.) NM_004327(BCR, Breakpoint cluster region), 유전자 등록번호(GeneBank accession No.) NM_004231(ATP6V1F, ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F), 유전자 등록번호(GeneBank accession No.) NM_004090(DUSP3, Dual specificity phosphatase 3(vaccinia virus phosphatase VH1-related)), 유전자 등록번호(GeneBank accession No.) NM_002843(PTPRJ, Protein tyrosine phosphatase, receptor type, J), 유전자 등록번호(GeneBank accession No.) NM_002496(NDUFS8, NADH dehydrogenase(ubiquinone) Fe-S protein 8, 23kDa(NADH-coenzyme Q reductase)), 유전자 등록번호(GeneBank accession No.) NM_001001852(PIM3, Pim-3 oncogene), 유전자 등록번호(GeneBank accession No.) L76191(IRAK1, Interleukin-1 receptor-associated kinase 1), 유전자 등록번호(GeneBank accession No.) D15049(PTPRH, Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(GeneBank accession No.) BC065207(ATP6V0D2, ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2), 유전자 등록번호(GeneBank accession No.) BC035578(STK24, Serine/threonine kinase 24(STE20 homolog, yeast)), 유전자 등록번호(GeneBank accession No.) BC028724(DUSP18, Dual specificity phosphatase 18), 유전자 등록번호(GeneBank accession No.) AL117482(ULK3, Unc-51-like kinase 3(C. elegans)), 유전자 등록번호(GeneBank accession No.) AK126879(PCTK3, PCTAIRE protein kinase 3), 유전자 등록번호(GeneBank accession No.) AB209416(ILK, Integrin-linked kinase-2), 유전자 등록번호(GeneBank accession No.) NM_000782(CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) CR597101(ZFP36, Zinc finger protein 36, C3H type, homolog(mouse)), 유전자 등록번호(GeneBank accession No.) CR936799(FHL2, Four and a half LIM domains 2), 유전자 등록번호(GeneBank accession No.) M24898(NR1D1, Nuclear receptor subfamily 1, group D, member 1), 유전자 등록번호(GeneBank accession No.) AF132818(KLF5, Kruppel-like factor 5(intestinal)), 유전자 등록번호(GeneBank accession No.) AK055337(ZNF213, Zinc finger protein 213), 유전자 등록번호(GeneBank accession No.) BC008834(PHF1, PHD finger protein 1), 유전자 등록번호(GeneBank accession No.) AK126918(GLIS2, GLIS family zinc finger 2), 유전자 등록번호(GeneBank accession No.) BC042692(CTL2, Solute carrier family 44, member 2), 유전자 등록번호(GeneBank accession No.) NM_002224(ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), 유전자 등록번호(GeneBank accession No.) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(GeneBank accession No.) NM_174953(ATP2A3, ATPase, Ca++ transporting, ubiquitous), 유전자 등록번호(GeneBank accession No.) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(GeneBank accession No.) NM_016113(TRPV2, Transient receptor potential cation channel, subfamily V, member 2), 유전자 등록번호(GeneBank accession No.) BM926478(RBP1, Retinol binding protein 1, cellular), 유전자 등록번호(GeneBank accession No.) NM_000069(CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), 유전자 등록번호(GeneBank accession No.) AK002107(RAB3B, RAB3B, member RAS oncogene family), 유전자 등록번호(GeneBank accession No.) NM_013321(SNX8, Sorting nexin 8), 유전자 등록번호(GeneBank accession No.) AK125026(SLC6A12, Solute carrier family 6(neurotransmitter transporter, betaine/GABA), member 12), 유전자 등록번호(GeneBank accession No.) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(GeneBank accession No.) AK092512(SLC16A5, Solute carrier family 16(monocarboxylic acid transporters), member 5), 유전자 등록번호(GeneBank accession No.) U49248(ABCC2, ATP-binding cassette, sub-family C(CFTR/MRP), member 2), 유전자 등록번호(GeneBank accession No.) AK172792(SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), 유전자 등록번호(GeneBank accession No.) BC044656(CASC3, Cancer susceptibility candidate 3), 유전자 등록번호(GeneBank accession No.) NM_203403(C9orf150, Chromosome 9 open reading frame 150), 유전자 등록번호(GeneBank accession No.) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(GeneBank accession No.) NM_031286(SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), 유전자 등록번호(GeneBank accession No.) NM_022153(PP2135, Chromosome 10 open reading frame 54), 유전자 등록번호(GeneBank accession No.) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(GeneBank accession No.) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(GeneBank accession No.) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(GeneBank accession No.) BX537968(LOC51149, Hypothetical LOC51149), 유전자 등록번호(GeneBank accession No.) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(GeneBank accession No.) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(GeneBank accession No.) BQ276852(TMSB10, Thymosin, beta 10), 유전자 등록번호(GeneBank accession No.) AK126182(KIAA1949, KIAA1949), 유전자 등록번호(GeneBank accession No.) AK124751(CAPN2, Calpain 2,(m/II) large subunit), 유전자 등록번호(GeneBank accession No.) AK095079(RGC32, Response gene to complement 32), 유전자 등록번호(GeneBank accession No.) AB075871(FLJ42654, Golgi transport 1 homolog A(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AK125150(MAPK8, Mitogen-activated protein kinase 8), 유전자 등 록번호(GeneBank accession No.) NM_002758(MAP2K6, Mitogen-activated protein kinase kinase 6), 유전자 등록번호(GeneBank accession No.) NM_004612(TGFBR1, Transforming growth factor, beta receptor I(activin A receptor type II-like kinase, 53kDa)), 유전자 등록번호(GeneBank accession No.) NM_145686(MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4), 유전자 등록번호(GeneBank accession No.) XM_042066(MAP3K1, Mitogen-activated protein kinase kinase kinase 1), 유전자 등록번호(GeneBank accession No.) AB011123(TNIK, TRAF2 and NCK interacting kinase), 유전자 등록번호(GeneBank accession No.) AB209031(C5, Complement component 5), 유전자 등록번호(GeneBank accession No.) NM_022740(HIPK2, Homeodomain interacting protein kinase 2), 유전자 등록번호(GeneBank accession No.) NM_148957(TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(GeneBank accession No.) AB208909(ITGB2, Integrin, beta 2(antigen CD18(p95), lymphocyte function-associated antigen 1; macrophage antigen 1(mac-1) beta subunit)), 유전자 등록번호(GeneBank accession No.) AB209211(TIA1, TIA1 cytotoxic granule-associated RNA binding protein), 유전자 등록번호(GeneBank accession No.) AB209613(DNASE1L3, Deoxyribonuclease I-like 3), 유전자 등록번호(GeneBank accession No.) AK122825(HMGB1, High-mobility group box 1), 유전자 등록번호(GeneBank accession No.) AK127326(PHF17, PHD finger protein 17), 유전자 등록번호(GeneBank accession No.) AK223503(CASP1, Caspase 1, apoptosis-related cysteine peptidase(interleukin 1, beta, convertase)), 유전자 등록번호(GeneBank accession No.) BC013326(GAS2, Growth arrest-specific 2), 유전자 등록번호(GeneBank accession No.) BC047698(IL7, Interleukin 7), 유전자 등록번호(GeneBank accession No.) D79987(ESPL1, Extra spindle poles like 1(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_000893(KNG1, Kininogen 1), 유전자 등록번호(GeneBank accession No.) NM_001012271(BIRC5, Effector cell peptidase receptor 1), 유전자 등록번호(GeneBank accession No.) NM_004938(DAPK1, Death-associated protein kinase 1), 유전자 등록번호(GeneBank accession No.) NM_005879(TRIP, TRAF interacting protein), 유전자 등록번호(GeneBank accession No.) NM_014739(BCLAF1, BCL2-associated transcription factor 1), 유전자 등록번호(GeneBank accession No.) NM_018947(CYCS, Cytochrome c, somatic), 유전자 등록번호(GeneBank accession No.) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(GeneBank accession No.) AB209179(PLK1, Polo-like kinase 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) AB209337(CDC7, CDC7 cell division cycle 7(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AF053305(BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(GeneBank accession No.) AF053306(BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(GeneBank accession No.) AF345347(SPAG5, Sperm associated antigen 5), 유전자 등록번호(GeneBank accession No.) AK092638(CCNG2, Cyclin G2), 유전자 등록번호(GeneBank accession No.) AK222819(NUSAP1, Nucleolar and spindle associated protein 1), 유전자 등록번호(GeneBank accession No.) AL833191(SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등록번호(GeneBank accession No.) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(GeneBank accession No.) BC011000(CDCA5, Cell division cycle associated 5), 유전자 등록번호(GeneBank accession No.) BC032677(UBE2C, Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(GeneBank accession No.) BC043502(NEK2, NIMA(never in mitosis gene a)-related kinase 2), 유전자 등록번호(GeneBank accession No.) BU675073(PTTG1, Pituitary tumor-transforming 1), 유전자 등록번호(GeneBank accession No.) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(GeneBank accession No.) CR592757(BRRN1, Barren homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) CR597075(MAPRE2, Microtubule-associated protein, RP/EB family, member 2), 유전자 등록번호(GeneBank accession No.) CR604810(CCNA2, Cyclin A2), 유전자 등록번호(GeneBank accession No.) CR933728(CDC2, Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(GeneBank accession No.) NM_000919(PAM, Peptidylglycine alpha-amidating monooxygenase), 유전자 등록번호(GeneBank accession No.) NM_001790(CDC25C, Cell division cycle 25C), 유전자 등록번호(GeneBank accession No.) NM_001798(CDK2, Cyclin-dependent kinase 2), 유전자 등록번호(GeneBank accession No.) NM_001813(CENPE, Centromere protein E, 312kDa), 유전자 등록번호(GeneBank accession No.) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(GeneBank accession No.) NM_003981(PRC1, Protein regulator of cytokinesis 1), 유전자 등록번호(GeneBank accession No.) NM_004523(KIF11, Kinesin family member 11), 유전자 등록번호(GeneBank accession No.) NM_004701(CCNB2, Cyclin B2), 유전자 등록번호(GeneBank accession No.) NM_005983(SKP2, S-phase kinase-associated protein 2(p45)), 유전자 등록번호(GeneBank accession No.) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(GeneBank accession No.) NM_006845(KIF2C, Kinesin family member 2C), 유전자 등록번호(GeneBank accession No.) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(GeneBank accession No.) NM_012112(TPX2, TPX2, microtubule-associated, homolog(Xenopus laevis)), 유전자 등록번호(GeneBank accession No.) NM_014750(DLG7, Discs, large homolog 7(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015097(CLASP2, Cytoplasmic linker associated protein 2), 유전자 등록번호(GeneBank accession No.) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(GeneBank accession No.) NM_016426(GTSE1, G-2 and S-phase expressed 1), 유전자 등록번호(GeneBank accession No.) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(GeneBank accession No.) NM_018685(ANLN, Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020242(KNSL7, Kinesin family member 15), 유전자 등록번호(GeneBank accession No.) NM_031966(CCNB1, Cyclin B1), 유전자 등록번호(GeneBank accession No.) NM_138555(KIF23, Kinesin family member 23), 유전자 등록번호(GeneBank accession No.) U65410(MAD2L1, MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AB020656(CYLD, Cylindromatosis(turban tumor syndrome)), 유전자 등록번호(GeneBank accession No.) AF033122(SESN1, Sestrin 1), 유전자 등록번호(GeneBank accession No.) AK074377(UHRF1, Chromosome 19 open reading frame 31), 유전자 등록번호(GeneBank accession No.) AK091170(CDKN2C, Cyclin-dependent kinase inhibitor 2C(p18, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) AK094323(NFYC, Nuclear transcription factor Y, gamma), 유전자 등록번호(GeneBank accession No.) AY366508(LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), 유전자 등록번호(GeneBank accession No.) BC033086(TCF19, Transcription factor 19(SC1)), 유전자 등록번호(GeneBank accession No.) BC040303(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(GeneBank accession No.) BC040991(TFDP2, Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(GeneBank accession No.) BC092412(SGOL2, Shugoshin-like 2(S. pombe)), 유전자 등록번호(GeneBank accession No.) BQ278454(CKS1B, CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(GeneBank accession No.) BX649128(SESN3, Sestrin 3), 유전자 등록번호(GeneBank accession No.) CD049340(AURKB, Aurora kinase B), 유전자 등록번호(GeneBank accession No.) M89914(NF1, Neurofibromin 1(neurofibromatosis, von Recklinghausen disease, Watson disease)), 유전자 등록번호(GeneBank accession No.) NM_001005414(ZWINT, ZW10 interactor antisense), 유전자 등록번호(GeneBank accession No.) NM_001008491(Sep 2, Septin 2), 유전자 등록번호(GeneBank accession No.) NM_001274(CHEK1, CHK1 checkpoint homolog(S. pombe)), 유전자 등록번호(GeneBank accession No.) NM_002105(H2AFX, H2A histone family, member X), 유전자 등록번호(GeneBank accession No.) NM_002388(MCM3, MCM3 minichromosome maintenance deficient 3(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_002417(MKI67, Antigen identified by monoclonal antibody Ki-67), 유전자 등록번호(GeneBank accession No.) NM_002875(RAD51, RAD51 homolog(RecA homolog, E. coli)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(GeneBank accession No.) NM_004526(MCM2, MCM2 minichromosome maintenance deficient 2, mitotin(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_004847(AIF1, Allograft inflammatory factor 1), 유전자 등록번호(GeneBank accession No.) NM_005915(MCM6, MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_012090(MACF1, Microtubule-actin crosslinking factor 1), 유 전자 등록번호(GeneBank accession No.) NM_012415(RAD54B, RAD54 homolog B(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_014264(PLK4, Polo-like kinase 4(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015714(G0S2, G0/G1switch 2), 유전자 등록번호(GeneBank accession No.) NM_024680(FLJ23311, E2F transcription factor 8), 유전자 등록번호(GeneBank accession No.) XM_034274(MYBL1, V-myb myeloblastosis viral oncogene homolog(avian)-like 1), 유전자 등록번호(GeneBank accession No.) AK001720(FLJ10858, Nei endonuclease VIII-like 3(E. coli)), 유전자 등록번호(GeneBank accession No.) AY032677(POLQ, Polymerase(DNA directed), theta), 유전자 등록번호(GeneBank accession No.) BC034480(BLM, Bloom syndrome), 유전자 등록번호(GeneBank accession No.) BC073161(RAD51C, RAD51 homolog C(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) CR600021(HMGB2, High-mobility group box 2), 유전자 등록번호(GeneBank accession No.) CR625391(RAD51AP1, RAD51 associated protein 1), 유전자 등록번호(GeneBank accession No.) CR936783(FLJ40869, Hypothetical protein LOC284952), 유전자 등록번호(GeneBank accession No.) DQ140356(KIAA1596, Fanconi anemia, complementation group M), 유전자 등록번호(GeneBank accession No.) NM_001067(TOP2A, Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(GeneBank accession No.) NM_001618(PARP1, Poly(ADP-ribose) polymerase family, member 1), 유전자 등록번호(GeneBank accession No.) NM_003362(UNG, Uracil-DNA glycosylase), 유전자 등록번호(GeneBank accession No.) NM_006904(PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(GeneBank accession No.) NM_130398(EXO1, Exonuclease 1), 유전자 등록번호(GeneBank accession No.) AB020807(TLR6, Toll-like receptor 6), 유전자 등록번호(GeneBank accession No.) AB032980(DCDC2, Doublecortin domain containing 2), 유전자 등록번호(GeneBank accession No.) AB209866(TFPI, Tissue factor pathway inhibitor(lipoprotein-associated coagulation inhibitor)), 유전자 등록번호(GeneBank accession No.) AK057015(HSPA4, Heat shock 70kDa protein 4), 유전자 등록번호(GeneBank accession No.) AK095515(IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), 유전자 등록번호(GeneBank accession No.) AK122686(IF, I factor(complement)), 유전자 등록번호(GeneBank accession No.) AK123010(RRM2, Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(GeneBank accession No.) BC035582(TRIM22, Tripartite motif-containing 22), 유전자 등록번호(GeneBank accession No.) BX537894(LOC493869, Similar to RIKEN cDNA 2310016C16), 유전자 등록번호(GeneBank accession No.) M14338(PROS1, Protein S(alpha)), 유전자 등록번호(GeneBank accession No.) NM_000821(GGCX, Gamma-glutamyl carboxylase), 유전자 등록번호(GeneBank accession No.) NM_000963(PTGS2, Prostaglandin-endoperoxide synthase 2(prostaglandin G/H synthase and cyclooxygenase)), 유전자 등록번호(GeneBank accession No.) NM_001001547(CD36, CD36 antigen(collagen type I receptor, thrombospondin receptor)), 유전자 등록번호(GeneBank accession No.) NM_001512(GSTA4, Glutathione S-transferase A4), 유전자 등록번호(GeneBank accession No.) NM_001629(ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), 유전자 등록번호(GeneBank accession No.) NM_001752(CAT, Catalase), 유전자 등록번호(GeneBank accession No.) NM_001837(CCR3, Chemokine(C-C motif) receptor 3), 유전자 등록번호(GeneBank accession No.) NM_001979(EPHX2, Epoxide hydrolase 2, cytoplasmic), 유전자 등록번호(GeneBank accession No.) NM_001994(F13B, Coagulation factor XIII, B polypeptide), 유전자 등록번호(GeneBank accession No.) NM_002182(IL1RAP, Interleukin 1 receptor accessory protein), 유전자 등록번호(GeneBank accession No.) NM_006120(HLA-DMA, Major histocompatibility complex, class II, DM alpha), 유전자 등록번호(GeneBank accession No.) NM_173216(SIAT1, ST6 beta-galactosamide alpha-2,6-sialyltranferase 1), 유전자 등록번호(GeneBank accession No.) NM_202002(FOXM1, Forkhead box M1), 유전자 등록번호(GeneBank accession No.) AB163917(LRAP, Leukocyte-derived arginine aminopeptidase), 유전자 등록번호(GeneBank accession No.) BC027881(AFP, Alpha-fetoprotein), 유전자 등록번호(GeneBank accession No.) NM_015915(SPG3A, Spastic paraplegia 3A(autosomal dominant)), 유전자 등록번호(GeneBank accession No.) NM_000671(ADH5, Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(GeneBank accession No.) J05428(UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), 유전자 등록번호(GeneBank accession No.) NM_000672(ADH6, Alcohol dehydrogenase 6(class V)), 유전자 등록번호(GeneBank accession No.) M15943(ADH4, Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(GeneBank accession No.) AK223395(FBP1, Fructose-1,6-bisphosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_000151(G6PC, Glucose-6-phosphatase, catalytic(glycogen storage disease type I, von Gierke disease)), 유전자 등록번호(GeneBank accession No.) XM_113962(KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), 유전자 등록번호(GeneBank accession No.) AB020644(ACSL6, Acyl-CoA synthetase long-chain family member 6), 유전자 등록번호(GeneBank accession No.) AB209907(PLD1, Phospholipase D1, phophatidylcholine-specific), 유전자 등록번호(GeneBank accession No.) AF285167(ABCA1, ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(GeneBank accession No.) AF297872(TRERF1, Transcriptional regulating factor 1), 유전자 등록번호(GeneBank accession No.) AF303134(ALDH8A1, Aldehyde dehydrogenase 8 family, member A1), 유전자 등록번호(GeneBank accession No.) AF339053(PLA2G12B, Phospholipase A2, group XIIB), 유전자 등록번호(GeneBank accession No.) AK096018(HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), 유전자 등록번호(GeneBank accession No.) AK124635(PCSK9, Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(GeneBank accession No.) AK127346(SIAT9, ST3 beta-galactoside alpha-2,3- sialyltransferase 5), 유전자 등록번호(GeneBank accession No.) AL359559(AGPS, Alkylglycerone phosphate synthase), 유전자 등록번호(GeneBank accession No.) AY691170(PLCL3, Phospholipase C-like 3), 유전자 등록번호(GeneBank accession No.) BG567934(APOM, Apolipoprotein M), 유전자 등록번호(GeneBank accession No.) BX538214(C6orf167, Chromosome 6 open reading frame 167), 유전자 등록번호(GeneBank accession No.) BX640945(FADS2, Fatty acid desaturase 2), 유전자 등록번호(GeneBank accession No.) BX648473(PIGK, Phosphatidylinositol glycan, class K), 유전자 등록번호(GeneBank accession No.) BX648557(HSD17B2, Hydroxysteroid(17-beta) dehydrogenase 2), 유전자 등록번호(GeneBank accession No.) CR749601(ETNK1, Death-associated protein kinase 3), 유전자 등록번호(GeneBank accession No.) NM_000859(HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), 유전자 등록번호(GeneBank accession No.) NM_001443(FABP1, Fatty acid binding protein 1, liver), 유전자 등록번호(GeneBank accession No.) NM_002130(HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1(soluble)), 유전자 등록번호(GeneBank accession No.) NM_003725(RODH, Hydroxysteroid(17-beta) dehydrogenase 6), 유전자 등록번호(GeneBank accession No.) NM_004845(PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), 유전자 등록번호(GeneBank accession No.) NM_014762(DHCR24, 24-dehydrocholesterol reductase), 유전자 등록번호(GeneBank accession No.) NM_020139(DHRS6, Dehydrogenase/reductase(SDR family) member 6), 유전자 등록번 호(GeneBank accession No.) NM_020918(GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(GeneBank accession No.) NM_032523(OSBPL6, Oxysterol binding protein-like 6), 유전자 등록번호(GeneBank accession No.) NM_033505(SELI, Selenoprotein I), 유전자 등록번호(GeneBank accession No.) Z28339(AKR1D1, Aldo-keto reductase family 1, member D1(delta 4-3-ketosteroid-5-beta-reductase)), 유전자 등록번호(GeneBank accession No.) AK024899(ENPP3, Ectonucleotide pyrophosphatase/phosphodiesterase 3), 유전자 등록번호(GeneBank accession No.) AK025546(PTPN4, Protein tyrosine phosphatase, non-receptor type 4(megakaryocyte)), 유전자 등록번호(GeneBank accession No.) AK124910(ENPP2, Ectonucleotide pyrophosphatase/phosphodiesterase 2(autotaxin)), 유전자 등록번호(GeneBank accession No.) BC035116(FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), 유전자 등록번호(GeneBank accession No.) BC050565(PASK, PAS domain containing serine/threonine kinase), 유전자 등록번호(GeneBank accession No.) L13436(NPR2, Natriuretic peptide receptor B/guanylate cyclase B(atrionatriuretic peptide receptor B)), 유전자 등록번호(GeneBank accession No.) NM_001005862(ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog(avian)), 유전자 등록번호(GeneBank accession No.) NM_005012(ROR1, Receptor tyrosine kinase-like orphan receptor 1), 유전자 등록번호(GeneBank accession No.) NM_006035(CDC42BPB, CDC42 binding protein kinase beta(DMPK-like)), 유전자 등록번호(GeneBank accession No.) NM_014791(MELK, Maternal embryonic leucine zipper kinase), 유전자 등록번호(GeneBank accession No.) NM_023028(FGFR2, Fibroblast growth factor receptor 2(bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), 유전자 등록번호(GeneBank accession No.) NM_080836(STK35, Serine/threonine kinase 35), 유전자 등록번호(GeneBank accession No.) AF419331(FUSIP1, FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(GeneBank accession No.) AK091927(SFRS3, Splicing factor, arginine/serine-rich 3), 유전자 등록번호(GeneBank accession No.) BC010266(HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(GeneBank accession No.) BC012360(CTAGE5, CTAGE family, member 5), 유전자 등록번호(GeneBank accession No.) BC036046(PLRG1, Pleiotropic regulator 1(PRL1 homolog, Arabidopsis)), 유전자 등록번호(GeneBank accession No.) BC065384(PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BX537360(CPSF5, Nudix(nucleoside diphosphate linked moiety X)-type motif 21), 유전자 등록번호(GeneBank accession No.) BX537494(HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2/B1), 유전자 등록번호(GeneBank accession No.) BX647784(HNRPR, Heterogeneous nuclear ribonucleoprotein R), 유전자 등록번 호(GeneBank accession No.) CA455267(PPIH, Peptidyl prolyl isomerase H(cyclophilin H)), 유전자 등록번호(GeneBank accession No.) CR596214(HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), 유전자 등록번호(GeneBank accession No.) NM_001326(CSTF3, Hypothetical protein LOC283267), 유전자 등록번호(GeneBank accession No.) NM_004640(BAT1, HLA-B associated transcript 1), 유전자 등록번호(GeneBank accession No.) NM_005463(HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(GeneBank accession No.) NM_006924(SFRS1, Splicing factor, arginine/serine-rich 1(splicing factor 2, alternate splicing factor)), 유전자 등록번호(GeneBank accession No.) NM_012426(SF3B3, Splicing factor 3b, subunit 3, 130kDa), 유전자 등록번호(GeneBank accession No.) NM_018048(FLJ10292, Mago-nashi homolog), 유전자 등록번호(GeneBank accession No.) NM_030919(C20orf129, Chromosome 20 open reading frame 129), 유전자 등록번호(GeneBank accession No.) NM_031370(HNRPD, Heterogeneous nuclear ribonucleoprotein D(AU-rich element RNA binding protein 1, 37kDa)), 유전자 등록번호(GeneBank accession No.) NM_138933(ACF, Apobec-1 complementation factor), 유전자 등록번호(GeneBank accession No.) AB193259(ACE2, Angiotensin I converting enzyme(peptidyl-dipeptidase A) 2), 유전자 등록번호(GeneBank accession No.) BX648769(EWSR1, Ewing sarcoma breakpoint region 1), 유전자 등록번호(GeneBank accession No.) AB023154(DTX4, Deltex 4 homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) AL543755(VAV3, Vav 3 oncogene), 유전자 등록번호(GeneBank accession No.) M75106(CPB2, Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(GeneBank accession No.) NM_021045(ZNF248, Zinc finger protein 248), 유전자 등록번호(GeneBank accession No.) AB209194(B4GALT6, UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6), 유전자 등록번호(GeneBank accession No.) AF279145(ANTXR1, Anthrax toxin receptor 1), 유전자 등록번호(GeneBank accession No.) NM_025074(FRAS1, Fraser syndrome 1), 유전자 등록번호(GeneBank accession No.) AK025790(KIF20A, Kinesin family member 20A), 유전자 등록번호(GeneBank accession No.) NM_006152(LRMP, Lymphoid-restricted membrane protein), 유전자 등록번호(GeneBank accession No.) NM_000340(SLC2A2, Solute carrier family 2(facilitated glucose transporter), member 2), 유전자 등록번호(GeneBank accession No.) AF071592(KIF4A, Kinesin family member 4A), 유전자 등록번호(GeneBank accession No.) NM_013277(RACGAP1, Rac GTPase activating protein 1), 유전자 등록번호(GeneBank accession No.) AY043484(SCN1A, Sodium channel, voltage-gated, type I, alpha), 유전자 등록번호(GeneBank accession No.) AY791349(KIF18A, Kinesin family member 18A), 유전자 등록번호(GeneBank accession No.) NM_018018(SLC38A4, Solute carrier family 38, member 4), 유전자 등록번호(GeneBank accession No.) AK094603(FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(GeneBank accession No.) NM_021069(ARGBP2, Sorbin and SH3 domain containing 2), 유전자 등록번호(GeneBank accession No.) NM_001005747(CACNB4, Calcium channel, voltage-dependent, beta 4 subunit), 유전자 등록번호(GeneBank accession No.) AJ496568(SLC25A12, Solute carrier family 25(mitochondrial carrier, Aralar), member 12), 유전자 등록번호(GeneBank accession No.) NM_030641(APOL6, Apolipoprotein L, 6), 유전자 등록번호(GeneBank accession No.) NM_173512(FLJ39822, Hypothetical protein FLJ39822), 유전자 등록번호(GeneBank accession No.) NM_000037(ANK1, Ankyrin 1, erythrocytic), 유전자 등록번호(GeneBank accession No.) NM_001011554(SLC13A3, Solute carrier family 13(sodium-dependent dicarboxylate transporter), member 3), 유전자 등록번호(GeneBank accession No.) AB091343(C10orf3, Centrosomal protein 55kDa), 유전자 등록번호(GeneBank accession No.) AK000643(ASB9, Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(GeneBank accession No.) AK055221(FBXO5, F-box protein 5), 유전자 등록번호(GeneBank accession No.) AK075271(SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like(aminotransferase 2)), 유전자 등록번호(GeneBank accession No.) AK122685(GLUD1, Glutamate dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AK127098(FLJ10706, Chromosome 1 open reading frame 112), 유전자 등록번호(GeneBank accession No.) AL133031(MLR1, Transcription factor MLR1), 유전자 등록번호(GeneBank accession No.) AY007723(MAL2, Mal, T-cell differentiation protein 2), 유전자 등록번호(GeneBank accession No.) BC022255(Spc25, Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BC041882(ATF7IP2, Activating transcription factor 7 interacting protein 2), 유전자 등록번호(GeneBank accession No.) BC052951(LMNB1, Lamin B1), 유전자 등록번호(GeneBank accession No.) BC098313(FLJ20641, Hypothetical protein FLJ20641), 유전자 등록번호(GeneBank accession No.) NM_001809(CENPA, Centromere protein A, 17kDa), 유전자 등록번호(GeneBank accession No.) NM_145061(C13orf3, Chromosome 13 open reading frame 3), 유전자 등록번호(GeneBank accession No.) XM_372695(LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase(LOC390859), mRNA).Gene accession number (GeneBank accession No. ) NM_004420 (DUSP8, Dual specificity phosphatase 8), gene accession number (GeneBank accession No. ) L11329 (DUSP2, Dual specificity phosphatase 2), gene accession number (GeneBank accession No. ) BC094766 (PKN1, Protein kinase N1), gene accession number (GeneBank accession No. ) AY247738 (TRIB3, Tribbles homolog 3 (Drosophila)), gene accession number (GeneBank accession No. ) AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Gene Accession No. ) AB208849 (SHC1, Src homology 2 domain containing (SHC) transforming protein 1), gene accession number (GeneBank accession No. ) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease)), Gene Accession No. ) NM_198951 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (GeneBank accession No. NM_147780 (CTSB, Cathepsin B), gene accession number (GeneBank accession No. NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), gene accession number (GeneBank accession No. NM_033027 (AXUD1, AXIN1 up-regulated 1), gene accession number (GeneBank accession No. NM_032797 (AMID, Apoptosis-inducing factor (AIF) -like mitochondrion-associated inducer of death), GeneBank accession No. ) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (GeneBank accession No. ) NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), gene accession number (GeneBank accession No. ) NM_016222 (DDX41, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41), gene accession number (GeneBank accession No. ) NM_013246 (CLC, Cardiotrophin-like cytokine factor 1), gene accession number (GeneBank accession No. ) NM_004401 (DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), gene registration number (GeneBank accession No. ) NM_004281 (BAG3, BCL2-associated athanogene 3), gene accession number (GeneBank accession No. ) NM_003897 (IER3, Immediate early response 3), Gene accession number (GeneBank accession No. ) NM_003806 (HRK, Harakiri, BCL2 interacting protein (contains only BH3 domain)), gene accession number (GeneBank accession No. ) NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), GeneBank accession No. ) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), gene accession number (GeneBank accession No. ) NM_002737 (PRKCA, Protein Kinase C, alpha), Gene Accession Number (GeneBank accession No. NM_002648 (PIM1, Pim-1 oncogene), gene accession number (GeneBank accession No. NM_002507 (NGFR, Nerve growth factor receptor (TNFR superfamily, member 16)), gene accession number (GeneBank accession No. ) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), gene accession number (GeneBank accession No. ) NM_001013398 (IGFBP3, Insulin-like growth factor binding protein 3), gene registration number (GeneBank accession No. ) BX640923 (MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)), gene accession number (GeneBank accession No. ) BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), gene accession number (GeneBank accession No. ) BG284742 (P8, P8 protein (candidate of metastasis 1)), gene accession number (GeneBank accession No. ) BE903247 (PDCD6IP, Programmed cell death 6 interacting protein), gene accession number (GeneBank accession No. ) BC027949 (P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), gene accession number (GeneBank accession No. ) BC006365 (PSEN2, Presenilin 2 (Alzheimer disease 4)), gene accession number (GeneBank accession No. ) AY869712 (PPP1R13L, Protein phosphatase 1, regulatory (inhibitor) subunit 13 like), Gene Accession No. ) AY028896 (CARD10, Caspase recruitment domain family, member 10), gene accession number (GeneBank accession No. ) AK122614 (PPARD, Peroxisome proliferative activated receptor, delta), gene accession number (GeneBank accession No. ) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), gene registration number (GeneBank accession No. ) AK092808 (RRAGC, Ras-related GTP binding C), gene accession number (GeneBank accession No. ) AJ001898 (GDNF, Glial cell derived neurotrophic factor), gene accession number (GeneBank accession No. ) AF220656 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), gene accession number (GeneBank accession No. AF055634 (UNC5C, Unc-5 homolog C (C.  elegans), GeneBank accession No. ) AB209485 (Vescular endothelial growth factor), gene accession number (GeneBank accession No. ) AB096256 (UNC5B, Unc-5 homolog B (C.  elegans), GeneBank accession No. ) AB007960 (SH3GLB1, SH3-domain GRB2-like endophilin B1), gene accession number (GeneBank accession No. ) X06374 (PDGFA, Platelet-derived growth factor alpha polypeptide), Gene accession number (GeneBank accession No. ) S62138 (DDIT3, DNA-damage-inducible transcript 3), gene accession number (GeneBank accession No. NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), gene accession number (GeneBank accession No. ) NM_012127 (CIZ1, CDKN1A interacting zinc finger protein 1), gene accession number (GeneBank accession No. ) NM_005883 (APC2, Adenomatosis polyposis coli 2), gene accession number (GeneBank accession No. ) NM_004196 (CDKL1, Cyclin-dependent kinase-like 1 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_003236 (TGFA, Transforming growth factor, alpha), gene registration number (GeneBank accession No. ) NM_001261 (CDK9, Cyclin-dependent kinase 9 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_001007271 (DUSP13, Dual specificity phosphatase 13), gene accession number (GeneBank accession No. ) CR749511 (PARC, P53-associated parkin-like cytoplasmic protein), gene registration number (GeneBank accession No. CR623038 (ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), gene accession number (GeneBank accession No. CR618371 (EGFR, Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)), GeneBank accession No. ) BF965144 (IFITM1, Interferon induced transmembrane protein 1 (9-27)), gene accession number (GeneBank accession No. ) AK127679 (DUSP1, Dual specificity phosphatase 1), gene accession number (GeneBank accession No. ) AK096276 (CCND3, Cyclin D3), gene accession number (GeneBank accession No. ) AB209586 (MAPK13, Mitogen-activated protein kinase 13), gene accession number (GeneBank accession No. ) AB209465 (PCTK1, PCTAIRE protein kinase 1), gene accession number (GeneBank accession No. ) Z19588 (SKIL, SKI-like), gene accession number (GeneBank accession No. NM_020429 (SMURF1, SMAD specific E3 ubiquitin protein ligase 1), gene accession number (GeneBank accession No. ) NM_014767 (SPOCK2, Sparc / osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2), Gene Accession No. ) NM_005979 (S100A13, S100 calcium binding protein A13), gene registration number (GeneBank accession No. NM_005187 (CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), gene accession number (GeneBank accession No. ) NM_004364 (CEBPA, CCAAT / enhancer binding protein (C / EBP), alpha), gene registration number (GeneBank accession No. ) NM_001769 (CD9, CD9 antigen (p24)), gene accession number (GeneBank accession No. ) NM_001718 (BMP6, Bone morphogenetic protein 6), gene accession number (GeneBank accession No. ) NM_000641 (IL11, Interleukin 11), gene accession number (GeneBank accession No. ) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), gene registration number (GeneBank accession No. ) BQ066037 (RPS19, Ribosomal protein S19), gene accession number (GeneBank accession No. ) BE791300 (EDF1, Endothelial differentiation-related factor 1), Gene accession number (GeneBank accession No. ) BC038504 (SNF1LK, SNF1-like kinase), gene accession number (GeneBank accession No. ) AL832287 (ZAP70, Zeta-chain (TCR) associated protein kinase 70kDa), gene accession number (GeneBank accession No. ) AK125742 (PCGF1, Polycomb group ring finger 1), gene accession number (GeneBank accession No. ) AK124709 (NDRG1, N-myc downstream regulated gene 1), gene accession number (GeneBank accession No. ) AB011157 (PTDSR, Phosphatidylserine receptor), Gene Accession No. NM_013255 (MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), gene accession number (GeneBank accession No. ) NM_006572 (GNA13, Guanine nucleotide binding protein (G protein), alpha 13), gene registration number (GeneBank accession No. NM_002211 (ITGB1, Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), gene accession number (GeneBank accession No. ) CR601067 (PLAUR, Plasminogen activator, urokinase receptor), gene accession number (GeneBank accession No. ) BC050456 (THBS4, Thrombospondin 4), gene registration number (GeneBank accession No. ) AK027389 (CXCL16, Chemokine (C-X-C motif) ligand 16), gene accession number (GeneBank accession No. ) AJ132099 (VNN1, Vanin 1), gene accession number (GeneBank accession No. ) XM_371354 (FLJ10157, Hypothetical protein FLJ10157), gene accession number (GeneBank accession No. ) XM_208313 (TPM3, Similar to tropomyosin 4), gene accession number (GeneBank accession No. XM_208270 (ACR, Acrosin-like protease), gene accession number (GeneBank accession No. ) NM_203353 (PDLIM7, PDZ and LIM domain 7 (enigma)), gene accession number (GeneBank accession No. ) NM_201382 (PLEC1, Plectin 1, intermediate filament binding protein 500kDa), gene registration number (GeneBank accession No. ) NM_182961 (SYNE1, Spectrin repeat containing, nuclear envelope 1), gene accession number (GeneBank accession No. ) NM_181826 (NF2, Neurofibromin 2 (bilateral acoustic neuroma)), gene accession number (GeneBank accession No. NM_172069 (PLEKHH2, Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2), gene accession number (GeneBank accession No. ) NM_022648 (TNS, Tensin 1), gene accession number (GeneBank accession No. NM_017556 (FBLP-1, Filamin binding LIM protein 1), gene accession number (GeneBank accession No. NM_016081 (KIAA0992, Palladin, cytoskeletal associated protein), gene accession number (GeneBank accession No. ) NM_006617 (NES, Nestin), gene accession number (GeneBank accession No. ) NM_006262 (PRPH, Peripherin), gene accession number (GeneBank accession No. NM_005100 (AKAP12, A kinase (PRKA) anchor protein (gravin) 12), gene registration number (GeneBank accession No. NM_004368 (CNN2, Calponin 2), gene accession number (GeneBank accession No. ) NM_003388 (CYLN2, Cytoplasmic linker 2), gene accession number (GeneBank accession No. ) NM_003370 (VASP, Vasodilator-stimulated phosphoprotein), gene accession number (GeneBank accession No. ) NM_003128 (SPTBN1, Spectrin, beta, non-erythrocytic 1), gene accession number (GeneBank accession No. ) NM_002705 (PPL, Periplakin), gene accession number (GeneBank accession No. ) NM_002475 (MLC1SA, Myosin light chain 1 slow a), Gene accession number (GeneBank accession No. ) NM_002018 (FLII, Flightless I homolog (Drosophila)), Gene Accession Number (GeneBank accession No. ) NM_001465 (FYB, FYN binding protein (FYB-120 / 130)), gene registration number (GeneBank accession No. NM_001069 (TUBB2, Tubulin, beta 2A), gene accession number (GeneBank accession No. ) CR625172 (MGC8685, Tubulin, beta 2B), gene accession number (GeneBank accession No. CR616919 (KRT18, Keratin 18), gene accession number (GeneBank accession No. ) CR606241 (ACTG1, Actin, gamma 1), gene accession number (GeneBank accession No. ) CB240572 (MYH11, Myosin, heavy polypeptide 11, smooth muscle), gene accession number (GeneBank accession No. ) BX648253 (PTPN3, Protein tyrosine phosphatase, non-receptor type 3), Gene accession number (GeneBank accession No. ) BX648190 (WDR1, WD repeat domain 1), Gene accession number (GeneBank accession No. ) BX641076 (ACTN1, Actinin, alpha 1), gene accession number (GeneBank accession No. ) BX537978 (EPB41L1, Erythrocyte membrane protein band 4. 1-like 1), gene accession number (GeneBank accession No. ) BG121847 (NUDC, Nuclear distribution gene C homolog (A.  nidulans)), and GeneBank accession No. ) BC068013 (MYO1C, Myosin IC), gene accession number (GeneBank accession No. ) BC065499 (MAST2, Microtubule associated serine / threonine kinase 2), gene accession number (GeneBank accession No. ) BC051890 (TUBG2, Tubulin, gamma 2), gene accession number (GeneBank accession No. ) BC041874 (MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), gene accession number (GeneBank accession No. ) BC012597 (ACTA1, Actin, alpha 1, skeletal muscle), gene accession number (GeneBank accession No. ) AY484427 (KIF17, Kinesin family member 17), gene accession number (GeneBank accession No. ) AK130546 (STOML2, Stomatin (EPB72) -like 2), Gene accession number (GeneBank accession No. ) AK124711 (CORO2B, Coronin, actin binding protein, 2B), gene accession number (GeneBank accession No. ) AK123974 (MYL5, Myosin, light polypeptide 5, regulatory), gene accession number (GeneBank accession No. ) AK092792 (LOC389833, Similar to hypothetical protein MGC27019), gene accession number (GeneBank accession No. ) AK026518 (MYOHD1, Myosin head domain containing 1), gene accession number (GeneBank accession No. ) AK024500 (NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), gene accession number (GeneBank accession No. ) AF085886 (FLJ46675, Ribosomal protein L29 pseudogene 2), gene accession number (GeneBank accession No. ) AB209997 (MYO9B, Myosin IXB), gene accession number (GeneBank accession No. Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), gene accession number (GeneBank accession No. ) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), gene accession number (GeneBank accession No. X17033 (ITGA2, Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)), gene accession number (GeneBank accession No. ) U41763 (CLTCL1, Clathrin, heavy polypeptide-like 1), gene accession number (GeneBank accession No. NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene accession number (GeneBank accession No. ) NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse)), gene accession number (GeneBank accession No. ) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), gene accession number (GeneBank accession No. NM_017555 (EGLN2, Egl nine homolog 2 (C.  elegans), GeneBank accession No. NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), gene accession number (GeneBank accession No. NM_004148 (NINJ1, Ninjurin 1), gene accession number (GeneBank accession No. ) NM_003377 (VEGFB, Vascular endothelial growth factor B), gene accession number (GeneBank accession No. ) NM_001983 (ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)), GeneBank accession No. ) NM_001552 (IGFBP4, Insulin-like growth factor binding protein 4), gene registration number (GeneBank accession No. ) NM_001430 (EPAS1, Endothelial PAS domain protein 1), Gene accession number (GeneBank accession No. NM_001300 (KLF6, Kruppel-like factor 6), gene accession number (GeneBank accession No. ) NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2), gene accession number (GeneBank accession No. NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (GeneBank accession No. ) NM_000474 (TWIST1, Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila)), Gene Accession No. ) BX649103 (ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), Gene Accession No. ) BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), gene accession number (GeneBank accession No. ) BM904612 (S100A6, S100 calcium binding protein A6 (calcyclin)), gene accession number (GeneBank accession No. ) BM556279 (EMP3, Epithelial membrane protein 3), gene accession number (GeneBank accession No. ) BC015041 (VAT1, Family with sequence similarity 82, member C), gene accession number (GeneBank accession No. ) AY258066 (OKL38, Pregnancy-induced growth inhibitor), gene accession number (GeneBank accession No. ) AK126729 (NDRG4, NDRG family member 4), gene accession number (GeneBank accession No. ) AK090459 (NFE2L1, Nuclear factor (erythroid-derived 2) -like 1), gene accession number (GeneBank accession No. ) AK074163 (ROBO4, Roundabout homolog 4, magic roundabout (Drosophila)), Gene accession number (GeneBank accession No. ) AK024680 (FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), gene accession number (GeneBank accession No. ) AF176422 (HEY1, Hairy / enhancer-of-split related with YRPW motif 1), gene accession number (GeneBank accession No. ) AF003837 (JAG1, Jagged 1 (Alagille syndrome)), gene accession number (GeneBank accession No. ) AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), GeneBank accession No. ) AB011150 (NRXN1, Neurexin 1), gene accession number (GeneBank accession No. ) NM_201589 (MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)), gene accession number (GeneBank accession No. NM_052999 (CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), gene accession number (GeneBank accession No. NM_006644 (HSPH1, Heat shock 105kDa / 110kDa protein 1), gene registration number (GeneBank accession No. NM_005438 (FOSL1, FOS-like antigen 1), gene accession number (GeneBank accession No. ) NM_004996 (ABCC1, ATP-binding cassette, sub-family C (CFTR / MRP), member 1), gene accession number (GeneBank accession No. ) NM_002658 (PLAU, Plasminogen activator, urokinase), gene accession number (GeneBank accession No. ) NM_001353 (AKR1C1, Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)), gene accession number (GeneBank accession No. ) H18681 (C20orf139, Sulfiredoxin 1 homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) DR004094 (HAMP, Hepcidin antimicrobial peptide), gene accession number (GeneBank accession No. ) BC082272 (KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), Gene Accession No. ) BC040494 (DNAJB2, DnaJ (Hsp40) homolog, subfamily B, member 2), gene registration number (GeneBank accession No. ) BC018064 (ATF6, Activating transcription factor 6), gene accession number (GeneBank accession No. ) BC006523 (SGK2, Serum / glucocorticoid regulated kinase 2), gene registration number (GeneBank accession No. ) AK090482 (CXCL12, Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)), gene accession number (GeneBank accession No. ) AF219946 (TULP4, Tubby like protein 4), gene accession number (GeneBank accession No. ) AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), gene accession number (GeneBank accession No. ) NM_005242 (F2RL1, Coagulation factor II (thrombin) receptor-like 1), gene accession number (GeneBank accession No. ) NM_001002029 (C4A, Complement component 4B, telomeric), Gene accession number (GeneBank accession No. ) NM_000539 (RHO, Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)), gene accession number (GeneBank accession No. ) BX649164 (PAI, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene registration number (GeneBank accession No. ) BM918324 (LY96, Lymphocyte antigen 96), gene accession number (GeneBank accession No. ) AB209647 (NCF2, Neutrophil cytosolic factor 2 (65 kDa, chronic granulomatous disease, autosomal 2)), gene accession number (GeneBank accession No. ) NM_152221 (CSNK1E, Casein kinase 1, epsilon), Gene accession number (GeneBank accession No. ) NM_017999 (RNF31, Ring finger protein 31), gene accession number (GeneBank accession No. ) NM_016819 (OGG1, 8-oxoguanine DNA glycosylase), Gene Accession No. ) NM_016816 (OAS1, 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa), Gene Accession No. NM_012235 (SCAP, SREBP cleavage-activating protein), gene accession number (GeneBank accession No. ) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), gene accession number (GeneBank accession No. ) NM_001779 (CD58, CD58 antigen, (lymphocyte function-associated antigen 3)), gene accession number (GeneBank accession No. ) CB055213 (ICOSLG, Inducible T-cell co-stimulator ligand), Gene accession number (GeneBank accession No. ) BX641029 (MASP1, Mannan-binding lectin serine peptidase 1 (C4 / C2 activating component of Ra-reactive factor)), GeneBank accession No. ) BQ053419 (BATF, Basic leucine zipper transcription factor, ATF-like), Gene Accession No. ) BC039299 (STIP1, Stress-induced-phosphoprotein 1 (Hsp70 / Hsp90-organizing protein)), gene accession number (GeneBank accession No. ) AY055760 (DAF, Decay accelerating factor for complement (CD55, Cromer blood group system)), gene accession number (GeneBank accession No. ) AK130188 (FGR, Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog), Gene Accession No. ) AK095326 (MUS81, MUS81 endonuclease homolog (yeast)), gene accession number (GeneBank accession No. NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde binding 1), gene registration number (GeneBank accession No. ) NM_003004 (SECTM1, Secreted and transmembrane 1), gene accession number (GeneBank accession No. ) NM_002309 (LIF, Hypothetical protein MGC20647), gene accession number (GeneBank accession No. ) NM_001421 (ELF4, E74-like factor 4 (ets domain transcription factor)), gene accession number (GeneBank accession No. ) NM_000418 (IL4R, Interleukin 4 receptor), gene accession number (GeneBank accession No. ) BI909222 (FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), gene accession number (GeneBank accession No. ) BF569086 (NK4, Interleukin 32), gene accession number (GeneBank accession No. ) BC014470 (AZGP1, Alpha-2-glycoprotein 1, zinc), gene accession number (GeneBank accession No. ) BC020744 (AKR1C4, Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol), dehydrogenase 4), gene accession number (GeneBank accession No. ) BQ939577 (AKR1C3, Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)), gene accession number (GeneBank accession No. ) NM_000499 (CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) NM_030622 (CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), gene accession number (GeneBank accession No. ) NM_184041 (ALDOA, Aldolase A, fructose-bisphosphate), gene accession number (GeneBank accession No. ) NM_024307 (MGC4171, Hypothetical protein LOC283901), gene accession number (GeneBank accession No. ) NM_005336 (HDLBP, High density lipoprotein binding protein (vigilin)), gene registration number (GeneBank accession No. ) NM_002627 (PFKP, Phosphofructokinase, platelet), Gene Registration Number (GeneBank accession No. ) BX648281 (LDLR, low density lipoprotein receptor (familial hypercholesterolemia)), gene accession number (GeneBank accession No. ) BC069201 (FLJ22761, Hexokinase domain containing 1), gene accession number (GeneBank accession No. ) BC030207 (NR0B2, Nuclear receptor subfamily 0, group B, member 2), gene accession number (GeneBank accession No. ) AL833069 (KIAA1434, Hypothetical protein KIAA1434), gene accession number (GeneBank accession No. ) AK124656 (ENO2, Enolase 2 (gamma, neuronal)), gene accession number (GeneBank accession No. ) AK094474 (RHOC, Ras homolog gene family, member C), gene accession number (GeneBank accession No. ) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene accession number (GeneBank accession No. ) AB053232 (GAL3ST3, Galactose-3-O-sulfotransferase 3), gene accession number (GeneBank accession No. ) AB045292 (TMEM8, Transmembrane protein 8 (five membrane-spanning domains)), gene accession number (GeneBank accession No. ) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), Gene accession number (GeneBank accession No. ) NM_002900 (RBP3, Retinol binding protein 3, interstitial), gene accession number (GeneBank accession No. ) NM_001995 (ACSL1, Acyl-CoA synthetase long-chain family member 1), gene accession number (GeneBank accession No. NM_000018 (ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), gene accession number (GeneBank accession No. ) BC094756 (CRA, Myotubularin related protein 11), gene accession number (GeneBank accession No. ) BC050553 (NTE, Neuropathy target esterase), gene accession number (GeneBank accession No. ) BC033110 (HSD17B1, Hydroxysteroid (17-beta) dehydrogenase 1), Gene accession number (GeneBank accession No. ) AY268890 (TPP1, Tripeptidyl peptidase I), gene accession number (GeneBank accession No. ) AK172798 (CPT1A, Carnitine palmitoyltransferase 1A (liver)), gene accession number (GeneBank accession No. ) AK096809 (CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), gene accession number (GeneBank accession No. ) AK000600 (SIAT7D, ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), Gene accession number ) AB002454 (CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), gene accession number (GeneBank accession No. ) Z29093 (DDR1, Discoidin domain receptor family, member 1), gene accession number (GeneBank accession No. ) Z25424 (MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (GeneBank accession No. ) XM_291277 (DKFZp761P0423, Hypothetical protein DKFZp761P0423), gene accession number (GeneBank accession No. XM_038150 (MAST3, Microtubule associated serine / threonine kinase 3), gene accession number (GeneBank accession No. ) U88357 (ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)), gene accession number (GeneBank accession No. ) NM_025195 (TRIB1, Tribbles homolog 1 (Drosophila)), gene accession number (GeneBank accession No. ) NM_020639 (RIPK4, Receptor-interacting serine-threonine kinase 4), gene accession number (GeneBank accession No. ) NM_014172 (PHPT1, Phosphohistidine phosphatase 1), Gene accession number (GeneBank accession No. ) NM_006254 (PRKCD, Protein kinase C, delta), Gene accession number (GeneBank accession No. ) NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), gene accession number (GeneBank accession No. ) NM_005026 (PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), Gene accession number (GeneBank accession No. ) NM_004431 (EPHA2, EPH receptor A2), gene accession number (GeneBank accession No. ) NM_004419 (DUSP5, Dual specificity phosphatase 5), gene accession number (GeneBank accession No. ) NM_004327 (BCR, Breakpoint cluster region), Gene accession number (GeneBank accession No. ) NM_004231 (ATP6V1F, ATPase, H + transporting, lysosomal 14kDa, V1 subunit F), gene registration number (GeneBank accession No. ) NM_004090 (DUSP3, Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)), gene accession number (GeneBank accession No. ) NM_002843 (PTPRJ, Protein tyrosine phosphatase, receptor type, J), gene accession number (GeneBank accession No. NM_002496 (NDUFS8, NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23 kDa (NADH-coenzyme Q reductase)), gene accession number (GeneBank accession No. NM_001001852 (PIM3, Pim-3 oncogene), gene accession number (GeneBank accession No. ) L76191 (IRAK1, Interleukin-1 receptor-associated kinase 1), gene accession number (GeneBank accession No. ) D15049 (PTPRH, Protein tyrosine phosphatase, receptor type, H), gene accession number (GeneBank accession No. ) BC065207 (ATP6V0D2, ATPase, H + transporting, lysosomal 38kDa, V0 subunit d isoform 2), gene accession number (GeneBank accession No. ) BC035578 (STK24, Serine / threonine kinase 24 (STE20 homolog, yeast)), gene accession number (GeneBank accession No. ) BC028724 (DUSP18, Dual specificity phosphatase 18), gene accession number (GeneBank accession No. AL117482 (ULK3, Unc-51-like kinase 3 (C.  elegans), GeneBank accession No. ) AK126879 (PCTK3, PCTAIRE protein kinase 3), gene accession number (GeneBank accession No. ) AB209416 (ILK, Integrin-linked kinase-2), gene accession number (GeneBank accession No. ) NM_000782 (CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) CR597101 (ZFP36, Zinc finger protein 36, C3H type, homolog (mouse)), Gene accession number (GeneBank accession No. ) CR936799 (FHL2, Four and a half LIM domains 2), gene accession number (GeneBank accession No. ) M24898 (NR1D1, Nuclear receptor subfamily 1, group D, member 1), gene accession number (GeneBank accession No. ) AF132818 (KLF5, Kruppel-like factor 5 (intestinal)), gene accession number (GeneBank accession No. ) AK055337 (ZNF213, Zinc finger protein 213), Gene accession number (GeneBank accession No. ) BC008834 (PHF1, PHD finger protein 1), gene accession number (GeneBank accession No. ) AK126918 (GLIS2, GLIS family zinc finger 2), Gene accession number (GeneBank accession No. ) BC042692 (CTL2, Solute carrier family 44, member 2), gene accession number (GeneBank accession No. ) NM_002224 (ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), gene accession number (GeneBank accession No. ) AK095363 (AQP3, Aquaporin 3), gene accession number (GeneBank accession No. NM_174953 (ATP2A3, ATPase, Ca ++ transporting, ubiquitous), gene accession number (GeneBank accession No. ) BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)), GeneBank Accession No. NM_016113 (TRPV2, Transient receptor potential cation channel, subfamily V, member 2), gene accession number (GeneBank accession No. ) BM926478 (RBP1, Retinol binding protein 1, cellular), gene accession number (GeneBank accession No. NM_000069 (CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), Gene Registration Number (GeneBank accession No. ) AK002107 (RAB3B, RAB3B, member RAS oncogene family), gene accession number (GeneBank accession No. ) NM_013321 (SNX8, Sorting nexin 8), Gene accession number (GeneBank accession No. ) AK125026 (SLC6A12, Solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12), gene accession number (GeneBank accession No. ) NM_005843 (STAM2, Signal transducing adapter molecule (SH3 domain and ITAM motif) 2), gene accession number (GeneBank accession No. ) AK092512 (SLC16A5, Solute carrier family 16 (monocarboxylic acid transporters), member 5), gene accession number (GeneBank accession No. ) U49248 (ABCC2, ATP-binding cassette, sub-family C (CFTR / MRP), member 2), gene accession number (GeneBank accession No. ) AK172792 (SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), gene accession number (GeneBank accession No. ) BC044656 (CASC3, Cancer susceptibility candidate 3), gene accession number (GeneBank accession No. NM_203403 (C9orf150, Chromosome 9 open reading frame 150), gene accession number (GeneBank accession No. NM_080388 (S100A16, S100 calcium binding protein A16), gene registration number (GeneBank accession No. NM_031286 (SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), gene accession number (GeneBank accession No. NM_022153 (PP2135, Chromosome 10 open reading frame 54), gene accession number (GeneBank accession No. ) NM_004864 (GDF15, Growth differentiation factor 15), Gene accession number (GeneBank accession No. ) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene accession number (GeneBank accession No. ) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), gene accession number (GeneBank accession No. ) BX537968 (LOC51149, Hypothetical LOC51149), gene accession number (GeneBank accession No. BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), gene accession number (GeneBank accession No. ) BQ683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), gene accession number (GeneBank accession No. ) BQ276852 (TMSB10, Thymosin, beta 10), gene accession number (GeneBank accession No. ) AK126182 (KIAA1949, KIAA1949), gene accession number (GeneBank accession No. ) AK124751 (CAPN2, Calpain 2, (m / II) large subunit), gene accession number (GeneBank accession No. ) AK095079 (RGC32, Response gene to complement 32), gene accession number (GeneBank accession No. ) AB075871 (FLJ42654, Golgi transport 1 homolog A (S.  cerevisiae)), gene accession number (GeneBank accession No. ) AK125150 (MAPK8, Mitogen-activated protein kinase 8), gene registration number (GeneBank accession No. ) NM_002758 (MAP2K6, Mitogen-activated protein kinase kinase 6), gene accession number (GeneBank accession No. ) NM_004612 (TGFBR1, Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kDa)), gene accession number (GeneBank accession No. NM_145686 (MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4), gene accession number (GeneBank accession No. ) XM_042066 (MAP3K1, Mitogen-activated protein kinase kinase kinase 1), gene accession number (GeneBank accession No. ) AB011123 (TNIK, TRAF2 and NCK interacting kinase), gene accession number (GeneBank accession No. ) AB209031 (C5, Complement component 5), gene accession number (GeneBank accession No. NM_022740 (HIPK2, Homeodomain interacting protein kinase 2), gene accession number (GeneBank accession No. ) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), gene accession number (GeneBank accession No. ) AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)), GeneBank accession No. ) AB209211 (TIA1, TIA1 cytotoxic granule-associated RNA binding protein), gene accession number (GeneBank accession No. ) AB209613 (DNASE1L3, Deoxyribonuclease I-like 3), Gene accession number (GeneBank accession No. ) AK122825 (HMGB1, High-mobility group box 1), gene accession number (GeneBank accession No. ) AK127326 (PHF17, PHD finger protein 17), gene accession number (GeneBank accession No. ) AK223503 (CASP1, Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), gene accession number (GeneBank accession No. ) BC013326 (GAS2, Growth arrest-specific 2), Gene accession number (GeneBank accession No. ) BC047698 (IL7, Interleukin 7), gene accession number (GeneBank accession No. D79987 (ESPL1, Extra spindle poles like 1 (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_000893 (KNG1, Kininogen 1), gene accession number (GeneBank accession No. ) NM_001012271 (BIRC5, Effector cell peptidase receptor 1), gene accession number (GeneBank accession No. ) NM_004938 (DAPK1, Death-associated protein kinase 1), gene accession number (GeneBank accession No. NM_005879 (TRIP, TRAF interacting protein), gene accession number (GeneBank accession No. NM_014739 (BCLAF1, BCL2-associated transcription factor 1), gene accession number (GeneBank accession No. ) NM_018947 (CYCS, Cytochrome c, somatic), Gene accession number (GeneBank accession No. ) AB033337 (MPHOSPH1, M-phase phosphoprotein 1), gene accession number (GeneBank accession No. ) AB209179 (PLK1, Polo-like kinase 1 (Drosophila)), gene accession number (GeneBank accession No. ) AB209337 (CDC7, CDC7 cell division cycle 7 (S.  cerevisiae)), gene accession number (GeneBank accession No. ) AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)), gene accession number (GeneBank accession No. ) AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)), Gene Accession No. ) AF345347 (SPAG5, Sperm associated antigen 5), gene accession number (GeneBank accession No. ) AK092638 (CCNG2, Cyclin G2), gene accession number (GeneBank accession No. ) AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), gene accession number (GeneBank accession No. ) AL833191 (SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1 (yeast)), gene accession number (GeneBank accession No. ) AY257469 (CIT, Citron (rho-interacting, serine / threonine kinase 21)), gene accession number (GeneBank accession No. ) AY367065 (ASPM, Abnormal Spindle-like, microcephaly associated (Drosophila)), GeneBank Accession No. ) BC011000 (CDCA5, Cell division cycle associated 5), gene accession number (GeneBank accession No. ) BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), gene accession number (GeneBank accession No. ) BC043502 (NEK2, never in mitosis gene a) -related kinase 2), gene accession number (GeneBank accession No. BU675073 (PTTG1, Pituitary tumor-transforming 1), gene accession number (GeneBank accession No. ) BX647885 (STMN1, Stathmin 1 / oncoprotein 18), gene accession number (GeneBank accession No. ) CR592757 (BRRN1, Barren homolog 1 (Drosophila)), gene accession number (GeneBank accession No. CR597075 (MAPRE2, Microtubule-associated protein, RP / EB family, member 2), gene accession number (GeneBank accession No. ) CR604810 (CCNA2, Cyclin A2), gene accession number (GeneBank accession No. CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), Gene accession number (GeneBank accession No. ) NM_000919 (PAM, Peptidylglycine alpha-amidating monooxygenase), gene accession number (GeneBank accession No. ) NM_001790 (CDC25C, Cell division cycle 25C), Gene accession number (GeneBank accession No. NM_001798 (CDK2, Cyclin-dependent kinase 2), gene accession number (GeneBank accession No. ) NM_001813 (CENPE, Centromere protein E, 312kDa), Gene accession number (GeneBank accession No. ) NM_003318 (TTK, TTK protein kinase), gene accession number (GeneBank accession No. ) NM_003981 (PRC1, Protein regulator of cytokinesis 1), gene accession number (GeneBank accession No. NM_004523 (KIF11, Kinesin family member 11), gene accession number (GeneBank accession No. ) NM_004701 (CCNB2, Cyclin B2), gene accession number (GeneBank accession No. ) NM_005983 (SKP2, S-phase kinase-associated protein 2 (p45)), gene accession number (GeneBank accession No. NM_006101 (KNTC2, Kinetochore associated 2), gene accession number (GeneBank accession No. ) NM_006845 (KIF2C, Kinesin family member 2C), gene accession number (GeneBank accession No. ) NM_007375 (TARDBP, TAR DNA binding protein), gene registration number (GeneBank accession No. ) NM_012112 (TPX2, TPX2, microtubule-associated, homolog (Xenopus laevis)), gene accession number (GeneBank accession No. ) NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), gene accession number (GeneBank accession No. ) NM_015097 (CLASP2, Cytoplasmic linker associated protein 2), gene accession number (GeneBank accession No. ) NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), gene accession number (GeneBank accession No. NM_016426 (GTSE1, G-2 and S-phase expressed 1), gene accession number (GeneBank accession No. ) NM_018492 (PBK, PDZ binding kinase), gene accession number (GeneBank accession No. NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), gene accession number (GeneBank accession No. ) NM_020242 (KNSL7, Kinesin family member 15), gene accession number (GeneBank accession No. ) NM_031966 (CCNB1, Cyclin B1), gene accession number (GeneBank accession No. NM_138555 (KIF23, Kinesin family member 23), gene accession number (GeneBank accession No. ) U65410 (MAD2L1, MAD2 mitotic arrest deficient-like 1 (yeast)), gene accession number (GeneBank accession No. ) AB020656 (CYLD, Cylindromatosis (turban tumor syndrome)), gene accession number (GeneBank accession No. ) AF033122 (SESN1, Sestrin 1), gene accession number (GeneBank accession No. ) AK074377 (UHRF1, Chromosome 19 open reading frame 31), gene accession number (GeneBank accession No. ) AK091170 (CDKN2C, Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)), gene accession number (GeneBank accession No. ) AK094323 (NFYC, Nuclear transcription factor Y, gamma), gene accession number (GeneBank accession No. ) AY366508 (LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), GeneBank accession No. ) BC033086 (TCF19, Transcription factor 19 (SC1)), gene accession number (GeneBank accession No. ) BC040303 (PTP4A1, Protein tyrosine phosphatase type IVA, member 1), Gene accession number (GeneBank accession No. ) BC040991 (TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2)), gene accession number (GeneBank accession No. BC092412 (SGOL2, Shugoshin-like 2 (S.  pombe), GeneBank accession No. ) BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), gene accession number (GeneBank accession No. ) BX649128 (SESN3, Sestrin 3), gene accession number (GeneBank accession No. ) CD049340 (AURKB, Aurora kinase B), gene accession number (GeneBank accession No. ) M89914 (NF1, Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)), gene accession number (GeneBank accession No. NM_001005414 (ZWINT, ZW10 interactor antisense), gene accession number (GeneBank accession No. ) NM_001008491 (Sep 2, Septin 2), gene accession number (GeneBank accession No. NM_001274 (CHEK1, CHK1 checkpoint homolog (S.  pombe), GeneBank accession No. NM_002105 (H2AFX, H2A histone family, member X), gene accession number (GeneBank accession No. NM_002388 (MCM3, MCM3 minichromosome maintenance deficient 3 (S.  cerevisiae)), gene accession number (GeneBank accession No. NM_002417 (MKI67, Antigen identified by monoclonal antibody Ki-67), gene accession number (GeneBank accession No. NM_002875 (RAD51, RAD51 homolog (RecA homolog, E.  coli) (S.  cerevisiae)), gene accession number (GeneBank accession No. NM_003884 (PCAF, P300 / CBP-associated factor), gene accession number (GeneBank accession No. NM_004526 (MCM2, MCM2 minichromosome maintenance deficient 2, mitotin (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_004847 (AIF1, Allograft inflammatory factor 1), gene accession number (GeneBank accession No. NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S.  pombe) (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_012090 (MACF1, Microtubule-actin crosslinking factor 1), Gene Registration Number (GeneBank accession No. NM_012415 (RAD54B, RAD54 homolog B (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_014264 (PLK4, Polo-like kinase 4 (Drosophila)), gene accession number (GeneBank accession No. ) NM_015714 (G0S2, G0 / G1switch 2), gene accession number (GeneBank accession No. NM_024680 (FLJ23311, E2F transcription factor 8), gene accession number (GeneBank accession No. XM_034274 (MYBL1, V-myb myeloblastosis viral oncogene homolog (avian) -like 1), gene accession number (GeneBank accession No. ) AK001720 (FLJ10858, Nei endonuclease VIII-like 3 (E.  coli)), and GeneBank accession No. ) AY032677 (POLQ, Polymerase (DNA directed), theta), Gene Accession No. ) BC034480 (BLM, Bloom syndrome), Gene accession number (GeneBank accession No. BC073161 (RAD51C, RAD51 homolog C (S.  cerevisiae)), gene accession number (GeneBank accession No. CR600021 (HMGB2, High-mobility group box 2), gene accession number (GeneBank accession No. CR625391 (RAD51AP1, RAD51 associated protein 1), gene accession number (GeneBank accession No. CR936783 (FLJ40869, Hypothetical protein LOC284952), gene accession number (GeneBank accession No. ) DQ140356 (KIAA1596, Fanconi anemia, complementation group M), gene accession number (GeneBank accession No. ) NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), gene accession number (GeneBank accession No. ) NM_001618 (PARP1, Poly (ADP-ribose) polymerase family, member 1), gene accession number (GeneBank accession No. ) NM_003362 (UNG, Uracil-DNA glycosylase), gene accession number (GeneBank accession No. ) NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), Gene accession number (GeneBank accession No. ) NM_130398 (EXO1, Exonuclease 1), gene accession number (GeneBank accession No. ) AB020807 (TLR6, Toll-like receptor 6), gene accession number (GeneBank accession No. ) AB032980 (DCDC2, Doublecortin domain containing 2), gene accession number (GeneBank accession No. ) AB209866 (TFPI, Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)), gene accession number (GeneBank accession No. ) AK057015 (HSPA4, Heat shock 70kDa protein 4), Gene accession number (GeneBank accession No. ) AK095515 (IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), gene accession number (GeneBank accession No. ) AK122686 (IF, I factor (complement), gene accession number (GeneBank accession No. ) AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide), gene accession number (GeneBank accession No. ) BC035582 (TRIM22, Tripartite motif-containing 22), gene accession number (GeneBank accession No. ) BX537894 (LOC493869, Similar to RIKEN cDNA 2310016C16), gene accession number (GeneBank accession No. ) M14338 (PROS1, Protein S (alpha)), gene accession number (GeneBank accession No. ) NM_000821 (GGCX, Gamma-glutamyl carboxylase), gene accession number (GeneBank accession No. ) NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), Gene Accession No. NM_001001547 (CD36, CD36 antigen (collagen type I receptor, thrombospondin receptor)), gene accession number (GeneBank accession No. NM_001512 (GSTA4, Glutathione S-transferase A4), gene accession number (GeneBank accession No. NM_001629 (ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), gene accession number (GeneBank accession No. ) NM_001752 (CAT, Catalase), gene accession number (GeneBank accession No. NM_001837 (CCR3, Chemokine (C-C motif) receptor 3), gene accession number (GeneBank accession No. ) NM_001979 (EPHX2, Epoxide hydrolase 2, cytoplasmic), gene registration number (GeneBank accession No. ) NM_001994 (F13B, Coagulation factor XIII, B polypeptide), gene accession number (GeneBank accession No. ) NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), gene accession number (GeneBank accession No. ) NM_006120 (HLA-DMA, Major histocompatibility complex, class II, DM alpha), Gene accession number (GeneBank accession No. NM_173216 (SIAT1, ST6 beta-galactosamide alpha-2,6-sylyltranferase 1), gene accession number (GeneBank accession No. NM_202002 (FOXM1, Forkhead box M1), gene accession number (GeneBank accession No. ) AB163917 (LRAP, Leukocyte-derived arginine aminopeptidase), Gene accession number (GeneBank accession No. ) BC027881 (AFP, Alpha-fetoprotein), gene accession number (GeneBank accession No. ) NM_015915 (SPG3A, Spastic paraplegia 3A (autosomal dominant)), gene accession number (GeneBank accession No. ) NM_000671 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), gene registration number (GeneBank accession No. ) J05428 (UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), gene accession number (GeneBank accession No. ) NM_000672 (ADH6, Alcohol dehydrogenase 6 (class V)), gene accession number (GeneBank accession No. ) M15943 (ADH4, Alcohol dehydrogenase 4 (class II), pi polypeptide), gene accession number (GeneBank accession No. ) AK223395 (FBP1, Fructose-1,6-bisphosphatase 1), gene accession number (GeneBank accession No. NM_000151 (G6PC, Glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)), gene accession number (GeneBank accession No. XM_113962 (KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), gene accession number (GeneBank accession No. ) AB020644 (ACSL6, Acyl-CoA synthetase long-chain family member 6), gene accession number (GeneBank accession No. ) AB209907 (PLD1, Phospholipase D1, phophatidylcholine-specific), gene accession number (GeneBank accession No. ) AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1), member 1), gene accession number (GeneBank accession No. ) AF297872 (TRERF1, Transcriptional regulating factor 1), gene registration number (GeneBank accession No. ) AF303134 (ALDH8A1, Aldehyde dehydrogenase 8 family, member A1), gene accession number (GeneBank accession No. ) AF339053 (PLA2G12B, Phospholipase A2, group XIIB), gene accession number (GeneBank accession No. ) AK096018 (HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), gene accession number (GeneBank accession No. ) AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), gene registration number (GeneBank accession No. ) AK127346 (SIAT9, ST3 beta-galactoside alpha-2,3- sialyltransferase 5), gene accession number (GeneBank accession No. ) AL359559 (AGPS, Alkylglycerone phosphate synthase), gene accession number (GeneBank accession No. ) AY691170 (PLCL3, Phospholipase C-like 3), gene accession number (GeneBank accession No. ) BG567934 (APOM, Apolipoprotein M), gene accession number (GeneBank accession No. ) BX538214 (C6orf167, Chromosome 6 open reading frame 167), gene accession number (GeneBank accession No. ) BX640945 (FADS2, Fatty acid desaturase 2), gene accession number (GeneBank accession No. ) BX648473 (PIGK, Phosphatidylinositol glycan, class K), gene accession number (GeneBank accession No. ) BX648557 (HSD17B2, Hydroxysteroid (17-beta) dehydrogenase 2), Gene accession number (GeneBank accession No. ) CR749601 (ETNK1, Death-associated protein kinase 3), gene accession number (GeneBank accession No. ) NM_000859 (HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), gene accession number (GeneBank accession No. ) NM_001443 (FABP1, Fatty acid binding protein 1, liver), gene accession number (GeneBank accession No. ) NM_002130 (HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)), gene accession number (GeneBank accession No. ) NM_003725 (RODH, Hydroxysteroid (17-beta) dehydrogenase 6), Gene accession number (GeneBank accession No. NM_004845 (PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), Gene accession number (GeneBank accession No. ) NM_014762 (DHCR24, 24-dehydrocholesterol reductase), gene accession number (GeneBank accession No. ) NM_020139 (DHRS6, Dehydrogenase / reductase (SDR family) member 6), gene registration number (GeneBank accession No. NM_020918 (GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), gene accession number (GeneBank accession No. NM_032523 (OSBPL6, Oxysterol binding protein-like 6), gene accession number (GeneBank accession No. ) NM_033505 (SELI, Selenoprotein I), gene accession number (GeneBank accession No. ) Z28339 (AKR1D1, Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)), GeneBank accession No. ) AK024899 (ENPP3, Ectonucleotide pyrophosphatase / phosphodiesterase 3), gene accession number (GeneBank accession No. ) AK025546 (PTPN4, Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)), Gene accession number (GeneBank accession No. ) AK124910 (ENPP2, Ectonucleotide pyrophosphatase / phosphodiesterase 2 (autotaxin)), gene accession number (GeneBank accession No. ) BC035116 (FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), gene registration number (GeneBank accession No. ) BC050565 (PASK, PAS domain containing serine / threonine kinase), gene accession number (GeneBank accession No. ) L13436 (NPR2, Natriuretic peptide receptor B / guanylate cyclase B (atrionatriuretic peptide receptor B)), gene accession number (GeneBank accession No. ) NM_001005862 (ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro / glioblastoma derived oncogene homolog (avian)), gene accession number (GeneBank accession No. NM_005012 (ROR1, Receptor tyrosine kinase-like orphan receptor 1), gene accession number (GeneBank accession No. NM_006035 (CDC42BPB, CDC42 binding protein kinase beta (DMPK-like)), gene accession number (GeneBank accession No. NM_014791 (MELK, Maternal embryonic leucine zipper kinase), gene accession number (GeneBank accession No. NM_023028 (FGFR2, Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), gene registration number (GeneBank accession No. ) NM_080836 (STK35, Serine / threonine kinase 35), gene accession number (GeneBank accession No. ) AF419331 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), gene accession number (GeneBank accession No. ) AK091927 (SFRS3, Splicing factor, arginine / serine-rich 3), gene accession number (GeneBank accession No. ) BC010266 (HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), gene accession number (GeneBank accession No. ) BC012360 (CTAGE5, CTAGE family, member 5), gene accession number (GeneBank accession No. ) BC036046 (PLRG1, Pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)), gene accession number (GeneBank accession No. BC065384 (PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) BX537360 (CPSF5, Nudix (nucleoside diphosphate linked moiety X) -type motif 21), GeneBank accession No. ) BX537494 (HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2 / B1), gene accession number (GeneBank accession No. ) BX647784 (HNRPR, Heterogeneous nuclear ribonucleoprotein R), gene registration number (GeneBank accession No. ) CA455267 (PPIH, Peptidyl prolyl isomerase H (cyclophilin H)), gene accession number (GeneBank accession No. ) CR596214 (HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), gene accession number (GeneBank accession No. NM_001326 (CSTF3, Hypothetical protein LOC283267), gene accession number (GeneBank accession No. ) NM_004640 (BAT1, HLA-B associated transcript 1), gene accession number (GeneBank accession No. NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), gene accession number (GeneBank accession No. ) NM_006924 (SFRS1, Splicing factor, arginine / serine-rich 1 (splicing factor 2, alternate splicing factor)), gene accession number (GeneBank accession No. ) NM_012426 (SF3B3, Splicing factor 3b, subunit 3, 130 kDa), Gene accession number (GeneBank accession No. NM_018048 (FLJ10292, Mago-nashi homolog), gene accession number (GeneBank accession No. NM_030919 (C20orf129, Chromosome 20 open reading frame 129), gene accession number (GeneBank accession No. ) NM_031370 (HNRPD, Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa)), gene registration number (GeneBank accession No. ) NM_138933 (ACF, Apobec-1 complementation factor), gene accession number (GeneBank accession No. ) AB193259 (ACE2, Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2), gene accession number (GeneBank accession No. ) BX648769 (EWSR1, Ewing sarcoma breakpoint region 1), gene accession number (GeneBank accession No. ) AB023154 (DTX4, Deltex 4 homolog (Drosophila)), gene accession number (GeneBank accession No. ) AL543755 (VAV3, Vav 3 oncogene), gene accession number (GeneBank accession No. ) M75106 (CPB2, Carboxypeptidase B2 (plasma, carboxypeptidase U)), gene accession number (GeneBank accession No. NM_021045 (ZNF248, Zinc finger protein 248), gene accession number (GeneBank accession No. ) AB209194 (B4GALT6, UDP-Gal: betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6), gene accession number (GeneBank accession No. ) AF279145 (ANTXR1, Anthrax toxin receptor 1), gene accession number (GeneBank accession No. ) NM_025074 (FRAS1, Fraser syndrome 1), gene accession number (GeneBank accession No. ) AK025790 (KIF20A, Kinesin family member 20A), gene accession number (GeneBank accession No. ) NM_006152 (LRMP, Lymphoid-restricted membrane protein), gene accession number (GeneBank accession No. ) NM_000340 (SLC2A2, Solute carrier family 2 (facilitated glucose transporter), member 2), gene accession number (GeneBank accession No. ) AF071592 (KIF4A, Kinesin family member 4A), gene accession number (GeneBank accession No. NM_013277 (RACGAP1, Rac GTPase activating protein 1), gene accession number (GeneBank accession No. ) AY043484 (SCN1A, Sodium channel, voltage-gated, type I, alpha), Gene Registration Number (GeneBank accession No. ) AY791349 (KIF18A, Kinesin family member 18A), gene accession number (GeneBank accession No. ) NM_018018 (SLC38A4, Solute carrier family 38, member 4), gene accession number (GeneBank accession No. ) AK094603 (FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. ), Gene accession number (GeneBank accession No. NM_021069 (ARGBP2, Sorbin and SH3 domain containing 2), gene accession number (GeneBank accession No. NM_001005747 (CACNB4, Calcium channel, voltage-dependent, beta 4 subunit), Gene accession number (GeneBank accession No. ) AJ496568 (SLC25A12, Solute carrier family 25 (mitochondrial carrier, Aralar), member 12), gene accession number (GeneBank accession No. ) NM_030641 (APOL6, Apolipoprotein L, 6), gene accession number (GeneBank accession No. NM_173512 (FLJ39822, Hypothetical protein FLJ39822), gene accession number (GeneBank accession No. ) NM_000037 (ANK1, Ankyrin 1, erythrocytic), gene accession number (GeneBank accession No. ) NM_001011554 (SLC13A3, Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3), gene accession number (GeneBank accession No. ) AB091343 (C10orf3, Centrosomal protein 55kDa), gene accession number (GeneBank accession No. ) AK000643 (ASB9, Ankyrin repeat and SOCS box-containing 9), gene accession number (GeneBank accession No. ) AK055221 (FBXO5, F-box protein 5), gene accession number (GeneBank accession No. ) AK075271 (SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)), gene accession number (GeneBank accession No. ) AK122685 (GLUD1, Glutamate dehydrogenase 1), gene accession number (GeneBank accession No. ) AK127098 (FLJ10706, Chromosome 1 open reading frame 112), gene accession number (GeneBank accession No. ) AL133031 (MLR1, Transcription factor MLR1), gene accession number (GeneBank accession No. ) AY007723 (MAL2, Mal, T-cell differentiation protein 2), gene accession number (GeneBank accession No. BC022255 (Spc25, Spindle pole body component 25 homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) BC041882 (ATF7IP2, Activating transcription factor 7 interacting protein 2), gene accession number (GeneBank accession No. ) BC052951 (LMNB1, Lamin B1), gene accession number (GeneBank accession No. ) BC098313 (FLJ20641, Hypothetical protein FLJ20641), gene accession number (GeneBank accession No. ) NM_001809 (CENPA, Centromere protein A, 17kDa), gene accession number (GeneBank accession No. NM_145061 (C13orf3, Chromosome 13 open reading frame 3), gene accession number (GeneBank accession No. XM_372695 (LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase (LOC390859), mRNA).

1) 상기 바이오마커 중에서 페난트렌의 노출에 의해 발현이 증가하는 바이오마커 유전자는 하기와 같다: 1) Biomarker genes whose expression is increased by exposure of phenanthrene in the biomarkers are as follows:

유전자 등록번호(GeneBank accession No.) NM_004420(DUSP8, Dual specificity phosphatase 8), 유전자 등록번호(GeneBank accession No.) L11329(DUSP2, Dual specificity phosphatase 2), 유전자 등록번호(GeneBank accession No.) BC094766(PKN1, Protein kinase N1), 유전자 등록번호(GeneBank accession No.) AY247738(TRIB3, Tribbles homolog 3(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK129595(GADD45B, Growth arrest and DNA-damage- inducible, beta), 유전자 등록번호(GeneBank accession No.) AB208849(SHC1, SHC(Src homology 2 domain containing) transforming protein 1), 유전자 등록번호(GeneBank accession No.) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)),유전자 등록번호(GeneBank accession No.) NM_198951(TGM2, Transglutaminase 2(C polypeptide, protein-glutamine-gamma-glutamyltransferase)), 유전자 등록번호(GeneBank accession No.) NM_147780(CTSB, Cathepsin B), 유전자 등록번호(GeneBank accession No.) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(GeneBank accession No.) NM_033027(AXUD1, AXIN1 up-regulated 1), 유전자 등록번호(GeneBank accession No.) NM_032797(AMID, Apoptosis-inducing factor(AIF)-like mitochondrion-associated inducer of death), 유전자 등록번호(GeneBank accession No.) NM_021960(MCL1, Myeloid cell leukemia sequence 1(BCL2-related)), 유전자 등록번호(GeneBank accession No.) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(GeneBank accession No.) NM_016222(DDX41, DEAD(Asp-Glu-Ala-Asp) box polypeptide 41), 유전자 등록번호(GeneBank accession No.) NM_013246(CLC, Cardiotrophin-like cytokine factor 1), 유전자 등록번호(GeneBank accession No.) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004281(BAG3, BCL2-associated athanogene 3), 유전자 등록번호(GeneBank accession No.) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(GeneBank accession No.) NM_003806(HRK, Harakiri, BCL2 interacting protein(contains only BH3 domain)), 유전자 등록번호(GeneBank accession No.) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(GeneBank accession No.) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(GeneBank accession No.) NM_002737(PRKCA, Protein kinase C, alpha), 유전자 등록번호(GeneBank accession No.) NM_002648(PIM1, Pim-1 oncogene), 유전자 등록번호(GeneBank accession No.) NM_002507(NGFR, Nerve growth factor receptor(TNFR superfamily, member 16)), 유전자 등록번호(GeneBank accession No.) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(GeneBank accession No.) NM_001013398(IGFBP3, Insulin-like growth factor binding protein 3), 유전자 등록번호(GeneBank accession No.) BX640923(MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein(mouse)), 유전자 등록번호(GeneBank accession No.) BX537586(STK17A, Serine/threonine kinase 17a(apoptosis-inducing)), 유전자 등록번호(GeneBank accession No.) BG284742(P8, P8 protein(candidate of metastasis 1)), 유전자 등록번호(GeneBank accession No.) BE903247(PDCD6IP, Programmed cell death 6 interacting protein), 유전자 등록번호(GeneBank accession No.) BC027949(P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), 유전자 등록번호(GeneBank accession No.) BC006365(PSEN2, Presenilin 2(Alzheimer disease 4)), 유전자 등록번호(GeneBank accession No.) AY869712(PPP1R13L, Protein phosphatase 1, regulatory(inhibitor) subunit 13 like), 유전자 등록번호(GeneBank accession No.) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(GeneBank accession No.) AK122614(PPARD, Peroxisome proliferative activated receptor, delta), 유전자 등록번호(GeneBank accession No.) AK092872(ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2(xeroderma pigmentosum D)), 유전자 등록번호(GeneBank accession No.) AK092808(RRAGC, Ras-related GTP binding C), 유전자 등록번호(GeneBank accession No.) AJ001898(GDNF, Glial cell derived neurotrophic factor), 유전자 등록번호(GeneBank accession No.) AF220656(PHLDA1, Pleckstrin homology-like domain, family A, member 1), 유전자 등록번호(GeneBank accession No.) AF055634(UNC5C, Unc-5 homolog C(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB209485(VEGF, Vascular endothelial growth factor), 유전자 등록번호(GeneBank accession No.) AB096256(UNC5B, Unc-5 homolog B(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB007960(SH3GLB1, SH3-domain GRB2-like endophilin B1), 유전자 등록번호(GeneBank accession No.) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(GeneBank accession No.) S62138(DDIT3, DNA-damage-inducible transcript 3), 유전자 등록번호(GeneBank accession No.) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(GeneBank accession No.) NM_005883(APC2, Adenomatosis polyposis coli 2), 유전자 등록번호(GeneBank accession No.) NM_004196(CDKL1, Cyclin-dependent kinase-like 1(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_003236(TGFA, Transforming growth factor, alpha), 유전자 등록번호(GeneBank accession No.) NM_001261(CDK9, Cyclin-dependent kinase 9(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(GeneBank accession No.) CR749511(PARC, P53-associated parkin-like cytoplasmic protein), 유전자 등록번호(GeneBank accession No.) CR623038(ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(GeneBank accession No.) CR618371(EGFR, Epidermal growth factor receptor(erythroblastic leukemia viral(v-erb-b) oncogene homolog, avian)), 유전자 등록번호(GeneBank accession No.) BF965144(IFITM1, Interferon induced transmembrane protein 1(9-27)), 유전자 등록번호(GeneBank accession No.) AK127679(DUSP1, Dual specificity phosphatase 1), 유전자 등록번호(GeneBank accession No.) AK096276(CCND3, Cyclin D3), 유전자 등록번호(GeneBank accession No.) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(GeneBank accession No.) AB209465(PCTK1, PCTAIRE protein kinase 1), 유전자 등록번호(GeneBank accession No.) Z19588(SKIL, SKI-like), 유전자 등록번호(GeneBank accession No.) NM_020429(SMURF1, SMAD specific E3 ubiquitin protein ligase 1), 유전자 등록번호(GeneBank accession No.) NM_014767(SPOCK2, Sparc/osteonectin, cwcv and kazal-like domains proteoglycan(testican) 2), 유전자 등록번호(GeneBank accession No.) NM_005979(S100A13, S100 calcium binding protein A13), 유전자 등록번호(GeneBank accession No.) NM_005187(CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), 유전자 등록번호(GeneBank accession No.) NM_004364(CEBPA, CCAAT/enhancer binding protein(C/EBP), alpha), 유전자 등록번호(GeneBank accession No.) NM_001769(CD9, CD9 antigen(p24)), 유전자 등록번호(GeneBank accession No.) NM_001718(BMP6, Bone morphogenetic protein 6), 유전자 등록번호(GeneBank accession No.) NM_000641(IL11, Interleukin 11), 유전자 등록번호(GeneBank accession No.) BX647459(SERPINE2, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 2), 유전자 등록번호(GeneBank accession No.) BQ066037(RPS19, Ribosomal protein S19), 유전자 등록번호(GeneBank accession No.) BE791300(EDF1, Endothelial differentiation-related factor 1), 유전자 등록번호(GeneBank accession No.) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(GeneBank accession No.) AL832287(ZAP70, Zeta-chain(TCR) associated protein kinase 70kDa), 유전자 등록번호(GeneBank accession No.) AK125742(PCGF1, Polycomb group ring finger 1), 유전자 등록번호(GeneBank accession No.) AK124709(NDRG1, N-myc downstream regulated gene 1), 유전자 등록번호(GeneBank accession No.) AB011157(PTDSR, Phosphatidylserine receptor), 유전자 등록번호(GeneBank accession No.) NM_013255(MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), 유전자 등록번호(GeneBank accession No.) NM_006572(GNA13, Guanine nucleotide binding protein(G protein), alpha 13), 유전자 등록번호(GeneBank accession No.) NM_002211(ITGB1, Integrin, beta 1(fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), 유전자 등록번호(GeneBank accession No.) CR601067(PLAUR, Plasminogen activator, urokinase receptor), 유전자 등록번호(GeneBank accession No.) BC050456(THBS4, Thrombospondin 4), 유전자 등록번호(GeneBank accession No.) AK027389(CXCL16, Chemokine(C-X-C motif) ligand 16), 유전자 등록번호(GeneBank accession No.) AJ132099(VNN1, Vanin 1), 유전자 등록번호(GeneBank accession No.) XM_371354(FLJ10157, Hypothetical protein FLJ10157), 유전자 등록번호(GeneBank accession No.) XM_208313(TPM3, Similar to tropomyosin 4), 유전자 등록번호(GeneBank accession No.) XM_208270(ACR, Acrosin-like protease), 유전자 등록번호(GeneBank accession No.) NM_203353(PDLIM7, PDZ and LIM domain 7(enigma)), 유전자 등록번호(GeneBank accession No.) NM_201382(PLEC1, Plectin 1, intermediate filament binding protein 500kDa), 유전자 등록번호(GeneBank accession No.) NM_182961(SYNE1, Spectrin repeat containing, nuclear envelope 1), 유전자 등록번호(GeneBank accession No.) NM_181826(NF2, Neurofibromin 2(bilateral acoustic neuroma)), 유전자 등록번호(GeneBank accession No.) NM_172069(PLEKHH2, Pleckstrin homology domain containing, family H(with MyTH4 domain) member 2), 유전자 등록번호(GeneBank accession No.) NM_022648(TNS, Tensin 1), 유전자 등록번호(GeneBank accession No.) NM_017556(FBLP-1, Filamin binding LIM protein 1), 유전자 등록번호(GeneBank accession No.) NM_016081(KIAA0992, Palladin, cytoskeletal associated protein), 유전자 등록번호(GeneBank accession No.) NM_006617(NES, Nestin), 유전자 등록번호(GeneBank accession No.) NM_006262(PRPH, Peripherin), 유전자 등록번호(GeneBank accession No.) NM_005100(AKAP12, A kinase(PRKA) anchor protein(gravin) 12), 유전자 등록번호(GeneBank accession No.) NM_004368(CNN2, Calponin 2), 유전자 등록번호(GeneBank accession No.) NM_003388(CYLN2, Cytoplasmic linker 2), 유전자 등록번호(GeneBank accession No.) NM_003370(VASP, Vasodilator-stimulated phosphoprotein), 유전자 등록번호(GeneBank accession No.) NM_003128(SPTBN1, Spectrin, beta, non-erythrocytic 1), 유전자 등록번호(GeneBank accession No.) NM_002705(PPL, Periplakin), 유전자 등록번호(GeneBank accession No.) NM_002475(MLC1SA, Myosin light chain 1 slow a), 유전자 등록번호(GeneBank accession No.) NM_002018(FLII, Flightless I homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_001465(FYB, FYN binding protein(FYB-120/130)), 유전자 등록번호(GeneBank accession No.) NM_001069(TUBB2, Tubulin, beta 2A), 유전자 등록번호(GeneBank accession No.) CR625172(MGC8685, Tubulin, beta 2B), 유전자 등록번호(GeneBank accession No.) CR616919(KRT18, Keratin 18), 유전자 등록번호(GeneBank accession No.) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(GeneBank accession No.) CB240572(MYH11, Myosin, heavy polypeptide 11, smooth muscle), 유전자 등록번호(GeneBank accession No.) BX648253(PTPN3, Protein tyrosine phosphatase, non-receptor type 3), 유전자 등록번호(GeneBank accession No.) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(GeneBank accession No.) BX641076(ACTN1, Actinin, alpha 1), 유전자 등록번호(GeneBank accession No.) BX537978(EPB41L1, Erythrocyte membrane protein band 4.1-like 1), 유전자 등록번호(GeneBank accession No.) BG121847(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(GeneBank accession No.) BC068013(MYO1C, Myosin IC), 유전자 등록번호(GeneBank accession No.) BC065499(MAST2, Microtubule associated serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) BC051890(TUBG2, Tubulin, gamma 2), 유전자 등록번호(GeneBank accession No.) BC041874(MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), 유전자 등록번호(GeneBank accession No.) BC012597(ACTA1, Actin, alpha 1, skeletal muscle), 유전자 등록번호(GeneBank accession No.) AY484427(KIF17, Kinesin family member 17), 유전자 등록번호(GeneBank accession No.) AK130546(STOML2, Stomatin(EPB72)-like 2), 유전자 등록번호(GeneBank accession No.) AK124711(CORO2B, Coronin, actin binding protein, 2B), 유전자 등록번호(GeneBank accession No.) AK123974(MYL5, Myosin, light polypeptide 5, regulatory), 유전자 등록번호(GeneBank accession No.) AK092792(LOC389833, Similar to hypothetical protein MGC27019), 유전자 등록번호(GeneBank accession No.) AK026518(MYOHD1, Myosin head domain containing 1), 유전자 등록번호(GeneBank accession No.) AK024500(NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), 유전자 등록번호(GeneBank accession No.) AF085886(FLJ46675, Ribosomal protein L29 pseudogene 2), 유전자 등록번호(GeneBank accession No.) AB209997(MYO9B, Myosin IXB), 유전자 등록번호(GeneBank accession No.) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(GeneBank accession No.) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(GeneBank accession No.) X17033(ITGA2, Integrin, alpha 2(CD49B, alpha 2 subunit of VLA-2 receptor)), 유전자 등록번호(GeneBank accession No.) U41763(CLTCL1, Clathrin, heavy polypeptide-like 1), 유전자 등록번호(GeneBank accession No.) NM_153609(TMPRSS6, Transmembrane protease, serine 6), 유전자 등록번호(GeneBank accession No.) NM_031483(ITCH, Itchy homolog E3 ubiquitin protein ligase(mouse)), 유전자 등록번호(GeneBank accession No.) NM_024342(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(GeneBank accession No.) NM_017555(EGLN2, Egl nine homolog 2(C. elegans)), 유전자 등록번호(GeneBank accession No.) NM_016569(TBX3, T-box 3(ulnar mammary syndrome)), 유전자 등록번호(GeneBank accession No.) NM_004148(NINJ1, Ninjurin 1), 유전자 등록번호(GeneBank accession No.) NM_003377(VEGFB, Vascular endothelial growth factor B), 유전자 등록번호(GeneBank accession No.) NM_001983(ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1(includes overlapping antisense sequence)), 유전자 등록번호(GeneBank accession No.) NM_001552(IGFBP4, Insulin-like growth factor binding protein 4), 유전자 등록번호(GeneBank accession No.) NM_001430(EPAS1, Endothelial PAS domain protein 1), 유전자 등록번호(GeneBank accession No.) NM_001300(KLF6, Kruppel-like factor 6), 유전자 등록번호(GeneBank accession No.) NM_001012661(SLC3A2, Solute carrier family 3(activators of dibasic and neutral amino acid transport), member 2), 유전자 등록번호(GeneBank accession No.) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(GeneBank accession No.) NM_000474(TWIST1, Twist homolog 1(acrocephalosyndactyly 3; Saethre-Chotzen syndrome)(Drosophila)), 유전자 등록번호(GeneBank accession No.) BX649103(ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), 유전자 등록번호(GeneBank accession No.) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(GeneBank accession No.) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(GeneBank accession No.) BM556279(EMP3, Epithelial membrane protein 3), 유전자 등록번호(GeneBank accession No.) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(GeneBank accession No.) AY258066(OKL38, Pregnancy-induced growth inhibitor), 유전자 등록번호(GeneBank accession No.) AK126729(NDRG4, NDRG family member 4), 유전자 등록번호(GeneBank accession No.) AK090459(NFE2L1, Nuclear factor(erythroid-derived 2)-like 1), 유전자 등록번호(GeneBank accession No.) AK074163(ROBO4, Roundabout homolog 4, magic roundabout(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK024680(FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), 유전자 등록번호(GeneBank accession No.) AF176422(HEY1, Hairy/enhancer-of-split related with YRPW motif 1), 유전자 등록번호(GeneBank accession No.) AF003837(JAG1, Jagged 1(Alagille syndrome)), 유전자 등록번호(GeneBank accession No.) AB209322(SEMA3B, Sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3B), 유전자 등록번호(GeneBank accession No.) AB011150(NRXN1, Neurexin 1), 유전자 등록번호(GeneBank accession No.) NM_201589(MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A(avian)), 유전자 등록번호(GeneBank accession No.) NM_052999(CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), 유전자 등록번호(GeneBank accession No.) NM_006644(HSPH1, Heat shock 105kDa/110kDa protein 1), 유전자 등록번호(GeneBank accession No.) NM_005438(FOSL1, FOS-like antigen 1), 유전자 등록번호(GeneBank accession No.) NM_004996(ABCC1, ATP-binding cassette, sub- family C(CFTR/MRP), member 1), 유전자 등록번호(GeneBank accession No.) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(GeneBank accession No.) NM_001353(AKR1C1, Aldo-keto reductase family 1, member C1(dihydrodiol dehydrogenase 1; 20-alpha(3-alpha)-hydroxysteroid dehydrogenase)), 유전자 등록번호(GeneBank accession No.) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) DR004094(HAMP, Hepcidin antimicrobial peptide), 유전자 등록번호(GeneBank accession No.) BC082272(KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), 유전자 등록번호(GeneBank accession No.) BC040494(DNAJB2, DnaJ(Hsp40) homolog, subfamily B, member 2), 유전자 등록번호(GeneBank accession No.) BC018064(ATF6, Activating transcription factor 6), 유전자 등록번호(GeneBank accession No.) BC006523(SGK2, Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(GeneBank accession No.) AK090482(CXCL12, Chemokine(C-X-C motif) ligand 12(stromal cell-derived factor 1)), 유전자 등록번호(GeneBank accession No.) AF219946(TULP4, Tubby like protein 4), 유전자 등록번호(GeneBank accession No.) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(GeneBank accession No.) NM_005242(F2RL1, Coagulation factor II(thrombin) receptor-like 1), 유전자 등록번호(GeneBank accession No.) NM_001002029(C4A, Complement component 4B, telomeric), 유전자 등록번호(GeneBank accession No.) NM_000539(RHO, Rhodopsin(opsin 2, rod pigment)(retinitis pigmentosa 4, autosomal dominant)), 유전자 등록번호(GeneBank accession No.) BX649164(PAI, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(GeneBank accession No.) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(GeneBank accession No.) AB209647(NCF2, Neutrophil cytosolic factor 2(65kDa, chronic granulomatous disease, autosomal 2)), 유전자 등록번호(GeneBank accession No.) NM_152221(CSNK1E, Casein kinase 1, epsilon), 유전자 등록번호(GeneBank accession No.) NM_017999(RNF31, Ring finger protein 31), 유전자 등록번호(GeneBank accession No.) NM_016819(OGG1, 8-oxoguanine DNA glycosylase), 유전자 등록번호(GeneBank accession No.) NM_016816(OAS1, 2',5'-oligoadenylate synthetase 1, 40/46kDa), 유전자 등록번호(GeneBank accession No.) NM_012235(SCAP, SREBP cleavage-activating protein), 유전자 등록번호(GeneBank accession No.) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(GeneBank accession No.) NM_001779(CD58, CD58 antigen,(lymphocyte function-associated antigen 3)), 유전자 등록번호(GeneBank accession No.) CB055213(ICOSLG, Inducible T-cell co-stimulator ligand), 유전자 등록번호(GeneBank accession No.) BX641029(MASP1, Mannan-binding lectin serine peptidase 1(C4/C2 activating component of Ra-reactive factor)), 유전자 등록번호(GeneBank accession No.) BQ053419(BATF, Basic leucine zipper transcription factor, ATF-like), 유전자 등록번호(GeneBank accession No.) BC039299(STIP1, Stress-induced-phosphoprotein 1(Hsp70/Hsp90-organizing protein)), 유전자 등록번호(GeneBank accession No.) AY055760(DAF, Decay accelerating factor for complement(CD55, Cromer blood group system)), 유전자 등록번호(GeneBank accession No.) AK130188(FGR, Gardner-Rasheed feline sarcoma viral(v-fgr) oncogene homolog), 유전자 등록번호(GeneBank accession No.) AK095326(MUS81, MUS81 endonuclease homolog(yeast)), 유전자 등록번호(GeneBank accession No.) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(GeneBank accession No.) NM_003004(SECTM1, Secreted and transmembrane 1), 유전자 등록번호(GeneBank accession No.) NM_002309(LIF, Hypothetical protein MGC20647), 유전자 등록번호(GeneBank accession No.) NM_001421(ELF4, E74-like factor 4(ets domain transcription factor)), 유전자 등록번호(GeneBank accession No.) NM_000418(IL4R, Interleukin 4 receptor), 유전자 등록번호(GeneBank accession No.) BI909222(FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), 유전자 등록번호(GeneBank accession No.) BF569086(NK4, Interleukin 32), 유전자 등록번호(GeneBank accession No.) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(GeneBank accession No.) BC020744(AKR1C4, Aldo-keto reductase family 1, member C4(chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol),dehydrogenase 4), 유전자 등록번호(GeneBank accession No.) BQ939577(AKR1C3, Aldo-keto reductase family 1, member C3(3-alpha hydroxysteroid dehydrogenase, type II)), 유전자 등록번호(GeneBank accession No.) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_030622(CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_184041(ALDOA, Aldolase A, fructose-bisphosphate), 유전자 등록번호(GeneBank accession No.) NM_024307(MGC4171, Hypothetical protein LOC283901), 유전자 등록번호(GeneBank accession No.) NM_005336(HDLBP, High density lipoprotein binding protein(vigilin)), 유전자 등록번호(GeneBank accession No.) NM_002627(PFKP, Phosphofructokinase, platelet), 유전자 등록번호(GeneBank accession No.) BX648281(LDLR, Low density lipoprotein receptor(familial hypercholesterolemia)), 유전자 등록번호(GeneBank accession No.) BC069201(FLJ22761, Hexokinase domain containing 1), 유전자 등록번호(GeneBank accession No.) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(GeneBank accession No.) AL833069(KIAA1434, Hypothetical protein KIAA1434), 유전자 등록번호(GeneBank accession No.) AK124656(ENO2, Enolase 2(gamma, neuronal)), 유전자 등록번호(GeneBank accession No.) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(GeneBank accession No.) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(GeneBank accession No.) AB053232(GAL3ST3, Galactose-3-O-sulfotransferase 3), 유전자 등록번호(GeneBank accession No.) AB045292(TMEM8, Transmembrane protein 8(five membrane-spanning domains)), 유전자 등록번호(GeneBank accession No.) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(GeneBank accession No.) NM_002900(RBP3, Retinol binding protein 3, interstitial), 유전자 등록번호(GeneBank accession No.) NM_001995(ACSL1, Acyl-CoA synthetase long-chain family member 1), 유전자 등록번호(GeneBank accession No.) NM_000018(ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), 유전자 등록번호(GeneBank accession No.) BC094756(CRA, Myotubularin related protein 11), 유전자 등록번호(GeneBank accession No.) BC050553(NTE, Neuropathy target esterase), 유전자 등록번호(GeneBank accession No.) BC033110(HSD17B1, Hydroxysteroid(17-beta) dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AY268890(TPP1, Tripeptidyl peptidase I), 유전자 등록번호(GeneBank accession No.) AK172798(CPT1A, Carnitine palmitoyltransferase 1A(liver)), 유전자 등록번호(GeneBank accession No.) AK096809(CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), 유전자 등록번호(GeneBank accession No.) AK000600(SIAT7D, ST6(alpha-N-acetyl-neuraminyl-2,3-beta- galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), 유전자 등록번호(GeneBank accession No.) AB002454(CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), 유전자 등록번호(GeneBank accession No.) Z29093(DDR1, Discoidin domain receptor family, member 1), 유전자 등록번호(GeneBank accession No.) Z25424(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) XM_291277(DKFZp761P0423, Hypothetical protein DKFZp761P0423), 유전자 등록번호(GeneBank accession No.) XM_038150(MAST3, Microtubule associated serine/threonine kinase 3), 유전자 등록번호(GeneBank accession No.) U88357(ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3(avian)), 유전자 등록번호(GeneBank accession No.) NM_025195(TRIB1, Tribbles homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020639(RIPK4, Receptor-interacting serine-threonine kinase 4), 유전자 등록번호(GeneBank accession No.) NM_014172(PHPT1, Phosphohistidine phosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_006254(PRKCD, Protein kinase C, delta), 유전자 등록번호(GeneBank accession No.) NM_005415(SLC20A1, Solute carrier family 20(phosphate transporter), member 1), 유전자 등록번호(GeneBank accession No.) NM_005026(PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004431(EPHA2, EPH receptor A2), 유전자 등록번호(GeneBank accession No.) NM_004419(DUSP5, Dual specificity phosphatase 5), 유전자 등록번호(GeneBank accession No.) NM_004327(BCR, Breakpoint cluster region), 유전자 등록번호(GeneBank accession No.) NM_004231(ATP6V1F, ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F), 유전자 등록번호(GeneBank accession No.) NM_004090(DUSP3, Dual specificity phosphatase 3(vaccinia virus phosphatase VH1-related)), 유전자 등록번호(GeneBank accession No.) NM_002843(PTPRJ, Protein tyrosine phosphatase, receptor type, J), 유전자 등록번호(GeneBank accession No.) NM_002496(NDUFS8, NADH dehydrogenase(ubiquinone) Fe-S protein 8, 23kDa(NADH-coenzyme Q reductase)), 유전자 등록번호(GeneBank accession No.) NM_001001852(PIM3, Pim-3 oncogene), 유전자 등록번호(GeneBank accession No.) L76191(IRAK1, Interleukin-1 receptor-associated kinase 1), 유전자 등록번호(GeneBank accession No.) D15049(PTPRH, Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(GeneBank accession No.) BC065207(ATP6V0D2, ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2), 유전자 등록번호(GeneBank accession No.) BC035578(STK24, Serine/threonine kinase 24(STE20 homolog, yeast)), 유전자 등록번호(GeneBank accession No.) BC028724(DUSP18, Dual specificity phosphatase 18), 유전자 등록번호(GeneBank accession No.) AL117482(ULK3, Unc-51-like kinase 3(C. elegans)), 유전자 등록번호(GeneBank accession No.) AK126879(PCTK3, PCTAIRE protein kinase 3), 유전자 등록번호(GeneBank accession No.) AB209416(ILK, Integrin-linked kinase-2), 유전자 등록번호(GeneBank accession No.) NM_000782(CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) CR597101(ZFP36, Zinc finger protein 36, C3H type, homolog(mouse)), 유전자 등록번호(GeneBank accession No.) CR936799(FHL2, Four and a half LIM domains 2), 유전자 등록번호(GeneBank accession No.) M24898(NR1D1, Nuclear receptor subfamily 1, group D, member 1), 유전자 등록번호(GeneBank accession No.) AF132818(KLF5, Kruppel-like factor 5(intestinal)), 유전자 등록번호(GeneBank accession No.) AK055337(ZNF213, Zinc finger protein 213), 유전자 등록번호(GeneBank accession No.) BC008834(PHF1, PHD finger protein 1), 유전자 등록번호(GeneBank accession No.) AK126918(GLIS2, GLIS family zinc finger 2), 유전자 등록번호(GeneBank accession No.) BC042692(CTL2, Solute carrier family 44, member 2), 유전자 등록번호(GeneBank accession No.) NM_002224(ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), 유전자 등록번호(GeneBank accession No.) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(GeneBank accession No.) NM_174953(ATP2A3, ATPase, Ca++ transporting, ubiquitous), 유전자 등록번호(GeneBank accession No.) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(GeneBank accession No.) NM_016113(TRPV2, Transient receptor potential cation channel, subfamily V, member 2), 유전자 등록번호(GeneBank accession No.) BM926478(RBP1, Retinol binding protein 1, cellular), 유전자 등록번호(GeneBank accession No.) NM_000069(CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), 유전자 등록번호(GeneBank accession No.) AK002107(RAB3B, RAB3B, member RAS oncogene family), 유전자 등록번호(GeneBank accession No.) NM_013321(SNX8, Sorting nexin 8), 유전자 등록번호(GeneBank accession No.) AK125026(SLC6A12, Solute carrier family 6(neurotransmitter transporter, betaine/GABA), member 12), 유전자 등록번호(GeneBank accession No.) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(GeneBank accession No.) AK092512(SLC16A5, Solute carrier family 16(monocarboxylic acid transporters), member 5), 유전자 등록번호(GeneBank accession No.) U49248(ABCC2, ATP-binding cassette, sub-family C(CFTR/MRP), member 2), 유전자 등록번호(GeneBank accession No.) AK172792(SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), 유전자 등록번호(GeneBank accession No.) BC044656(CASC3, Cancer susceptibility candidate 3), 유전자 등록번호(GeneBank accession No.) NM_203403(C9orf150, Chromosome 9 open reading frame 150), 유전자 등록번호(GeneBank accession No.) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(GeneBank accession No.) NM_031286(SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), 유전자 등록번호(GeneBank accession No.) NM_022153(PP2135, Chromosome 10 open reading frame 54), 유전자 등록번호(GeneBank accession No.) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(GeneBank accession No.) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(GeneBank accession No.) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(GeneBank accession No.) BX537968(LOC51149, Hypothetical LOC51149), 유전자 등록번호(GeneBank accession No.) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(GeneBank accession No.) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(GeneBank accession No.) BQ276852(TMSB10, Thymosin, beta 10), 유전자 등록번호(GeneBank accession No.) AK126182(KIAA1949, KIAA1949), 유전자 등록번호(GeneBank accession No.) AK124751(CAPN2, Calpain 2,(m/II) large subunit), 유전자 등록번호(GeneBank accession No.) AK095079(RGC32, Response gene to complement 32), 유전자 등록번호(GeneBank accession No.) AB075871(FLJ42654, Golgi transport 1 homolog A(S. cerevisiae)).Gene accession number (GeneBank accession No. ) NM_004420 (DUSP8, Dual specificity phosphatase 8), gene accession number (GeneBank accession No. ) L11329 (DUSP2, Dual specificity phosphatase 2), gene accession number (GeneBank accession No. ) BC094766 (PKN1, Protein kinase N1), gene accession number (GeneBank accession No. ) AY247738 (TRIB3, Tribbles homolog 3 (Drosophila)), gene accession number (GeneBank accession No. ) AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Gene Accession No. ) AB208849 (SHC1, Src homology 2 domain containing (SHC) transforming protein 1), gene accession number (GeneBank accession No. ) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease)), Gene Accession No. ) NM_198951 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (GeneBank accession No. NM_147780 (CTSB, Cathepsin B), gene accession number (GeneBank accession No. NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), gene accession number (GeneBank accession No. NM_033027 (AXUD1, AXIN1 up-regulated 1), gene accession number (GeneBank accession No. NM_032797 (AMID, Apoptosis-inducing factor (AIF) -like mitochondrion-associated inducer of death), GeneBank accession No. ) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (GeneBank accession No. ) NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), gene accession number (GeneBank accession No. ) NM_016222 (DDX41, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41), gene accession number (GeneBank accession No. ) NM_013246 (CLC, Cardiotrophin-like cytokine factor 1), gene accession number (GeneBank accession No. ) NM_004401 (DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), gene registration number (GeneBank accession No. ) NM_004281 (BAG3, BCL2-associated athanogene 3), gene accession number (GeneBank accession No. ) NM_003897 (IER3, Immediate early response 3), Gene accession number (GeneBank accession No. ) NM_003806 (HRK, Harakiri, BCL2 interacting protein (contains only BH3 domain)), gene accession number (GeneBank accession No. ) NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), GeneBank accession No. ) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), gene accession number (GeneBank accession No. ) NM_002737 (PRKCA, Protein Kinase C, alpha), Gene Accession Number (GeneBank accession No. NM_002648 (PIM1, Pim-1 oncogene), gene accession number (GeneBank accession No. NM_002507 (NGFR, Nerve growth factor receptor (TNFR superfamily, member 16)), gene accession number (GeneBank accession No. ) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), gene accession number (GeneBank accession No. ) NM_001013398 (IGFBP3, Insulin-like growth factor binding protein 3), gene registration number (GeneBank accession No. ) BX640923 (MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)), gene accession number (GeneBank accession No. ) BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), gene accession number (GeneBank accession No. ) BG284742 (P8, P8 protein (candidate of metastasis 1)), gene accession number (GeneBank accession No. ) BE903247 (PDCD6IP, Programmed cell death 6 interacting protein), gene accession number (GeneBank accession No. ) BC027949 (P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), gene accession number (GeneBank accession No. ) BC006365 (PSEN2, Presenilin 2 (Alzheimer disease 4)), gene accession number (GeneBank accession No. ) AY869712 (PPP1R13L, Protein phosphatase 1, regulatory (inhibitor) subunit 13 like), Gene Accession No. ) AY028896 (CARD10, Caspase recruitment domain family, member 10), gene accession number (GeneBank accession No. ) AK122614 (PPARD, Peroxisome proliferative activated receptor, delta), gene accession number (GeneBank accession No. ) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), gene registration number (GeneBank accession No. ) AK092808 (RRAGC, Ras-related GTP binding C), gene accession number (GeneBank accession No. ) AJ001898 (GDNF, Glial cell derived neurotrophic factor), gene accession number (GeneBank accession No. ) AF220656 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), gene accession number (GeneBank accession No. AF055634 (UNC5C, Unc-5 homolog C (C.  elegans), GeneBank accession No. ) AB209485 (Vescular endothelial growth factor), gene accession number (GeneBank accession No. ) AB096256 (UNC5B, Unc-5 homolog B (C.  elegans), GeneBank accession No. ) AB007960 (SH3GLB1, SH3-domain GRB2-like endophilin B1), gene accession number (GeneBank accession No. ) X06374 (PDGFA, Platelet-derived growth factor alpha polypeptide), Gene accession number (GeneBank accession No. ) S62138 (DDIT3, DNA-damage-inducible transcript 3), gene accession number (GeneBank accession No. NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), gene accession number (GeneBank accession No. ) NM_012127 (CIZ1, CDKN1A interacting zinc finger protein 1), gene accession number (GeneBank accession No. ) NM_005883 (APC2, Adenomatosis polyposis coli 2), gene accession number (GeneBank accession No. ) NM_004196 (CDKL1, Cyclin-dependent kinase-like 1 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_003236 (TGFA, Transforming growth factor, alpha), gene registration number (GeneBank accession No. ) NM_001261 (CDK9, Cyclin-dependent kinase 9 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_001007271 (DUSP13, Dual specificity phosphatase 13), gene accession number (GeneBank accession No. CR749511 (PARC, P53-associated parkin-like cytoplasmic protein), gene accession number (GeneBank accession No. CR623038 (ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), gene accession number (GeneBank accession No. CR618371 (EGFR, Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)), GeneBank accession No. ) BF965144 (IFITM1, Interferon induced transmembrane protein 1 (9-27)), gene accession number (GeneBank accession No. ) AK127679 (DUSP1, Dual specificity phosphatase 1), gene accession number (GeneBank accession No. ) AK096276 (CCND3, Cyclin D3), gene accession number (GeneBank accession No. ) AB209586 (MAPK13, Mitogen-activated protein kinase 13), gene accession number (GeneBank accession No. ) AB209465 (PCTK1, PCTAIRE protein kinase 1), gene accession number (GeneBank accession No. ) Z19588 (SKIL, SKI-like), gene accession number (GeneBank accession No. NM_020429 (SMURF1, SMAD specific E3 ubiquitin protein ligase 1), gene accession number (GeneBank accession No. ) NM_014767 (SPOCK2, Sparc / osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2), Gene Accession No. ) NM_005979 (S100A13, S100 calcium binding protein A13), gene registration number (GeneBank accession No. NM_005187 (CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), gene accession number (GeneBank accession No. ) NM_004364 (CEBPA, CCAAT / enhancer binding protein (C / EBP), alpha), gene registration number (GeneBank accession No. ) NM_001769 (CD9, CD9 antigen (p24)), gene accession number (GeneBank accession No. ) NM_001718 (BMP6, Bone morphogenetic protein 6), gene accession number (GeneBank accession No. ) NM_000641 (IL11, Interleukin 11), gene accession number (GeneBank accession No. ) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), gene registration number (GeneBank accession No. ) BQ066037 (RPS19, Ribosomal protein S19), gene accession number (GeneBank accession No. ) BE791300 (EDF1, Endothelial differentiation-related factor 1), Gene accession number (GeneBank accession No. ) BC038504 (SNF1LK, SNF1-like kinase), gene accession number (GeneBank accession No. ) AL832287 (ZAP70, Zeta-chain (TCR) associated protein kinase 70kDa), gene accession number (GeneBank accession No. ) AK125742 (PCGF1, Polycomb group ring finger 1), gene accession number (GeneBank accession No. ) AK124709 (NDRG1, N-myc downstream regulated gene 1), gene accession number (GeneBank accession No. ) AB011157 (PTDSR, Phosphatidylserine receptor), Gene Accession No. NM_013255 (MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), gene accession number (GeneBank accession No. ) NM_006572 (GNA13, Guanine nucleotide binding protein (G protein), alpha 13), gene registration number (GeneBank accession No. NM_002211 (ITGB1, Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), gene accession number (GeneBank accession No. ) CR601067 (PLAUR, Plasminogen activator, urokinase receptor), gene accession number (GeneBank accession No. ) BC050456 (THBS4, Thrombospondin 4), gene accession number (GeneBank accession No. ) AK027389 (CXCL16, Chemokine (C-X-C motif) ligand 16), gene accession number (GeneBank accession No. ) AJ132099 (VNN1, Vanin 1), gene accession number (GeneBank accession No. ) XM_371354 (FLJ10157, Hypothetical protein FLJ10157), gene accession number (GeneBank accession No. ) XM_208313 (TPM3, Similar to tropomyosin 4), gene accession number (GeneBank accession No. XM_208270 (ACR, Acrosin-like protease), gene accession number (GeneBank accession No. ) NM_203353 (PDLIM7, PDZ and LIM domain 7 (enigma)), gene accession number (GeneBank accession No. ) NM_201382 (PLEC1, Plectin 1, intermediate filament binding protein 500kDa), gene registration number (GeneBank accession No. ) NM_182961 (SYNE1, Spectrin repeat containing, nuclear envelope 1), gene accession number (GeneBank accession No. ) NM_181826 (NF2, Neurofibromin 2 (bilateral acoustic neuroma)), gene accession number (GeneBank accession No. NM_172069 (PLEKHH2, Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2), gene accession number (GeneBank accession No. ) NM_022648 (TNS, Tensin 1), gene accession number (GeneBank accession No. NM_017556 (FBLP-1, Filamin binding LIM protein 1), gene accession number (GeneBank accession No. NM_016081 (KIAA0992, Palladin, cytoskeletal associated protein), gene accession number (GeneBank accession No. ) NM_006617 (NES, Nestin), gene accession number (GeneBank accession No. ) NM_006262 (PRPH, Peripherin), gene accession number (GeneBank accession No. NM_005100 (AKAP12, A kinase (PRKA) anchor protein (gravin) 12), gene accession number (GeneBank accession No. NM_004368 (CNN2, Calponin 2), gene accession number (GeneBank accession No. ) NM_003388 (CYLN2, Cytoplasmic linker 2), gene accession number (GeneBank accession No. ) NM_003370 (VASP, Vasodilator-stimulated phosphoprotein), gene accession number (GeneBank accession No. ) NM_003128 (SPTBN1, Spectrin, beta, non-erythrocytic 1), gene accession number (GeneBank accession No. ) NM_002705 (PPL, Periplakin), gene accession number (GeneBank accession No. ) NM_002475 (MLC1SA, Myosin light chain 1 slow a), Gene accession number (GeneBank accession No. ) NM_002018 (FLII, Flightless I homolog (Drosophila)), Gene Accession Number (GeneBank accession No. ) NM_001465 (FYB, FYN binding protein (FYB-120 / 130)), gene registration number (GeneBank accession No. NM_001069 (TUBB2, Tubulin, beta 2A), gene accession number (GeneBank accession No. ) CR625172 (MGC8685, Tubulin, beta 2B), gene accession number (GeneBank accession No. CR616919 (KRT18, Keratin 18), gene accession number (GeneBank accession No. ) CR606241 (ACTG1, Actin, gamma 1), gene accession number (GeneBank accession No. ) CB240572 (MYH11, Myosin, heavy polypeptide 11, smooth muscle), gene accession number (GeneBank accession No. ) BX648253 (PTPN3, Protein tyrosine phosphatase, non-receptor type 3), Gene accession number (GeneBank accession No. ) BX648190 (WDR1, WD repeat domain 1), Gene accession number (GeneBank accession No. ) BX641076 (ACTN1, Actinin, alpha 1), gene accession number (GeneBank accession No. ) BX537978 (EPB41L1, Erythrocyte membrane protein band 4. 1-like 1), gene accession number (GeneBank accession No. ) BG121847 (NUDC, Nuclear distribution gene C homolog (A.  nidulans)), and GeneBank accession No. ) BC068013 (MYO1C, Myosin IC), gene accession number (GeneBank accession No. ) BC065499 (MAST2, Microtubule associated serine / threonine kinase 2), gene accession number (GeneBank accession No. ) BC051890 (TUBG2, Tubulin, gamma 2), gene accession number (GeneBank accession No. ) BC041874 (MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), gene accession number (GeneBank accession No. ) BC012597 (ACTA1, Actin, alpha 1, skeletal muscle), gene accession number (GeneBank accession No. ) AY484427 (KIF17, Kinesin family member 17), gene accession number (GeneBank accession No. ) AK130546 (STOML2, Stomatin (EPB72) -like 2), Gene accession number (GeneBank accession No. ) AK124711 (CORO2B, Coronin, actin binding protein, 2B), gene accession number (GeneBank accession No. ) AK123974 (MYL5, Myosin, light polypeptide 5, regulatory), gene accession number (GeneBank accession No. ) AK092792 (LOC389833, Similar to hypothetical protein MGC27019), gene accession number (GeneBank accession No. ) AK026518 (MYOHD1, Myosin head domain containing 1), gene accession number (GeneBank accession No. ) AK024500 (NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), gene accession number (GeneBank accession No. ) AF085886 (FLJ46675, Ribosomal protein L29 pseudogene 2), gene accession number (GeneBank accession No. ) AB209997 (MYO9B, Myosin IXB), gene accession number (GeneBank accession No. Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), gene accession number (GeneBank accession No. ) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), gene accession number (GeneBank accession No. X17033 (ITGA2, Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)), gene accession number (GeneBank accession No. ) U41763 (CLTCL1, Clathrin, heavy polypeptide-like 1), gene accession number (GeneBank accession No. NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene accession number (GeneBank accession No. ) NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse)), gene accession number (GeneBank accession No. ) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), gene accession number (GeneBank accession No. NM_017555 (EGLN2, Egl nine homolog 2 (C.  elegans), GeneBank accession No. NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), gene accession number (GeneBank accession No. NM_004148 (NINJ1, Ninjurin 1), gene accession number (GeneBank accession No. ) NM_003377 (VEGFB, Vascular endothelial growth factor B), gene accession number (GeneBank accession No. ) NM_001983 (ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)), GeneBank accession No. ) NM_001552 (IGFBP4, Insulin-like growth factor binding protein 4), gene registration number (GeneBank accession No. ) NM_001430 (EPAS1, Endothelial PAS domain protein 1), Gene accession number (GeneBank accession No. NM_001300 (KLF6, Kruppel-like factor 6), gene accession number (GeneBank accession No. ) NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2), gene accession number (GeneBank accession No. NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (GeneBank accession No. ) NM_000474 (TWIST1, Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila)), Gene Accession No. ) BX649103 (ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), Gene Accession No. ) BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), gene accession number (GeneBank accession No. ) BM904612 (S100A6, S100 calcium binding protein A6 (calcyclin)), gene accession number (GeneBank accession No. ) BM556279 (EMP3, Epithelial membrane protein 3), gene accession number (GeneBank accession No. ) BC015041 (VAT1, Family with sequence similarity 82, member C), gene accession number (GeneBank accession No. ) AY258066 (OKL38, Pregnancy-induced growth inhibitor), gene accession number (GeneBank accession No. ) AK126729 (NDRG4, NDRG family member 4), gene accession number (GeneBank accession No. ) AK090459 (NFE2L1, Nuclear factor (erythroid-derived 2) -like 1), gene accession number (GeneBank accession No. ) AK074163 (ROBO4, Roundabout homolog 4, magic roundabout (Drosophila)), Gene accession number (GeneBank accession No. ) AK024680 (FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), gene accession number (GeneBank accession No. ) AF176422 (HEY1, Hairy / enhancer-of-split related with YRPW motif 1), gene accession number (GeneBank accession No. ) AF003837 (JAG1, Jagged 1 (Alagille syndrome)), gene accession number (GeneBank accession No. ) AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), GeneBank accession No. ) AB011150 (NRXN1, Neurexin 1), gene accession number (GeneBank accession No. ) NM_201589 (MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)), gene accession number (GeneBank accession No. NM_052999 (CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), gene accession number (GeneBank accession No. NM_006644 (HSPH1, Heat shock 105kDa / 110kDa protein 1), gene registration number (GeneBank accession No. NM_005438 (FOSL1, FOS-like antigen 1), gene accession number (GeneBank accession No. ) NM_004996 (ABCC1, ATP-binding cassette, sub-family C (CFTR / MRP), member 1), gene registration number (GeneBank accession No. ) NM_002658 (PLAU, Plasminogen activator, urokinase), gene accession number (GeneBank accession No. ) NM_001353 (AKR1C1, Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)), gene accession number (GeneBank accession No. ) H18681 (C20orf139, Sulfiredoxin 1 homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) DR004094 (HAMP, Hepcidin antimicrobial peptide), gene accession number (GeneBank accession No. ) BC082272 (KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), Gene Accession No. ) BC040494 (DNAJB2, DnaJ (Hsp40) homolog, subfamily B, member 2), gene accession number (GeneBank accession No. ) BC018064 (ATF6, Activating transcription factor 6), gene accession number (GeneBank accession No. ) BC006523 (SGK2, Serum / glucocorticoid regulated kinase 2), gene registration number (GeneBank accession No. ) AK090482 (CXCL12, Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)), gene accession number (GeneBank accession No. ) AF219946 (TULP4, Tubby like protein 4), gene accession number (GeneBank accession No. ) AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), gene accession number (GeneBank accession No. ) NM_005242 (F2RL1, Coagulation factor II (thrombin) receptor-like 1), gene accession number (GeneBank accession No. ) NM_001002029 (C4A, Complement component 4B, telomeric), Gene accession number (GeneBank accession No. ) NM_000539 (RHO, Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)), gene accession number (GeneBank accession No. ) BX649164 (PAI, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene registration number (GeneBank accession No. ) BM918324 (LY96, Lymphocyte antigen 96), gene accession number (GeneBank accession No. ) AB209647 (NCF2, Neutrophil cytosolic factor 2 (65 kDa, chronic granulomatous disease, autosomal 2)), gene accession number (GeneBank accession No. ) NM_152221 (CSNK1E, Casein kinase 1, epsilon), Gene accession number (GeneBank accession No. ) NM_017999 (RNF31, Ring finger protein 31), gene accession number (GeneBank accession No. ) NM_016819 (OGG1, 8-oxoguanine DNA glycosylase), gene accession number (GeneBank accession No. ) NM_016816 (OAS1, 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa), Gene Accession No. NM_012235 (SCAP, SREBP cleavage-activating protein), gene accession number (GeneBank accession No. ) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), gene accession number (GeneBank accession No. ) NM_001779 (CD58, CD58 antigen, (lymphocyte function-associated antigen 3)), gene accession number (GeneBank accession No. ) CB055213 (ICOSLG, Inducible T-cell co-stimulator ligand), Gene accession number (GeneBank accession No. ) BX641029 (MASP1, Mannan-binding lectin serine peptidase 1 (C4 / C2 activating component of Ra-reactive factor)), GeneBank accession No. ) BQ053419 (BATF, Basic leucine zipper transcription factor, ATF-like), Gene Accession No. ) BC039299 (STIP1, Stress-induced-phosphoprotein 1 (Hsp70 / Hsp90-organizing protein)), gene accession number (GeneBank accession No. ) AY055760 (DAF, Decay accelerating factor for complement (CD55, Cromer blood group system)), gene accession number (GeneBank accession No. ) AK130188 (FGR, Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog), Gene Accession No. ) AK095326 (MUS81, MUS81 endonuclease homolog (yeast)), gene accession number (GeneBank accession No. NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde binding 1), gene registration number (GeneBank accession No. ) NM_003004 (SECTM1, Secreted and transmembrane 1), gene accession number (GeneBank accession No. ) NM_002309 (LIF, Hypothetical protein MGC20647), gene accession number (GeneBank accession No. ) NM_001421 (ELF4, E74-like factor 4 (ets domain transcription factor)), gene accession number (GeneBank accession No. ) NM_000418 (IL4R, Interleukin 4 receptor), gene accession number (GeneBank accession No. ) BI909222 (FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), gene accession number (GeneBank accession No. ) BF569086 (NK4, Interleukin 32), gene accession number (GeneBank accession No. ) BC014470 (AZGP1, Alpha-2-glycoprotein 1, zinc), gene accession number (GeneBank accession No. ) BC020744 (AKR1C4, Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol), dehydrogenase 4), gene accession number (GeneBank accession No. ) BQ939577 (AKR1C3, Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)), gene accession number (GeneBank accession No. ) NM_000499 (CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) NM_030622 (CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), gene accession number (GeneBank accession No. ) NM_184041 (ALDOA, Aldolase A, fructose-bisphosphate), gene accession number (GeneBank accession No. ) NM_024307 (MGC4171, Hypothetical protein LOC283901), gene accession number (GeneBank accession No. ) NM_005336 (HDLBP, High density lipoprotein binding protein (vigilin)), gene registration number (GeneBank accession No. NM_002627 (PFKP, Phosphofructokinase, platelet), Gene accession number (GeneBank accession No. ) BX648281 (LDLR, low density lipoprotein receptor (familial hypercholesterolemia)), gene accession number (GeneBank accession No. ) BC069201 (FLJ22761, Hexokinase domain containing 1), gene accession number (GeneBank accession No. ) BC030207 (NR0B2, Nuclear receptor subfamily 0, group B, member 2), gene accession number (GeneBank accession No. ) AL833069 (KIAA1434, Hypothetical protein KIAA1434), gene accession number (GeneBank accession No. ) AK124656 (ENO2, Enolase 2 (gamma, neuronal)), gene accession number (GeneBank accession No. ) AK094474 (RHOC, Ras homolog gene family, member C), gene accession number (GeneBank accession No. ) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene accession number (GeneBank accession No. ) AB053232 (GAL3ST3, Galactose-3-O-sulfotransferase 3), gene accession number (GeneBank accession No. ) AB045292 (TMEM8, Transmembrane protein 8 (five membrane-spanning domains)), gene accession number (GeneBank accession No. ) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), Gene accession number (GeneBank accession No. ) NM_002900 (RBP3, Retinol binding protein 3, interstitial), gene accession number (GeneBank accession No. ) NM_001995 (ACSL1, Acyl-CoA synthetase long-chain family member 1), gene accession number (GeneBank accession No. NM_000018 (ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), gene accession number (GeneBank accession No. ) BC094756 (CRA, Myotubularin related protein 11), gene accession number (GeneBank accession No. ) BC050553 (NTE, Neuropathy target esterase), gene accession number (GeneBank accession No. ) BC033110 (HSD17B1, Hydroxysteroid (17-beta) dehydrogenase 1), Gene accession number (GeneBank accession No. ) AY268890 (TPP1, Tripeptidyl peptidase I), gene accession number (GeneBank accession No. ) AK172798 (CPT1A, Carnitine palmitoyltransferase 1A (liver)), gene accession number (GeneBank accession No. ) AK096809 (CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), gene accession number (GeneBank accession No. ) AK000600 (SIAT7D, ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), Gene accession number ) AB002454 (CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), gene accession number (GeneBank accession No. ) Z29093 (DDR1, Discoidin domain receptor family, member 1), gene accession number (GeneBank accession No. ) Z25424 (MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (GeneBank accession No. ) XM_291277 (DKFZp761P0423, Hypothetical protein DKFZp761P0423), gene accession number (GeneBank accession No. XM_038150 (MAST3, Microtubule associated serine / threonine kinase 3), gene accession number (GeneBank accession No. ) U88357 (ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)), gene accession number (GeneBank accession No. ) NM_025195 (TRIB1, Tribbles homolog 1 (Drosophila)), gene accession number (GeneBank accession No. NM_020639 (RIPK4, Receptor-interacting serine-threonine kinase 4), gene accession number (GeneBank accession No. ) NM_014172 (PHPT1, Phosphohistidine phosphatase 1), Gene accession number (GeneBank accession No. ) NM_006254 (PRKCD, Protein kinase C, delta), Gene accession number (GeneBank accession No. ) NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), gene accession number (GeneBank accession No. ) NM_005026 (PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), Gene accession number (GeneBank accession No. ) NM_004431 (EPHA2, EPH receptor A2), gene accession number (GeneBank accession No. ) NM_004419 (DUSP5, Dual specificity phosphatase 5), gene accession number (GeneBank accession No. ) NM_004327 (BCR, Breakpoint cluster region), Gene accession number (GeneBank accession No. ) NM_004231 (ATP6V1F, ATPase, H + transporting, lysosomal 14kDa, V1 subunit F), gene registration number (GeneBank accession No. ) NM_004090 (DUSP3, Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)), gene accession number (GeneBank accession No. ) NM_002843 (PTPRJ, Protein tyrosine phosphatase, receptor type, J), gene accession number (GeneBank accession No. NM_002496 (NDUFS8, NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23 kDa (NADH-coenzyme Q reductase)), gene accession number (GeneBank accession No. NM_001001852 (PIM3, Pim-3 oncogene), gene accession number (GeneBank accession No. ) L76191 (IRAK1, Interleukin-1 receptor-associated kinase 1), gene accession number (GeneBank accession No. ) D15049 (PTPRH, Protein tyrosine phosphatase, receptor type, H), gene accession number (GeneBank accession No. ) BC065207 (ATP6V0D2, ATPase, H + transporting, lysosomal 38kDa, V0 subunit d isoform 2), gene accession number (GeneBank accession No. ) BC035578 (STK24, Serine / threonine kinase 24 (STE20 homolog, yeast)), gene accession number (GeneBank accession No. ) BC028724 (DUSP18, Dual specificity phosphatase 18), gene accession number (GeneBank accession No. AL117482 (ULK3, Unc-51-like kinase 3 (C.  elegans), GeneBank accession No. ) AK126879 (PCTK3, PCTAIRE protein kinase 3), gene accession number (GeneBank accession No. ) AB209416 (ILK, Integrin-linked kinase-2), gene accession number (GeneBank accession No. ) NM_000782 (CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) CR597101 (ZFP36, Zinc finger protein 36, C3H type, homolog (mouse)), Gene accession number (GeneBank accession No. ) CR936799 (FHL2, Four and a half LIM domains 2), gene accession number (GeneBank accession No. ) M24898 (NR1D1, Nuclear receptor subfamily 1, group D, member 1), gene accession number (GeneBank accession No. ) AF132818 (KLF5, Kruppel-like factor 5 (intestinal)), gene accession number (GeneBank accession No. ) AK055337 (ZNF213, Zinc finger protein 213), Gene accession number (GeneBank accession No. ) BC008834 (PHF1, PHD finger protein 1), gene accession number (GeneBank accession No. ) AK126918 (GLIS2, GLIS family zinc finger 2), Gene accession number (GeneBank accession No. ) BC042692 (CTL2, Solute carrier family 44, member 2), gene accession number (GeneBank accession No. ) NM_002224 (ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), gene accession number (GeneBank accession No. ) AK095363 (AQP3, Aquaporin 3), gene accession number (GeneBank accession No. NM_174953 (ATP2A3, ATPase, Ca ++ transporting, ubiquitous), gene accession number (GeneBank accession No. ) BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)), GeneBank Accession No. NM_016113 (TRPV2, Transient receptor potential cation channel, subfamily V, member 2), gene accession number (GeneBank accession No. ) BM926478 (RBP1, Retinol binding protein 1, cellular), gene accession number (GeneBank accession No. NM_000069 (CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), Gene Registration Number (GeneBank accession No. ) AK002107 (RAB3B, RAB3B, member RAS oncogene family), gene accession number (GeneBank accession No. ) NM_013321 (SNX8, Sorting nexin 8), Gene accession number (GeneBank accession No. ) AK125026 (SLC6A12, Solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12), gene accession number (GeneBank accession No. ) NM_005843 (STAM2, Signal transducing adapter molecule (SH3 domain and ITAM motif) 2), gene accession number (GeneBank accession No. ) AK092512 (SLC16A5, Solute carrier family 16 (monocarboxylic acid transporters), member 5), gene accession number (GeneBank accession No. ) U49248 (ABCC2, ATP-binding cassette, sub-family C (CFTR / MRP), member 2), gene accession number (GeneBank accession No. ) AK172792 (SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), gene accession number (GeneBank accession No. ) BC044656 (CASC3, Cancer susceptibility candidate 3), gene accession number (GeneBank accession No. NM_203403 (C9orf150, Chromosome 9 open reading frame 150), gene accession number (GeneBank accession No. NM_080388 (S100A16, S100 calcium binding protein A16), gene registration number (GeneBank accession No. NM_031286 (SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), gene accession number (GeneBank accession No. NM_022153 (PP2135, Chromosome 10 open reading frame 54), gene accession number (GeneBank accession No. ) NM_004864 (GDF15, Growth differentiation factor 15), Gene accession number (GeneBank accession No. ) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene accession number (GeneBank accession No. ) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), gene accession number (GeneBank accession No. ) BX537968 (LOC51149, Hypothetical LOC51149), gene accession number (GeneBank accession No. BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), gene accession number (GeneBank accession No. ) BQ683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), gene accession number (GeneBank accession No. ) BQ276852 (TMSB10, Thymosin, beta 10), gene accession number (GeneBank accession No. ) AK126182 (KIAA1949, KIAA1949), gene accession number (GeneBank accession No. ) AK124751 (CAPN2, Calpain 2, (m / II) large subunit), gene accession number (GeneBank accession No. ) AK095079 (RGC32, Response gene to complement 32), gene accession number (GeneBank accession No. ) AB075871 (FLJ42654, Golgi transport 1 homolog A (S.  cerevisiae)).

2) 상기 바이오마커 중에서, 페난트렌의 노출에 의해 발현이 감소하는 바이오마커 유전자는 하기와 같다: 2) Among the biomarkers, biomarker genes whose expression is reduced by exposure of phenanthrene are as follows:

유전자 등록번호(GeneBank accession No.) AK125150(MAPK8, Mitogen-activated protein kinase 8), 유전자 등록번호(GeneBank accession No.) NM_002758(MAP2K6, Mitogen-activated protein kinase kinase 6), 유전자 등록번호(GeneBank accession No.) NM_004612(TGFBR1, Transforming growth factor, beta receptor I(activin A receptor type II-like kinase, 53kDa)), 유전자 등록번호(GeneBank accession No.) NM_145686(MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4), 유전자 등록번호(GeneBank accession No.) XM_042066(MAP3K1, Mitogen-activated protein kinase kinase kinase 1), 유전자 등록번호(GeneBank accession No.) AB011123(TNIK, TRAF2 and NCK interacting kinase), 유전자 등록번호(GeneBank accession No.) AB209031(C5, Complement component 5), 유전자 등록번호(GeneBank accession No.) NM_022740(HIPK2, Homeodomain interacting protein kinase 2), 유전자 등록번호(GeneBank accession No.) NM_148957(TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(GeneBank accession No.) AB208909(ITGB2, Integrin, beta 2(antigen CD18(p95), lymphocyte function-associated antigen 1; macrophage antigen 1(mac-1) beta subunit)), 유전자 등록번호(GeneBank accession No.) AB209211(TIA1, TIA1 cytotoxic granule-associated RNA binding protein), 유전자 등록번호(GeneBank accession No.) AB209613(DNASE1L3, Deoxyribonuclease I-like 3), 유전자 등록번호(GeneBank accession No.) AK122825(HMGB1, High-mobility group box 1), 유전자 등록번호(GeneBank accession No.) AK127326(PHF17, PHD finger protein 17), 유전자 등록번호(GeneBank accession No.) AK223503(CASP1, Caspase 1, apoptosis-related cysteine peptidase(interleukin 1, beta, convertase)), 유전자 등록번호(GeneBank accession No.) BC013326(GAS2, Growth arrest-specific 2), 유전자 등록번호(GeneBank accession No.) BC047698(IL7, Interleukin 7), 유전자 등록번호(GeneBank accession No.) D79987(ESPL1, Extra spindle poles like 1(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_000893(KNG1, Kininogen 1), 유전자 등록번호(GeneBank accession No.) NM_001012271(BIRC5, Effector cell peptidase receptor 1), 유전자 등록번 호(GeneBank accession No.) NM_004938(DAPK1, Death-associated protein kinase 1), 유전자 등록번호(GeneBank accession No.) NM_005879(TRIP, TRAF interacting protein), 유전자 등록번호(GeneBank accession No.) NM_014739(BCLAF1, BCL2-associated transcription factor 1), 유전자 등록번호(GeneBank accession No.) NM_018947(CYCS, Cytochrome c, somatic), 유전자 등록번호(GeneBank accession No.) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(GeneBank accession No.) AB209179(PLK1, Polo-like kinase 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) AB209337(CDC7, CDC7 cell division cycle 7(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AF053305(BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(GeneBank accession No.) AF053306(BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(GeneBank accession No.) AF345347(SPAG5, Sperm associated antigen 5), 유전자 등록번호(GeneBank accession No.) AK092638(CCNG2, Cyclin G2), 유전자 등록번호(GeneBank accession No.) AK222819(NUSAP1, Nucleolar and spindle associated protein 1), 유전자 등록번호(GeneBank accession No.) AL833191(SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등록번호(GeneBank accession No.) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(GeneBank accession No.) BC011000(CDCA5, Cell division cycle associated 5), 유전자 등록번호(GeneBank accession No.) BC032677(UBE2C, Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(GeneBank accession No.) BC043502(NEK2, NIMA(never in mitosis gene a)-related kinase 2), 유전자 등록번호(GeneBank accession No.) BU675073(PTTG1, Pituitary tumor-transforming 1), 유전자 등록번호(GeneBank accession No.) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(GeneBank accession No.) CR592757(BRRN1, Barren homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) CR597075(MAPRE2, Microtubule-associated protein, RP/EB family, member 2), 유전자 등록번호(GeneBank accession No.) CR604810(CCNA2, Cyclin A2), 유전자 등록번호(GeneBank accession No.) CR933728(CDC2, Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(GeneBank accession No.) NM_000919(PAM, Peptidylglycine alpha-amidating monooxygenase), 유전자 등록번호(GeneBank accession No.) NM_001790(CDC25C, Cell division cycle 25C), 유전자 등록번호(GeneBank accession No.) NM_001798(CDK2, Cyclin-dependent kinase 2), 유전자 등록번호(GeneBank accession No.) NM_001813(CENPE, Centromere protein E, 312kDa), 유전자 등록번호(GeneBank accession No.) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(GeneBank accession No.) NM_003981(PRC1, Protein regulator of cytokinesis 1), 유전자 등록번호(GeneBank accession No.) NM_004523(KIF11, Kinesin family member 11), 유전자 등록번호(GeneBank accession No.) NM_004701(CCNB2, Cyclin B2), 유전자 등록번호(GeneBank accession No.) NM_005983(SKP2, S-phase kinase-associated protein 2(p45)), 유전자 등록번호(GeneBank accession No.) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(GeneBank accession No.) NM_006845(KIF2C, Kinesin family member 2C), 유전자 등록번호(GeneBank accession No.) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(GeneBank accession No.) NM_012112(TPX2, TPX2, microtubule-associated, homolog(Xenopus laevis)), 유전자 등록번호(GeneBank accession No.) NM_014750(DLG7, Discs, large homolog 7(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015097(CLASP2, Cytoplasmic linker associated protein 2), 유전자 등록번호(GeneBank accession No.) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(GeneBank accession No.) NM_016426(GTSE1, G-2 and S-phase expressed 1), 유전자 등록번호(GeneBank accession No.) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(GeneBank accession No.) NM_018685(ANLN, Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020242(KNSL7, Kinesin family member 15), 유전자 등록번호(GeneBank accession No.) NM_031966(CCNB1, Cyclin B1), 유전자 등록번호(GeneBank accession No.) NM_138555(KIF23, Kinesin family member 23), 유전자 등록번호(GeneBank accession No.) U65410(MAD2L1, MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AB020656(CYLD, Cylindromatosis(turban tumor syndrome)), 유전자 등록번 호(GeneBank accession No.) AF033122(SESN1, Sestrin 1), 유전자 등록번호(GeneBank accession No.) AK074377(UHRF1, Chromosome 19 open reading frame 31), 유전자 등록번호(GeneBank accession No.) AK091170(CDKN2C, Cyclin-dependent kinase inhibitor 2C(p18, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) AK094323(NFYC, Nuclear transcription factor Y, gamma), 유전자 등록번호(GeneBank accession No.) AY366508(LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), 유전자 등록번호(GeneBank accession No.) BC033086(TCF19, Transcription factor 19(SC1)), 유전자 등록번호(GeneBank accession No.) BC040303(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(GeneBank accession No.) BC040991(TFDP2, Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(GeneBank accession No.) BC092412(SGOL2, Shugoshin-like 2(S. pombe)), 유전자 등록번호(GeneBank accession No.) BQ278454(CKS1B, CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(GeneBank accession No.) BX649128(SESN3, Sestrin 3), 유전자 등록번호(GeneBank accession No.) CD049340(AURKB, Aurora kinase B), 유전자 등록번호(GeneBank accession No.) M89914(NF1, Neurofibromin 1(neurofibromatosis, von Recklinghausen disease, Watson disease)), 유전자 등록번호(GeneBank accession No.) NM_001005414(ZWINT, ZW10 interactor antisense), 유전자 등록번호(GeneBank accession No.) NM_001008491(Sep 2, Septin 2), 유전자 등록번호(GeneBank accession No.) NM_001274(CHEK1, CHK1 checkpoint homolog(S. pombe)), 유전자 등록번호(GeneBank accession No.) NM_002105(H2AFX, H2A histone family, member X), 유전자 등록번호(GeneBank accession No.) NM_002388(MCM3, MCM3 minichromosome maintenance deficient 3(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_002417(MKI67, Antigen identified by monoclonal antibody Ki-67), 유전자 등록번호(GeneBank accession No.) NM_002875(RAD51, RAD51 homolog(RecA homolog, E. coli)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(GeneBank accession No.) NM_004526(MCM2, MCM2 minichromosome maintenance deficient 2, mitotin(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_004847(AIF1, Allograft inflammatory factor 1), 유전자 등록번호(GeneBank accession No.) NM_005915(MCM6, MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_012090(MACF1, Microtubule-actin crosslinking factor 1), 유전자 등록번호(GeneBank accession No.) NM_012415(RAD54B, RAD54 homolog B(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_014264(PLK4, Polo-like kinase 4(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015714(G0S2, G0/G1switch 2), 유전자 등록번호(GeneBank accession No.) NM_024680(FLJ23311, E2F transcription factor 8), 유전자 등록번호(GeneBank accession No.) XM_034274(MYBL1, V-myb myeloblastosis viral oncogene homolog(avian)-like 1), 유전자 등록번호(GeneBank accession No.) AK001720(FLJ10858, Nei endonuclease VIII-like 3(E. coli)), 유전자 등록번호(GeneBank accession No.) AY032677(POLQ, Polymerase(DNA directed), theta), 유전자 등록번호(GeneBank accession No.) BC034480(BLM, Bloom syndrome), 유전자 등록번호(GeneBank accession No.) BC073161(RAD51C, RAD51 homolog C(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) CR600021(HMGB2, High-mobility group box 2), 유전자 등록번호(GeneBank accession No.) CR625391(RAD51AP1, RAD51 associated protein 1), 유전자 등록번호(GeneBank accession No.) CR936783(FLJ40869, Hypothetical protein LOC284952), 유전자 등록번호(GeneBank accession No.) DQ140356(KIAA1596, Fanconi anemia, complementation group M), 유전자 등록번호(GeneBank accession No.) NM_001067(TOP2A, Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(GeneBank accession No.) NM_001618(PARP1, Poly(ADP-ribose) polymerase family, member 1), 유전자 등록번호(GeneBank accession No.) NM_003362(UNG, Uracil-DNA glycosylase), 유전자 등록번호(GeneBank accession No.) NM_006904(PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(GeneBank accession No.) NM_130398(EXO1, Exonuclease 1), 유전자 등록번호(GeneBank accession No.) AB020807(TLR6, Toll-like receptor 6), 유전자 등록번호(GeneBank accession No.) AB032980(DCDC2, Doublecortin domain containing 2), 유전자 등록번호(GeneBank accession No.) AB209866(TFPI, Tissue factor pathway inhibitor(lipoprotein-associated coagulation inhibitor)), 유전 자 등록번호(GeneBank accession No.) AK057015(HSPA4, Heat shock 70kDa protein 4), 유전자 등록번호(GeneBank accession No.) AK095515(IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), 유전자 등록번호(GeneBank accession No.) AK122686(IF, I factor(complement)), 유전자 등록번호(GeneBank accession No.) AK123010(RRM2, Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(GeneBank accession No.) BC035582(TRIM22, Tripartite motif-containing 22), 유전자 등록번호(GeneBank accession No.) BX537894(LOC493869, Similar to RIKEN cDNA 2310016C16), 유전자 등록번호(GeneBank accession No.) M14338(PROS1, Protein S(alpha)), 유전자 등록번호(GeneBank accession No.) NM_000821(GGCX, Gamma-glutamyl carboxylase), 유전자 등록번호(GeneBank accession No.) NM_000963(PTGS2, Prostaglandin-endoperoxide synthase 2(prostaglandin G/H synthase and cyclooxygenase)), 유전자 등록번호(GeneBank accession No.) NM_001001547(CD36, CD36 antigen(collagen type I receptor, thrombospondin receptor)), 유전자 등록번호(GeneBank accession No.) NM_001512(GSTA4, Glutathione S-transferase A4), 유전자 등록번호(GeneBank accession No.) NM_001629(ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), 유전자 등록번호(GeneBank accession No.) NM_001752(CAT, Catalase), 유전자 등록번호(GeneBank accession No.) NM_001837(CCR3, Chemokine(C-C motif) receptor 3), 유전자 등록번호(GeneBank accession No.) NM_001979(EPHX2, Epoxide hydrolase 2, cytoplasmic), 유전자 등록번호(GeneBank accession No.) NM_001994(F13B, Coagulation factor XIII, B polypeptide), 유전자 등록번호(GeneBank accession No.) NM_002182(IL1RAP, Interleukin 1 receptor accessory protein), 유전자 등록번호(GeneBank accession No.) NM_006120(HLA-DMA, Major histocompatibility complex, class II, DM alpha), 유전자 등록번호(GeneBank accession No.) NM_173216(SIAT1, ST6 beta-galactosamide alpha-2,6-sialyltranferase 1), 유전자 등록번호(GeneBank accession No.) NM_202002(FOXM1, Forkhead box M1), 유전자 등록번호(GeneBank accession No.) AB163917(LRAP, Leukocyte-derived arginine aminopeptidase), 유전자 등록번호(GeneBank accession No.) BC027881(AFP, Alpha-fetoprotein), 유전자 등록번호(GeneBank accession No.) NM_015915(SPG3A, Spastic paraplegia 3A(autosomal dominant)), 유전자 등록번호(GeneBank accession No.) NM_000671(ADH5, Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(GeneBank accession No.) J05428(UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), 유전자 등록번호(GeneBank accession No.) NM_000672(ADH6, Alcohol dehydrogenase 6(class V)), 유전자 등록번호(GeneBank accession No.) M15943(ADH4, Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(GeneBank accession No.) AK223395(FBP1, Fructose-1,6-bisphosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_000151(G6PC, Glucose-6-phosphatase, catalytic(glycogen storage disease type I, von Gierke disease)), 유전자 등록번호(GeneBank accession No.) XM_113962(KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), 유전자 등록번호(GeneBank accession No.) AB020644(ACSL6, Acyl-CoA synthetase long-chain family member 6), 유전자 등록번호(GeneBank accession No.) AB209907(PLD1, Phospholipase D1, phophatidylcholine-specific), 유전자 등록번호(GeneBank accession No.) AF285167(ABCA1, ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(GeneBank accession No.) AF297872(TRERF1, Transcriptional regulating factor 1), 유전자 등록번호(GeneBank accession No.) AF303134(ALDH8A1, Aldehyde dehydrogenase 8 family, member A1), 유전자 등록번호(GeneBank accession No.) AF339053(PLA2G12B, Phospholipase A2, group XIIB), 유전자 등록번호(GeneBank accession No.) AK096018(HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), 유전자 등록번호(GeneBank accession No.) AK124635(PCSK9, Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(GeneBank accession No.) AK127346(SIAT9, ST3 beta-galactoside alpha-2,3-sialyltransferase 5), 유전자 등록번호(GeneBank accession No.) AL359559(AGPS, Alkylglycerone phosphate synthase), 유전자 등록번호(GeneBank accession No.) AY691170(PLCL3, Phospholipase C-like 3), 유전자 등록번호(GeneBank accession No.) BG567934(APOM, Apolipoprotein M), 유전자 등록번호(GeneBank accession No.) BX538214(C6orf167, Chromosome 6 open reading frame 167), 유전자 등록번호(GeneBank accession No.) BX640945(FADS2, Fatty acid desaturase 2), 유전자 등록번호(GeneBank accession No.) BX648473(PIGK, Phosphatidylinositol glycan, class K), 유전자 등록번호(GeneBank accession No.) BX648557(HSD17B2, Hydroxysteroid(17-beta) dehydrogenase 2), 유전자 등록번호(GeneBank accession No.) CR749601(ETNK1, Death-associated protein kinase 3), 유전자 등록번호(GeneBank accession No.) NM_000859(HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), 유전자 등록번호(GeneBank accession No.) NM_001443(FABP1, Fatty acid binding protein 1, liver), 유전자 등록번호(GeneBank accession No.) NM_002130(HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1(soluble)), 유전자 등록번호(GeneBank accession No.) NM_003725(RODH, Hydroxysteroid(17-beta) dehydrogenase 6), 유전자 등록번호(GeneBank accession No.) NM_004845(PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), 유전자 등록번호(GeneBank accession No.) NM_014762(DHCR24, 24-dehydrocholesterol reductase), 유전자 등록번호(GeneBank accession No.) NM_020139(DHRS6, Dehydrogenase/reductase(SDR family) member 6), 유전자 등록번호(GeneBank accession No.) NM_020918(GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(GeneBank accession No.) NM_032523(OSBPL6, Oxysterol binding protein-like 6), 유전자 등록번호(GeneBank accession No.) NM_033505(SELI, Selenoprotein I), 유전자 등록번호(GeneBank accession No.) Z28339(AKR1D1, Aldo-keto reductase family 1, member D1(delta 4-3-ketosteroid-5-beta-reductase)), 유전자 등록번호(GeneBank accession No.) AK024899(ENPP3, Ectonucleotide pyrophosphatase/ phosphodiesterase 3), 유전자 등록번호(GeneBank accession No.) AK025546(PTPN4, Protein tyrosine phosphatase, non-receptor type 4(megakaryocyte)), 유전자 등록번호(GeneBank accession No.) AK124910(ENPP2, Ectonucleotide pyrophosphatase/phosphodiesterase 2(autotaxin)), 유전자 등록번호(GeneBank accession No.) BC035116(FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), 유전자 등록번호(GeneBank accession No.) BC050565(PASK, PAS domain containing serine/threonine kinase), 유전자 등록번호(GeneBank accession No.) L13436(NPR2, Natriuretic peptide receptor B/guanylate cyclase B(atrionatriuretic peptide receptor B)), 유전자 등록번호(GeneBank accession No.) NM_001005862(ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog(avian)), 유전자 등록번호(GeneBank accession No.) NM_005012(ROR1, Receptor tyrosine kinase-like orphan receptor 1), 유전자 등록번호(GeneBank accession No.) NM_006035(CDC42BPB, CDC42 binding protein kinase beta(DMPK-like)), 유전자 등록번호(GeneBank accession No.) NM_014791(MELK, Maternal embryonic leucine zipper kinase), 유전자 등록번호(GeneBank accession No.) NM_023028(FGFR2, Fibroblast growth factor receptor 2(bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), 유전자 등록번호(GeneBank accession No.) NM_080836(STK35, Serine/threonine kinase 35), 유전자 등록번호(GeneBank accession No.) AF419331(FUSIP1, FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(GeneBank accession No.) AK091927(SFRS3, Splicing factor, arginine/serine-rich 3), 유전자 등록번호(GeneBank accession No.) BC010266(HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(GeneBank accession No.) BC012360(CTAGE5, CTAGE family, member 5), 유전자 등록번호(GeneBank accession No.) BC036046(PLRG1, Pleiotropic regulator 1(PRL1 homolog, Arabidopsis)), 유전자 등록번호(GeneBank accession No.) BC065384(PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BX537360(CPSF5, Nudix(nucleoside diphosphate linked moiety X)-type motif 21), 유전자 등록번호(GeneBank accession No.) BX537494(HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2/B1), 유전자 등록번호(GeneBank accession No.) BX647784(HNRPR, Heterogeneous nuclear ribonucleoprotein R), 유전자 등록번호(GeneBank accession No.) CA455267(PPIH, Peptidyl prolyl isomerase H(cyclophilin H)), 유전자 등록번호(GeneBank accession No.) CR596214(HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), 유전자 등록번호(GeneBank accession No.) NM_001326(CSTF3, Hypothetical protein LOC283267), 유전자 등록번호(GeneBank accession No.) NM_004640(BAT1, HLA-B associated transcript 1), 유전자 등록번호(GeneBank accession No.) NM_005463(HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(GeneBank accession No.) NM_006924(SFRS1, Splicing factor, arginine/serine-rich 1(splicing factor 2, alternate splicing factor)), 유전자 등록번호(GeneBank accession No.) NM_012426(SF3B3, Splicing factor 3b, subunit 3, 130kDa), 유전자 등록번호(GeneBank accession No.) NM_018048(FLJ10292, Mago-nashi homolog), 유전자 등록번호(GeneBank accession No.) NM_030919(C20orf129, Chromosome 20 open reading frame 129), 유전자 등록번호(GeneBank accession No.) NM_031370(HNRPD, Heterogeneous nuclear ribonucleoprotein D(AU-rich element RNA binding protein 1, 37kDa)), 유전자 등록번호(GeneBank accession No.) NM_138933(ACF, Apobec-1 complementation factor), 유전자 등록번호(GeneBank accession No.) AB193259(ACE2, Angiotensin I converting enzyme(peptidyl-dipeptidase A) 2), 유전자 등록번호(GeneBank accession No.) BX648769(EWSR1, Ewing sarcoma breakpoint region 1), 유전자 등록번호(GeneBank accession No.) AB023154(DTX4, Deltex 4 homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) AL543755(VAV3, Vav 3 oncogene), 유전자 등록번호(GeneBank accession No.) M75106(CPB2, Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(GeneBank accession No.) NM_021045(ZNF248, Zinc finger protein 248), 유전자 등록번호(GeneBank accession No.) AB209194(B4GALT6, UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6), 유전자 등록번호(GeneBank accession No.) AF279145(ANTXR1, Anthrax toxin receptor 1), 유전자 등록번호(GeneBank accession No.) NM_025074(FRAS1, Fraser syndrome 1), 유전자 등록번 호(GeneBank accession No.) AK025790(KIF20A, Kinesin family member 20A), 유전자 등록번호(GeneBank accession No.) NM_006152(LRMP, Lymphoid-restricted membrane protein), 유전자 등록번호(GeneBank accession No.) NM_000340(SLC2A2, Solute carrier family 2(facilitated glucose transporter), member 2), 유전자 등록번호(GeneBank accession No.) AF071592(KIF4A, Kinesin family member 4A), 유전자 등록번호(GeneBank accession No.) NM_013277(RACGAP1, Rac GTPase activating protein 1), 유전자 등록번호(GeneBank accession No.) AY043484(SCN1A, Sodium channel, voltage-gated, type I, alpha), 유전자 등록번호(GeneBank accession No.) AY791349(KIF18A, Kinesin family member 18A), 유전자 등록번호(GeneBank accession No.) NM_018018(SLC38A4, Solute carrier family 38, member 4), 유전자 등록번호(GeneBank accession No.) AK094603(FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(GeneBank accession No.) NM_021069(ARGBP2, Sorbin and SH3 domain containing 2), 유전자 등록번호(GeneBank accession No.) NM_001005747(CACNB4, Calcium channel, voltage-dependent, beta 4 subunit), 유전자 등록번호(GeneBank accession No.) AJ496568(SLC25A12, Solute carrier family 25(mitochondrial carrier, Aralar), member 12), 유전자 등록번호(GeneBank accession No.) NM_030641(APOL6, Apolipoprotein L, 6), 유전자 등록번호(GeneBank accession No.) NM_173512(FLJ39822, Hypothetical protein FLJ39822), 유전자 등록번호(GeneBank accession No.) NM_000037(ANK1, Ankyrin 1, erythrocytic), 유전자 등록번호(GeneBank accession No.) NM_001011554(SLC13A3, Solute carrier family 13(sodium-dependent dicarboxylate transporter), member 3), 유전자 등록번호(GeneBank accession No.) AB091343(C10orf3, Centrosomal protein 55kDa), 유전자 등록번호(GeneBank accession No.) AK000643(ASB9, Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(GeneBank accession No.) AK055221(FBXO5, F-box protein 5), 유전자 등록번호(GeneBank accession No.) AK075271(SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like(aminotransferase 2)), 유전자 등록번호(GeneBank accession No.) AK122685(GLUD1, Glutamate dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AK127098(FLJ10706, Chromosome 1 open reading frame 112), 유전자 등록번호(GeneBank accession No.) AL133031(MLR1, Transcription factor MLR1), 유전자 등록번호(GeneBank accession No.) AY007723(MAL2, Mal, T-cell differentiation protein 2), 유전자 등록번호(GeneBank accession No.) BC022255(Spc25, Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BC041882(ATF7IP2, Activating transcription factor 7 interacting protein 2), 유전자 등록번호(GeneBank accession No.) BC052951(LMNB1, Lamin B1), 유전자 등록번호(GeneBank accession No.) BC098313(FLJ20641, Hypothetical protein FLJ20641), 유전자 등록번호(GeneBank accession No.) NM_001809(CENPA, Centromere protein A, 17kDa), 유전자 등록번호(GeneBank accession No.) NM_145061(C13orf3, Chromosome 13 open reading frame 3), 유전자 등록번호(GeneBank accession No.) XM_372695(LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase(LOC390859), mRNA).GeneBank accession No.AK125150 (MAPK8, Mitogen-activated protein kinase 8), GeneBank accession No. NM_002758 (MAP2K6, Mitogen-activated protein kinase kinase 6), Gene accession number (GeneBank accession No.) NM_004612 (TGFBR1, Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kDa)), gene accession number (GeneBank accession No.) NM_145686 (MAP4K4, Mitogen-activated protein kinase kinase kinase 4) , GeneBank accession No. XM_042066 (MAP3K1, Mitogen-activated protein kinase kinase kinase 1), GeneBank accession No. AB011123 (TNIK, TRAF2 and NCK interacting kinase), Gene accession number (GeneBank accession No.) AB209031 (C5, Complement component 5), GeneBank accession No. NM_022740 (HIPK2, Homeodomain interacting protein kinase 2), GeneBank accession No. NM_148957 (TNFRSF19, Tumor necrosis factor receptor superf amily, member 19), GeneBank accession No. AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1); macrophage antigen 1 (mac-1) beta subunit)), GeneBank accession No. AB209211 (TIA1, TIA1 cytotoxic granule-associated RNA binding protein), GeneBank accession No. AB209613 (DNASE1L3, Deoxyribonuclease) I-like 3), GeneBank accession No. AK122825 (HMGB1, High-mobility group box 1), GeneBank accession No. AK127326 (PHF17, PHD finger protein 17), Gene accession number ( GeneBank accession No.) AK223503 (CASP1, Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), GeneBank accession No. BC013326 (GAS2, Growth arrest-specific 2), gene registration number GeneBank accession No. BC047698 (IL7, Interleukin 7), GeneBank accession No. D79987 (ESPL1, Extra spindle poles like 1 (S. cerevisiae)), GeneBank accession No. NM_000893 ( KNG1, Kininogen 1), GeneBank accession No. NM_001012271 (BIRC5, Effe ctor cell peptidase receptor 1), GeneBank accession No. NM_004938 (DAPK1, Death-associated protein kinase 1), GeneBank accession No. NM_005879 (TRIP, TRAF interacting protein), gene registration number (GeneBank accession No.) NM_014739 (BCLAF1, BCL2-associated transcription factor 1), gene accession number (GeneBank accession No.) NM_018947 (CYCS, Cytochrome c, somatic), gene accession number (GeneBank accession No.) AB033337 (MPHOSPH1, M-phase phosphoprotein 1), GeneBank accession No. AB209179 (PLK1, Polo-like kinase 1 (Drosophila)), Gene accession number (GeneBank accession No.) AB209337 (CDC7, CDC7 cell division cycle 7 (S . cerevisiae)), GeneBank accession No. AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)), GeneBank accession No. AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast), GeneBank accession No. AF345347 (SPAG5, Sperm associated antigen 5), GeneBank accession No. AK092638 (CCNG2, Cyclin G2), GeneBank accession No. AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), GeneBank accession No. AL833191 (SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1 (yeast)), GeneBank accession No. AY257469 ( CIT, Citron (rho-interacting, serine / threonine kinase 21), GeneBank accession No. AY367065 (ASPM, Asp (abnormal spindle) -like, microcephaly associated (Drosophila)), GeneBank accession No.) BC011000 (CDCA5, Cell division cycle asso ciated 5), GeneBank accession No. BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), GeneBank accession No. BC043502 (NEK2, never in mitosis gene a) -related kinase 2 , GeneBank accession No. BU675073 (PTTG1, Pituitary tumor-transforming 1), GeneBank accession No. BX647885 (STMN1, Stathmin 1 / oncoprotein 18), GeneBank accession No. CR592757 (BRRN1, Barren homolog 1 (Drosophila)), GeneBank accession No. CR597075 (MAPRE2, Microtubule-associated protein, RP / EB family, member 2), GeneBank accession No. CR604810 ( CCNA2, Cyclin A2), GeneBank accession No. CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), GeneBank accession No. NM_000919 (PAM, Peptidylglycine alpha-amidating monooxygenase), GeneBank accession No. NM_001790 (CDC25C, Cell division cycle 2 5C), GeneBank accession No. NM_001798 (CDK2, Cyclin-dependent kinase 2), GeneBank accession No. NM_001813 (CENPE, Centromere protein E, 312kDa), GeneBank accession No. NM_003318 (TTK, TTK protein kinase), GeneBank accession No. NM_003981 (PRC1, Protein regulator of cytokinesis 1), GeneBank accession No. NM_004523 (KIF11, Kinesin family member 11) Gene accession number (GeneBank accession No.) NM_004701 (CCNB2, Cyclin B2), gene accession number (GeneBank accession No.) NM_005983 (SKP2, S-phase kinase-associated protein 2 (p45)), gene accession number (GeneBank accession No. NM_006101 (KNTC2, Kinetochore associated 2), GeneBank accession No. NM_006845 (KIF2C, Kinesin family member 2C), GeneBank accession No. NM_007375 (TARDBP, TAR DNA binding protein), Gene Registration number (GeneBank accession No.) NM_012112 (TPX2, TPX2, microtubul e-associated, homolog (Xenopus laevis)), GeneBank accession No. NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), GeneBank accession No. NM_015097 (CLASP2, Cytoplasmic linker associated protein 2), GeneBank accession No. NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), GeneBank accession No. NM_016426 (GTSE1, G-2 and S-phase expressed 1), Gene Registration Number (GeneBank accession No.) NM_018492 (PBK, PDZ binding kinase), Gene Registration Number (GeneBank accession No.) NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), Gene Registration Number GeneBank accession No. NM_020242 (KNSL7, Kinesin family member 15), GeneBank accession No. NM_031966 (CCNB1, Cyclin B1), GeneBank accession No. NM_138555 (KIF23, Kinesin family member 23 ), GeneBank accession No. U65410 (MAD2L1, MAD2 mitotic arrest defic ient-like 1 (yeast), GeneBank accession No. AB020656 (CYLD, Cylindromatosis (turban tumor syndrome)), GeneBank accession No. AF033122 (SESN1, Sestrin 1), Gene registration GeneBank accession No. AK074377 (UHRF1, Chromosome 19 open reading frame 31), GeneBank accession No. AK091170 (CDKN2C, Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)), gene registration number ( GeneBank accession No.) AK094323 (NFYC, Nuclear transcription factor Y, gamma), GeneBank accession No. AY366508 (LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), Gene accession number (GeneBank accession No.) BC033086 (TCF19, Transcription factor 19 (SC1)), GeneBank accession No. BC040303 (PTP4A1, Protein tyrosine phosphatase type IVA, member 1), GeneBank accession No. BC040991 (TFDP2 , Transcription factor Dp-2 (E2F dimerization partner 2), gene registration number (GeneBank accession No.) BC092412 (SGOL2, Shugoshin-like 2 (S. pombe), GeneBank accession No. BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), GeneBank accession No. BX649128 (SESN3, Sestrin 3), GeneBank accession No. ) CD049340 (AURKB, Aurora kinase B), GeneBank accession No. M89914 (NF1, Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)), GeneBank accession No. NM_001005414 (ZWINT, ZW10 interactor antisense, GeneBank accession No. NM_001008491 (Sep 2, Septin 2), GeneBank accession No. NM_001274 (CHEK1, CHK1 checkpoint homolog (S. pombe)), Gene accession number ( GeneBank accession No.) NM_002105 (H2AFX, H2A histone family, member X), GeneBank accession No.) NM_002388 (MCM3, MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)), Gene accession number (GeneBank accession No. NM_002417 (MKI67, Antigen identified by monoclon al antibody Ki-67), GeneBank accession No. NM_002875 (RAD51, RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)), GeneBank accession No. NM_003884 (PCAF, P300 / CBP-associated factor), GeneBank accession No. NM_004526 (MCM2, MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)), GeneBank accession No. NM_004847 (AIF1, Allograft inflammatory factor 1), GeneBank accession No. NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) ( S. cerevisiae)), GeneBank accession No. NM_012090 (MACF1, Microtubule-actin crosslinking factor 1), GeneBank accession No. NM_012415 (RAD54B, RAD54 homolog B (S. cerevisiae)), GeneBank accession No. NM_014264 (PLK4, Polo-like kinase 4 (Drosophila)), GeneBank accession No. NM_015714 (G0S2, G0 / G1switch 2), GeneBank accession No. ) NM_024680 (FLJ23311, E2F transcription factor 8), GeneBank accession No. XM_034274 (MYBL1, V-myb myeloblastosis viral oncogene homolog (avian) -like 1), Gene accession number (GeneBank accession No.) AK001720 ( FLJ10858, Nei endonuclease VIII-like 3 (E. coli)), gene registration number (GeneBank acc ession No.) AY032677 (POLQ, Polymerase (DNA directed), theta), GeneBank accession No. BC034480 (BLM, Bloom syndrome), GeneBank accession No. BC073161 (RAD51C, RAD51 homolog C (S. cerevisiae)), GeneBank accession No. CR600021 (HMGB2, High-mobility group box 2), GeneBank accession No. CR625391 (RAD51AP1, RAD51 associated protein 1), GeneBank accession No.) CR936783 (FLJ40869, Hypothetical protein LOC284952), GeneBank accession No. DQ140356 (KIAA1596, Fanconi anemia, complementation group M), GeneBank accession No. NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), GeneBank accession No. NM_001618 (PARP1, Poly (ADP-ribose) polymerase family, member 1), GeneBank accession No. NM_003362 (UNG, Uracil-DNA glycosylase), GeneBank accession No. NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), GeneBank accession No. NM_130398 (EXO1, Exonuclease 1), GeneBank accession No. AB020807 (TLR6, Toll-like receptor 6), gene GeneBank accession No. AB032980 (DCDC2, Doublecortin domain containing 2), GeneBank accession No. AB209866 (TFPI, Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor), GeneBank accession No.) AK057015 (HSPA4, Heat shock 70kDa protein 4), GeneBank accession No. AK095515 (IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), GeneBank accession No. AK122686 (IF , I factor (complement), GeneBank accession No. AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide), GeneBank accession No. BC035582 (TRIM22, Tripartite motif-containing 22) GeneBank accession No. BX537894 (LOC493869, Similar to RIKEN cDNA 2310016C16), GeneBank accession No. M14338 (PROS1, Protein S (alpha)), GeneBank accession No. NM_000821 (GGCX, Gamma-glutamyl carboxyla se), GeneBank accession No. NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), GeneBank accession No. NM_001001547 (CD36, CD36 antigen (collagen type) I receptor, thrombospondin receptor), GeneBank accession No. NM_001512 (GSTA4, Glutathione S-transferase A4), GeneBank accession No. NM_001629 (ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), GeneBank accession No. NM_001752 (CAT, Catalase), GeneBank accession No. NM_001837 (CCR3, Chemokine (CC motif) receptor 3), GeneBank accession No. NM_001979 (EPHX2 , Epoxide hydrolase 2, cytoplasmic), GeneBank accession No. NM_001994 (F13B, Coagulation factor XIII, B polypeptide), GeneBank accession No. NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), gene Registration number GeneBank accession No. NM_006120 (HLA-DMA, Major histocompatibility complex, class II, DM alpha), GeneBank accession No. NM_173216 (SIAT1, ST6 beta-galactosamide alpha-2,6-sylyltranferase 1), GeneBank accession No. NM_202002 (FOXM1, Forkhead box M1), GeneBank accession No. AB163917 (LRAP, Leukocyte-derived arginine aminopeptidase), GeneBank accession No. BC027881 (AFP) , Alpha-fetoprotein, GeneBank accession No. NM_015915 (SPG3A, Spastic paraplegia 3A (autosomal dominant)), GeneBank accession No. NM_000671 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), GeneBank accession No. J05428 (UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), GeneBank accession No. NM_000672 (ADH6, Alcohol dehydrogenase 6 (class V)), gene registration number (GeneBank accession No.) M15943 (ADH4, Alcohol dehy drogenase 4 (class II), pi polypeptide), gene accession number (GeneBank accession No.) AK223395 (FBP1, Fructose-1,6-bisphosphatase 1), gene accession number (GeneBank accession No.) NM_000151 (G6PC, Glucose-6 -phosphatase, catalytic (glycogen storage disease type I, von Gierke disease), GeneBank accession No. XM_113962 (KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), GeneBank accession No. AB020644 (ACSL6, Acyl-CoA synthetase long-chain family member 6), GeneBank accession No. AB209907 (PLD1, Phospholipase D1, phophatidylcholine-specific), GeneBank accession No. AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1), member 1), GeneBank accession No. AF297872 (TRERF1, Transcriptional regulating factor 1), GeneBank accession No. AF303134 (ALDH8A1, Aldehyde) dehydrogenase 8 family, member A1), gene registration number GeneBank accession No.AF339053 (PLA2G12B, Phospholipase A2, group XIIB), GeneBank accession No.AK096018 (HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), Gene accession number (GeneBank accession No.) AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), GeneBank accession No. AK127346 (SIAT9, ST3 beta-galactoside alpha-2,3-sialyltransferase 5), GeneBank accession No. AL359559 (AGPS, Alkylglycerone phosphate synthase), GeneBank accession No. AY691170 (PLCL3, Phospholipase C-like 3), GeneBank accession No. BG567934 (APOM, Apolipoprotein M), Gene Registration Number (GeneBank accession No.) BX538214 (C6orf167, Chromosome 6 open reading frame 167), GeneBank accession No. BX640945 (FADS2, Fatty acid desaturase 2), GeneBank accession No. BX648473 (PIGK , Phosphatidylinositol glycan, class K), gene registration GeneBank accession No. BX648557 (HSD17B2, Hydroxysteroid (17-beta) dehydrogenase 2), GeneBank accession No. CR749601 (ETNK1, Death-associated protein kinase 3), Gene accession No. ) NM_000859 (HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), GeneBank accession No. NM_001443 (FABP1, Fatty acid binding protein 1, liver), GeneBank accession No. NM_002130 (HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble), GeneBank accession No.) NM_003725 (RODH, Hydroxysteroid (17-beta) dehydrogenase 6), Gene accession number (GeneBank accession No NM_004845 (PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), GeneBank accession No. NM_014762 (DHCR24, 24-dehydrocholesterol reductase), GeneBank accession No. NM_020139 (DHRS6ductase) (SDR family) member 6), GeneBank accessi on No.) NM_020918 (GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), GeneBank accession No. NM_032523 (OSBPL6, Oxysterol binding protein-like 6), GeneBank accession No. NM_033505 ( SELI, Selenoprotein I), GeneBank accession No. Z28339 (AKR1D1, Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)), GeneBank accession No.) AK024899 (ENPP3, Ectonucleotide pyrophosphatase / phosphodiesterase 3), GeneBank accession No. AK025546 (PTPN4, Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)), Gene accession number (GeneBank accession No.) AK124910 (ENPP2, Ectonucleotide pyrophosphatase / phosphodiesterase 2 (autotaxin)), gene accession number (GeneBank accession No.) BC035116 (FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), gene accession number (GeneBank accession No.) BC050565 (PASK, PAS domain containing serine / threonine kinase), GeneBank accession No. L13436 (NPR2, Natriuretic peptide receptor B / guanylate cyclase B (atrionatriuretic peptide receptor B)), GeneBank accession No. NM_001005862 (ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro / glioblastoma derived oncogene homolog (avian), GeneBank accession No. NM_005012 (ROR1, Receptor tyrosine kinase-like orphan receptor 1), GeneBank accession No. NM_006035 (CDC42BPB , CDC42 binding protein kinase beta (DMPK-like), GeneBank accession No. NM_014791 (MELK, Maternal embryonic leucine zipper kinase), GeneBank accession No. NM_023028 (FGFR2, Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), GeneBank accession No. NM_080836 (STK35, Serine / threonine kinase 35), GeneBank accession No. AF419331 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), GeneBank accession No. AK091927 (SFRS3, Splicing factor, arginine / serine-rich) 3), GeneBank accession No. BC010266 (HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), GeneBank accession No. BC012360 (CTAGE5, CTAGE family, member 5), GeneBank accession No. ) BC036046 (PLRG1, Pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)), GeneBank accession No. BC065384 (PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)), GeneBank accession No. BX537360 (CPSF5, Nudix (nucleoside diphosphate linked moiety X) -type motif 21), GeneBank accession No. BX537494 (HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2 / B1 GeneBank accession No. BX647784 (HNRPR, Heterogeneous nuclear ribonucleoprotein R), GeneBank accession No. CA455267 (PPIH, Peptidyl prolyl isomerase H (cyclophilin H), GeneBank accession No.) CR596214 (HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), GeneBank accession No. NM_001326 (CSTF3, Hypothetical protein LOC283267), GeneBank accession No. NM_004640 (BAT1, HLA-B associated transcript 1 GeneBank accession No. NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), GeneBank accession No. NM_006924 (SFRS1, Splicing factor, arginine / serine-rich 1 (splicing fact) or 2, alternate splicing factor), GeneBank accession No. NM_012426 (SF3B3, Splicing factor 3b, subunit 3, 130 kDa), GeneBank accession No. NM_018048 (FLJ10292, Mago-nashi homolog) , GeneBank accession No. NM_030919 (C20orf129, Chromosome 20 open reading frame 129), GeneBank accession No. NM_031370 (HNRPD, Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) GeneBank accession No. NM_138933 (ACF, Apobec-1 complementation factor), GeneBank accession No. AB193259 (ACE2, Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2), gene GeneBank accession No. BX648769 (EWSR1, Ewing sarcoma breakpoint region 1), GeneBank accession No. AB023154 (DTX4, Deltex 4 homolog (Drosophila)), GeneBank accession No. AL543755 (VAV3, Vav 3 oncogene), gene registration number ( GeneBank accession No.) M75106 (CPB2, Carboxypeptidase B2 (plasma, carboxypeptidase U)), gene accession number (GeneBank accession No.) NM_021045 (ZNF248, Zinc finger protein 248), gene accession number (GeneBank accession No.) AB209194 (B4GALT6 , UDP-Gal: betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6), gene accession number (GeneBank accession No.) AF279145 (ANTXR1, Anthrax toxin receptor 1), gene accession number (GeneBank accession No.) NM_025074 (FRAS1, Fraser syndrome 1), GeneBank accession No.AK025790 (KIF20A, Kinesin family member 20A), GeneBank accession No. NM_006152 (LRMP, Lymphoid-restricted membrane protein), GeneBank accession No.) NM_000340 (SLC2A2, Solute carrier family 2 (facilitated glucose transporter), member 2), GeneBank accession No. AF071592 (KIF4A, Kinesin family member 4A), Gene accession number (GeneBank accession No.) NM_013277 (RACGAP1, Rac GTPase activating protein 1), GeneBank accession No. AY043484 (SCN1A, Sodium channel, voltage-gated, type I, alpha), GeneBank accession No. AY791349 (KIF18A, Kinesin family member 18A), gene registration Number (GeneBank accession No.) NM_018018 (SLC38A4, Solute carrier family 38, member 4), GeneBank accession No. AK094603 (FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), GeneBank accession No. NM_021069 (ARGBP2, Sorbin and SH3 domain containing 2), GeneBank accession No. NM_001005747 (CACNB4, Calcium channel, voltage- dependent, beta 4 subunit), GeneBank accession No. AJ496568 (SLC25A12, Solute carrier family 25 (mitochondrial carrier, Aralar), member 12), GeneBank accession No. NM_030641 (APOL6, Apolipoprotein L , 6), GeneBank accession No. NM_173512 (FLJ39822, Hypothetical protein FLJ39822), GeneBank accession No. NM_000037 (ANK1, Ankyrin 1, erythrocytic), Gene accession number (GeneBank accession No.) NM_001011554 (SLC13A3, Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3), gene accession number (GeneBank accession No.) AB091343 (C10orf3, Centrosomal protein 55kDa), gene accession number (GeneBank accession No.) AK000643 (ASB9 , Ankyrin repeat and SOCS box-containing 9), GeneBank accession No. AK055221 (FBXO5, F-box protein 5), GeneBank accession No. AK075271 (SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2 -like (aminotransferase 2)), gene accession number (GeneBank accession No.) AK122685 (GLUD1, Glutamate dehydrogenase 1), gene accession number (GeneBank accession No.) AK127098 (FLJ10706, Chromosome 1 open reading frame 112), gene accession number GeneBank accession No.AL133031 (MLR1, Transcription factor MLR1), GeneBank accession No. AY007723 (MAL2, Mal, T-cell differentiation protein 2), GeneBank accession No. BC022255 (Spc25 Spindle pole body component 25 homolog (S. cerevisiae)), GeneBank accession No. BC041882 (ATF7IP2, Activating transcription factor 7 interacting protein 2), GeneBank accession No. BC052951 (LMNB1, Lamin B1), Gene accession No. BC098313 (FLJ20641, Hypothetical protein FLJ20641), GeneBank accession No. NM_001809 (CENPA, Centromere protein A, 17kDa), GeneBank accession No. NM_145061 (C13orf3, Chromosome 13 open reading frame 3 GeneBank accession No. XM_372695 (LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase (LOC390859), mRNA).

본 발명자들은 페난트렌에 대한 노출 여부 확인용 바이오마커를 발굴하기 위하여, 페난트렌을 인간 간암 세포주(HepG2)에 처리하여 세포 독성을 확인하였다. 그 결과, 상기 페난트렌은 인간 간암 세포주에 독성을 가짐이 확인되었고(도 1 참조), 상기 실험을 바탕으로 페난트렌의 농도를 결정하였다. 이후 상기 결정된 농도로 페난트렌을 인간 간암 세포주에 처리하고, 상기 물질을 처리한 세포주에서 mRNA를 분리하여 cDNA를 합성하면서 형광물질(Cy5)로 표지하였으며, 약물을 처리하지 않은 대조군의 경우 Cy3로 표지하였다. 상기 형광표지된 cDNA를 44 k 올리고마이크로어레이 칩 Human whole genome microarray(Agilent, USA)와 혼성화하였고, 형광 이미지를 스캔하여 유전자 발현 양상의 차이를 분석하였다(도 2 참조). 분석시 Cy5/Cy3 비율이 2.0배 이상인 경우 발현 증가된 유전자로 분류하였고, 0.5배 이하인 경우 발현 감소된 유전자로 분류하였다. 분석 결과, 발현 증가된 유전자는 0.69%(44,000개의 유전자 중 302개) 발현이 감소된 유전자는 0.55%(44,000개의 유전자 중 244개)임을 확인하였다. 이때, 페난트렌에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 분류한 기능별로 분류하면, MAPKinase 신호 경로(MAPKinase Signaling Pathway), MAPKKK 캐스케이드(MAPKKK cascade), 아팝토시스(apoptosis), 유사분열 세포주기(Mitotic cell cycle), 세포 주기(cell cycle), 세포 분화(Cell differentiation), 세포 운동성(Cell motility), 세포 골격(Cytoskeleton), 형태 발생(Morphogenesis), DNA 손상 반응(response to DNA damage stimulus), 화학자극에 대한 반응(Response to chemical stimulus), 외부자극에 대한 반응(Response to external stimulus), 스트레스에 대한 반응(Response to stress), 면역반응(immune response), 사이토크롬 p450에 의한 대사(Metabolism of xenobiotics by cytochrome p450), 알코올 대사(Alcohol metabolism), 지질 대사(lipid metabolism), 인산염 대사(Phosphate metabolism), DNA 대사(DNA metabolism), 금속원소 결합(metal binding) 또는 전달(Transport) 등의 관련 유전자들이었다(표 2 및 표 3참조). 상기 유전자들은 본 발명에서 사용한 페난트렌을 처리했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.The present inventors confirmed the cytotoxicity by treating phenanthrene to human liver cancer cell line (HepG2) in order to discover a biomarker for confirming the exposure to phenanthrene. As a result, the phenanthrene was confirmed to be toxic to human liver cancer cell line (see FIG. 1), and the concentration of phenanthrene was determined based on the experiment. Thereafter, phenanthrene was treated to human liver cancer cell lines at the determined concentration, mRNA was isolated from the cell line treated with the substance, and cDNA was synthesized and labeled with fluorescent substance (Cy5), and the control group not treated with drug was labeled with Cy3. It was. The fluorescently labeled cDNA was hybridized with a 44 k oligomicroarray chip, Human whole genome microarray (Agilent, USA), and analyzed for differences in gene expression patterns by scanning fluorescent images (see FIG. 2). In the analysis, when the Cy5 / Cy3 ratio was 2.0 times or more, the expression was increased. As a result, it was confirmed that the gene with increased expression was 0.69% (302 of 44,000 genes) and 0.55% (244 of 44,000 genes) with reduced expression. In this case, when the genes that are overexpressed or underexpressed by phenanthrene are classified by the function classified, MAPKinase Signaling Pathway, MAPKKK cascade, apoptosis, and mitotic cell cycle (Mitotic cell cycle), cell cycle, cell differentiation, cell motility, cytoskeleton, morphogenesis, response to DNA damage stimulus, Response to chemical stimulus, Response to external stimulus, Response to stress, Immune response, Metabolism of cytochrome p450 xenobiotics by cytochrome p450), alcohol metabolism, lipid metabolism, phosphate metabolism, DNA metabolism, metal binding or transport It was in the genes (see Table 2 and Table 3). The genes are not reported to be associated with toxicity in human liver cancer cells when treated with phenanthrene used in the present invention.

본 발명자들은 상기 유전자 중 과발현된 유전자 19종과 저발현된 유전자 9종을 분리하여 실시간 RT-PCR(real-time reverse transcript polymerase chain reaction) 방법으로 발현 양상을 조사하였다. 그 결과, 19종의 과발현 유전자들과 9종의 저발현 유전자의 발현 양상이 올리고마이크로어레이 칩 결과와 유사하게 나타남을 확인하였다(표 5 참조). 이들 유전자들은 유전자 등록번호(GeneBank accession No.) BM913048(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(GeneBank accession No.) BX649164(serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번 호(GeneBank accession No.) NM_004864(Growth differentiation factor 15), 유전자 등록번호(GeneBank accession No.) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) AK095363(Aquaporin 3), 유전자 등록번호(GeneBank accession No.) NM_001013632(Similar to hypothetical protein 4833401D15), 유전자 등록번호(GeneBank accession No.) BC042390(Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(GeneBank accession No.) BQ683841(S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(GeneBank accession No.) NM_003897(Immediate early response 3), 유전자 등록번호(GeneBank accession No.) BM926478(Retinol binding protein 1, cellular), 유전자 등록번호(GeneBank accession No.) BU945318(metallothionein 2A), 유전자 등록번호(GeneBank accession No.) AK094474(Ras homolog gene family, member C), 유전자 등록번호(GeneBank accession No.) Y11307(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(GeneBank accession No.) AY247738(Tribbles homolog 3(Drosophila)), 유전자 등록번호(GeneBank accession No.) Z25424(MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) NM_001769(CD9 antigen(p24)), 유전자 등록번호(GeneBank accession No.) Y12692(Wingless-type MMTV integration site family, member 11), 유전자 등록번호(GeneBank accession No.) X02812(Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(GeneBank accession No.) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(GeneBank accession No.) NM_006101(Kinetochore associated 2), 유전자 등록번호(GeneBank accession No.) NM_003318(TTK protein kinase), 유전자 등록번호(GeneBank accession No.) NM_001067(Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(GeneBank accession No.) NM_018492(PDZ binding kinase), 유전자 등록번호(GeneBank accession No.) U65410(MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AK074377(Chromosome 19 open reading frame 31), 유전자 등록번호(GeneBank accession No.) CR600021(High-mobility group box 2), 유전자 등록번호(GeneBank accession No.) BC022255(Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AB091343(Centrosomal protein 55kDa) 이다.The present inventors separated the overexpressed genes and the nine low-expressed genes from the genes and examined the expression patterns by real-time reverse transcript polymerase chain reaction (RT-PCR). As a result, it was confirmed that the expression patterns of 19 overexpression genes and 9 low expression genes were similar to those of the oligomicroarray chip (see Table 5). These genes include the GeneBank accession No. BM913048 (TIMP metallopeptidase inhibitor 1), the GeneBank accession No. BX649164 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1) , GeneBank accession No. NM_004864 (Growth differentiation factor 15), GeneBank accession No. NM_000499 (Cytochrome P450, family 1, subfamily A, polypeptide 1), Gene accession number (GeneBank accession No.) AK095363 (Aquaporin 3), GeneBank accession No. NM_001013632 (Similar to hypothetical protein 4833401D15), GeneBank accession No. BC042390 (Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) ), GeneBank accession No. BQ683841 (S100 calcium binding protein A11 (calgizzarin)), GeneBank accession No. NM_003897 (Immediate early response 3), Gene accession number (GeneBank acc ession No.) BM926478 (Retinol binding protein 1, cellular), GeneBank accession No. BU945318 (metallothionein 2A), GeneBank accession No. AK094474 (Ras homolog gene family, member C), gene GeneBank accession No. Y11307 (Cysteine-rich, angiogenic inducer, 61), GeneBank accession No. AY247738 (Tribbles homolog 3 (Drosophila)), GeneBank accession No. Z25424 (GeneBank accession No.) MAP kinase interacting serine / threonine kinase 2), GeneBank accession No. NM_001769 (CD9 antigen (p24)), GeneBank accession No. Y12692 (Wingless-type MMTV integration site family, member 11) , GeneBank accession No. X02812 (Transforming growth factor, beta 1 (Camurati-Engelmann disease)), GeneBank accession No. NM_000596 (Insulin-like growth factor binding protein 1), Gene accession number (GeneBank accession No.) NM_006101 (Kinetochore assoc iated 2), GeneBank accession No. NM_003318 (TTK protein kinase), GeneBank accession No. NM_001067 (Topoisomerase (DNA) II alpha 170kDa), GeneBank accession No. NM_018492 (PDZ binding kinase), GeneBank accession No. U65410 (MAD2 mitotic arrest deficient-like 1 (yeast)), GeneBank accession No. AK074377 (Chromosome 19 open reading frame 31), Gene registration Number (GeneBank accession No.) CR600021 (High-mobility group box 2), GeneBank accession No. BC022255 (Spindle pole body component 25 homolog (S. cerevisiae)), GeneBank accession No. AB091343 (Centrosomal protein 55 kDa).

또한, 본 발명은 상기 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보적인 올리고뉴클레오티드가 집적된 페난트렌에 대한 노출 여부 확인용 DNA 마이크로어레이칩을 제공한다.In another aspect, the present invention provides a DNA microarray chip for confirming the exposure to phenanthrene in which an oligonucleotide comprising all or part of the biomarker gene sequence or its complementary oligonucleotide is integrated.

상기 올리고 뉴클레오티드 또는 이의 상보적인 올리고뉴클레오티드는 상기 바이오마커 유전자의 18 내지 30개의 핵산을 포함하고, 바람직하게는 20 내지 25개의 핵산을 포함한다. The oligonucleotide or its complementary oligonucleotide comprises 18 to 30 nucleic acids of the biomarker gene, preferably 20 to 25 nucleic acids.

본 발명의 페난트렌 검색용 DNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 상기 탐색된 바이오마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 핀 형태의 스폿터인 마이크로어레이를 이용하였다. 상기 DNA 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이 바람직하나 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나 이에 제한되는 것은 아니며, 본 발명의 바람직한 실시예에서는 아미노-실란이 코팅된 슬라이드 글래스를 이용하였다. The phenanthrene retrieval DNA microarray chip of the present invention can be produced by a method known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method or a pin-shaped spotter using a piezoelectric method is used. It is preferable to use the method, but the present invention is not limited thereto. In a preferred embodiment of the present invention, a microarray, which is a pin-shaped spotter, is used. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It is not limited. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto, and in the preferred embodiment of the present invention, amino-silane may be used. Coated slide glass was used.

또한, 본 발명은 상기 바이오마커를 이용한 페난트렌에 대한 노출 여부를 확인하는 방법을 제공한다.In addition, the present invention provides a method for checking the exposure to phenanthrene using the biomarker.

구체적으로, 본 발명은Specifically, the present invention

1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;1) separating RNA from test subject-derived human somatic cells and control somatic cells;

2) 단계 1)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;2) labeling the experimental group and the control group with different fluorescent substances while synthesizing RNA of the experimental group and the control group of step 1) with cDNA;

3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 상기 DNA 마이크로어레이 칩과 혼성화 시키는 단계;3) hybridizing cDNA labeled with different fluorescent materials of step 2) with the DNA microarray chip;

4) 단계 3)의 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및4) analyzing the reacted DNA microarray chip of step 3); And

5) 단계 4)의 분석한 데이터에서 본 발명의 바이오마커의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 페난트렌에 대한 노출 여부를 확인하기 위해 본 발명의 바이오마커를 검출하는 방법을 제공한다.5) provides a method of detecting the biomarker of the present invention to determine whether the exposure to phenanthrene, including the step of confirming the expression level of the biomarker of the present invention in the analyzed data of step 4) compared to the control group do.

상기 방법에 있어서, 단계 1)의 체세포는 인간 간암 세포주(HepG2)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.In the above method, the somatic cell of step 1) preferably uses human liver cancer cell line (HepG2), but is not limited thereto, and any cell derived from cells and tissues of human liver or liver cancer may be used.

상기 방법에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되어지는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다.In the method, the fluorescent material of step 3) is preferably selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). One is not limited thereto, and any fluorescent material known to those skilled in the art may be used.

상기 방법에 있어서, 단계 5)의 DNA 마이크로어레이 칩은 Whole Human Genome Oligo Microarray(Agilent, USA)등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간 게놈 중 본 발명에서 상기 공통적으로 과발현 또는 저발현 유전자(표 2 및 표 3 참조)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, 상기 본 발명자가 제작한 DNA 마이크로어레이 칩을 사용하는 것이 가장 바람직하다. 또한, 단계 5)의 분석 방법은 GenePix 4.1 소프트웨어(Axon Instruments, USA)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.In the above method, the DNA microarray chip of step 5) preferably uses Whole Human Genome Oligo Microarray (Agilent, USA) and the like, but is not limited thereto. Any microarray chip loaded with genes (see Tables 2 and 3) can be used, and it is most preferable to use a DNA microarray chip produced by the present inventors. In addition, the analysis method of step 5) preferably uses GenePix 4.1 software (Axon Instruments, USA), but is not limited thereto, and analysis software known to those skilled in the art may be used.

또한, 본 발명은In addition, the present invention

1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;1) separating RNA from test subject-derived human somatic cells and control somatic cells;

2) 단계 1)의 RNA를 대상으로, 본 발명의 바이오마커 유전자를 증폭할 수 있는 프라이머쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및2) performing real-time reverse transcript polymerase chain reaction (RT-PCR) on the RNA of step 1) using a primer pair capable of amplifying the biomarker gene of the present invention; And

3) 단계 2)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계를 포함하는 페난트렌에 대한 노출 여부를 확인하기 위해 본 발명의 바이오마커를 검출하는 방법을 제공한다.3) provides a method of detecting the biomarker of the present invention to determine whether the exposure to phenanthrene, including the step of comparing the gene product of step 2) with the control to confirm the expression level.

상기 방법에 있어서, 단계 1)의 체세포는 인간 간암 세포주(HepG2)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.In the above method, the somatic cell of step 1) preferably uses human liver cancer cell line (HepG2), but is not limited thereto, and any cell derived from cells and tissues of human liver or liver cancer may be used.

상기 방법에 있어서, 단계 3)의 프라이머는 본 발명에서 탐색된 바이오마커 유전자와 상보적이고, 바이오마커를 증폭할 수 있는 프라이머라면 모두 사용가능하다. 본 발명에서는 서열번호 1 내지 56으로 기재되는 정방향 및 역방향의 프라이머 28쌍을 제시하였으나 이에 한정되는 것은 아니다.In the above method, the primer of step 3) is complementary to the biomarker gene found in the present invention, and any primer that can amplify the biomarker can be used. In the present invention, 28 pairs of the forward and reverse primers set forth in SEQ ID NOs: 1 to 56 are provided, but the present invention is not limited thereto.

또한, 본 발명은 페난트렌에 대한 노출 여부 확인용 키트를 제공한다.The present invention also provides a kit for confirming exposure to phenanthrene.

본 발명은 상기 본 발명에서 제작한 DNA 마이크로어레이 칩을 포함하는 페난 트렌에 대한 노출 여부 확인용 키트를 제공한다. The present invention provides a kit for confirming exposure to phenanthrene, including the DNA microarray chip prepared in the present invention.

상기 확인용 키트에 추가적으로 인간 간세포를 포함하는 페난트렌에 대한 노출 여부 확인용 키트를 제공한다. 상기 인간 간세포는 HepG2를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다. In addition to the identification kit provides a kit for confirming the exposure to phenanthrene containing human hepatocytes. The human hepatocyte is preferably HepG2, but is not limited thereto. Any human hepatocyte may be used as long as it is derived from cells and tissues of human liver or liver cancer.

상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 Cy3와 Cy5를 사용하였다. The kit may further include a fluorescent material, wherein the fluorescent material is selected from the group consisting of a strepavidin-like phosphatease conjugate, a chemiflurorensce and a chemiluminescent material. Preferably, but not limited thereto, Cy3 and Cy5 were used in the preferred embodiment of the present invention.

상기 키트에 추가적으로 반응 시약을 포함시킬 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 DNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함시킬 수 있다.The kit may additionally include a reaction reagent, which is a buffer used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), chemical inducer of fluorescent dyes It may be composed of a labeling reagent, such as a washing buffer, but is not limited thereto, and may include all reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art.

아울러, 본 발명은 상기 바이오마커 유전자를 증폭할 수 있는 프라이머쌍을 포함하는 페난트렌에 대한 노출 여부 확인용 키트를 제공한다. In addition, the present invention provides a kit for confirming exposure to phenanthrene comprising a primer pair capable of amplifying the biomarker gene.

상기 확인용 키트의 프라이머는 서열번호 1 내지 56으로 기재되는 서열로 구 성된 군으로부터 선택되는 2개 이상의 정방향 및 역방향의 프라이머쌍을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 상기 바이오마커 유전자에 상보적이며, 바이오마커 유전자를 증폭할 수 있으며, 증폭산물이 100 내지 300 bp가 되도록 설계된 정방향 및 역방향 프라이머쌍은 모두 사용 가능하다. Primer of the kit for confirmation is preferably used two or more forward and reverse primer pairs selected from the group consisting of the sequence described in SEQ ID NO: 1 to 56, but is not limited thereto, and complementary to the biomarker gene It is possible to amplify a biomarker gene, and both forward and reverse primer pairs designed to be 100 to 300 bp may be used.

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

<< 실시예Example 1> 세포 배양 및 화학물질 처리 1> Cell Culture and Chemical Treatment

<1-1> 세포배양<1-1> Cell Culture

인간 간암 세포주인 HepG2 세포(한국 세포주 은행)를 10% FBS가 첨가된 DMEM 배지(Gibro-BRL, USA)를 이용하여 100 디쉬(dish)에서 80% 정도 자랄 때까지 배양하였다. 본 발명자들은 기존의 연구와 보고를 통해 다환방향족 탄화수소류의 하나로서 발암성을 가지고 있는 물질인 페난트렌을 선정하였으며, DMSO에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.HepG2 cells (Korea Cell Line Bank), a human liver cancer cell line, were cultured using DMEM medium (Gibro-BRL, USA) to which 10% FBS was added until they grew from 100 dishes to 80%. The present inventors have selected phenanthrene, a substance having carcinogenicity, as one of the polycyclic aromatic hydrocarbons through existing studies and reports, and dissolved it in DMSO. Vehicle concentration was less than 0.1% in all experiments.

<1-2> 세포 독성 실험(MTT assay) 및 화학 물질 처리<1-2> MTT assay and chemical treatment

Mossman 등(J. Immunol . Methods, 65, 55-63, 1983)의 방법으로 HepG2 세포 주를 이용한 MTT 실험을 수행하였다. 세포는 24-웰 플레이트에 4x105/웰 세포수로 DMEM 배지(Gibro-BRL, USA)에서 DMSO에 용해된 페난트렌을 처리하고 48시간 후에 MTT(3-4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해하였다. 96-웰 플레이트로 옮겨 분주(aliquot)하고 흡광도 540 nm에서 O.D.값을 측정하였다.MTT experiments were performed using HepG2 cell lines by the method of Mossman et al . ( J. Immunol . Methods , 65, 55-63, 1983). Cells were treated with phenanthrene dissolved in DMSO in DMEM medium (Gibro-BRL, USA) with 4 × 10 5 / well cell counts in 24-well plates and after 48 h MTT (3-4,5-dimethylthiazol-2,5- 5 mg / ml of diphenyltetra zolium bromide) was added to the tube and incubated at 37 ° C. for 3 hours. Thereafter, the medium was removed and the formed formazan crystal was dissolved in 500 µl of DMSO. Transfer to a 96-well plate was aliquoted and the OD value was measured at absorbance 540 nm.

HepG2 세포주에서 페난트렌의 세포독성을 살펴본 결과, 500 uM 이상의 농도에서는 시험물질이 석출되고 세포독성은 보이지 않아, 시험물질이 석출되지 않는 최고농도인 500 uM을(도 1 참조), 상기 농도로 결정하여 마이크로어레이 실험을 수행하였다.As a result of examining the cytotoxicity of phenanthrene in the HepG2 cell line, the test substance was precipitated and the cytotoxicity was not detected at the concentration of 500 uM or more, so the highest concentration at which the test substance was not precipitated was determined (see FIG. 1). Microarray experiments were performed.

<< 실시예Example 2>  2> 마이크로어레이Microarray 실험 Experiment

<2-1> 표적 RNA의 분리 및 형광 물질 표지<2-1> Isolation of Target RNA and Fluorescent Labeling

6 x 106 cell/㎖ 농도로 100 mm 디쉬에 HepG2 세포를 분주한 후, 상기 실시예 <1-2>에서 결정된 페난트렌의 농도를 48시간 동안 처리하였다. 이후, 상기 처리한 세포에서 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하고, RNeasy mini kit(Qiagen, USA)를 사용하여 정제하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase set(Qiagen, USA)를 사용하여 제거하였다. 각 전체 RNA 시료의 양은 분광광도계로 측정하였고, 농 도는 Agilent 2100 Bioanalyzer(Agilent Technologies, USA)와 아가로스 젤 전기영동으로 확인하였다. After dispensing HepG2 cells in a 100 mm dish at a concentration of 6 x 10 6 cells / ml, the concentration of phenanthrene determined in Example <1-2> was treated for 48 hours. Thereafter, the whole cells were separated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using the RNeasy mini kit (Qiagen, USA). Genomic DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The amount of each total RNA sample was measured by spectrophotometer, the concentration was confirmed by Agilent 2100 Bioanalyzer (Agilent Technologies, USA) and agarose gel electrophoresis.

<2-2> 표지된 cDNA 제조 <2-2> Labeled cDNA Preparation

올리고 마이크로어레이 분석을 위하여 실시예 2-1에서 수득한 페난트렌 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. 상기 수득한 전체 RNA 30 ㎍과 올리고(dT) 프라이머 2 ㎍(1 ㎍/㎕)과 혼합하고 65에서 10분간 반응시킨 후 바로 얼음에 넣어 어닐링(annealing)시켰다. 상기 어닐링된 RNA의 역전사(Reverse Transcript) 반응을 위해 표 1과 같이 시약을 혼합하였다. CDNA was prepared using the total RNA of the phenanthrene treatment group obtained in Example 2-1 for oligo microarray analysis. The total RNA obtained above was mixed with 30 μg of oligo (dT) primer and 2 μg (1 μg / μl), reacted at 65 for 10 minutes, and then annealed in ice. Reagents were mixed as shown in Table 1 for Reverse Transcript reaction of the annealed RNA.

구성Configuration 부피(㎕)Volume (μl) 5X first strand buffer5X first strand buffer 66 dNTPsdNTPs 0.60.6 0.1 M DDT0.1 M DDT 33 SuperScript II enzymeSuperScript II enzyme 33 Cy-3 or Cy-5 dUTPCy-3 or Cy-5 dUTP 22

대조군인 HepG2 세포주에서 분리한 전체 RNA는 Cy3-dUTP(녹색)로 표지화하였고, 페난트렌을 처리한 HepG2 세포주로부터 분리한 RNA는 Cy5-dUTP(적색)로 표지화하였다. 이때 두 시료는 Microcon YM-30 컬럼(Millipore, USA)을 사용하여 혼합, 정제되었다. Total RNA isolated from control HepG2 cell line was labeled with Cy3-dUTP (green), and RNA isolated from phenanthrene-treated HepG2 cell line was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

<2-3> 혼성화 반응<2-3> hybridization reaction

혼성화 및 세척 과정은 지노첵(주)의 지시방법에 따라 수행되었다. 혼성화는 12시간 동안 62℃ 오븐에서 수행되었다. DNA 마이크로어레이 칩으로는 44 k Whole Human Genome Oligo Microarray(Agilent, USA)를 이용하였다. 세척(2분간 2XSSC/0.1% SDS에 세척, 3분간 1XSSC, 2분간 0.2XSSC에 세척) 후 슬라이드는 3분간 800 rpm으로 원심분리하여 건조하였다. Hybridization and washing procedures were carried out according to the instructions of Genochem Co., Ltd. Hybridization was performed in a 62 ° C. oven for 12 hours. 44 k Whole Human Genome Oligo Microarray (Agilent, USA) was used as the DNA microarray chip. After washing (washing in 2XSSC / 0.1% SDS for 2 minutes, washing in 1XSSC for 3 minutes and 0.2XSSC for 2 minutes), the slides were dried by centrifugation at 800 rpm for 3 minutes.

<2-4> 형광 이미지 획득<2-4> Fluorescence Image Acquisition

슬라이드 상의 혼성화 이미지는 Genepix 4000B(Axon Instruments, USA)로 스캔하였다. 결합하지 않은 유전자를 세척한 칩은 레이저 광 스캐너(laser fluorescence scanner)를 사용하여 형광 이미지를 획득하였다. 이때 녹색 형광 이미지는 대조군에서, 적색 형광 이미지는 실험군에서만 특이하게 발현되는 유전자의 활성정도를 나타내게 되며, 노란색 형광 이미지는 녹색과 적색의 보색으로 두 군의 발현이 큰 차이가 없음을 의미한다. 스캔한 이미지들은 유전자 발현 비율을 얻기 위하여 GenePix 4.1 소프트웨어(Axon Instruments, USA)로 분석하였다. 이렇게 하여 얻어진 데이터로부터 페난트렌에 대한 마커 유전자를 선별하였다(도 2 참조). Hybridization images on the slides were scanned with the Genepix 4000B (Axon Instruments, USA). Chips washed with unbound genes were obtained with a fluorescence image using a laser fluorescence scanner. In this case, the green fluorescence image in the control group, the red fluorescence image represents the activity level of the gene specifically expressed only in the experimental group, and the yellow fluorescence image is the complementary color of green and red, which means that there is no significant difference between the two groups. Scanned images were analyzed with GenePix 4.1 software (Axon Instruments, USA) to obtain gene expression rates. The marker gene for phenanthrene was selected from the data thus obtained (see FIG. 2).

그 결과, 올리고 칩 상에 존재하는 대략 4만 4천 개의 유전자 중에서 페난트렌에 의해 Cy5/Cy3의 비율이 2.0배 이상으로 유전자 발현 증가를 보이는 유전자는 0.69%(44,000개의 유전자 중 302개) 발현이 감소된 유전자는 0.55%(44,000개의 유전자 중 244개)임을 확인하였다. As a result, 0.69% (302 out of 44,000 genes) of the 44,000 genes present on the oligo chip showed an increase in the expression of Cy5 / Cy3 by 2.0 times or more by phenanthrene. The reduced gene was found to be 0.55% (244 of 44,000 genes).

이때, 페난트렌에 의해 2배 이상 과발현 혹은 저발현 되는 유전자들을 기능별로 분류한 결과, MAPKinase 신호 경로(MAPKinase Signaling Pathway), MAPKKK 캐스케이드(MAPKKK cascade), 아팝토시스(apoptosis), 유사분열 세포주기(Mitotic cell cycle), 세포 주기(cell cycle), 세포 분화(Cell differentiation), 세포 운동성(Cell motility), 세포 골격(Cytoskeleton), 형태 발생(Morphogenesis), DNA 손상 반응(response to DNA damage stimulus), 화학자극에 대한 반응(Response to chemical stimulus), 외부자극에 대한 반응(Response to external stimulus), 스트레스에 대한 반응(Response to stress), 면역반응(immune response), 사이토크롬 p450에 의한 대사(Metabolism of xenobiotics by cytochrome p450), 알코올 대사(Alcohol metabolism), 지질 대사(lipid metabolism), 인산염 대사(Phosphate metabolism), DNA 대사(DNA metabolism), 금속원소 결합(metal binding) 또는 전달(Transport) 등의 관련 유전자로 선별되었다(표 2 및 3). 상기 유전자들은 본 발명에서 사용한 페난트렌을 처리하였을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다. At this time, as a result of classifying genes overexpressed or underexpressed by phenanthrene by function more than two times, MAPKinase Signaling Pathway, MAPKKK cascade, apoptosis, and mitotic cell cycle Mitotic cell cycle, cell cycle, cell differentiation, cell motility, cytoskeleton, morphogenesis, response to DNA damage stimulus, chemistry Response to chemical stimulus, Response to external stimulus, Response to stress, Immune response, Metabolism of xenobiotics by cytochrome p450), alcohol metabolism, lipid metabolism, phosphate metabolism, DNA metabolism, metal binding or transport, etc. He was selected as a relevant gene (Table 2 and 3). The genes have not been reported to be associated with toxicity in human liver cancer cells when treated with phenanthrene used in the present invention.

페난트렌에 의해 발현이 증가하는 유전자Gene whose expression is increased by phenanthrene 등록번호Registration Number 유전자명Gene name 유전자약어Gene abbreviation 중간값의비Ratio of medians (a) MAPKKK 캐스케이드 (MAPKKK cascade)(a) MAPKKK cascade NM_004420NM_004420 DUSP8DUSP8 Dual specificity phosphatase 8Dual specificity phosphatase 8 2.270227622.27022762 L11329L11329 DUSP2DUSP2 Dual specificity phosphatase 2Dual specificity phosphatase 2 2.5215091042.521509104 BC094766BC094766 PKN1PKN1 Protein kinase N1Protein kinase N1 2.6119164642.611916464 AY247738AY247738 TRIB3TRIB3 Tribbles homolog 3 (Drosophila)Tribbles homolog 3 (Drosophila) 3.4270776043.427077604 AK129595AK129595 GADD45BGADD45B Growth arrest and DNA-damage-inducible, betaGrowth arrest and DNA-damage-inducible, beta 2.9090021152.909002115 AB208849AB208849 SHC1SHC1 SHC (Src homology 2 domain containing) transforming protein 1SHC (Src homology 2 domain containing) transforming protein 1 2.5124646752.512464675 (b) 아팝토시스 (Apoptosis)(b) apoptosis X02812X02812 TGFB1TGFB1 Transforming growth factor, beta 1 (Camurati-Engelmann disease)Transforming growth factor, beta 1 (Camurati-Engelmann disease) 2.5549840382.554984038 NM_198951NM_198951 TGM2TGM2 Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 2.4252045532.425204553 NM_147780NM_147780 CTSBCTSB Cathepsin BCathepsin b 6.7619082426.761908242 NM_078467NM_078467 CDKN1ACDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1)Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 3.5260324253.526032425 NM_033027NM_033027 AXUD1AXUD1 AXIN1 up-regulated 1AXIN1 up-regulated 1 2.0662800722.066280072 NM_032797NM_032797 AMIDAMID Apoptosis-inducing factor (AIF)-like mitochondrion-associated inducer of deathApoptosis-inducing factor (AIF) -like mitochondrion-associated inducer of death 2.957736022.95773602 NM_021960NM_021960 MCL1MCL1 Myeloid cell leukemia sequence 1 (BCL2-related)Myeloid cell leukemia sequence 1 (BCL2-related) 2.0540262962.054026296 NM_016639NM_016639 TNFRSF12ATNFRSF12A Tumor necrosis factor receptor superfamily, member 12ATumor necrosis factor receptor superfamily, member 12A 3.7462159323.746215932 NM_016222NM_016222 DDX41DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 2.2054771322.205477132 NM_013246NM_013246 CLCCLC Cardiotrophin-like cytokine factor 1Cardiotrophin-like cytokine factor 1 4.5975262124.597526212 NM_004401NM_004401 DFFADFFA DNA fragmentation factor, 45kDa, alpha polypeptideDNA fragmentation factor, 45kDa, alpha polypeptide 2.1904871272.190487127 NM_004281NM_004281 BAG3BAG3 BCL2-associated athanogene 3BCL2-associated athanogene 3 2.1648849322.164884932 NM_003897NM_003897 IER3IER3 Immediate early response 3Immediate early response 3 4.9503421844.950342184 NM_003806NM_003806 HRKHRK Harakiri, BCL2 interacting protein (contains only BH3 domain)Harakiri, BCL2 interacting protein (contains only BH3 domain) 2.1777964962.177796496 NM_003639NM_003639 IKBKGIKBKG Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gammaInhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma 2.0516236712.051623671 NM_003311NM_003311 PHLDA2PHLDA2 Pleckstrin homology-like domain, family A, member 2Pleckstrin homology-like domain, family A, member 2 4.2827995564.282799556 NM_002737NM_002737 PRKCAPRKCA Protein kinase C, alphaProtein kinase C, alpha 2.0128571222.012857122 NM_002648NM_002648 PIM1PIM1 Pim-1 oncogenePim-1 oncogene 3.7377804193.737780419 NM_002507NM_002507 NGFRNGFR Nerve growth factor receptor (TNFR superfamily, member 16)Nerve growth factor receptor (TNFR superfamily, member 16) 2.4823507282.482350728 NM_002305NM_002305 LGALS1LGALS1 Lectin, galactoside-binding, soluble, 1 (galectin 1)Lectin, galactoside-binding, soluble, 1 (galectin 1) 4.2459098044.245909804 NM_001013398NM_001013398 IGFBP3IGFBP3 Insulin-like growth factor binding protein 3Insulin-like growth factor binding protein 3 4.5317307084.531730708 BX640923BX640923 MDM4MDM4 Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse) 2.1649958072.164995807 BX537586BX537586 STK17ASTK17A Serine/threonine kinase 17a (apoptosis-inducing)Serine / threonine kinase 17a (apoptosis-inducing) 2.4092478812.409247881 BG284742BG284742 P8P8 P8 protein (candidate of metastasis 1)P8 protein (candidate of metastasis 1) 3.9488145523.948814552 BE903247BE903247 PDCD6IPPDCD6IP Programmed cell death 6 interacting proteinProgrammed cell death 6 interacting protein 2.3539127242.353912724 BC027949BC027949 P2RX1P2RX1 Purinergic receptor P2X, ligand-gated ion channel, 1Purinergic receptor P2X, ligand-gated ion channel, 1 2.3548209292.354820929 BC006365BC006365 PSEN2PSEN2 Presenilin 2 (Alzheimer disease 4)Presenilin 2 (Alzheimer disease 4) 2.303736912.30373691 AY869712AY869712 PPP1R13LPPP1R13L Protein phosphatase 1, regulatory (inhibitor) subunit 13 likeProtein phosphatase 1, regulatory (inhibitor) subunit 13 like 2.238042432.23804243 AY028896AY028896 CARD10CARD10 Caspase recruitment domain family, member 10Caspase recruitment domain family, member 10 2.0562885662.056288566 AK122614AK122614 PPARDPPARD Peroxisome proliferative activated receptor, deltaPeroxisome proliferative activated receptor, delta 2.1804665382.180466538 AK092872AK092872 ERCC2ERCC2 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) 2.0157843852.015784385 AK092808AK092808 RRAGCRRAGC Ras-related GTP binding CRas-related GTP binding C 2.2000553892.200055389 AJ001898AJ001898 GDNFGDNF Glial cell derived neurotrophic factorGlial cell derived neurotrophic factor 2.2667266512.266726651 AF220656AF220656 PHLDA1PHLDA1 Pleckstrin homology-like domain, family A, member 1Pleckstrin homology-like domain, family A, member 1 2.9130290672.913029067 AF055634AF055634 UNC5CUNC5C Unc-5 homolog C (C. elegans)Unc-5 homolog C (C. elegans) 2.2321024872.232102487 AB209485AB209485 VEGFVEGF Vascular endothelial growth factorVascular endothelial growth factor 2.5867296472.586729647 AB096256AB096256 UNC5BUNC5B Unc-5 homolog B (C. elegans)Unc-5 homolog B (C. elegans) 2.4947122722.494712272 AB007960AB007960 SH3GLB1SH3GLB1 SH3-domain GRB2-like endophilin B1SH3-domain GRB2-like endophilin B1 2.0738598982.073859898 (c) 세포 주기 (Cell cycle)(c) Cell cycle X06374X06374 PDGFAPDGFA Platelet-derived growth factor alpha polypeptidePlatelet-derived growth factor alpha polypeptide 3.6484490583.648449058 S62138S62138 DDIT3DDIT3 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 3.1513724413.151372441 NM_078487NM_078487 CDKN2BCDKN2B Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 2.4464159612.446415961 NM_012127NM_012127 CIZ1CIZ1 CDKN1A interacting zinc finger protein 1CDKN1A interacting zinc finger protein 1 2.1127791432.112779143 NM_005883NM_005883 APC2APC2 Adenomatosis polyposis coli 2Adenomatosis polyposis coli 2 2.0275547562.027554756 NM_004196NM_004196 CDKL1CDKL1 Cyclin-dependent kinase-like 1 (CDC2-related kinase)Cyclin-dependent kinase-like 1 (CDC2-related kinase) 2.2356767262.235676726 NM_003236NM_003236 TGFATGFA Transforming growth factor, alphaTransforming growth factor, alpha 2.4548420222.454842022 NM_001261NM_001261 CDK9CDK9 Cyclin-dependent kinase 9 (CDC2-related kinase)Cyclin-dependent kinase 9 (CDC2-related kinase) 2.2746332932.274633293 NM_001007271NM_001007271 DUSP13DUSP13 Dual specificity phosphatase 13Dual specificity phosphatase 13 3.1495599963.149559996 CR749511CR749511 PARCPARC P53-associated parkin-like cytoplasmic proteinP53-associated parkin-like cytoplasmic protein 2.0948702252.094870225 CR623038CR623038 ID2ID2 Inhibitor of DNA binding 2, dominant negative helix-loop-helix proteinInhibitor of DNA binding 2, dominant negative helix-loop-helix protein 2.5502979672.550297967 CR618371CR618371 EGFREGFR Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) 2.4910513162.491051316 BF965144BF965144 IFITM1IFITM1 Interferon induced transmembrane protein 1 (9-27)Interferon induced transmembrane protein 1 (9-27) 2.5432701892.543270189 AK127679AK127679 DUSP1DUSP1 Dual specificity phosphatase 1Dual specificity phosphatase 1 3.9145388623.914538862 AK096276AK096276 CCND3CCND3 Cyclin D3Cyclin D3 2.8577427172.857742717 AB209586AB209586 MAPK13MAPK13 Mitogen-activated protein kinase 13Mitogen-activated protein kinase 13 2.9055548512.905554851 AB209465AB209465 PCTK1PCTK1 PCTAIRE protein kinase 1PCTAIRE protein kinase 1 2.425770992.42577099 (d) 세포 분화 (Cell differentiation)(d) Cell differentiation Z19588Z19588 SKILSKIL SKI-likeSKI-like 2.3095984492.309598449 NM_020429NM_020429 SMURF1SMURF1 SMAD specific E3 ubiquitin protein ligase 1SMAD specific E3 ubiquitin protein ligase 1 2.3720784492.372078449 NM_014767NM_014767 SPOCK2SPOCK2 Sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2Sparc / osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 2.2570357392.257035739 NM_005979NM_005979 S100A13S100A13 S100 calcium binding protein A13S100 calcium binding protein A13 2.1099509452.109950945 NM_005187NM_005187 CBFA2T3CBFA2T3 Core-binding factor, runt domain, alpha subunit 2; translocated to, 3Core-binding factor, runt domain, alpha subunit 2; translocated to, 3 2.1586355932.158635593 NM_004364NM_004364 CEBPACEBPA CCAAT/enhancer binding protein (C/EBP), alphaCCAAT / enhancer binding protein (C / EBP), alpha 2.4959106412.495910641 NM_001769NM_001769 CD9CD9 CD9 antigen (p24)CD9 antigen (p24) 3.0969545873.096954587 NM_001718NM_001718 BMP6BMP6 Bone morphogenetic protein 6Bone morphogenetic protein 6 4.2498354574.249835457 NM_000641NM_000641 IL11IL11 Interleukin 11Interleukin 11 8.1415136858.141513685 BX647459BX647459 SERPINE2SERPINE2 Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 3.4711362193.471136219 BQ066037BQ066037 RPS19RPS19 Ribosomal protein S19Ribosomal protein S19 2.1940090562.194009056 BE791300BE791300 EDF1EDF1 Endothelial differentiation-related factor 1Endothelial differentiation-related factor 1 2.5626078232.562607823 BC038504BC038504 SNF1LKSNF1LK SNF1-like kinaseSNF1-like kinase 2.2281806292.228180629 AL832287AL832287 ZAP70ZAP70 Zeta-chain (TCR) associated protein kinase 70kDaZeta-chain (TCR) associated protein kinase 70kDa 2.2545380982.254538098 AK125742AK125742 PCGF1PCGF1 Polycomb group ring finger 1Polycomb group ring finger 1 2.0622072112.062207211 AK124709AK124709 NDRG1NDRG1 N-myc downstream regulated gene 1N-myc downstream regulated gene 1 2.7575081292.757508129 AB011157AB011157 PTDSRPTDSR Phosphatidylserine receptorPhosphatidylserine receptor 2.096645692.09664569 (e) 세포 운동성 (Cell motility) (e) Cell motility NM_013255NM_013255 MKLN1MKLN1 Muskelin 1, intracellular mediator containing kelch motifsMuskelin 1, intracellular mediator containing kelch motifs 2.0953882132.095388213 NM_006572NM_006572 GNA13GNA13 Guanine nucleotide binding protein (G protein), alpha 13Guanine nucleotide binding protein (G protein), alpha 13 2.5866387762.586638776 NM_002211NM_002211 ITGB1ITGB1 Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) 2.0371086122.037108612 CR601067CR601067 PLAURPLAUR Plasminogen activator, urokinase receptorPlasminogen activator, urokinase receptor 2.6229237312.622923731 BC050456BC050456 THBS4THBS4 Thrombospondin 4Thrombospondin 4 4.1731622144.173162214 AK027389AK027389 CXCL16CXCL16 Chemokine (C-X-C motif) ligand 16Chemokine (C-X-C motif) ligand 16 2.1721032992.172103299 AJ132099AJ132099 VNN1VNN1 Vanin 1Vanin 1 2.4958091112.495809111 (f) 세포 골격 (Cytoskeleton)(f) Cytoskeleton XM_371354XM_371354 FLJ10157FLJ10157 Hypothetical protein FLJ10157Hypothetical protein FLJ10157 3.5858538293.585853829 XM_208313XM_208313 TPM3TPM3 Similar to tropomyosin 4Similar to tropomyosin 4 2.0318353812.031835381 XM_208270XM_208270 ACRACR Acrosin-like proteaseAcrosin-like protease 2.2362601412.236260141 NM_203353NM_203353 PDLIM7PDLIM7 PDZ and LIM domain 7 (enigma)PDZ and LIM domain 7 (enigma) 4.413393314.41339331 NM_201382NM_201382 PLEC1PLEC1 Plectin 1, intermediate filament binding protein 500kDaPlectin 1, intermediate filament binding protein 500kDa 2.2811715112.281171511 NM_182961NM_182961 SYNE1SYNE1 Spectrin repeat containing, nuclear envelope 1Spectrin repeat containing, nuclear envelope 1 3.1392792893.139279289 NM_181826NM_181826 NF2NF2 Neurofibromin 2 (bilateral acoustic neuroma)Neurofibromin 2 (bilateral acoustic neuroma) 2.077724972.07772497 NM_172069NM_172069 PLEKHH2PLEKHH2 Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 2.0566557362.056655736 NM_022648NM_022648 TNSTNS Tensin 1Tensin 1 2.7103660652.710366065 NM_017556NM_017556 FBLP-1FBLP-1 Filamin binding LIM protein 1Filamin binding LIM protein 1 6.0337604576.033760457 NM_016081NM_016081 KIAA0992KIAA0992 Palladin, cytoskeletal associated proteinPalladin, cytoskeletal associated protein 2.8833523332.883352333 NM_006617NM_006617 NESNES NestinNestin 13.8472476513.84724765 NM_006262NM_006262 PRPHPRPH PeripherinPeripherin 10.766912510.7669125 NM_005100NM_005100 AKAP12AKAP12 A kinase (PRKA) anchor protein (gravin) 12A kinase (PRKA) anchor protein (gravin) 12 4.2309665044.230966504 NM_004368NM_004368 CNN2CNN2 Calponin 2Calponin 2 2.4199593792.419959379 NM_003388NM_003388 CYLN2CYLN2 Cytoplasmic linker 2Cytoplasmic linker 2 5.4667435235.466743523 NM_003370NM_003370 VASPVASP Vasodilator-stimulated phosphoproteinVasodilator-stimulated phosphoprotein 2.4703966562.470396656 NM_003128NM_003128 SPTBN1SPTBN1 Spectrin, beta, non-erythrocytic 1Spectrin, beta, non-erythrocytic 1 3.3895864753.389586475 NM_002705NM_002705 PPLPPL PeriplakinPeriplakin 4.3911685964.391168596 NM_002475NM_002475 MLC1SAMLC1SA Myosin light chain 1 slow aMyosin light chain 1 slow a 2.0457281072.045728107 NM_002018NM_002018 FLIIFLII Flightless I homolog (Drosophila)Flightless I homolog (Drosophila) 2.9237171612.923717161 NM_001465NM_001465 FYBFYB FYN binding protein (FYB-120/130)FYN binding protein (FYB-120 / 130) 2.2430759892.243075989 NM_001069NM_001069 TUBB2TUBB2 Tubulin, beta 2ATubulin, beta 2A 2.0780025412.078002541 CR625172CR625172 MGC8685MGC8685 Tubulin, beta 2BTubulin, beta 2B 2.0224910472.022491047 CR616919CR616919 KRT18KRT18 Keratin 18Keratin 18 2.2547264122.254726412 CR606241CR606241 ACTG1ACTG1 Actin, gamma 1Actin, gamma 1 4.3296680874.329668087 CB240572CB240572 MYH11MYH11 Myosin, heavy polypeptide 11, smooth muscleMyosin, heavy polypeptide 11, smooth muscle 2.2266881862.226688186 BX648253BX648253 PTPN3PTPN3 Protein tyrosine phosphatase, non-receptor type 3Protein tyrosine phosphatase, non-receptor type 3 2.2285401112.228540111 BX648190BX648190 WDR1WDR1 WD repeat domain 1WD repeat domain 1 3.153992253.15399225 BX641076BX641076 ACTN1ACTN1 Actinin, alpha 1Actinin, alpha 1 2.0722638382.072263838 BX537978BX537978 EPB41L1EPB41L1 Erythrocyte membrane protein band 4.1-like 1Erythrocyte membrane protein band 4.1-like 1 2.3473111122.347311112 BG121847BG121847 NUDCNUDC Nuclear distribution gene C homolog (A. nidulans)Nuclear distribution gene C homolog (A. nidulans) 2.8105201132.810520113 BC068013BC068013 MYO1CMYO1C Myosin ICMyosin IC 2.0774687022.077468702 BC065499BC065499 MAST2MAST2 Microtubule associated serine/threonine kinase 2Microtubule associated serine / threonine kinase 2 2.6842720012.684272001 BC051890BC051890 TUBG2TUBG2 Tubulin, gamma 2Tubulin, gamma 2 2.0646794022.064679402 BC041874BC041874 MAP1LC3BMAP1LC3B Microtubule-associated protein 1 light chain 3 betaMicrotubule-associated protein 1 light chain 3 beta 2.0309712082.030971208 BC012597BC012597 ACTA1ACTA1 Actin, alpha 1, skeletal muscleActin, alpha 1, skeletal muscle 2.3045396732.304539673 AY484427AY484427 KIF17KIF17 Kinesin family member 17Kinesin family member 17 2.3530162582.353016258 AK130546AK130546 STOML2STOML2 Stomatin (EPB72)-like 2Stomatin (EPB72) -like 2 2.036435072.03643507 AK124711AK124711 CORO2BCORO2B Coronin, actin binding protein, 2BCoronin, actin binding protein, 2B 3.2938618983.293861898 AK123974AK123974 MYL5MYL5 Myosin, light polypeptide 5, regulatoryMyosin, light polypeptide 5, regulatory 2.0230130162.023013016 AK092792AK092792 LOC389833LOC389833 Similar to hypothetical protein MGC27019Similar to hypothetical protein MGC27019 2.3893669222.389366922 AK026518AK026518 MYOHD1MYOHD1 Myosin head domain containing 1Myosin head domain containing 1 2.0598513372.059851337 AK024500AK024500 NICALNICAL Microtubule associated monoxygenase, calponin and LIM domain containing 1Microtubule associated monoxygenase, calponin and LIM domain containing 1 4.2459933274.245993327 AF085886AF085886 FLJ46675FLJ46675 Ribosomal protein L29 pseudogene 2Ribosomal protein L29 pseudogene 2 2.6039660592.603966059 AB209997AB209997 MYO9BMYO9B Myosin IXBMyosin IXB 2.0099596512.009959651 (g) 형태 발생 (Morphogenesis)(g) Morphogenesis Y12692Y12692 WNT11WNT11 Wingless-type MMTV integration site family, member 11Wingless-type MMTV integration site family, member 11 3.0844210353.084421035 Y11307Y11307 CYR61CYR61 Cysteine-rich, angiogenic inducer, 61Cysteine-rich, angiogenic inducer, 61 3.7331659793.733165979 X17033X17033 ITGA2ITGA2 Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) 2.3662159822.366215982 U41763U41763 CLTCL1CLTCL1 Clathrin, heavy polypeptide-like 1Clathrin, heavy polypeptide-like 1 2.0409734372.040973437 NM_153609NM_153609 TMPRSS6TMPRSS6 Transmembrane protease, serine 6Transmembrane protease, serine 6 2.7270026312.727002631 NM_031483NM_031483 ITCHITCH Itchy homolog E3 ubiquitin protein ligase (mouse)Itchy homolog E3 ubiquitin protein ligase (mouse) 2.4767820732.476782073 NM_024342NM_024342 GRLF1GRLF1 Glucocorticoid receptor DNA binding factor 1Glucocorticoid receptor DNA binding factor 1 2.4208941782.420894178 NM_017555NM_017555 EGLN2EGLN2 Egl nine homolog 2 (C. elegans)Egl nine homolog 2 (C. elegans) 2.2390285952.239028595 NM_016569NM_016569 TBX3TBX3 T-box 3 (ulnar mammary syndrome)T-box 3 (ulnar mammary syndrome) 2.2919241722.291924172 NM_004148NM_004148 NINJ1NINJ1 Ninjurin 1Ninjurin 1 3.0791519723.079151972 NM_003377NM_003377 VEGFBVEGFB Vascular endothelial growth factor BVascular endothelial growth factor B 2.2457287272.245728727 NM_001983NM_001983 ERCC1ERCC1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) 2.0441623322.044162332 NM_001552NM_001552 IGFBP4IGFBP4 Insulin-like growth factor binding protein 4Insulin-like growth factor binding protein 4 2.0244026342.024402634 NM_001430NM_001430 EPAS1EPAS1 Endothelial PAS domain protein 1Endothelial PAS domain protein 1 4.0330786154.033078615 NM_001300NM_001300 KLF6KLF6 Kruppel-like factor 6Kruppel-like factor 6 3.5064360223.506436022 NM_001012661NM_001012661 SLC3A2SLC3A2 Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 4.4904984334.490498433 NM_000596NM_000596 IGFBP1IGFBP1 Insulin-like growth factor binding protein 1Insulin-like growth factor binding protein 1 2.5379893622.537989362 NM_000474NM_000474 TWIST1TWIST1 Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila)Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila) 2.8686393162.868639316 BX649103BX649103 ChGnChGn Chondroitin beta1,4 N-acetylgalactosaminyltransferaseChondroitin beta1,4 N-acetylgalactosaminyltransferase 2.716660462.71666046 BM913048BM913048 TIMP1TIMP1 TIMP metallopeptidase inhibitor 1TIMP metallopeptidase inhibitor 1 12.627354712.6273547 BM904612BM904612 S100A6S100A6 S100 calcium binding protein A6 (calcyclin)S100 calcium binding protein A6 (calcyclin) 4.4595848064.459584806 BM556279BM556279 EMP3EMP3 Epithelial membrane protein 3Epithelial membrane protein 3 2.7763758642.776375864 BC015041BC015041 VAT1VAT1 Family with sequence similarity 82, member CFamily with sequence similarity 82, member C 2.8283061762.828306176 AY258066AY258066 OKL38OKL38 Pregnancy-induced growth inhibitorPregnancy-induced growth inhibitor 2.0065907782.006590778 AK126729AK126729 NDRG4NDRG4 NDRG family member 4NDRG family member 4 2.9923386682.992338668 AK090459AK090459 NFE2L1NFE2L1 Nuclear factor (erythroid-derived 2)-like 1Nuclear factor (erythroid-derived 2) -like 1 2.0678523872.067852387 AK074163AK074163 ROBO4ROBO4 Roundabout homolog 4, magic roundabout (Drosophila)Roundabout homolog 4, magic roundabout (Drosophila) 2.2539930162.253993016 AK024680AK024680 FLJ21027 fisFLJ21027 fis CDNA: FLJ21027 fis, clone CAE07110CDNA: FLJ21027 fis, clone CAE07110 3.2779971843.277997184 AF176422AF176422 HEY1HEY1 Hairy/enhancer-of-split related with YRPW motif 1Hairy / enhancer-of-split related with YRPW motif 1 6.3855671616.385567161 AF003837AF003837 JAG1JAG1 Jagged 1 (Alagille syndrome)Jagged 1 (Alagille syndrome) 3.3576411613.357641161 AB209322AB209322 SEMA3BSEMA3B Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3BSema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B 2.5142072272.514207227 AB011150AB011150 NRXN1NRXN1 Neurexin 1Neurexin 1 2.6511193982.651119398 (h) 화학자극에 대한 반응 (Response to chemical stimulus)(h) Response to chemical stimulus NM_201589NM_201589 MAFAMAFA V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) 2.2894661332.289466133 NM_052999NM_052999 CKLFSF1CKLFSF1 CKLF-like MARVEL transmembrane domain containing 1CKLF-like MARVEL transmembrane domain containing 1 2.1545004212.154500421 NM_006644NM_006644 HSPH1HSPH1 Heat shock 105kDa/110kDa protein 1Heat shock 105kDa / 110kDa protein 1 2.0528148322.052814832 NM_005438NM_005438 FOSL1FOSL1 FOS-like antigen 1FOS-like antigen 1 4.3694794474.369479447 NM_004996NM_004996 ABCC1ABCC1 ATP-binding cassette, sub-family C (CFTR/MRP), member 1ATP-binding cassette, sub-family C (CFTR / MRP), member 1 2.4965466672.496546667 NM_002658NM_002658 PLAUPLAU Plasminogen activator, urokinasePlasminogen activator, urokinase 3.1189382773.118938277 NM_001353NM_001353 AKR1C1AKR1C1 Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase) 4.1894499134.189449913 H18681H18681 C20orf139C20orf139 Sulfiredoxin 1 homolog (S. cerevisiae)Sulfiredoxin 1 homolog (S. cerevisiae) 3.4598204963.459820496 DR004094DR004094 HAMPHAMP Hepcidin antimicrobial peptideHepcidin antimicrobial peptide 8.4548629398.454862939 BC082272BC082272 KCNMB3KCNMB3 Potassium large conductance calcium-activated channel, subfamily M beta member 3Potassium large conductance calcium-activated channel, subfamily M beta member 3 5.9085055745.908505574 BC040494BC040494 DNAJB2DNAJB2 DnaJ (Hsp40) homolog, subfamily B, member 2DnaJ (Hsp40) homolog, subfamily B, member 2 3.1185893393.118589339 BC018064BC018064 ATF6ATF6 Activating transcription factor 6Activating transcription factor 6 2.2005185122.200518512 BC006523BC006523 SGK2SGK2 Serum/glucocorticoid regulated kinase 2Serum / glucocorticoid regulated kinase 2 2.3240971352.324097135 AK090482AK090482 CXCL12CXCL12 Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) 2.0950568182.095056818 AF219946AF219946 TULP4TULP4 Tubby like protein 4Tubby like protein 4 2.1527113592.152711359 AB209112AB209112 SLC2A8SLC2A8 Solute carrier family 2, (facilitated glucose transporter) member 8Solute carrier family 2, (facilitated glucose transporter) member 8 2.0964242162.096424216 (i) 외부자극에 대한 반응 (Response to external stimulus)(i) Response to external stimulus NM_005242NM_005242 F2RL1F2RL1 Coagulation factor II (thrombin) receptor-like 1Coagulation factor II (thrombin) receptor-like 1 2.4723827812.472382781 NM_001002029NM_001002029 C4AC4A Complement component 4B, telomericComplement component 4B, telomeric 2.4433979952.443397995 NM_000539NM_000539 RHORHO Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant) 3.5134552053.513455205 BX649164BX649164 PAIPAI serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 12.3751429712.37514297 BM918324BM918324 LY96LY96 Lymphocyte antigen 96Lymphocyte antigen 96 2.1672482132.167248213 AB209647AB209647 NCF2NCF2 Neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)Neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2) 12.8754731212.87547312 (j) 스트레스에 대한 반응 (Response to stress) (j) Response to stress NM_152221NM_152221 CSNK1ECSNK1E Casein kinase 1, epsilonCasein kinase 1, epsilon 2.1787536962.178753696 NM_017999NM_017999 RNF31RNF31 Ring finger protein 31Ring finger protein 31 2.5702926322.570292632 NM_016819NM_016819 OGG1OGG1 8-oxoguanine DNA glycosylase8-oxoguanine DNA glycosylase 2.5338639052.533863905 NM_016816NM_016816 OAS1OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa 3.5012332763.501233276 NM_012235NM_012235 SCAPSCAP SREBP cleavage-activating proteinSREBP cleavage-activating protein 2.0600925932.060092593 NM_006384NM_006384 CIB1CIB1 Calcium and integrin binding 1 (calmyrin)Calcium and integrin binding 1 (calmyrin) 2.257181342.25718134 NM_001779NM_001779 CD58CD58 CD58 antigen, (lymphocyte function-associated antigen 3)CD58 antigen, (lymphocyte function-associated antigen 3) 2.0346815672.034681567 CB055213CB055213 ICOSLGICOSLG Inducible T-cell co-stimulator ligandInducible T-cell co-stimulator ligand 2.6191813652.619181365 BX641029BX641029 MASP1MASP1 Mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)Mannan-binding lectin serine peptidase 1 (C4 / C2 activating component of Ra-reactive factor) 2.0256366672.025636667 BQ053419BQ053419 BATFBATF Basic leucine zipper transcription factor, ATF-likeBasic leucine zipper transcription factor, ATF-like 2.5545872272.554587227 BC039299BC039299 STIP1STIP1 Stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein)Stress-induced-phosphoprotein 1 (Hsp70 / Hsp90-organizing protein) 2.768362062.76836206 AY055760AY055760 DAFDAF Decay accelerating factor for complement (CD55, Cromer blood group system)Decay accelerating factor for complement (CD55, Cromer blood group system) 2.0313594982.031359498 AK130188AK130188 FGRFGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homologGardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 2.1368509522.136850952 AK095326AK095326 MUS81MUS81 MUS81 endonuclease homolog (yeast)MUS81 endonuclease homolog (yeast) 2.2380166332.238016633 (k) 면역 반응 (Immune response) (k) Immune response NM_017670NM_017670 OTUB1OTUB1 OTU domain, ubiquitin aldehyde binding 1OTU domain, ubiquitin aldehyde binding 1 2.0328341072.032834107 NM_003004NM_003004 SECTM1SECTM1 Secreted and transmembrane 1Secreted and transmembrane 1 2.4912083242.491208324 NM_002309NM_002309 LIFLIF Hypothetical protein MGC20647Hypothetical protein MGC20647 3.2306325983.230632598 NM_001421NM_001421 ELF4ELF4 E74-like factor 4 (ets domain transcription factor)E74-like factor 4 (ets domain transcription factor) 3.4781754423.478175442 NM_000418NM_000418 IL4RIL4R Interleukin 4 receptorInterleukin 4 receptor 2.4228465962.422846596 BI909222BI909222 FCER1GFCER1G Fc fragment of IgE, high affinity I, receptor for; gamma polypeptideFc fragment of IgE, high affinity I, receptor for; gamma polypeptide 2.2892390112.289239011 BF569086BF569086 NK4NK4 Interleukin 32Interleukin 32 3.1969709243.196970924 BC014470BC014470 AZGP1AZGP1 Alpha-2-glycoprotein 1, zincAlpha-2-glycoprotein 1, zinc 2.2064815062.206481506 (l) 사이토크롬 p450에 의한 대사 (Metabolism of xenobiotics by cytochrome p450)  (l) Metabolism of xenobiotics by cytochrome p450 BC020744BC020744 AKR1C4AKR1C4 Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4)Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol dehydrogenase 4) 4.0264972444.026497244 BQ939577BQ939577 AKR1C3AKR1C3 Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) 3.5349619593.534961959 NM_000499NM_000499 CYP1A1CYP1A1 Cytochrome P450, family 1, subfamily A, polypeptide 1Cytochrome P450, family 1, subfamily A, polypeptide 1 7.8003775217.800377521 NM_030622NM_030622 CYP2S1CYP2S1 Cytochrome P450, family 2, subfamily S, polypeptide 1Cytochrome P450, family 2, subfamily S, polypeptide 1 9.1652662229.165266222 (m) 알코올 대사 (Alcohol metabolism)(m) Alcohol metabolism NM_184041NM_184041 ALDOAALDOA Aldolase A, fructose-bisphosphateAldolase A, fructose-bisphosphate 2.4843424882.484342488 NM_024307NM_024307 MGC4171MGC4171 Hypothetical protein LOC283901Hypothetical protein LOC283901 2.1805719962.180571996 NM_005336NM_005336 HDLBPHDLBP High density lipoprotein binding protein (vigilin)High density lipoprotein binding protein (vigilin) 2.052070692.05207069 NM_002627NM_002627 PFKPPFKP Phosphofructokinase, plateletPhosphofructokinase, platelet 2.2364356952.236435695 BX648281BX648281 LDLRLDLR Low density lipoprotein receptor (familial hypercholesterolemia)Low density lipoprotein receptor (familial hypercholesterolemia) 2.0852562652.085256265 BC069201BC069201 FLJ22761FLJ22761 Hexokinase domain containing 1Hexokinase domain containing 1 4.733450144.73345014 BC030207BC030207 NR0B2NR0B2 Nuclear receptor subfamily 0, group B, member 2Nuclear receptor subfamily 0, group B, member 2 2.2841003652.284100365 AL833069AL833069 KIAA1434KIAA1434 Hypothetical protein KIAA1434Hypothetical protein KIAA1434 4.0791427674.079142767 AK124656AK124656 ENO2ENO2 Enolase 2 (gamma, neuronal)Enolase 2 (gamma, neuronal) 2.1122988812.112298881 AK094474AK094474 RHOCRHOC Ras homolog gene family, member CRas homolog gene family, member C 3.5945848123.594584812 AK093461AK093461 ISYNA1ISYNA1 Myo-inositol 1-phosphate synthase A1Myo-inositol 1-phosphate synthase A1 2.7354047792.735404779 AB053232AB053232 GAL3ST3GAL3ST3 Galactose-3-O-sulfotransferase 3Galactose-3-O-sulfotransferase 3 2.0936807172.093680717 AB045292AB045292 TMEM8TMEM8 Transmembrane protein 8 (five membrane-spanning domains)Transmembrane protein 8 (five membrane-spanning domains) 3.7076777923.707677792 (n) 지질 대사 (Lipid metabolism)(n) Lipid metabolism NM_004753NM_004753 DHRS3DHRS3 Dehydrogenase/reductase (SDR family) member 3Dehydrogenase / reductase (SDR family) member 3 3.5958559153.595855915 NM_002900NM_002900 RBP3RBP3 Retinol binding protein 3, interstitialRetinol binding protein 3, interstitial 2.0289965672.028996567 NM_001995NM_001995 ACSL1ACSL1 Acyl-CoA synthetase long-chain family member 1Acyl-CoA synthetase long-chain family member 1 2.3615605712.361560571 NM_000018NM_000018 ACADVLACADVL Acyl-Coenzyme A dehydrogenase, very long chainAcyl-Coenzyme A dehydrogenase, very long chain 2.2111329062.211132906 BC094756BC094756 CRACRA Myotubularin related protein 11Myotubularin related protein 11 6.4444258736.444425873 BC050553BC050553 NTENTE Neuropathy target esteraseNeuropathy target esterase 2.0906678922.090667892 BC033110BC033110 HSD17B1HSD17B1 Hydroxysteroid (17-beta) dehydrogenase 1Hydroxysteroid (17-beta) dehydrogenase 1 2.0739814262.073981426 AY268890AY268890 TPP1TPP1 Tripeptidyl peptidase ITripeptidyl peptidase I 2.0143444372.014344437 AK172798AK172798 CPT1ACPT1A Carnitine palmitoyltransferase 1A (liver)Carnitine palmitoyltransferase 1A (liver) 2.6573136852.657313685 AK096809AK096809 CYP4F8CYP4F8 Cytochrome P450, family 4, subfamily F, polypeptide 8Cytochrome P450, family 4, subfamily F, polypeptide 8 2.2033727492.203372749 AK000600AK000600 SIAT7DSIAT7D ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 2.5073392132.507339213 AB002454AB002454 CYP4F3CYP4F3 Cytochrome P450, family 4, subfamily F, polypeptide 3Cytochrome P450, family 4, subfamily F, polypeptide 3 2.0806202092.080620209 (o) 인산염 대사 (Phosphate metabolism)(o) Phosphate metabolism Z29093Z29093 DDR1DDR1 Discoidin domain receptor family, member 1Discoidin domain receptor family, member 1 2.4624916052.462491605 Z25424Z25424 MKNK2MKNK2 MAP kinase interacting serine/threonine kinase 2MAP kinase interacting serine / threonine kinase 2 3.9470910853.947091085 XM_291277XM_291277 DKFZp761P0423DKFZp761P0423 Hypothetical protein DKFZp761P0423Hypothetical protein DKFZp761P0423 2.1093381542.109338154 XM_038150XM_038150 MAST3MAST3 Microtubule associated serine/threonine kinase 3Microtubule associated serine / threonine kinase 3 2.3048420072.304842007 U88357U88357 ERBB3ERBB3 V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 2.1522834062.152283406 NM_025195NM_025195 TRIB1TRIB1 Tribbles homolog 1 (Drosophila)Tribbles homolog 1 (Drosophila) 2.3151373272.315137327 NM_020639NM_020639 RIPK4RIPK4 Receptor-interacting serine-threonine kinase 4Receptor-interacting serine-threonine kinase 4 2.6720537232.672053723 NM_014172NM_014172 PHPT1PHPT1 Phosphohistidine phosphatase 1Phosphohistidine phosphatase 1 2.6427379792.642737979 NM_006254NM_006254 PRKCDPRKCD Protein kinase C, deltaProtein kinase C, delta 2.0149468282.014946828 NM_005415NM_005415 SLC20A1SLC20A1 Solute carrier family 20 (phosphate transporter), member 1Solute carrier family 20 (phosphate transporter), member 1 3.9004087183.900408718 NM_005026NM_005026 PIK3CDPIK3CD Phosphoinositide-3-kinase, catalytic, delta polypeptidePhosphoinositide-3-kinase, catalytic, delta polypeptide 2.1650500962.165050096 NM_004431NM_004431 EPHA2EPHA2 EPH receptor A2EPH receptor A2 2.2438295742.243829574 NM_004419NM_004419 DUSP5DUSP5 Dual specificity phosphatase 5Dual specificity phosphatase 5 20.0150455620.01504556 NM_004327NM_004327 BCRBCR Breakpoint cluster regionBreakpoint cluster region 2.528560752.52856075 NM_004231NM_004231 ATP6V1FATP6V1F ATPase, H+ transporting, lysosomal 14kDa, V1 subunit FATPase, H + transporting, lysosomal 14kDa, V1 subunit F 2.23225342.2322534 NM_004090NM_004090 DUSP3DUSP3 Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) 2.0652520842.065252084 NM_002843NM_002843 PTPRJPTPRJ Protein tyrosine phosphatase, receptor type, JProtein tyrosine phosphatase, receptor type, J 3.1688847683.168884768 NM_002496NM_002496 NDUFS8NDUFS8 NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase) 2.1993945992.199394599 NM_001001852NM_001001852 PIM3PIM3 Pim-3 oncogenePim-3 oncogene 2.1806343112.180634311 L76191L76191 IRAK1IRAK1 Interleukin-1 receptor-associated kinase 1Interleukin-1 receptor-associated kinase 1 2.3606323252.360632325 D15049D15049 PTPRHPTPRH Protein tyrosine phosphatase, receptor type, HProtein tyrosine phosphatase, receptor type, H 3.1866533513.186653351 BC065207BC065207 ATP6V0D2ATP6V0D2 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2ATPase, H + transporting, lysosomal 38kDa, V0 subunit d isoform 2 5.7100886325.710088632 BC035578BC035578 STK24STK24 Serine/threonine kinase 24 (STE20 homolog, yeast)Serine / threonine kinase 24 (STE20 homolog, yeast) 2.5669517032.566951703 BC028724BC028724 DUSP18DUSP18 Dual specificity phosphatase 18Dual specificity phosphatase 18 2.1437972952.143797295 AL117482AL117482 ULK3ULK3 Unc-51-like kinase 3 (C. elegans)Unc-51-like kinase 3 (C. elegans) 2.1258492732.125849273 AK126879AK126879 PCTK3PCTK3 PCTAIRE protein kinase 3PCTAIRE protein kinase 3 2.7615527092.761552709 AB209416AB209416 ILKILK Integrin-linked kinase-2Integrin-linked kinase-2 2.329163392.32916339 (p) 금속 결합 (Metal-binding)(p) metal-binding NM_000782NM_000782 CYP24A1CYP24A1 Cytochrome P450, family 24, subfamily A, polypeptide 1Cytochrome P450, family 24, subfamily A, polypeptide 1 5.6226413325.622641332 CR597101CR597101 ZFP36ZFP36 Zinc finger protein 36, C3H type, homolog (mouse)Zinc finger protein 36, C3H type, homolog (mouse) 5.0247898525.024789852 CR936799CR936799 FHL2FHL2 Four and a half LIM domains 2Four and a half LIM domains 2 4.6753812684.675381268 M24898M24898 NR1D1NR1D1 Nuclear receptor subfamily 1, group D, member 1Nuclear receptor subfamily 1, group D, member 1 4.1369324094.136932409 AF132818AF132818 KLF5KLF5 Kruppel-like factor 5 (intestinal)Kruppel-like factor 5 (intestinal) 4.1166809894.116680989 AK055337AK055337 ZNF213ZNF213 Zinc finger protein 213Zinc finger protein 213 3.5183761123.518376112 BC008834BC008834 PHF1PHF1 PHD finger protein 1PHD finger protein 1 3.2404488483.240448848 AK126918AK126918 GLIS2GLIS2 GLIS family zinc finger 2GLIS family zinc finger 2 3.1688019353.168801935 (q) 전달 (Transport)(q) Transport BC042692BC042692 CTL2CTL2 Solute carrier family 44, member 2Solute carrier family 44, member 2 7.7122767197.712276719 NM_002224NM_002224 ITPR3ITPR3 Inositol 1,4,5-triphosphate receptor, type 3Inositol 1,4,5-triphosphate receptor, type 3 7.2003161337.200316133 AK095363AK095363 AQP3AQP3 Aquaporin 3Aquaporin 3 7.0893117267.089311726 NM_174953NM_174953 ATP2A3ATP2A3 ATPase, Ca++ transporting, ubiquitousATPase, Ca ++ transporting, ubiquitous 6.6676384226.667638422 BC042390BC042390 VTI1BVTI1B Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 5.3956406795.395640679 NM_016113NM_016113 TRPV2TRPV2 Transient receptor potential cation channel, subfamily V, member 2Transient receptor potential cation channel, subfamily V, member 2 5.3009488265.300948826 BM926478BM926478 RBP1RBP1 Retinol binding protein 1, cellularRetinol binding protein 1, cellular 4.2578762974.257876297 NM_000069NM_000069 CACNA1SCACNA1S Calcium channel, voltage-dependent, L type, alpha 1S subunitCalcium channel, voltage-dependent, L type, alpha 1S subunit 3.9338115963.933811596 AK002107AK002107 RAB3BRAB3B RAB3B, member RAS oncogene familyRAB3B, member RAS oncogene family 3.7198804813.719880481 NM_013321NM_013321 SNX8SNX8 Sorting nexin 8Sorting nexin 8 3.5114333863.511433386 AK125026AK125026 SLC6A12SLC6A12 Solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12Solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12 3.4968243483.496824348 NM_005843NM_005843 STAM2STAM2 Signal transducing adaptor molecule (SH3 domain and ITAM motif) 2Signal transducing adapter molecule (SH3 domain and ITAM motif) 2 3.3176964373.317696437 AK092512AK092512 SLC16A5SLC16A5 Solute carrier family 16 (monocarboxylic acid transporters), member 5Solute carrier family 16 (monocarboxylic acid transporters), member 5 3.292629473.29262947 U49248U49248 ABCC2ABCC2 ATP-binding cassette, sub-family C (CFTR/MRP), member 2ATP-binding cassette, sub-family C (CFTR / MRP), member 2 3.1788493893.178849389 AK172792AK172792 SCNN1ASCNN1A Sodium channel, nonvoltage-gated 1 alphaSodium channel, nonvoltage-gated 1 alpha 3.0974821713.097482171 BC044656BC044656 CASC3CASC3 Cancer susceptibility candidate 3Cancer susceptibility candidate 3 3.0928208843.092820884 (r) 기타 (The others)(r) The others NM_203403NM_203403 C9orf150C9orf150 Chromosome 9 open reading frame 150Chromosome 9 open reading frame 150 4.328876134.32887613 NM_080388NM_080388 S100A16S100A16 S100 calcium binding protein A16S100 calcium binding protein A16 2.9415909732.941590973 NM_031286NM_031286 SH3BGRL3SH3BGRL3 SH3 domain binding glutamic acid-rich protein like 3SH3 domain binding glutamic acid-rich protein like 3 3.9424716393.942471639 NM_022153NM_022153 PP2135PP2135 Chromosome 10 open reading frame 54Chromosome 10 open reading frame 54 3.9168658893.916865889 NM_004864NM_004864 GDF15GDF15 Growth differentiation factor 15Growth differentiation factor 15 8.0334596648.033459664 NM_003330NM_003330 TXNRD1TXNRD1 Thioredoxin reductase 1Thioredoxin reductase 1 2.0161713862.016171386 NM_001013632NM_001013632 LOC343521LOC343521 Similar to hypothetical protein 4833401D15Similar to hypothetical protein 4833401D15 6.2657979516.265797951 BX537968BX537968 LOC51149LOC51149 Hypothetical LOC51149Hypothetical LOC51149 6.3824793996.382479399 BU945318BU945318 MT2AMT2A Hypothetical gene supported by X97260; BC070289Hypothetical gene supported by X97260; BC070289 5.2234014475.223401447 BQ683841BQ683841 S100A11S100A11 S100 calcium binding protein A11 (calgizzarin)S100 calcium binding protein A11 (calgizzarin) 6.4257935596.425793559 BQ276852BQ276852 TMSB10TMSB10 Thymosin, beta 10Thymosin, beta 10 3.4583981313.458398131 AK126182AK126182 KIAA1949KIAA1949 KIAA1949KIAA1949 4.2566198314.256619831 AK124751AK124751 CAPN2CAPN2 Calpain 2, (m/II) large subunitCalpain 2, (m / II) large subunit 3.007133763.00713376 AK095079AK095079 RGC32RGC32 Response gene to complement 32Response gene to complement 32 2.4521701072.452170107 AB075871AB075871 FLJ42654FLJ42654 Golgi transport 1 homolog A (S. cerevisiae)Golgi transport 1 homolog A (S. cerevisiae) 2.3447517492.344751749

페난트렌에 의해 발현이 감소하는 유전자Gene whose expression is reduced by phenanthrene 등록번호Registration Number 유전자명Gene name 유전자약어Gene abbreviation 중간값의비Ratio of medians (a) MAPKinase 신호 경로 (MAPKinase Signaling Pathway)(a) MAPKinase Signaling Pathway AK125150AK125150 MAPK8MAPK8 Mitogen-activated protein kinase 8Mitogen-activated protein kinase 8 0.371581590.37158159 NM_002758NM_002758 MAP2K6MAP2K6 Mitogen-activated protein kinase kinase 6Mitogen-activated protein kinase kinase 6 0.2734144280.273414428 NM_004612NM_004612 TGFBR1TGFBR1 Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kDa)Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kDa) 0.4589742490.458974249 NM_145686NM_145686 MAP4K4MAP4K4 Mitogen-activated protein kinase kinase kinase kinase 4Mitogen-activated protein kinase kinase kinase kinase 4 0.3762766740.376276674 XM_042066XM_042066 MAP3K1MAP3K1 Mitogen-activated protein kinase kinase kinase 1Mitogen-activated protein kinase kinase kinase 1 0.4916488230.491648823 (b) MAPKKK 캐스케이드 (MAPKKK cascade) (b) MAPKKK cascade AB011123AB011123 TNIKTNIK TRAF2 and NCK interacting kinaseTRAF2 and NCK interacting kinase 0.4259732560.425973256 AB209031AB209031 C5C5 Complement component 5Complement component 5 0.3727506140.372750614 NM_022740NM_022740 HIPK2HIPK2 Homeodomain interacting protein kinase 2Homeodomain interacting protein kinase 2 0.4705488210.470548821 NM_148957NM_148957 TNFRSF19TNFRSF19 Tumor necrosis factor receptor superfamily, member 19Tumor necrosis factor receptor superfamily, member 19 0.2917739850.291773985 (c) 아팝토시스 (Apoptosis)(c) Apoptosis AB208909AB208909 ITGB2ITGB2 Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) 0.2824140490.282414049 AB209211AB209211 TIA1TIA1 TIA1 cytotoxic granule-associated RNA binding proteinTIA1 cytotoxic granule-associated RNA binding protein 0.3592738740.359273874 AB209613AB209613 DNASE1L3DNASE1L3 Deoxyribonuclease I-like 3Deoxyribonuclease I-like 3 0.4823029190.482302919 AK122825AK122825 HMGB1HMGB1 High-mobility group box 1High-mobility group box 1 0.4054168590.405416859 AK127326AK127326 PHF17PHF17 PHD finger protein 17PHD finger protein 17 0.4482195250.448219525 AK223503AK223503 CASP1CASP1 Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) 0.3627276750.362727675 BC013326BC013326 GAS2GAS2 Growth arrest-specific 2Growth arrest-specific 2 0.3051813250.305181325 BC047698BC047698 IL7IL7 Interleukin 7Interleukin 7 0.3911767770.391176777 D79987D79987 ESPL1ESPL1 Extra spindle poles like 1 (S. cerevisiae)Extra spindle poles like 1 (S. cerevisiae) 0.4730634610.473063461 NM_000893NM_000893 KNG1KNG1 Kininogen 1Kininogen 1 0.3156198520.315619852 NM_001012271NM_001012271 BIRC5BIRC5 Effector cell peptidase receptor 1Effector cell peptidase receptor 1 0.3472357920.347235792 NM_004938NM_004938 DAPK1DAPK1 Death-associated protein kinase 1Death-associated protein kinase 1 0.4144700550.414470055 NM_005879NM_005879 TRIPTRIP TRAF interacting proteinTRAF interacting protein 0.3431973610.343197361 NM_014739NM_014739 BCLAF1BCLAF1 BCL2-associated transcription factor 1BCL2-associated transcription factor 1 0.4944340730.494434073 NM_018947NM_018947 CYCSCYCS Cytochrome c, somaticCytochrome c, somatic 0.4844340580.484434058 (d) 유사분열 세포주기 (Mitotic cell cycle)(d) Mitotic cell cycle AB033337AB033337 MPHOSPH1MPHOSPH1 M-phase phosphoprotein 1M-phase phosphoprotein 1 0.3502638110.350263811 AB209179AB209179 PLK1PLK1 Polo-like kinase 1 (Drosophila)Polo-like kinase 1 (Drosophila) 0.4514872150.451487215 AB209337AB209337 CDC7CDC7 CDC7 cell division cycle 7 (S. cerevisiae)CDC7 cell division cycle 7 (S. cerevisiae) 0.4902900430.490290043 AF053305AF053305 BUB1BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) 0.2262509440.226250944 AF053306AF053306 BUB1BBUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) 0.2871506490.287150649 AF345347AF345347 SPAG5SPAG5 Sperm associated antigen 5Sperm associated antigen 5 0.3845987210.384598721 AK092638AK092638 CCNG2CCNG2 Cyclin G2Cyclin G2 0.3692673190.369267319 AK222819AK222819 NUSAP1NUSAP1 Nucleolar and spindle associated protein 1Nucleolar and spindle associated protein 1 0.2697119070.269711907 AL833191AL833191 SMC2L1SMC2L1 SMC2 structural maintenance of chromosomes 2-like 1 (yeast)SMC2 structural maintenance of chromosomes 2-like 1 (yeast) 0.3584696750.358469675 AY257469AY257469 CITCIT Citron (rho-interacting, serine/threonine kinase 21)Citron (rho-interacting, serine / threonine kinase 21) 0.3327004070.332700407 AY367065AY367065 ASPMASPM Asp (abnormal spindle)-like, microcephaly associated (Drosophila)Asp (abnormal spindle) -like, microcephaly associated (Drosophila) 0.1909904690.190990469 BC011000BC011000 CDCA5CDCA5 Cell division cycle associated 5Cell division cycle associated 5 0.3647892110.364789211 BC032677BC032677 UBE2CUBE2C Ubiquitin-conjugating enzyme E2CUbiquitin-conjugating enzyme E2C 0.2747844750.274784475 BC043502BC043502 NEK2NEK2 NIMA (never in mitosis gene a)-related kinase 2NIMA (never in mitosis gene a) -related kinase 2 0.3587936970.358793697 BU675073BU675073 PTTG1PTTG1 Pituitary tumor-transforming 1Pituitary tumor-transforming 1 0.3849348480.384934848 BX647885BX647885 STMN1STMN1 Stathmin 1/oncoprotein 18Stathmin 1 / oncoprotein 18 0.4385896170.438589617 CR592757CR592757 BRRN1BRRN1 Barren homolog 1 (Drosophila)Barren homolog 1 (Drosophila) 0.442120030.44212003 CR597075CR597075 MAPRE2MAPRE2 Microtubule-associated protein, RP/EB family, member 2Microtubule-associated protein, RP / EB family, member 2 0.4018748250.401874825 CR604810CR604810 CCNA2CCNA2 Cyclin A2Cyclin A2 0.2717979270.271797927 CR933728CR933728 CDC2CDC2 Cell division cycle 2, G1 to S and G2 to MCell division cycle 2, G1 to S and G2 to M 0.2621985330.262198533 NM_000919NM_000919 PAMPAM Peptidylglycine alpha-amidating monooxygenasePeptidylglycine alpha-amidating monooxygenase 0.3959251240.395925124 NM_001790NM_001790 CDC25CCDC25C Cell division cycle 25CCell division cycle 25C 0.2866088810.286608881 NM_001798NM_001798 CDK2CDK2 Cyclin-dependent kinase 2Cyclin-dependent kinase 2 0.4836243170.483624317 NM_001813NM_001813 CENPECENPE Centromere protein E, 312kDaCentromere protein E, 312kDa 0.1974010940.197401094 NM_003318NM_003318 TTKTTK TTK protein kinaseTTK protein kinase 0.2161075530.216107553 NM_003981NM_003981 PRC1PRC1 Protein regulator of cytokinesis 1Protein regulator of cytokinesis 1 0.2765705560.276570556 NM_004523NM_004523 KIF11KIF11 Kinesin family member 11Kinesin family member 11 0.3248120810.324812081 NM_004701NM_004701 CCNB2CCNB2 Cyclin B2Cyclin B2 0.2659523870.265952387 NM_005983NM_005983 SKP2SKP2 S-phase kinase-associated protein 2 (p45)S-phase kinase-associated protein 2 (p45) 0.4062540310.406254031 NM_006101NM_006101 KNTC2KNTC2 Kinetochore associated 2Kinetochore associated 2 0.1566794480.156679448 NM_006845NM_006845 KIF2CKIF2C Kinesin family member 2CKinesin family member 2C 0.4277433510.427743351 NM_007375NM_007375 TARDBPTARDBP TAR DNA binding proteinTAR DNA binding protein 0.4652308230.465230823 NM_012112NM_012112 TPX2TPX2 TPX2, microtubule-associated, homolog (Xenopus laevis)TPX2, microtubule-associated, homolog (Xenopus laevis) 0.4371502910.437150291 NM_014750NM_014750 DLG7DLG7 Discs, large homolog 7 (Drosophila)Discs, large homolog 7 (Drosophila) 0.2418186180.241818618 NM_015097NM_015097 CLASP2CLASP2 Cytoplasmic linker associated protein 2Cytoplasmic linker associated protein 2 0.487345010.48734501 NM_016343NM_016343 CENPFCENPF Centromere protein F, 350/400ka (mitosin)Centromere protein F, 350 / 400ka (mitosin) 0.2456199250.245619925 NM_016426NM_016426 GTSE1GTSE1 G-2 and S-phase expressed 1G-2 and S-phase expressed 1 0.4577477460.457747746 NM_018492NM_018492 PBKPBK PDZ binding kinasePDZ binding kinase 0.2502397010.250239701 NM_018685NM_018685 ANLNANLN Anillin, actin binding protein (scraps homolog, Drosophila)Anillin, actin binding protein (scraps homolog, Drosophila) 0.2934959460.293495946 NM_020242NM_020242 KNSL7KNSL7 Kinesin family member 15Kinesin family member 15 0.3082524640.308252464 NM_031966NM_031966 CCNB1CCNB1 Cyclin B1Cyclin B1 0.3495284870.349528487 NM_138555NM_138555 KIF23KIF23 Kinesin family member 23Kinesin family member 23 0.3391204570.339120457 U65410U65410 MAD2L1MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast)MAD2 mitotic arrest deficient-like 1 (yeast) 0.2873003350.287300335 (e) 세포 주기 (Cell cycle) (e) Cell cycle AB020656AB020656 CYLDCYLD Cylindromatosis (turban tumor syndrome)Cylindromatosis (turban tumor syndrome) 0.4993153210.499315321 AF033122AF033122 SESN1SESN1 Sestrin 1Sestrin 1 0.4792650950.479265095 AK074377AK074377 UHRF1UHRF1 Chromosome 19 open reading frame 31Chromosome 19 open reading frame 31 0.3702300350.370230035 AK091170AK091170 CDKN2CCDKN2C Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 0.4386596880.438659688 AK094323AK094323 NFYCNFYC Nuclear transcription factor Y, gammaNuclear transcription factor Y, gamma 0.4871009930.487100993 AY366508AY366508 LOH11CR2ALOH11CR2A Loss of heterozygosity, 11, chromosomal region 2, gene ALoss of heterozygosity, 11, chromosomal region 2, gene A 0.3760708150.376070815 BC033086BC033086 TCF19TCF19 Transcription factor 19 (SC1)Transcription factor 19 (SC1) 0.4191542360.419154236 BC040303BC040303 PTP4A1PTP4A1 Protein tyrosine phosphatase type IVA, member 1Protein tyrosine phosphatase type IVA, member 1 0.2902560960.290256096 BC040991BC040991 TFDP2TFDP2 Transcription factor Dp-2 (E2F dimerization partner 2)Transcription factor Dp-2 (E2F dimerization partner 2) 0.4820766430.482076643 BC092412BC092412 SGOL2SGOL2 Shugoshin-like 2 (S. pombe)Shugoshin-like 2 (S. pombe) 0.2886033230.288603323 BQ278454BQ278454 CKS1BCKS1B CDC28 protein kinase regulatory subunit 1BCDC28 protein kinase regulatory subunit 1B 0.4764475790.476447579 BX649128BX649128 SESN3SESN3 Sestrin 3Sestrin 3 0.2122810930.212281093 CD049340CD049340 AURKBAURKB Aurora kinase BAurora kinase B 0.4584213090.458421309 M89914M89914 NF1NF1 Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease) 0.4487547020.448754702 NM_001005414NM_001005414 ZWINTZWINT ZW10 interactor antisenseZW10 interactor antisense 0.3050268390.305026839 NM_001008491NM_001008491 02-Sep02-Sep Septin 2Septin 2 0.4333832820.433383282 NM_001274NM_001274 CHEK1CHEK1 CHK1 checkpoint homolog (S. pombe)CHK1 checkpoint homolog (S. pombe) 0.3994706640.399470664 NM_002105NM_002105 H2AFXH2AFX H2A histone family, member XH2A histone family, member X 0.4621045470.462104547 NM_002388NM_002388 MCM3MCM3 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) 0.4933473620.493347362 NM_002417NM_002417 MKI67MKI67 Antigen identified by monoclonal antibody Ki-67Antigen identified by monoclonal antibody Ki-67 0.2111979510.211197951 NM_002875NM_002875 RAD51RAD51 RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) 0.4684963580.468496358 NM_003884NM_003884 PCAFPCAF P300/CBP-associated factorP300 / CBP-associated factor 0.3478756330.347875633 NM_004526NM_004526 MCM2MCM2 MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae) 0.4519838670.451983867 NM_004847NM_004847 AIF1AIF1 Allograft inflammatory factor 1Allograft inflammatory factor 1 0.474514030.47451403 NM_005915NM_005915 MCM6MCM6 MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae) 0.4923847230.492384723 NM_012090NM_012090 MACF1MACF1 Microtubule-actin crosslinking factor 1Microtubule-actin crosslinking factor 1 0.481946550.48194655 NM_012415NM_012415 RAD54BRAD54B RAD54 homolog B (S. cerevisiae)RAD54 homolog B (S. cerevisiae) 0.4166567820.416656782 NM_014264NM_014264 PLK4PLK4 Polo-like kinase 4 (Drosophila)Polo-like kinase 4 (Drosophila) 0.3057080650.305708065 NM_015714NM_015714 G0S2G0S2 G0/G1switch 2G0 / G1switch 2 0.2126172580.212617258 NM_024680NM_024680 FLJ23311FLJ23311 E2F transcription factor 8E2F transcription factor 8 0.3837744230.383774423 XM_034274XM_034274 MYBL1MYBL1 V-myb myeloblastosis viral oncogene homolog (avian)-like 1V-myb myeloblastosis viral oncogene homolog (avian) -like 1 0.4009690190.400969019 (f) DNA 손상에 대한 반응 (Response to DNA damage stimulus)(f) Response to DNA damage stimulus AK001720AK001720 FLJ10858FLJ10858 Nei endonuclease VIII-like 3 (E. coli)Nei endonuclease VIII-like 3 (E. coli) 0.2910066290.291006629 AY032677AY032677 POLQPOLQ Polymerase (DNA directed), thetaPolymerase (DNA directed), theta 0.4673249210.467324921 BC034480BC034480 BLMBLM Bloom syndromeBloom syndrome 0.4515710420.451571042 BC073161BC073161 RAD51CRAD51C RAD51 homolog C (S. cerevisiae)RAD51 homolog C (S. cerevisiae) 0.4501897690.450189769 CR600021CR600021 HMGB2HMGB2 High-mobility group box 2High-mobility group box 2 0.3969817150.396981715 CR625391CR625391 RAD51AP1RAD51AP1 RAD51 associated protein 1RAD51 associated protein 1 0.2846921630.284692163 CR936783CR936783 FLJ40869FLJ40869 Hypothetical protein LOC284952Hypothetical protein LOC284952 0.355483510.35548351 DQ140356DQ140356 KIAA1596KIAA1596 Fanconi anemia, complementation group MFanconi anemia, complementation group M 0.412873460.41287346 NM_001067NM_001067 TOP2ATOP2A Topoisomerase (DNA) II alpha 170kDaTopoisomerase (DNA) II alpha 170kDa 0.2234227830.223422783 NM_001618NM_001618 PARP1PARP1 Poly (ADP-ribose) polymerase family, member 1Poly (ADP-ribose) polymerase family, member 1 0.416444920.41644492 NM_003362NM_003362 UNGUNG Uracil-DNA glycosylaseUracil-DNA glycosylase 0.3381997420.338199742 NM_006904NM_006904 PRKDCPRKDC Protein kinase, DNA-activated, catalytic polypeptideProtein kinase, DNA-activated, catalytic polypeptide 0.4845152150.484515215 NM_130398NM_130398 EXO1EXO1 Exonuclease 1Exonuclease 1 0.4666202790.466620279 (g) 스트레스에 대한 반응 (Response to stress)(g) Response to stress AB020807AB020807 TLR6TLR6 Toll-like receptor 6Toll-like receptor 6 0.4464776410.446477641 AB032980AB032980 DCDC2DCDC2 Doublecortin domain containing 2Doublecortin domain containing 2 0.2961248270.296124827 AB209866AB209866 TFPITFPI Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 0.3796015180.379601518 AK057015AK057015 HSPA4HSPA4 Heat shock 70kDa protein 4Heat shock 70kDa protein 4 0.4145803680.414580368 AK095515AK095515 IFIT1IFIT1 Interferon-induced protein with tetratricopeptide repeats 1Interferon-induced protein with tetratricopeptide repeats 1 0.2276398020.227639802 AK122686AK122686 IFIF I factor (complement)I factor (complement) 0.3199728310.319972831 AK123010AK123010 RRM2RRM2 Ribonucleotide reductase M2 polypeptideRibonucleotide reductase M2 polypeptide 0.3594367570.359436757 BC035582BC035582 TRIM22TRIM22 Tripartite motif-containing 22Tripartite motif-containing 22 0.4298596930.429859693 BX537894BX537894 LOC493869LOC493869 Similar to RIKEN cDNA 2310016C16Similar to RIKEN cDNA 2310016C16 0.4308087530.430808753 M14338M14338 PROS1PROS1 Protein S (alpha)Protein S (alpha) 0.387585870.38758587 NM_000821NM_000821 GGCXGGCX Gamma-glutamyl carboxylaseGamma-glutamyl carboxylase 0.447866980.44786698 NM_000963NM_000963 PTGS2PTGS2 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase) 0.2385585880.238558588 NM_001001547NM_001001547 CD36CD36 CD36 antigen (collagen type I receptor, thrombospondin receptor)CD36 antigen (collagen type I receptor, thrombospondin receptor) 0.4275826620.427582662 NM_001512NM_001512 GSTA4GSTA4 Glutathione S-transferase A4Glutathione S-transferase A4 0.4096961330.409696133 NM_001629NM_001629 ALOX5APALOX5AP Arachidonate 5-lipoxygenase-activating proteinArachidonate 5-lipoxygenase-activating protein 0.3702580010.370258001 NM_001752NM_001752 CATCAT CatalaseCatalase 0.482290970.48229097 NM_001837NM_001837 CCR3CCR3 Chemokine (C-C motif) receptor 3Chemokine (C-C motif) receptor 3 0.3929998150.392999815 NM_001979NM_001979 EPHX2EPHX2 Epoxide hydrolase 2, cytoplasmicEpoxide hydrolase 2, cytoplasmic 0.4097485370.409748537 NM_001994NM_001994 F13BF13B Coagulation factor XIII, B polypeptideCoagulation factor XIII, B polypeptide 0.4171036150.417103615 NM_002182NM_002182 IL1RAPIL1RAP Interleukin 1 receptor accessory proteinInterleukin 1 receptor accessory protein 0.4705442240.470544224 NM_006120NM_006120 HLA-DMAHLA-DMA Major histocompatibility complex, class II, DM alphaMajor histocompatibility complex, class II, DM alpha 0.4093816910.409381691 NM_173216NM_173216 SIAT1SIAT1 ST6 beta-galactosamide alpha-2,6-sialyltranferase 1ST6 beta-galactosamide alpha-2,6-sialyltranferase 1 0.3950488850.395048885 NM_202002NM_202002 FOXM1FOXM1 Forkhead box M1Forkhead box M1 0.3431647990.343164799 (h) 면역 반응 (Immune response)(h) Immune response AB163917AB163917 LRAPLRAP Leukocyte-derived arginine aminopeptidaseLeukocyte-derived arginine aminopeptidase 0.3895451520.389545152 BC027881BC027881 AFPAFP Alpha-fetoproteinAlpha-fetoprotein 0.4825989860.482598986 NM_015915NM_015915 SPG3ASPG3A Spastic paraplegia 3A (autosomal dominant)Spastic paraplegia 3A (autosomal dominant) 0.3205987060.320598706 (i) 사이토크롬 p450에 의한 대사 (Metabolism of xenobiotics by cytochrome p450)(i) Metabolism of xenobiotics by cytochrome p450 NM_000671NM_000671 ADH5ADH5 Alcohol dehydrogenase 5 (class III), chi polypeptideAlcohol dehydrogenase 5 (class III), chi polypeptide 0.4157698850.415769885 J05428J05428 UGT2B7UGT2B7 UDP glucuronosyltransferase 2 family, polypeptide B7UDP glucuronosyltransferase 2 family, polypeptide B7 0.3559498990.355949899 NM_000672NM_000672 ADH6ADH6 Alcohol dehydrogenase 6 (class V)Alcohol dehydrogenase 6 (class V) 0.2400174770.240017477 M15943M15943 ADH4ADH4 Alcohol dehydrogenase 4 (class II), pi polypeptideAlcohol dehydrogenase 4 (class II), pi polypeptide 0.3690023720.369002372 (j) 알코올 대사 (Alcohol metabolism)(j) Alcohol metabolism AK223395AK223395 FBP1FBP1 Fructose-1,6-bisphosphatase 1Fructose-1,6-bisphosphatase 1 0.3459759240.345975924 NM_000151NM_000151 G6PCG6PC Glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)Glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease) 0.4838654860.483865486 XM_113962XM_113962 KIAA0650KIAA0650 Structural maintenance of chromosomes flexible hinge domain containing 1Structural maintenance of chromosomes flexible hinge domain containing 1 0.4811136040.481113604 (k) 지질 대사 (Lipid metabolism)(k) Lipid metabolism AB020644AB020644 ACSL6ACSL6 Acyl-CoA synthetase long-chain family member 6Acyl-CoA synthetase long-chain family member 6 0.3667965790.366796579 AB209907AB209907 PLD1PLD1 Phospholipase D1, phophatidylcholine-specificPhospholipase D1, phophatidylcholine-specific 0.497943990.49794399 AF285167AF285167 ABCA1ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1ATP-binding cassette, sub-family A (ABC1), member 1 0.4005762120.400576212 AF297872AF297872 TRERF1TRERF1 Transcriptional regulating factor 1Transcriptional regulating factor 1 0.4244244420.424424442 AF303134AF303134 ALDH8A1ALDH8A1 Aldehyde dehydrogenase 8 family, member A1Aldehyde dehydrogenase 8 family, member A1 0.3272167490.327216749 AF339053AF339053 PLA2G12BPLA2G12B Phospholipase A2, group XIIBPhospholipase A2, group XIIB 0.4039108820.403910882 AK096018AK096018 HADHSCHADHSC L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chainL-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain 0.4770725160.477072516 AK124635AK124635 PCSK9PCSK9 Proprotein convertase subtilisin/kexin type 9Proprotein convertase subtilisin / kexin type 9 0.3545292990.354529299 AK127346AK127346 SIAT9SIAT9 ST3 beta-galactoside alpha-2,3-sialyltransferase 5ST3 beta-galactoside alpha-2,3-sialyltransferase 5 0.4998007580.499800758 AL359559AL359559 AGPSAGPS Alkylglycerone phosphate synthaseAlkylglycerone phosphate synthase 0.4664435770.466443577 AY691170AY691170 PLCL3PLCL3 Phospholipase C-like 3Phospholipase C-like 3 0.4508897110.450889711 BG567934BG567934 APOMAPOM Apolipoprotein MApolipoprotein M 0.4278658380.427865838 BX538214BX538214 C6orf167C6orf167 Chromosome 6 open reading frame 167Chromosome 6 open reading frame 167 0.3614515790.361451579 BX640945BX640945 FADS2FADS2 Fatty acid desaturase 2Fatty acid desaturase 2 0.3369869570.336986957 BX648473BX648473 PIGKPIGK Phosphatidylinositol glycan, class KPhosphatidylinositol glycan, class K 0.4476426730.447642673 BX648557BX648557 HSD17B2HSD17B2 Hydroxysteroid (17-beta) dehydrogenase 2Hydroxysteroid (17-beta) dehydrogenase 2 0.4234134530.423413453 CR749601CR749601 ETNK1ETNK1 Death-associated protein kinase 3Death-associated protein kinase 3 0.3428432880.342843288 NM_000859NM_000859 HMGCRHMGCR 3-hydroxy-3-methylglutaryl-Coenzyme A reductase3-hydroxy-3-methylglutaryl-Coenzyme A reductase 0.4336288280.433628828 NM_001443NM_001443 FABP1FABP1 Fatty acid binding protein 1, liverFatty acid binding protein 1, liver 0.4623650860.462365086 NM_002130NM_002130 HMGCS1HMGCS1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) 0.4256022320.425602232 NM_003725NM_003725 RODHRODH Hydroxysteroid (17-beta) dehydrogenase 6Hydroxysteroid (17-beta) dehydrogenase 6 0.3692859220.369285922 NM_004845NM_004845 PCYT1BPCYT1B Phosphate cytidylyltransferase 1, choline, betaPhosphate cytidylyltransferase 1, choline, beta 0.3250800420.325080042 NM_014762NM_014762 DHCR24DHCR24 24-dehydrocholesterol reductase24-dehydrocholesterol reductase 0.4823090720.482309072 NM_020139NM_020139 DHRS6DHRS6 Dehydrogenase/reductase (SDR family) member 6Dehydrogenase / reductase (SDR family) member 6 0.4853374260.485337426 NM_020918NM_020918 GPAMGPAM Glycerol-3-phosphate acyltransferase, mitochondrialGlycerol-3-phosphate acyltransferase, mitochondrial 0.4877464120.487746412 NM_032523NM_032523 OSBPL6OSBPL6 Oxysterol binding protein-like 6Oxysterol binding protein-like 6 0.4500670010.450067001 NM_033505NM_033505 SELISELI Selenoprotein ISelenoprotein I 0.4510562530.451056253 Z28339Z28339 AKR1D1AKR1D1 Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase) 0.4521917540.452191754 (l) 인산염 대사 (Phosphate metabolism) (l) Phosphate metabolism AK024899AK024899 ENPP3ENPP3 Ectonucleotide pyrophosphatase/phosphodiesterase 3Ectonucleotide pyrophosphatase / phosphodiesterase 3 0.4275403050.427540305 AK025546AK025546 PTPN4PTPN4 Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte) 0.4726744120.472674412 AK124910AK124910 ENPP2ENPP2 Ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin)Ectonucleotide pyrophosphatase / phosphodiesterase 2 (autotaxin) 0.3606663660.360666366 BC035116BC035116 FLJ35059 fisFLJ35059 fis CDNA FLJ30761 fis, clone FEBRA2000538CDNA FLJ30761 fis, clone FEBRA2000538 0.4043836590.404383659 BC050565BC050565 PASKPASK PAS domain containing serine/threonine kinasePAS domain containing serine / threonine kinase 0.4489216060.448921606 L13436L13436 NPR2NPR2 Natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B)Natriuretic peptide receptor B / guanylate cyclase B (atrionatriuretic peptide receptor B) 0.3543882760.354388276 NM_001005862NM_001005862 ERBB2ERBB2 V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro / glioblastoma derived oncogene homolog (avian) 0.4748577040.474857704 NM_005012NM_005012 ROR1ROR1 Receptor tyrosine kinase-like orphan receptor 1Receptor tyrosine kinase-like orphan receptor 1 0.3978477950.397847795 NM_006035NM_006035 CDC42BPBCDC42BPB CDC42 binding protein kinase beta (DMPK-like)CDC42 binding protein kinase beta (DMPK-like) 0.4748506060.474850606 NM_014791NM_014791 MELKMELK Maternal embryonic leucine zipper kinaseMaternal embryonic leucine zipper kinase 0.3006253910.300625391 NM_023028NM_023028 FGFR2FGFR2 Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome)Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) 0.2423221610.242322161 NM_080836NM_080836 STK35STK35 Serine/threonine kinase 35Serine / threonine kinase 35 0.4249671250.424967125 (m) RNA 대사 (RNA metabolism)(m) RNA metabolism AF419331AF419331 FUSIP1FUSIP1 FUS interacting protein (serine/arginine-rich) 1FUS interacting protein (serine / arginine-rich) 1 0.4127597480.412759748 AK091927AK091927 SFRS3SFRS3 Splicing factor, arginine/serine-rich 3Splicing factor, arginine / serine-rich 3 0.4204494850.420449485 BC010266BC010266 HNRNPA1HNRNPA1 Heterogeneous nuclear ribonucleoprotein A1Heterogeneous nuclear ribonucleoprotein A1 0.4623111440.462311144 BC012360BC012360 CTAGE5CTAGE5 CTAGE family, member 5CTAGE family, member 5 0.4314186920.431418692 BC036046BC036046 PLRG1PLRG1 Pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)Pleiotropic regulator 1 (PRL1 homolog, Arabidopsis) 0.330896540.33089654 BC065384BC065384 PCF11PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) 0.396613980.39661398 BX537360BX537360 CPSF5CPSF5 Nudix (nucleoside diphosphate linked moiety X)-type motif 21Nudix (nucleoside diphosphate linked moiety X) -type motif 21 0.4749035830.474903583 BX537494BX537494 HNRPA2B1HNRPA2B1 Heterogeneous nuclear ribonucleoprotein A2/B1Heterogeneous nuclear ribonucleoprotein A2 / B1 0.4832359580.483235958 BX647784BX647784 HNRPRHNRPR Heterogeneous nuclear ribonucleoprotein RHeterogeneous nuclear ribonucleoprotein R 0.4938329140.493832914 CA455267CA455267 PPIHPPIH Peptidyl prolyl isomerase H (cyclophilin H)Peptidyl prolyl isomerase H (cyclophilin H) 0.4527356920.452735692 CR596214CR596214 HNRPA0HNRPA0 Heterogeneous nuclear ribonucleoprotein A0Heterogeneous nuclear ribonucleoprotein A0 0.4928308560.492830856 NM_001326NM_001326 CSTF3CSTF3 Hypothetical protein LOC283267Hypothetical protein LOC283267 0.4883695660.488369566 NM_004640NM_004640 BAT1BAT1 HLA-B associated transcript 1HLA-B associated transcript 1 0.4646788020.464678802 NM_005463NM_005463 HNRPDLHNRPDL Heterogeneous nuclear ribonucleoprotein D-likeHeterogeneous nuclear ribonucleoprotein D-like 0.449431890.44943189 NM_006924NM_006924 SFRS1SFRS1 Splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor)Splicing factor, arginine / serine-rich 1 (splicing factor 2, alternate splicing factor) 0.4099852510.409985251 NM_012426NM_012426 SF3B3SF3B3 Splicing factor 3b, subunit 3, 130kDaSplicing factor 3b, subunit 3, 130 kDa 0.4096106070.409610607 NM_018048NM_018048 FLJ10292FLJ10292 Mago-nashi homologMago-nashi homolog 0.4766104530.476610453 NM_030919NM_030919 C20orf129C20orf129 Chromosome 20 open reading frame 129Chromosome 20 open reading frame 129 0.3328051960.332805196 NM_031370NM_031370 HNRPDHNRPD Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) 0.4250730790.425073079 NM_138933NM_138933 ACFACF Apobec-1 complementation factorApobec-1 complementation factor 0.495076290.49507629 (n) 금속 결합 (Metal-binding) (n) metal-binding AB193259AB193259 ACE2ACE2 Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 0.2398565180.239856518 BX648769BX648769 EWSR1EWSR1 Ewing sarcoma breakpoint region 1Ewing sarcoma breakpoint region 1 0.2571105350.257110535 AB023154AB023154 DTX4DTX4 Deltex 4 homolog (Drosophila)Deltex 4 homolog (Drosophila) 0.2676214750.267621475 AL543755AL543755 VAV3VAV3 Vav 3 oncogeneVav 3 oncogene 0.2992640240.299264024 M75106M75106 CPB2CPB2 Carboxypeptidase B2 (plasma, carboxypeptidase U)Carboxypeptidase B2 (plasma, carboxypeptidase U) 0.3130496860.313049686 NM_021045NM_021045 ZNF248ZNF248 Zinc finger protein 248Zinc finger protein 248 0.3201409970.320140997 AB209194AB209194 B4GALT6B4GALT6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6UDP-Gal: betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 0.3206856310.320685631 AF279145AF279145 ANTXR1ANTXR1 Anthrax toxin receptor 1Anthrax toxin receptor 1 0.398576740.39857674 NM_025074NM_025074 FRAS1FRAS1 Fraser syndrome 1Fraser syndrome 1 0.4817641060.481764106 (o) 전달 (Transport) (o) Transport AK025790AK025790 KIF20AKIF20A Kinesin family member 20AKinesin family member 20A 0.149867150.14986715 NM_006152NM_006152 LRMPLRMP Lymphoid-restricted membrane proteinLymphoid-restricted membrane protein 0.1569758930.156975893 NM_000340NM_000340 SLC2A2SLC2A2 Solute carrier family 2 (facilitated glucose transporter), member 2Solute carrier family 2 (facilitated glucose transporter), member 2 0.1996997240.199699724 AF071592AF071592 KIF4AKIF4A Kinesin family member 4AKinesin family member 4A 0.2124263810.212426381 NM_013277NM_013277 RACGAP1RACGAP1 Rac GTPase activating protein 1Rac GTPase activating protein 1 0.2195961710.219596171 AY043484AY043484 SCN1ASCN1A Sodium channel, voltage-gated, type I, alphaSodium channel, voltage-gated, type I, alpha 0.222199690.22219969 AY791349AY791349 KIF18AKIF18A Kinesin family member 18AKinesin family member 18A 0.2254547940.225454794 NM_018018NM_018018 SLC38A4SLC38A4 Solute carrier family 38, member 4Solute carrier family 38, member 4 0.2367117750.236711775 AK094603AK094603 FLJ37284 fisFLJ37284 fis unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. 0.2800977430.280097743 NM_021069NM_021069 ARGBP2ARGBP2 Sorbin and SH3 domain containing 2Sorbin and SH3 domain containing 2 0.2881753560.288175356 NM_001005747NM_001005747 CACNB4CACNB4 Calcium channel, voltage-dependent, beta 4 subunitCalcium channel, voltage-dependent, beta 4 subunit 0.3060402280.306040228 AJ496568AJ496568 SLC25A12SLC25A12 Solute carrier family 25 (mitochondrial carrier, Aralar), member 12Solute carrier family 25 (mitochondrial carrier, Aralar), member 12 0.3100818640.310081864 NM_030641NM_030641 APOL6APOL6 Apolipoprotein L, 6Apolipoprotein L, 6 0.3203659340.320365934 NM_173512NM_173512 FLJ39822FLJ39822 Hypothetical protein FLJ39822Hypothetical protein FLJ39822 0.322377740.32237774 NM_000037NM_000037 ANK1ANK1 Ankyrin 1, erythrocyticAnkyrin 1, erythrocytic 0.3297958370.329795837 NM_001011554NM_001011554 SLC13A3SLC13A3 Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 0.4359443860.435944386 (p) 기타 (The others)(p) The others AB091343AB091343 C10orf3C10orf3 Centrosomal protein 55kDaCentrosomal protein 55kDa 0.4281719820.428171982 AK000643AK000643 ASB9ASB9 Ankyrin repeat and SOCS box-containing 9Ankyrin repeat and SOCS box-containing 9 0.2604783980.260478398 AK055221AK055221 FBXO5FBXO5 F-box protein 5F-box protein 5 0.4335806070.433580607 AK075271AK075271 SPTLC2LSPTLC2L Serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)Serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2) 0.3213659410.321365941 AK122685AK122685 GLUD1GLUD1 Glutamate dehydrogenase 1Glutamate dehydrogenase 1 0.4136652120.413665212 AK127098AK127098 FLJ10706FLJ10706 Chromosome 1 open reading frame 112Chromosome 1 open reading frame 112 0.3940858770.394085877 AL133031AL133031 MLR1MLR1 Transcription factor MLR1Transcription factor MLR1 0.3237107640.323710764 AY007723AY007723 MAL2MAL2 Mal, T-cell differentiation protein 2Mal, T-cell differentiation protein 2 0.4475517820.447551782 BC022255BC022255 Spc25Spc25 Spindle pole body component 25 homolog (S. cerevisiae)Spindle pole body component 25 homolog (S. cerevisiae) 0.3993641680.399364168 BC041882BC041882 ATF7IP2ATF7IP2 Activating transcription factor 7 interacting protein 2Activating transcription factor 7 interacting protein 2 0.3987578950.398757895 BC052951BC052951 LMNB1LMNB1 Lamin B1Lamin b1 0.2860102430.286010243 BC098313BC098313 FLJ20641FLJ20641 Hypothetical protein FLJ20641Hypothetical protein FLJ20641 0.3523774850.352377485 NM_001809NM_001809 CENPACENPA Centromere protein A, 17kDaCentromere protein A, 17kDa 0.3164480380.316448038 NM_145061NM_145061 C13orf3C13orf3 Chromosome 13 open reading frame 3Chromosome 13 open reading frame 3 0.2820964530.282096453 XM_372695XM_372695 LOC390859LOC390859 PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase (LOC390859), mRNAPREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase (LOC390859), mRNA 0.4612166560.461216656

<< 실시예Example 3> 실시간  3> Real time RTRT -PCR(-PCR ( RealReal -- timetime reversereverse transcriptasetranscriptase polymerasepolymerase chainreaction) 정량 chainreaction)

페난트렌에 의해 발현 유도된 상기 실시예 2의 2배 이상 과발현 및 저발현된 유전자 중 페난트렌에 의해 과발현되는 유전자 19종과 저발현 되는 유전자 9종을 선별하였다. 이들 유전자들은 유전자 등록번호(GeneBank accession No.) BM913048(TIMP metallopeptidase inhibitor 1), 유전자 등록번호(GeneBank accession No.) BX649164(serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(GeneBank accession No.) NM_004864(Growth differentiation factor 15), 유전자 등록번호(GeneBank accession No.) NM_000499(Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) AK095363(Aquaporin 3), 유전자 등록번호(GeneBank accession No.) NM_001013632(Similar to hypothetical protein 4833401D15), 유전자 등록번호(GeneBank accession No.) BC042390(Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(GeneBank accession No.) BQ683841(S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(GeneBank accession No.) NM_003897(Immediate early response 3), 유전자 등록번호(GeneBank accession No.) BM926478(Retinol binding protein 1, cellular), 유전자 등록번호(GeneBank accession No.) BU945318(metallothionein 2A), 유전자 등록번호(GeneBank accession No.) AK094474(Ras homolog gene family, member C), 유전자 등록번호(GeneBank accession No.) Y11307(Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(GeneBank accession No.) AY247738(Tribbles homolog 3(Drosophila)), 유전자 등록번호(GeneBank accession No.) Z25424(MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) NM_001769(CD9 antigen(p24)), 유전자 등록번호(GeneBank accession No.) Y12692(Wingless-type MMTV integration site family, member 11), 유전자 등록번호(GeneBank accession No.) X02812(Transforming growth factor, beta 1(Camurati-Engelmann disease)), 유전자 등록번호(GeneBank accession No.) NM_000596(Insulin-like growth factor binding protein 1), 유전자 등록번호(GeneBank accession No.) NM_006101(Kinetochore associated 2), 유전자 등록번호(GeneBank accession No.) NM_003318(TTK protein kinase), 유전자 등록번호(GeneBank accession No.) NM_001067(Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(GeneBank accession No.) NM_018492(PDZ binding kinase), 유전자 등록번호(GeneBank accession No.) U65410(MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AK074377(Chromosome 19 open reading frame 31), 유전자 등록번호(GeneBank accession No.) CR600021(High-mobility group box 2), 유전자 등록번호(GeneBank accession No.) BC022255(Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AB091343(Centrosomal protein 55kDa) 이다.Of the genes overexpressed and underexpressed more than twice as in Example 2 induced by phenanthrene, 19 genes overexpressed by phenanthrene and 9 genes underexpressed were selected. These genes include the GeneBank accession No. BM913048 (TIMP metallopeptidase inhibitor 1), the GeneBank accession No. BX649164 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1) , GeneBank accession No. NM_004864 (Growth differentiation factor 15), GeneBank accession No. NM_000499 (Cytochrome P450, family 1, subfamily A, polypeptide 1), GeneBank accession No. ) AK095363 (Aquaporin 3), GeneBank accession No. NM_001013632 (Similar to hypothetical protein 4833401D15), GeneBank accession No. BC042390 (Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)) , GeneBank accession No. BQ683841 (S100 calcium binding protein A11 (calgizzarin)), GeneBank accession No. NM_003897 (Immediate early response 3), GeneBank acce ssion No.) BM926478 (Retinol binding protein 1, cellular), GeneBank accession No. BU945318 (metallothionein 2A), GeneBank accession No. AK094474 (Ras homolog gene family, member C), gene GeneBank accession No. Y11307 (Cysteine-rich, angiogenic inducer, 61), GeneBank accession No. AY247738 (Tribbles homolog 3 (Drosophila)), GeneBank accession No. Z25424 (GeneBank accession No.) MAP kinase interacting serine / threonine kinase 2), GeneBank accession No. NM_001769 (CD9 antigen (p24)), GeneBank accession No. Y12692 (Wingless-type MMTV integration site family, member 11) , GeneBank accession No. X02812 (Transforming growth factor, beta 1 (Camurati-Engelmann disease)), GeneBank accession No. NM_000596 (Insulin-like growth factor binding protein 1), Gene accession number (GeneBank accession No.) NM_006101 (Kinetochore associa ted 2), GeneBank accession No. NM_003318 (TTK protein kinase), GeneBank accession No. NM_001067 (Topoisomerase (DNA) II alpha 170kDa), GeneBank accession No. NM_018492 (PDZ binding kinase), GeneBank accession No. U65410 (MAD2 mitotic arrest deficient-like 1 (yeast)), GeneBank accession No. AK074377 (Chromosome 19 open reading frame 31), Gene registration Number (GeneBank accession No.) CR600021 (High-mobility group box 2), Gene accession number (GeneBank accession No.) BC022255 (Spindle pole body component 25 homolog (S. cerevisiae)), GeneBank accession No. AB091343 (Centrosomal protein 55 kDa).

상기 유전자들의 발현변화 정도를 조사 및 정량하기 위해 My IQ 실시간 PCR(My IQ Real-time PCR)(Bio-rad, USA)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다.Quantitative real-time RT-PCR was performed using My IQ Real-time PCR (Bio-rad, USA) to investigate and quantify the expression changes of the genes.

구체적으로, 올리고 dT 프라이머와 Superscript kit(OmnisciptTM kit, Qiagen, Co., USA)를 이용하여 역전사반응을 수행하여 cDNA를 합성하였다. PCR 산물을 정량하기 위하여 사이버그린(SYBR Green) I 염색(Bio-rad, USA)으로 염색하였다. 사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, PCR 과정 동안 이중나선 DNA가 생성될수록 형광강도(fluroscense intensity)가 증가하게 된다. 먼저 PCR에 이용한 표적 유전자와 내재성(endogenous) 대조군(GAPDH)에 대한 프라이머를 사이버그린 마스터 믹스(Master mix)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 합성된 cDNA 시료와 각각의 프라이머(표 4)를 혼합하고, 사이버그린 마스터 믹스를 첨가한 후 PCR를 수행하였고, 정량 소프트웨어(software)를 사용하여 분석하였다(표 5 참조).Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a Superscript kit (Omniscipt kit, Qiagen, Co., USA). To quantify the PCR products were stained with SYBR Green I stain (Bio-rad, USA). Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, primers for the target gene and endogenous control (GAPDH) used for PCR were added to the Cyberrin master mix, followed by PCR, followed by a primer optimization process to select an appropriate concentration. Was performed. Synthesized cDNA samples and each primer (Table 4) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (see Table 5).

프라이머primer 서열 order 등록번호Registration Number 유전자명Gene name PCR 프라이머 서열PCR primer sequence BM913048 BM913048 TIMPmetallopeptidaseinhibitor1  TIMPmetallopeptidaseinhibitor1 센스 (서열번호1)Sense (SEQ ID NO: 1) GATACTTCCACAGGTCCCACAACGATACTTCCACAGGTCCCACAAC 안티센스 (서열번호2)Antisense (SEQ ID NO: 2) GCAAGAGTCCATCCTGCAGTTGCAAGAGTCCATCCTGCAGTT BX649164 BX649164 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 센스 (서열번호3)Sense (SEQ ID NO: 3) CAGACCAAGAGCCTCTCCACCAGACCAAGAGCCTCTCCAC 안티센스 (서열번호4)Antisense (SEQ ID NO: 4) ATCACTTGGCCCATGAAAAGATCACTTGGCCCATGAAAAG NM_004864 NM_004864 Growth differentiation factor 15 Growth differentiation factor 15 센스 (서열번호5)Sense (SEQ ID NO: 5) CCTGAGACACCCGATTCCTCCTGAGACACCCGATTCCT 안티센스 (서열번호6)Antisense (SEQ ID NO: 6) ACAGTTCCATCAGACCAGCCACAGTTCCATCAGACCAGCC NM_000499NM_000499 Cytochrome P450, family 1, subfamily A, polypeptide 1 Cytochrome P450, family 1, subfamily A, polypeptide 1 센스 (서열번호7)Sense (SEQ ID NO: 7) CACCATCCCCCACAGCACCACCATCCCCCACAGCAC 안티센스 (서열번호8)Antisense (SEQ ID NO: 8) ACAAAGACACAACGCCCCTTACAAAGACACAACGCCCCTT AK095363 AK095363 Aquaporin 3 Aquaporin 3 센스 (서열번호9)Sense (SEQ ID NO: 9) TTCACGATCCACCCTTTCAGGCTA TTCACGATCCACCCTTTCAGGCTA 안티센스 (서열번호10)Antisense (SEQ ID NO: 10) ACACATACCTGCTGCCCATTCTCT ACACATACCTGCTGCCCATTCTCT NM_001013632 NM_001013632 polo-like kinase 3 (Drosophila) polo-like kinase 3 (Drosophila) 센스 (서열번호11)Sense (SEQ ID NO: 11) GACTACTCCAATAAGTTCGGCTTTGGACTACTCCAATAAGTTCGGCTTTG 안티센스 (서열번호12)Antisense (SEQ ID NO: 12) CATATGTGTGCCATCGTTGAAGACATATGTGTGCCATCGTTGAAGA BC042390 BC042390 Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) 센스 (서열번호13)Sense (SEQ ID NO: 13) GGGGGACTAACCTATCGAGAA GGGGGACTAACCTATCGAGAA 안티센스 (서열번호14)Antisense (SEQ ID NO: 14) GATCCAGTGCTGATAGCAACC GATCCAGTGCTGATAGCAACC BQ683841 BQ683841 S100 calcium binding protein A11 (calgizzarin) S100 calcium binding protein A11 (calgizzarin) 센스 (서열번호15)Sense (SEQ ID NO: 15) AGTCCCTGATTGCTGTCTTCCAGA AGTCCCTGATTGCTGTCTTCCAGA 안티센스 (서열번호16)Antisense (SEQ ID NO: 16) ACCAGGGTCCTTCTGGTTCTTTGT ACCAGGGTCCTTCTGGTTCTTTGT NM_003897 NM_003897 Immediate early response 3 Immediate early response 3 센스 (서열번호17)Sense (SEQ ID NO: 17) AGCCCTTTAATCTGACTTCGGAGCAGCCCTTTAATCTGACTTCGGAGC 안티센스 (서열번호18)Antisense (SEQ ID NO: 18) CAGGTACGCCTGGTGTTTCTTTGTCAGGTACGCCTGGTGTTTCTTTGT BM926478 BM926478 Retinol binding protein 1, cellular Retinol binding protein 1, cellular 센스 (서열번호19)Sense (SEQ ID NO: 19) AGGCATAGATGACCGCAAGT AGGCATAGATGACCGCAAGT 안티센스 (서열번호20)Antisense (SEQ ID NO: 20) ACCCTTCTGCACACACTGG ACCCTTCTGCACACACTGG BU945318 BU945318 metallothionein 2A metallothionein 2A 센스 (서열번호21)Sense (SEQ ID NO: 21) CTCTAGCCGCCTCTTCAGCCTCTAGCCGCCTCTTCAGC 안티센스 (서열번호22)Antisense (SEQ ID NO: 22) ACTCTTTGCATTTGCAGGAACACTCTTTGCATTTGCAGGAAC AK094474 AK094474 Ras homolog gene family, member C Ras homolog gene family, member C 센스 (서열번호23)Sense (SEQ ID NO: 23) ACCTGCCTCCTCATCGTCTTCACCTGCCTCCTCATCGTCTTC 안티센스 (서열번호24)Antisense (SEQ ID NO: 24) CACCTGCTTGCCGTCCACCACCTGCTTGCCGTCCAC Y11307 Y11307 Cysteine-rich, angiogenic inducer, 61 Cysteine-rich, angiogenic inducer, 61 센스 (서열번호25)Sense (SEQ ID NO: 25) ATTGTAGAAAGGAAGCCTTGCTCATATTGTAGAAAGGAAGCCTTGCTCAT 안티센스 (서열번호26)Antisense (SEQ ID NO: 26) TCCAATCGTGGCTGCATTAGTCCAATCGTGGCTGCATTAG AY247738 AY247738 Tribbles homolog 3 (Drosophila) Tribbles homolog 3 (Drosophila) 센스 (서열번호27)Sense (SEQ ID NO: 27) GTCTTCGCTGACCGTGAGAGTCTTCGCTGACCGTGAGA 안티센스 (서열번호28)Antisense (SEQ ID NO: 28) CAGTCAGCACGCAGGAGTCCAGTCAGCACGCAGGAGTC NM_017572 NM_017572 MAP kinase interacting serine/threonine kinase 2 MAP kinase interacting serine / threonine kinase 2 센스 (서열번호29)Sense (SEQ ID NO: 29) CCATGGTCCTGCAGAGGT  CCATGGTCCTGCAGAGGT 안티센스 (서열번호30)Antisense (SEQ ID NO: 30) TTCTGACCAGTCCTCCAGGT TTCTGACCAGTCCTCCAGGT NM_001769 NM_001769 CD9 antigen (p24) CD9 antigen (p24) 센스 (서열번호31)Sense (SEQ ID NO: 31) GCACCAAGTGCATCAAATACCTGCGCACCAAGTGCATCAAATACCTGC 안티센스 (서열번호32)Antisense (SEQ ID NO: 32) AGCCATAGTCCAATGGCAAGGACA AGCCATAGTCCAATGGCAAGGACA Y12692 Y12692 Wingless-type MMTV integration site family, member 11 Wingless-type MMTV integration site family, member 11 센스 (서열번호33)Sense (SEQ ID NO: 33) TTCACTTGGAAGCCACCAGGAACATTCACTTGGAAGCCACCAGGAACA 안티센스 (서열번호34)Antisense (SEQ ID NO: 34) TGGCCCTGAAAGGTCAAGTCTGTA TGGCCCTGAAAGGTCAAGTCTGTA X02812 X02812 Transforming growth factor, beta 1 (Camurati-Engelmann disease) Transforming growth factor, beta 1 (Camurati-Engelmann disease) 센스 (서열번호35)Sense (SEQ ID NO: 35) GCAGCACGTGGAGCTGTAGCAGCACGTGGAGCTGTA 안티센스 (서열번호36)Antisense (SEQ ID NO: 36) CAGCCGGTTGCTGAGGTA CAGCCGGTTGCTGAGGTA NM_000596 NM_000596 Insulin-like growth factor binding protein 1 Insulin-like growth factor binding protein 1 센스 (서열번호37)Sense (SEQ ID NO: 37) ATCATTCCATCCTTTGGGACGCCAATCATTCCATCCTTTGGGACGCCA 안티센스 (서열번호38)Antisense (SEQ ID NO: 38) TGTCTCCTGTGCCTTGGCTAAACTTGTCTCCTGTGCCTTGGCTAAACT NM_006101 NM_006101 Kinetochore associated 2 Kinetochore associated 2 센스 (서열번호39)Sense (SEQ ID NO: 39) TGCTACACATGTTGGGTCTGTATGCTACACATGTTGGGTCTGTA 안티센스 (서열번호40)Antisense (SEQ ID NO: 40) CCGAGAGATCTTCTGACATGCCCGAGAGATCTTCTGACATGC NM_003318 NM_003318 TTK protein kinase TTK protein kinase 센스 (서열번호41)Sense (SEQ ID NO: 41) TCATGCCCATTTGGAAGAGTCCCATCATGCCCATTTGGAAGAGTCCCA 안티센스 (서열번호42)Antisense (SEQ ID NO: 42) AGGCACAACCAAATCTCGGCATTC AGGCACAACCAAATCTCGGCATTC NM_001067 NM_001067 Topoisomerase (DNA) II alpha 170kDa Topoisomerase (DNA) II alpha 170kDa 센스 (서열번호43)Sense (SEQ ID NO: 43) CTAGTTAATGCTGCGGACAACACTAGTTAATGCTGCGGACAACA 안티센스 (서열번호44)Antisense (SEQ ID NO: 44) CATTTCGACCACCTGTCACTTCATTTCGACCACCTGTCACTT NM_018492 NM_018492 PDZ binding kinase PDZ binding kinase 센스 (서열번호45)Sense (SEQ ID NO: 45) TCTGGACTGAGAGTGGCTTTCACATCTGGACTGAGAGTGGCTTTCACA 안티센스 (서열번호46)Antisense (SEQ ID NO: 46) AGCCAAGCTTCTGCATAAACGGAGAGCCAAGCTTCTGCATAAACGGAG U65410 U65410 MAD2 mitotic arrest deficient-like 1 (yeast) MAD2 mitotic arrest deficient-like 1 (yeast) 센스 (서열번호47)Sense (SEQ ID NO: 47) ACTTAAATATCTCCCTACCTATACTGAGTCAAACTTAAATATCTCCCTACCTATACTGAGTCAA 안티센스 (서열번호48)Antisense (SEQ ID NO: 48) TAGTAACTGTAGATGGAAAAACTTGTGCTATAGTAACTGTAGATGGAAAAACTTGTGCTA AK074377 AK074377 Chromosome 19 open reading frame 31 Chromosome 19 open reading frame 31 센스 (서열번호49)Sense (SEQ ID NO: 49) CTGGTACGACGCGGAGATCTGGTACGACGCGGAGAT 안티센스 (서열번호50)Antisense (SEQ ID NO: 50) CGACAGTCGTTCAGAGAATCACGACAGTCGTTCAGAGAATCA CR600021 CR600021 High-mobility group box 2 High-mobility group box 2 센스 (서열번호51)Sense (SEQ ID NO: 51) CTTGGCACGATATGCAGCAACTTGGCACGATATGCAGCAA 안티센스 (서열번호52)Antisense (SEQ ID NO: 52) CAGCCAAAGATAAACAACCATATGACAGCCAAAGATAAACAACCATATGA BC022255 BC022255 Spindle pole body component 25 homolog (S. cerevisiae) Spindle pole body component 25 homolog (S. cerevisiae) 센스 (서열번호53)Sense (SEQ ID NO: 53) GAATGGTTGAGATGTTTCTGGAGAATGGTTGAGATGTTTCTGGA 안티센스 (서열번호54)Antisense (SEQ ID NO: 54) GCAATCAATTTTAACAAGTTATCCTTTGCAATCAATTTTAACAAGTTATCCTTT AB091343 AB091343 Centrosomal protein 55kDa Centrosomal protein 55kDa 센스 (서열번호55)Sense (SEQ ID NO: 55) GCTGTGCATTTCTCTTGGCAGTGAGCTGTGCATTTCTCTTGGCAGTGA 안티센스 (서열번호56)Antisense (SEQ ID NO: 56) TAGACGCTGCTCACCACATTCTGT TAGACGCTGCTCACCACATTCTGT

실시간 정량 Real time quantification PCRPCR 결과 result 등록번호Registration Number 유전자명Gene name 약어Abbreviation 마이크로어레이Microarray (Cy3/Cy5 비율)  (Cy3 / Cy5 ratio) 실시간 real time PCRPCR (상대적 배율) (Relative magnification) 과발현 유전자 Overexpression genes BM913048BM913048 TIMP metallopeptidase inhibitor 1TIMP metallopeptidase inhibitor 1 TIMP1TIMP1 12.63 12.63 12.67 12.67 BX649164BX649164 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PAIPAI 12.38 12.38 15.17 15.17 NM_004864NM_004864 Growth differentiation factor 15Growth differentiation factor 15 GDF15GDF15 8.03 8.03 52.89 52.89 NM_000499NM_000499 Cytochrome P450, family 1, subfamily A, polypeptide 1Cytochrome P450, family 1, subfamily A, polypeptide 1 CYP1A1CYP1A1 7.80 7.80 12.67 12.67 AK095363AK095363 Aquaporin 3Aquaporin 3 AQP3AQP3 7.09 7.09 9.06 9.06 NM_001013632NM_001013632 Similar to hypothetical protein 4833401D15Similar to hypothetical protein 4833401D15 LOC343521LOC343521 6.27 6.27 6.68 6.68 BC042390BC042390 Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)Vesicle transport through interaction with t-SNAREs homolog 1B (yeast) VTI1BVTI1B 5.40 5.40 8.06 8.06 BQ683841BQ683841 S100 calcium binding protein A11 (calgizzarin)S100 calcium binding protein A11 (calgizzarin) S100A11S100A11 5.14 5.14 8.53 8.53 NM_003897NM_003897 Immediate early response 3Immediate early response 3 IER3IER3 4.95 4.95 4.71 4.71 BM926478BM926478 Retinol binding protein 1, cellularRetinol binding protein 1, cellular RBP1RBP1 4.26 4.26 5.24 5.24 BU945318BU945318 metallothionein 2Ametallothionein 2A MT2AMT2A 4.12 4.12 4.28 4.28 AK094474AK094474 Ras homolog gene family, member CRas homolog gene family, member C RHOCRHOC 3.59 3.59 1.53 1.53 Y11307Y11307 Cysteine-rich, angiogenic inducer, 61Cysteine-rich, angiogenic inducer, 61 CYR61CYR61 3.51 3.51 5.23 5.23 AY247738AY247738 Tribbles homolog 3 (Drosophila)Tribbles homolog 3 (Drosophila) TRIB3TRIB3 3.43 3.43 1.85 1.85 Z25424Z25424 MAP kinase interacting serine/threonine kinase 2MAP kinase interacting serine / threonine kinase 2 MKNK2MKNK2 3.41 3.41 4.66 4.66 NM_001769NM_001769 CD9 antigen (p24)CD9 antigen (p24) CD9CD9 3.10 3.10 4.52 4.52 Y12692Y12692 Wingless-type MMTV integration site family, member 11Wingless-type MMTV integration site family, member 11 WNT11WNT11 3.08 3.08 4.00 4.00 X02812X02812 Transforming growth factor, beta 1 (Camurati-Engelmann disease)Transforming growth factor, beta 1 (Camurati-Engelmann disease) TGFB1TGFB1 2.55 2.55 4.46 4.46 NM_000596NM_000596 Insulin-like growth factor binding protein 1Insulin-like growth factor binding protein 1 IGFBP1IGFBP1 2.54 2.54 2.56 2.56 저발현 유전자Low expression genes NM_006101NM_006101 Kinetochore associated 2Kinetochore associated 2 KNTC2KNTC2 0.18 0.18 0.17 0.17 NM_003318NM_003318 TTK protein kinaseTTK protein kinase TTKTTK 0.22 0.22 0.27 0.27 NM_001067NM_001067 Topoisomerase (DNA) II alpha 170kDaTopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.22 0.22 0.29 0.29 NM_018492NM_018492 PDZ binding kinasePDZ binding kinase PBKPBK 0.25 0.25 0.23 0.23 U65410U65410 MAD2 mitotic arrest deficient-like 1 (yeast)MAD2 mitotic arrest deficient-like 1 (yeast) MAD2L1MAD2L1 0.29 0.29 0.29 0.29 AK074377AK074377 Chromosome 19 open reading frame 31Chromosome 19 open reading frame 31 UHRF1UHRF1 0.37 0.37 0.57 0.57 CR600021CR600021 High-mobility group box 2High-mobility group box 2 HMGB2HMGB2 0.40 0.40 0.35 0.35 BC022255BC022255 Spindle pole body component 25 homolog (S. cerevisiae)Spindle pole body component 25 homolog (S. cerevisiae) Spc25Spc25 0.40 0.40 0.27 0.27 AB091343AB091343 Centrosomal protein 55kDaCentrosomal protein 55kDa C10orf3C10orf3 0.43 0.43 0.52 0.52

그 결과, 19종의 과발현 유전자들 및 9종의 저발현 유전자의 유전자 발현 양상은 페난트렌에 의한 유전자 발현을 조사한 올리고 마이크로어레이 결과와 매우 유사하게 나타남을 확인하였다.As a result, it was confirmed that the gene expression patterns of 19 overexpression genes and 9 low expression genes were very similar to oligo microarray results of gene expression by phenanthrene.

도 1은 페난트렌(phenanthrene)의 인간 간암 세포주에서의 세포 독성을 조사한 그래프이다.1 is a graph illustrating the cytotoxicity of phenanthrene in human liver cancer cell lines.

도 2는 마이크로어레이 칩을 이용한 페난트렌을 처리한 인간 간암 세포주의 유전자 발현 양상을 분석한 결과를 나타내는 그림이다.Figure 2 is a diagram showing the results of analyzing the gene expression pattern of human liver cancer cell line treated with phenanthrene using a microarray chip.

<110> Korea Institute of Science and Technology <120> Biomarkers for identification of exposure to phenanthrene and the method of identification using the same <130> 8p-07-49 <160> 56 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer of TIMPmetallopeptidasein hibitor1 <400> 1 gatacttcca caggtcccac aac 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of TIMPmetallopeptidasein hibitor1 <400> 2 gcaagagtcc atcctgcagt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1 <400> 3 cagaccaaga gcctctccac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1 <400> 4 atcacttggc ccatgaaaag 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Growth differentiation factor 15 <400> 5 cctgagacac ccgattcct 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Growth differentiation factor 15 <400> 6 acagttccat cagaccagcc 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Cytochrome P450, family 1, subfamily A, polypeptide 1 <400> 7 caccatcccc cacagcac 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Cytochrome P450, family 1, subfamily A, polypeptide 1 <400> 8 acaaagacac aacgcccctt 20 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Aquaporin 3 <400> 9 ttcacgatcc accctttcag gcta 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Aquaporin 3 <400> 10 acacatacct gctgcccatt ctct 24 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sense primer of polo-like kinase 3(Drosophila) <400> 11 gactactcca ataagttcgg ctttg 25 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of polo-like kinase 3(Drosophila) <400> 12 catatgtgtg ccatcgttga aga 23 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Vesicle transport through interaction with t-SNAREs homolog 1B(yeast) <400> 13 gggggactaa cctatcgaga a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Vesicle transport through interaction with t-SNAREs homolog 1B(yeast) <400> 14 gatccagtgc tgatagcaac c 21 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of S100 calcium binding protein A11(calgizzarin) <400> 15 agtccctgat tgctgtcttc caga 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of S100 calcium binding protein A11(calgizzarin) <400> 16 accagggtcc ttctggttct ttgt 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Immediate early response 3 <400> 17 agccctttaa tctgacttcg gagc 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Immediate early response 3 <400> 18 caggtacgcc tggtgtttct ttgt 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Retinol binding protein 1, cellular <400> 19 aggcatagat gaccgcaagt 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Retinol binding protein 1, cellular <400> 20 acccttctgc acacactgg 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of metallothionein 2A <400> 21 ctctagccgc ctcttcagc 19 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of metallothionein 2A <400> 22 actctttgca tttgcaggaa c 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Ras homolog gene family, member C <400> 23 acctgcctcc tcatcgtctt c 21 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Ras homolog gene family, member C <400> 24 cacctgcttg ccgtccac 18 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Cysteine-rich, angiogenic inducer, 61 <400> 25 attgtagaaa ggaagccttg ctcat 25 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Cysteine-rich, angiogenic inducer, 61 <400> 26 tccaatcgtg gctgcattag 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Tribbles homolog 3(Drosophila) <400> 27 gtcttcgctg accgtgaga 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Tribbles homolog 3(Drosophila) <400> 28 cagtcagcac gcaggagtc 19 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MAP kinase interacting serine/threonine kinase 2 <400> 29 ccatggtcct gcagaggt 18 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MAP kinase interacting serine/threonine kinase 2 <400> 30 ttctgaccag tcctccaggt 20 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of CD9 antigen(p24) <400> 31 gcaccaagtg catcaaatac ctgc 24 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of CD9 antigen(p24) <400> 32 agccatagtc caatggcaag gaca 24 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Wingless-type MMTV integration site family, member 11 <400> 33 ttcacttgga agccaccagg aaca 24 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Wingless-type MMTV integration site family, member 11 <400> 34 tggccctgaa aggtcaagtc tgta 24 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Transforming growth factor, beta 1(Camurati-Engelmann disease) <400> 35 gcagcacgtg gagctgta 18 <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Transforming growth factor, beta 1(Camurati-Engelmann disease) <400> 36 cagccggttg ctgaggta 18 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Insulin-like growth factor binding protein 1 <400> 37 atcattccat cctttgggac gcca 24 <210> 38 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Insulin-like growth factor binding protein 1 <400> 38 tgtctcctgt gccttggcta aact 24 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Kinetochore associated 2 <400> 39 tgctacacat gttgggtctg ta 22 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Kinetochore associated 2 <400> 40 ccgagagatc ttctgacatg c 21 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of TTK protein kinase <400> 41 tcatgcccat ttggaagagt ccca 24 <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of TTK protein kinase <400> 42 aggcacaacc aaatctcggc attc 24 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Topoisomerase(DNA) II alpha 170kDa <400> 43 ctagttaatg ctgcggacaa ca 22 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Topoisomerase(DNA) II alpha 170kDa <400> 44 catttcgacc acctgtcact t 21 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of PDZ binding kinase <400> 45 tctggactga gagtggcttt caca 24 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of PDZ binding kinase <400> 46 agccaagctt ctgcataaac ggag 24 <210> 47 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MAD2 mitotic arrest deficient-like 1(yeast) <400> 47 acttaaatat ctccctacct atactgagtc aa 32 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MAD2 mitotic arrest deficient-like 1(yeast) <400> 48 tagtaactgt agatggaaaa acttgtgcta 30 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Chromosome 19 open reading frame 31 <400> 49 ctggtacgac gcggagat 18 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Chromosome 19 open reading frame 31 <400> 50 cgacagtcgt tcagagaatc a 21 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of High-mobility group box 2 <400> 51 cttggcacga tatgcagcaa 20 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of High-mobility group box 2 <400> 52 cagccaaaga taaacaacca tatga 25 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Spindle pole body component 25 homolog(S. cerevisiae) <400> 53 gaatggttga gatgtttctg ga 22 <210> 54 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Spindle pole body component 25 homolog(S. cerevisiae) <400> 54 gcaatcaatt ttaacaagtt atccttt 27 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Centrosomal protein 55kDa <400> 55 gctgtgcatt tctcttggca gtga 24 <210> 56 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Centrosomal protein 55kDa <400> 56 tagacgctgc tcaccacatt ctgt 24 <110> Korea Institute of Science and Technology <120> Biomarkers for identification of exposure to phenanthrene and the          method of identification using the same <130> 8p-07-49 <160> 56 <170> KopatentIn 1.71 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> sense primer of TIMPmetallopeptidasein hibitor1 <400> 1 gatacttcca caggtcccac aac 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of TIMPmetallopeptidasein hibitor1 <400> 2 gcaagagtcc atcctgcagt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of serpin peptidase inhibitor, clade E (nexin,          plasminogen activator inhibitor type 1), member 1 <400> 3 cagaccaaga gcctctccac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of serpin peptidase inhibitor, clade E (nexin,          plasminogen activator inhibitor type 1), member 1 <400> 4 atcacttggc ccatgaaaag 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Growth differentiation factor 15 <400> 5 cctgagacac ccgattcct 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Growth differentiation factor 15 <400> 6 acagttccat cagaccagcc 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Cytochrome P450, family 1, subfamily A,          polypeptide 1 <400> 7 caccatcccc cacagcac 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Cytochrome P450, family 1, subfamily A,          polypeptide 1 <400> 8 acaaagacac aacgcccctt 20 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Aquaporin 3 <400> 9 ttcacgatcc accctttcag gcta 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Aquaporin 3 <400> 10 acacatacct gctgcccatt ctct 24 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sense primer of polo-like kinase 3 (Drosophila) <400> 11 gactactcca ataagttcgg ctttg 25 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of polo-like kinase 3 (Drosophila) <400> 12 catatgtgtg ccatcgttga aga 23 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Vesicle transport through interaction with          t-SNAREs homolog 1B (yeast) <400> 13 gggggactaa cctatcgaga a 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Vesicle transport through interaction with          t-SNAREs homolog 1B (yeast) <400> 14 gatccagtgc tgatagcaac c 21 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of S100 calcium binding protein A11 (calgizzarin) <400> 15 agtccctgat tgctgtcttc caga 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of S100 calcium binding protein A11 (calgizzarin) <400> 16 accagggtcc ttctggttct ttgt 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Immediate early response 3 <400> 17 agccctttaa tctgacttcg gagc 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Immediate early response 3 <400> 18 caggtacgcc tggtgtttct ttgt 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Retinol binding protein 1, cellular <400> 19 aggcatagat gaccgcaagt 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Retinol binding protein 1, cellular <400> 20 acccttctgc acacactgg 19 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of metallothionein 2A <400> 21 ctctagccgc ctcttcagc 19 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of metallothionein 2A <400> 22 actctttgca tttgcaggaa c 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Ras homolog gene family, member C <400> 23 acctgcctcc tcatcgtctt c 21 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Ras homolog gene family, member C <400> 24 cacctgcttg ccgtccac 18 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Cysteine-rich, angiogenic inducer, 61 <400> 25 attgtagaaa ggaagccttg ctcat 25 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Cysteine-rich, angiogenic inducer, 61 <400> 26 tccaatcgtg gctgcattag 20 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Tribbles homolog 3 (Drosophila) <400> 27 gtcttcgctg accgtgaga 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Tribbles homolog 3 (Drosophila) <400> 28 cagtcagcac gcaggagtc 19 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MAP kinase interacting serine / threonine kinase 2 <400> 29 ccatggtcct gcagaggt 18 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MAP kinase interacting serine / threonine          kinase 2 <400> 30 ttctgaccag tcctccaggt 20 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of CD9 antigen (p24) <400> 31 gcaccaagtg catcaaatac ctgc 24 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of CD9 antigen (p24) <400> 32 agccatagtc caatggcaag gaca 24 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Wingless-type MMTV integration site family,          member 11 <400> 33 ttcacttgga agccaccagg aaca 24 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Wingless-type MMTV integration site family,          member 11 <400> 34 tggccctgaa aggtcaagtc tgta 24 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Transforming growth factor, beta          1 (Camurati-Engelmann disease) <400> 35 gcagcacgtg gagctgta 18 <210> 36 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Transforming growth factor, beta          1 (Camurati-Engelmann disease) <400> 36 cagccggttg ctgaggta 18 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Insulin-like growth factor binding protein 1 <400> 37 atcattccat cctttgggac gcca 24 <210> 38 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Insulin-like growth factor binding protein 1 <400> 38 tgtctcctgt gccttggcta aact 24 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Kinetochore associated 2 <400> 39 tgctacacat gttgggtctg ta 22 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Kinetochore associated 2 <400> 40 ccgagagatc ttctgacatg c 21 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of TTK protein kinase <400> 41 tcatgcccat ttggaagagt ccca 24 <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of TTK protein kinase <400> 42 aggcacaacc aaatctcggc attc 24 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Topoisomerase (DNA) II alpha 170kDa <400> 43 ctagttaatg ctgcggacaa ca 22 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Topoisomerase (DNA) II alpha 170kDa <400> 44 catttcgacc acctgtcact t 21 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of PDZ binding kinase <400> 45 tctggactga gagtggcttt caca 24 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of PDZ binding kinase <400> 46 agccaagctt ctgcataaac ggag 24 <210> 47 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> sense primer of MAD2 mitotic arrest deficient-like 1 (yeast) <400> 47 acttaaatat ctccctacct atactgagtc aa 32 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of MAD2 mitotic arrest deficient-like 1 (yeast) <400> 48 tagtaactgt agatggaaaa acttgtgcta 30 <210> 49 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Chromosome 19 open reading frame 31 <400> 49 ctggtacgac gcggagat 18 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Chromosome 19 open reading frame 31 <400> 50 cgacagtcgt tcagagaatc a 21 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer of High-mobility group box 2 <400> 51 cttggcacga tatgcagcaa 20 <210> 52 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of High-mobility group box 2 <400> 52 cagccaaaga taaacaacca tatga 25 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Spindle pole body component 25 homolog (S.          cerevisiae) <400> 53 gaatggttga gatgtttctg ga 22 <210> 54 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Spindle pole body component 25 homolog (S.          cerevisiae) <400> 54 gcaatcaatt ttaacaagtt atccttt 27 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer of Centrosomal protein 55kDa <400> 55 gctgtgcatt tctcttggca gtga 24 <210> 56 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer of Centrosomal protein 55 kDa <400> 56 tagacgctgc tcaccacatt ctgt 24  

Claims (15)

하기의 군으로부터 선택되는 유전자를 포함하는 페난트렌에 대한 노출 여부 확인용 바이오마커: Biomarker for confirming the exposure to phenanthrene comprising a gene selected from the following groups: 유전자 등록번호(GeneBank accession No.) NM_004420(DUSP8, Dual specificity phosphatase 8), 유전자 등록번호(GeneBank accession No.) L11329(DUSP2, Dual specificity phosphatase 2), 유전자 등록번호(GeneBank accession No.) BC094766(PKN1, Protein kinase N1), 유전자 등록번호(GeneBank accession No.) AY247738(TRIB3, Tribbles homolog 3(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(GeneBank accession No.) AB208849(SHC1, SHC(Src homology 2 domain containing) transforming protein 1), 유전자 등록번호(GeneBank accession No.) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)),유전자 등록번호(GeneBank accession No.) NM_198951(TGM2, Transglutaminase 2(C polypeptide, protein-glutamine-gamma-glutamyltransferase)), 유전자 등록번호(GeneBank accession No.) NM_147780(CTSB, Cathepsin B), 유전자 등록번호(GeneBank accession No.) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(GeneBank accession No.) NM_033027(AXUD1, AXIN1 up-regulated 1), 유전자 등록번호(GeneBank accession No.) NM_032797(AMID, Apoptosis-inducing factor(AIF)-like mitochondrion-associated inducer of death), 유전자 등록번호(GeneBank accession No.) NM_021960(MCL1, Myeloid cell leukemia sequence 1(BCL2-related)), 유전자 등록번호(GeneBank accession No.) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(GeneBank accession No.) NM_016222(DDX41, DEAD(Asp-Glu-Ala-Asp) box polypeptide 41), 유전자 등록번호(GeneBank accession No.) NM_013246(CLC, Cardiotrophin-like cytokine factor 1), 유전자 등록번호(GeneBank accession No.) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004281(BAG3, BCL2-associated athanogene 3), 유전자 등록번호(GeneBank accession No.) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(GeneBank accession No.) NM_003806(HRK, Harakiri, BCL2 interacting protein(contains only BH3 domain)), 유전자 등록번호(GeneBank accession No.) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(GeneBank accession No.) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(GeneBank accession No.) NM_002737(PRKCA, Protein kinase C, alpha), 유전자 등록번호(GeneBank accession No.) NM_002648(PIM1, Pim-1 oncogene), 유전자 등록번호(GeneBank accession No.) NM_002507(NGFR, Nerve growth factor receptor(TNFR superfamily, member 16)), 유전자 등록번호(GeneBank accession No.) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(GeneBank accession No.) NM_001013398(IGFBP3, Insulin-like growth factor binding protein 3), 유전자 등록번호(GeneBank accession No.) BX640923(MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein(mouse)), 유전자 등록번호(GeneBank accession No.) BX537586(STK17A, Serine/threonine kinase 17a(apoptosis-inducing)), 유전자 등록번호(GeneBank accession No.) BG284742(P8, P8 protein(candidate of metastasis 1)), 유전자 등록번호(GeneBank accession No.) BE903247(PDCD6IP, Programmed cell death 6 interacting protein), 유전자 등록번호(GeneBank accession No.) BC027949(P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), 유전자 등록번호(GeneBank accession No.) BC006365(PSEN2, Presenilin 2(Alzheimer disease 4)), 유전자 등록번호(GeneBank accession No.) AY869712(PPP1R13L, Protein phosphatase 1, regulatory(inhibitor) subunit 13 like), 유전자 등록번호(GeneBank accession No.) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(GeneBank accession No.) AK122614(PPARD, Peroxisome proliferative activated receptor, delta), 유전자 등록번호(GeneBank accession No.) AK092872(ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2(xeroderma pigmentosum D)), 유전자 등록번호(GeneBank accession No.) AK092808(RRAGC, Ras-related GTP binding C), 유전자 등록번호(GeneBank accession No.) AJ001898(GDNF, Glial cell derived neurotrophic factor), 유전자 등록번호(GeneBank accession No.) AF220656(PHLDA1, Pleckstrin homology-like domain, family A, member 1), 유전자 등록번호(GeneBank accession No.) AF055634(UNC5C, Unc-5 homolog C(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB209485(VEGF, Vascular endothelial growth factor), 유전자 등록번호(GeneBank accession No.) AB096256(UNC5B, Unc-5 homolog B(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB007960(SH3GLB1, SH3-domain GRB2-like endophilin B1), 유전자 등록번호(GeneBank accession No.) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(GeneBank accession No.) S62138(DDIT3, DNA-damage-inducible transcript 3), 유전자 등록번호(GeneBank accession No.) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(GeneBank accession No.) NM_005883(APC2, Adenomatosis polyposis coli 2), 유전자 등록번호(GeneBank accession No.) NM_004196(CDKL1, Cyclin-dependent kinase-like 1(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_003236(TGFA, Transforming growth factor, alpha), 유전자 등록번호(GeneBank accession No.) NM_001261(CDK9, Cyclin-dependent kinase 9(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(GeneBank accession No.) CR749511(PARC, P53-associated parkin-like cytoplasmic protein), 유전자 등록번 호(GeneBank accession No.) CR623038(ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(GeneBank accession No.) CR618371(EGFR, Epidermal growth factor receptor(erythroblastic leukemia viral(v-erb-b) oncogene homolog, avian)), 유전자 등록번호(GeneBank accession No.) BF965144(IFITM1, Interferon induced transmembrane protein 1(9-27)), 유전자 등록번호(GeneBank accession No.) AK127679(DUSP1, Dual specificity phosphatase 1), 유전자 등록번호(GeneBank accession No.) AK096276(CCND3, Cyclin D3), 유전자 등록번호(GeneBank accession No.) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(GeneBank accession No.) AB209465(PCTK1, PCTAIRE protein kinase 1), 유전자 등록번호(GeneBank accession No.) Z19588(SKIL, SKI-like), 유전자 등록번호(GeneBank accession No.) NM_020429(SMURF1, SMAD specific E3 ubiquitin protein ligase 1), 유전자 등록번호(GeneBank accession No.) NM_014767(SPOCK2, Sparc/osteonectin, cwcv and kazal-like domains proteoglycan(testican) 2), 유전자 등록번호(GeneBank accession No.) NM_005979(S100A13, S100 calcium binding protein A13), 유전자 등록번호(GeneBank accession No.) NM_005187(CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), 유전자 등록번호(GeneBank accession No.) NM_004364(CEBPA, CCAAT/enhancer binding protein(C/EBP), alpha), 유전자 등록번호(GeneBank accession No.) NM_001769(CD9, CD9 antigen(p24)), 유전자 등록번호(GeneBank accession No.) NM_001718(BMP6, Bone morphogenetic protein 6), 유전자 등록번호(GeneBank accession No.) NM_000641(IL11, Interleukin 11), 유전자 등록번호(GeneBank accession No.) BX647459(SERPINE2, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 2), 유전자 등록번호(GeneBank accession No.) BQ066037(RPS19, Ribosomal protein S19), 유전자 등록번호(GeneBank accession No.) BE791300(EDF1, Endothelial differentiation-related factor 1), 유전자 등록번호(GeneBank accession No.) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(GeneBank accession No.) AL832287(ZAP70, Zeta-chain(TCR) associated protein kinase 70kDa), 유전자 등록번호(GeneBank accession No.) AK125742(PCGF1, Polycomb group ring finger 1), 유전자 등록번호(GeneBank accession No.) AK124709(NDRG1, N-myc downstream regulated gene 1), 유전자 등록번호(GeneBank accession No.) AB011157(PTDSR, Phosphatidylserine receptor), 유전자 등록번호(GeneBank accession No.) NM_013255(MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), 유전자 등록번호(GeneBank accession No.) NM_006572(GNA13, Guanine nucleotide binding protein(G protein), alpha 13), 유전자 등록번호(GeneBank accession No.) NM_002211(ITGB1, Integrin, beta 1(fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), 유전자 등록번호(GeneBank accession No.) CR601067(PLAUR, Plasminogen activator, urokinase receptor), 유전자 등록번호(GeneBank accession No.) BC050456(THBS4, Thrombospondin 4), 유전자 등록번 호(GeneBank accession No.) AK027389(CXCL16, Chemokine(C-X-C motif) ligand 16), 유전자 등록번호(GeneBank accession No.) AJ132099(VNN1, Vanin 1), 유전자 등록번호(GeneBank accession No.) XM_371354(FLJ10157, Hypothetical protein FLJ10157), 유전자 등록번호(GeneBank accession No.) XM_208313(TPM3, Similar to tropomyosin 4), 유전자 등록번호(GeneBank accession No.) XM_208270(ACR, Acrosin-like protease), 유전자 등록번호(GeneBank accession No.) NM_203353(PDLIM7, PDZ and LIM domain 7(enigma)), 유전자 등록번호(GeneBank accession No.) NM_201382(PLEC1, Plectin 1, intermediate filament binding protein 500kDa), 유전자 등록번호(GeneBank accession No.) NM_182961(SYNE1, Spectrin repeat containing, nuclear envelope 1), 유전자 등록번호(GeneBank accession No.) NM_181826(NF2, Neurofibromin 2(bilateral acoustic neuroma)), 유전자 등록번호(GeneBank accession No.) NM_172069(PLEKHH2, Pleckstrin homology domain containing, family H(with MyTH4 domain) member 2), 유전자 등록번호(GeneBank accession No.) NM_022648(TNS, Tensin 1), 유전자 등록번호(GeneBank accession No.) NM_017556(FBLP-1, Filamin binding LIM protein 1), 유전자 등록번호(GeneBank accession No.) NM_016081(KIAA0992, Palladin, cytoskeletal associated protein), 유전자 등록번호(GeneBank accession No.) NM_006617(NES, Nestin), 유전자 등록번호(GeneBank accession No.) NM_006262(PRPH, Peripherin), 유전자 등록번호(GeneBank accession No.) NM_005100(AKAP12, A kinase(PRKA) anchor protein(gravin) 12), 유전자 등록번 호(GeneBank accession No.) NM_004368(CNN2, Calponin 2), 유전자 등록번호(GeneBank accession No.) NM_003388(CYLN2, Cytoplasmic linker 2), 유전자 등록번호(GeneBank accession No.) NM_003370(VASP, Vasodilator-stimulated phosphoprotein), 유전자 등록번호(GeneBank accession No.) NM_003128(SPTBN1, Spectrin, beta, non-erythrocytic 1), 유전자 등록번호(GeneBank accession No.) NM_002705(PPL, Periplakin), 유전자 등록번호(GeneBank accession No.) NM_002475(MLC1SA, Myosin light chain 1 slow a), 유전자 등록번호(GeneBank accession No.) NM_002018(FLII, Flightless I homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_001465(FYB, FYN binding protein(FYB-120/130)), 유전자 등록번호(GeneBank accession No.) NM_001069(TUBB2, Tubulin, beta 2A), 유전자 등록번호(GeneBank accession No.) CR625172(MGC8685, Tubulin, beta 2B), 유전자 등록번호(GeneBank accession No.) CR616919(KRT18, Keratin 18), 유전자 등록번호(GeneBank accession No.) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(GeneBank accession No.) CB240572(MYH11, Myosin, heavy polypeptide 11, smooth muscle), 유전자 등록번호(GeneBank accession No.) BX648253(PTPN3, Protein tyrosine phosphatase, non-receptor type 3), 유전자 등록번호(GeneBank accession No.) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(GeneBank accession No.) BX641076(ACTN1, Actinin, alpha 1), 유전자 등록번호(GeneBank accession No.) BX537978(EPB41L1, Erythrocyte membrane protein band 4.1-like 1), 유전자 등록번호(GeneBank accession No.) BG121847(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(GeneBank accession No.) BC068013(MYO1C, Myosin IC), 유전자 등록번호(GeneBank accession No.) BC065499(MAST2, Microtubule associated serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) BC051890(TUBG2, Tubulin, gamma 2), 유전자 등록번호(GeneBank accession No.) BC041874(MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), 유전자 등록번호(GeneBank accession No.) BC012597(ACTA1, Actin, alpha 1, skeletal muscle), 유전자 등록번호(GeneBank accession No.) AY484427(KIF17, Kinesin family member 17), 유전자 등록번호(GeneBank accession No.) AK130546(STOML2, Stomatin(EPB72)-like 2), 유전자 등록번호(GeneBank accession No.) AK124711(CORO2B, Coronin, actin binding protein, 2B), 유전자 등록번호(GeneBank accession No.) AK123974(MYL5, Myosin, light polypeptide 5, regulatory), 유전자 등록번호(GeneBank accession No.) AK092792(LOC389833, Similar to hypothetical protein MGC27019), 유전자 등록번호(GeneBank accession No.) AK026518(MYOHD1, Myosin head domain containing 1), 유전자 등록번호(GeneBank accession No.) AK024500(NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), 유전자 등록번호(GeneBank accession No.) AF085886(FLJ46675, Ribosomal protein L29 pseudogene 2), 유전자 등록번호(GeneBank accession No.) AB209997(MYO9B, Myosin IXB), 유전자 등록번호(GeneBank accession No.) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(GeneBank accession No.) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(GeneBank accession No.) X17033(ITGA2, Integrin, alpha 2(CD49B, alpha 2 subunit of VLA-2 receptor)), 유전자 등록번호(GeneBank accession No.) U41763(CLTCL1, Clathrin, heavy polypeptide-like 1), 유전자 등록번호(GeneBank accession No.) NM_153609(TMPRSS6, Transmembrane protease, serine 6), 유전자 등록번호(GeneBank accession No.) NM_031483(ITCH, Itchy homolog E3 ubiquitin protein ligase(mouse)), 유전자 등록번호(GeneBank accession No.) NM_024342(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(GeneBank accession No.) NM_017555(EGLN2, Egl nine homolog 2(C. elegans)), 유전자 등록번호(GeneBank accession No.) NM_016569(TBX3, T-box 3(ulnar mammary syndrome)), 유전자 등록번호(GeneBank accession No.) NM_004148(NINJ1, Ninjurin 1), 유전자 등록번호(GeneBank accession No.) NM_003377(VEGFB, Vascular endothelial growth factor B), 유전자 등록번호(GeneBank accession No.) NM_001983(ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1(includes overlapping antisense sequence)), 유전자 등록번호(GeneBank accession No.) NM_001552(IGFBP4, Insulin-like growth factor binding protein 4), 유전자 등록번호(GeneBank accession No.) NM_001430(EPAS1, Endothelial PAS domain protein 1), 유전자 등록번호(GeneBank accession No.) NM_001300(KLF6, Kruppel-like factor 6), 유전자 등록번호(GeneBank accession No.) NM_001012661(SLC3A2, Solute carrier family 3(activators of dibasic and neutral amino acid transport), member 2), 유전자 등록번호(GeneBank accession No.) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(GeneBank accession No.) NM_000474(TWIST1, Twist homolog 1(acrocephalosyndactyly 3; Saethre-Chotzen syndrome)(Drosophila)), 유전자 등록번호(GeneBank accession No.) BX649103(ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), 유전자 등록번호(GeneBank accession No.) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(GeneBank accession No.) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(GeneBank accession No.) BM556279(EMP3, Epithelial membrane protein 3), 유전자 등록번호(GeneBank accession No.) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(GeneBank accession No.) AY258066(OKL38, Pregnancy-induced growth inhibitor), 유전자 등록번호(GeneBank accession No.) AK126729(NDRG4, NDRG family member 4), 유전자 등록번호(GeneBank accession No.) AK090459(NFE2L1, Nuclear factor(erythroid-derived 2)-like 1), 유전자 등록번호(GeneBank accession No.) AK074163(ROBO4, Roundabout homolog 4, magic roundabout(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK024680(FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), 유전자 등록번호(GeneBank accession No.) AF176422(HEY1, Hairy/enhancer-of-split related with YRPW motif 1), 유전자 등록번호(GeneBank accession No.) AF003837(JAG1, Jagged 1(Alagille syndrome)), 유전자 등록번호(GeneBank accession No.) AB209322(SEMA3B, Sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3B), 유전자 등록번호(GeneBank accession No.) AB011150(NRXN1, Neurexin 1), 유전자 등록번호(GeneBank accession No.) NM_201589(MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A(avian)), 유전자 등록번호(GeneBank accession No.) NM_052999(CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), 유전자 등록번호(GeneBank accession No.) NM_006644(HSPH1, Heat shock 105kDa/110kDa protein 1), 유전자 등록번호(GeneBank accession No.) NM_005438(FOSL1, FOS-like antigen 1), 유전자 등록번호(GeneBank accession No.) NM_004996(ABCC1, ATP-binding cassette, sub-family C(CFTR/MRP), member 1), 유전자 등록번호(GeneBank accession No.) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(GeneBank accession No.) NM_001353(AKR1C1, Aldo-keto reductase family 1, member C1(dihydrodiol dehydrogenase 1; 20-alpha(3-alpha)-hydroxysteroid dehydrogenase)), 유전자 등록번호(GeneBank accession No.) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) DR004094(HAMP, Hepcidin antimicrobial peptide), 유전자 등록번호(GeneBank accession No.) BC082272(KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), 유전자 등록번호(GeneBank accession No.) BC040494(DNAJB2, DnaJ(Hsp40) homolog, subfamily B, member 2), 유전자 등록번 호(GeneBank accession No.) BC018064(ATF6, Activating transcription factor 6), 유전자 등록번호(GeneBank accession No.) BC006523(SGK2, Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(GeneBank accession No.) AK090482(CXCL12, Chemokine(C-X-C motif) ligand 12(stromal cell-derived factor 1)), 유전자 등록번호(GeneBank accession No.) AF219946(TULP4, Tubby like protein 4), 유전자 등록번호(GeneBank accession No.) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(GeneBank accession No.) NM_005242(F2RL1, Coagulation factor II(thrombin) receptor-like 1), 유전자 등록번호(GeneBank accession No.) NM_001002029(C4A, Complement component 4B, telomeric), 유전자 등록번호(GeneBank accession No.) NM_000539(RHO, Rhodopsin(opsin 2, rod pigment)(retinitis pigmentosa 4, autosomal dominant)), 유전자 등록번호(GeneBank accession No.) BX649164(PAI, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(GeneBank accession No.) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(GeneBank accession No.) AB209647(NCF2, Neutrophil cytosolic factor 2(65kDa, chronic granulomatous disease, autosomal 2)), 유전자 등록번호(GeneBank accession No.) NM_152221(CSNK1E, Casein kinase 1, epsilon), 유전자 등록번호(GeneBank accession No.) NM_017999(RNF31, Ring finger protein 31), 유전자 등록번호(GeneBank accession No.) NM_016819(OGG1, 8-oxoguanine DNA glycosylase), 유 전자 등록번호(GeneBank accession No.) NM_016816(OAS1, 2',5'-oligoadenylate synthetase 1, 40/46kDa), 유전자 등록번호(GeneBank accession No.) NM_012235(SCAP, SREBP cleavage-activating protein), 유전자 등록번호(GeneBank accession No.) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(GeneBank accession No.) NM_001779(CD58, CD58 antigen,(lymphocyte function-associated antigen 3)), 유전자 등록번호(GeneBank accession No.) CB055213(ICOSLG, Inducible T-cell co-stimulator ligand), 유전자 등록번호(GeneBank accession No.) BX641029(MASP1, Mannan-binding lectin serine peptidase 1(C4/C2 activating component of Ra-reactive factor)), 유전자 등록번호(GeneBank accession No.) BQ053419(BATF, Basic leucine zipper transcription factor, ATF-like), 유전자 등록번호(GeneBank accession No.) BC039299(STIP1, Stress-induced-phosphoprotein 1(Hsp70/Hsp90-organizing protein)), 유전자 등록번호(GeneBank accession No.) AY055760(DAF, Decay accelerating factor for complement(CD55, Cromer blood group system)), 유전자 등록번호(GeneBank accession No.) AK130188(FGR, Gardner-Rasheed feline sarcoma viral(v-fgr) oncogene homolog), 유전자 등록번호(GeneBank accession No.) AK095326(MUS81, MUS81 endonuclease homolog(yeast)), 유전자 등록번호(GeneBank accession No.) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(GeneBank accession No.) NM_003004(SECTM1, Secreted and transmembrane 1), 유전자 등록번호(GeneBank accession No.) NM_002309(LIF, Hypothetical protein MGC20647), 유전자 등록번호(GeneBank accession No.) NM_001421(ELF4, E74-like factor 4(ets domain transcription factor)), 유전자 등록번호(GeneBank accession No.) NM_000418(IL4R, Interleukin 4 receptor), 유전자 등록번호(GeneBank accession No.) BI909222(FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), 유전자 등록번호(GeneBank accession No.) BF569086(NK4, Interleukin 32), 유전자 등록번호(GeneBank accession No.) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(GeneBank accession No.) BC020744(AKR1C4, Aldo-keto reductase family 1, member C4(chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol),dehydrogenase 4), 유전자 등록번호(GeneBank accession No.) BQ939577(AKR1C3, Aldo-keto reductase family 1, member C3(3-alpha hydroxysteroid dehydrogenase, type II)), 유전자 등록번호(GeneBank accession No.) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_030622(CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_184041(ALDOA, Aldolase A, fructose-bisphosphate), 유전자 등록번호(GeneBank accession No.) NM_024307(MGC4171, Hypothetical protein LOC283901), 유전자 등록번호(GeneBank accession No.) NM_005336(HDLBP, High density lipoprotein binding protein(vigilin)), 유전자 등록번호(GeneBank accession No.) NM_002627(PFKP, Phosphofructokinase, platelet), 유전자 등록번 호(GeneBank accession No.) BX648281(LDLR, Low density lipoprotein receptor(familial hypercholesterolemia)), 유전자 등록번호(GeneBank accession No.) BC069201(FLJ22761, Hexokinase domain containing 1), 유전자 등록번호(GeneBank accession No.) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(GeneBank accession No.) AL833069(KIAA1434, Hypothetical protein KIAA1434), 유전자 등록번호(GeneBank accession No.) AK124656(ENO2, Enolase 2(gamma, neuronal)), 유전자 등록번호(GeneBank accession No.) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(GeneBank accession No.) AK093461(ISYNA1, Myo-inositol 1-phosphate synthase A1), 유전자 등록번호(GeneBank accession No.) AB053232(GAL3ST3, Galactose-3-O-sulfotransferase 3), 유전자 등록번호(GeneBank accession No.) AB045292(TMEM8, Transmembrane protein 8(five membrane-spanning domains)), 유전자 등록번호(GeneBank accession No.) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(GeneBank accession No.) NM_002900(RBP3, Retinol binding protein 3, interstitial), 유전자 등록번호(GeneBank accession No.) NM_001995(ACSL1, Acyl-CoA synthetase long-chain family member 1), 유전자 등록번호(GeneBank accession No.) NM_000018(ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), 유전자 등록번호(GeneBank accession No.) BC094756(CRA, Myotubularin related protein 11), 유전자 등록번호(GeneBank accession No.) BC050553(NTE, Neuropathy target esterase), 유전자 등록번호(GeneBank accession No.) BC033110(HSD17B1, Hydroxysteroid(17-beta) dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AY268890(TPP1, Tripeptidyl peptidase I), 유전자 등록번호(GeneBank accession No.) AK172798(CPT1A, Carnitine palmitoyltransferase 1A(liver)), 유전자 등록번호(GeneBank accession No.) AK096809(CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), 유전자 등록번호(GeneBank accession No.) AK000600(SIAT7D, ST6(alpha-N-acetyl-neuraminyl-2,3-beta- galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), 유전자 등록번호(GeneBank accession No.) AB002454(CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), 유전자 등록번호(GeneBank accession No.) Z29093(DDR1, Discoidin domain receptor family, member 1), 유전자 등록번호(GeneBank accession No.) Z25424(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) XM_291277(DKFZp761P0423, Hypothetical protein DKFZp761P0423), 유전자 등록번호(GeneBank accession No.) XM_038150(MAST3, Microtubule associated serine/threonine kinase 3), 유전자 등록번호(GeneBank accession No.) U88357(ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3(avian)), 유전자 등록번호(GeneBank accession No.) NM_025195(TRIB1, Tribbles homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020639(RIPK4, Receptor-interacting serine-threonine kinase 4), 유전자 등록 번호(GeneBank accession No.) NM_014172(PHPT1, Phosphohistidine phosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_006254(PRKCD, Protein kinase C, delta), 유전자 등록번호(GeneBank accession No.) NM_005415(SLC20A1, Solute carrier family 20(phosphate transporter), member 1), 유전자 등록번호(GeneBank accession No.) NM_005026(PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004431(EPHA2, EPH receptor A2), 유전자 등록번호(GeneBank accession No.) NM_004419(DUSP5, Dual specificity phosphatase 5), 유전자 등록번호(GeneBank accession No.) NM_004327(BCR, Breakpoint cluster region), 유전자 등록번호(GeneBank accession No.) NM_004231(ATP6V1F, ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F), 유전자 등록번호(GeneBank accession No.) NM_004090(DUSP3, Dual specificity phosphatase 3(vaccinia virus phosphatase VH1-related)), 유전자 등록번호(GeneBank accession No.) NM_002843(PTPRJ, Protein tyrosine phosphatase, receptor type, J), 유전자 등록번호(GeneBank accession No.) NM_002496(NDUFS8, NADH dehydrogenase(ubiquinone) Fe-S protein 8, 23kDa(NADH-coenzyme Q reductase)), 유전자 등록번호(GeneBank accession No.) NM_001001852(PIM3, Pim-3 oncogene), 유전자 등록번호(GeneBank accession No.) L76191(IRAK1, Interleukin-1 receptor-associated kinase 1), 유전자 등록번호(GeneBank accession No.) D15049(PTPRH, Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(GeneBank accession No.) BC065207(ATP6V0D2, ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2), 유전자 등록번호(GeneBank accession No.) BC035578(STK24, Serine/threonine kinase 24(STE20 homolog, yeast)), 유전자 등록번호(GeneBank accession No.) BC028724(DUSP18, Dual specificity phosphatase 18), 유전자 등록번호(GeneBank accession No.) AL117482(ULK3, Unc-51-like kinase 3(C. elegans)), 유전자 등록번호(GeneBank accession No.) AK126879(PCTK3, PCTAIRE protein kinase 3), 유전자 등록번호(GeneBank accession No.) AB209416(ILK, Integrin-linked kinase-2), 유전자 등록번호(GeneBank accession No.) NM_000782(CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) CR597101(ZFP36, Zinc finger protein 36, C3H type, homolog(mouse)), 유전자 등록번호(GeneBank accession No.) CR936799(FHL2, Four and a half LIM domains 2), 유전자 등록번호(GeneBank accession No.) M24898(NR1D1, Nuclear receptor subfamily 1, group D, member 1), 유전자 등록번호(GeneBank accession No.) AF132818(KLF5, Kruppel-like factor 5(intestinal)), 유전자 등록번호(GeneBank accession No.) AK055337(ZNF213, Zinc finger protein 213), 유전자 등록번호(GeneBank accession No.) BC008834(PHF1, PHD finger protein 1), 유전자 등록번호(GeneBank accession No.) AK126918(GLIS2, GLIS family zinc finger 2), 유전자 등록번호(GeneBank accession No.) BC042692(CTL2, Solute carrier family 44, member 2), 유전자 등록번호(GeneBank accession No.) NM_002224(ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), 유전자 등록번호(GeneBank accession No.) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(GeneBank accession No.) NM_174953(ATP2A3, ATPase, Ca++ transporting, ubiquitous), 유전자 등록번호(GeneBank accession No.) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(GeneBank accession No.) NM_016113(TRPV2, Transient receptor potential cation channel, subfamily V, member 2), 유전자 등록번호(GeneBank accession No.) BM926478(RBP1, Retinol binding protein 1, cellular), 유전자 등록번호(GeneBank accession No.) NM_000069(CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), 유전자 등록번호(GeneBank accession No.) AK002107(RAB3B, RAB3B, member RAS oncogene family), 유전자 등록번호(GeneBank accession No.) NM_013321(SNX8, Sorting nexin 8), 유전자 등록번호(GeneBank accession No.) AK125026(SLC6A12, Solute carrier family 6(neurotransmitter transporter, betaine/GABA), member 12), 유전자 등록번호(GeneBank accession No.) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(GeneBank accession No.) AK092512(SLC16A5, Solute carrier family 16(monocarboxylic acid transporters), member 5), 유전자 등록번호(GeneBank accession No.) U49248(ABCC2, ATP-binding cassette, sub-family C(CFTR/MRP), member 2), 유전자 등록번호(GeneBank accession No.) AK172792(SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), 유전자 등록번호(GeneBank accession No.) BC044656(CASC3, Cancer susceptibility candidate 3), 유전자 등록번호(GeneBank accession No.) NM_203403(C9orf150, Chromosome 9 open reading frame 150), 유전자 등록번호(GeneBank accession No.) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(GeneBank accession No.) NM_031286(SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), 유전자 등록번호(GeneBank accession No.) NM_022153(PP2135, Chromosome 10 open reading frame 54), 유전자 등록번호(GeneBank accession No.) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(GeneBank accession No.) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(GeneBank accession No.) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(GeneBank accession No.) BX537968(LOC51149, Hypothetical LOC51149), 유전자 등록번호(GeneBank accession No.) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(GeneBank accession No.) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(GeneBank accession No.) BQ276852(TMSB10, Thymosin, beta 10), 유전자 등록번호(GeneBank accession No.) AK126182(KIAA1949, KIAA1949), 유전자 등록번호(GeneBank accession No.) AK124751(CAPN2, Calpain 2,(m/II) large subunit), 유전자 등록번호(GeneBank accession No.) AK095079(RGC32, Response gene to complement 32), 유전자 등록번호(GeneBank accession No.) AB075871(FLJ42654, Golgi transport 1 homolog A(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AK125150(MAPK8, Mitogen-activated protein kinase 8), 유전자 등 록번호(GeneBank accession No.) NM_002758(MAP2K6, Mitogen-activated protein kinase kinase 6), 유전자 등록번호(GeneBank accession No.) NM_004612(TGFBR1, Transforming growth factor, beta receptor I(activin A receptor type II-like kinase, 53kDa)), 유전자 등록번호(GeneBank accession No.) NM_145686(MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4), 유전자 등록번호(GeneBank accession No.) XM_042066(MAP3K1, Mitogen-activated protein kinase kinase kinase 1), 유전자 등록번호(GeneBank accession No.) AB011123(TNIK, TRAF2 and NCK interacting kinase), 유전자 등록번호(GeneBank accession No.) AB209031(C5, Complement component 5), 유전자 등록번호(GeneBank accession No.) NM_022740(HIPK2, Homeodomain interacting protein kinase 2), 유전자 등록번호(GeneBank accession No.) NM_148957(TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(GeneBank accession No.) AB208909(ITGB2, Integrin, beta 2(antigen CD18(p95), lymphocyte function-associated antigen 1; macrophage antigen 1(mac-1) beta subunit)), 유전자 등록번호(GeneBank accession No.) AB209211(TIA1, TIA1 cytotoxic granule-associated RNA binding protein), 유전자 등록번호(GeneBank accession No.) AB209613(DNASE1L3, Deoxyribonuclease I-like 3), 유전자 등록번호(GeneBank accession No.) AK122825(HMGB1, High-mobility group box 1), 유전자 등록번호(GeneBank accession No.) AK127326(PHF17, PHD finger protein 17), 유전자 등록번호(GeneBank accession No.) AK223503(CASP1, Caspase 1, apoptosis-related cysteine peptidase(interleukin 1, beta, convertase)), 유전자 등록번호(GeneBank accession No.) BC013326(GAS2, Growth arrest-specific 2), 유전자 등록번호(GeneBank accession No.) BC047698(IL7, Interleukin 7), 유전자 등록번호(GeneBank accession No.) D79987(ESPL1, Extra spindle poles like 1(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_000893(KNG1, Kininogen 1), 유전자 등록번호(GeneBank accession No.) NM_001012271(BIRC5, Effector cell peptidase receptor 1), 유전자 등록번호(GeneBank accession No.) NM_004938(DAPK1, Death-associated protein kinase 1), 유전자 등록번호(GeneBank accession No.) NM_005879(TRIP, TRAF interacting protein), 유전자 등록번호(GeneBank accession No.) NM_014739(BCLAF1, BCL2-associated transcription factor 1), 유전자 등록번호(GeneBank accession No.) NM_018947(CYCS, Cytochrome c, somatic), 유전자 등록번호(GeneBank accession No.) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(GeneBank accession No.) AB209179(PLK1, Polo-like kinase 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) AB209337(CDC7, CDC7 cell division cycle 7(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AF053305(BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(GeneBank accession No.) AF053306(BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(GeneBank accession No.) AF345347(SPAG5, Sperm associated antigen 5), 유전자 등록번호(GeneBank accession No.) AK092638(CCNG2, Cyclin G2), 유전자 등록번호(GeneBank accession No.) AK222819(NUSAP1, Nucleolar and spindle associated protein 1), 유전자 등록번호(GeneBank accession No.) AL833191(SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등록번호(GeneBank accession No.) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(GeneBank accession No.) BC011000(CDCA5, Cell division cycle associated 5), 유전자 등록번호(GeneBank accession No.) BC032677(UBE2C, Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(GeneBank accession No.) BC043502(NEK2, NIMA(never in mitosis gene a)-related kinase 2), 유전자 등록번호(GeneBank accession No.) BU675073(PTTG1, Pituitary tumor-transforming 1), 유전자 등록번호(GeneBank accession No.) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(GeneBank accession No.) CR592757(BRRN1, Barren homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) CR597075(MAPRE2, Microtubule-associated protein, RP/EB family, member 2), 유전자 등록번호(GeneBank accession No.) CR604810(CCNA2, Cyclin A2), 유전자 등록번호(GeneBank accession No.) CR933728(CDC2, Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(GeneBank accession No.) NM_000919(PAM, Peptidylglycine alpha-amidating monooxygenase), 유전자 등록번호(GeneBank accession No.) NM_001790(CDC25C, Cell division cycle 25C), 유전자 등록번호(GeneBank accession No.) NM_001798(CDK2, Cyclin-dependent kinase 2), 유전자 등록번호(GeneBank accession No.) NM_001813(CENPE, Centromere protein E, 312kDa), 유전자 등록번호(GeneBank accession No.) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(GeneBank accession No.) NM_003981(PRC1, Protein regulator of cytokinesis 1), 유전자 등록번호(GeneBank accession No.) NM_004523(KIF11, Kinesin family member 11), 유전자 등록번호(GeneBank accession No.) NM_004701(CCNB2, Cyclin B2), 유전자 등록번호(GeneBank accession No.) NM_005983(SKP2, S-phase kinase-associated protein 2(p45)), 유전자 등록번호(GeneBank accession No.) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(GeneBank accession No.) NM_006845(KIF2C, Kinesin family member 2C), 유전자 등록번호(GeneBank accession No.) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(GeneBank accession No.) NM_012112(TPX2, TPX2, microtubule-associated, homolog(Xenopus laevis)), 유전자 등록번호(GeneBank accession No.) NM_014750(DLG7, Discs, large homolog 7(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015097(CLASP2, Cytoplasmic linker associated protein 2), 유전자 등록번호(GeneBank accession No.) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(GeneBank accession No.) NM_016426(GTSE1, G-2 and S-phase expressed 1), 유전자 등록번호(GeneBank accession No.) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(GeneBank accession No.) NM_018685(ANLN, Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020242(KNSL7, Kinesin family member 15), 유전자 등록번호(GeneBank accession No.) NM_031966(CCNB1, Cyclin B1), 유전자 등록번호(GeneBank accession No.) NM_138555(KIF23, Kinesin family member 23), 유전자 등록번호(GeneBank accession No.) U65410(MAD2L1, MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AB020656(CYLD, Cylindromatosis(turban tumor syndrome)), 유전자 등록번호(GeneBank accession No.) AF033122(SESN1, Sestrin 1), 유전자 등록번호(GeneBank accession No.) AK074377(UHRF1, Chromosome 19 open reading frame 31), 유전자 등록번호(GeneBank accession No.) AK091170(CDKN2C, Cyclin-dependent kinase inhibitor 2C(p18, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) AK094323(NFYC, Nuclear transcription factor Y, gamma), 유전자 등록번호(GeneBank accession No.) AY366508(LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), 유전자 등록번호(GeneBank accession No.) BC033086(TCF19, Transcription factor 19(SC1)), 유전자 등록번호(GeneBank accession No.) BC040303(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(GeneBank accession No.) BC040991(TFDP2, Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(GeneBank accession No.) BC092412(SGOL2, Shugoshin-like 2(S. pombe)), 유전자 등록번호(GeneBank accession No.) BQ278454(CKS1B, CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(GeneBank accession No.) BX649128(SESN3, Sestrin 3), 유전자 등록번호(GeneBank accession No.) CD049340(AURKB, Aurora kinase B), 유전자 등록번호(GeneBank accession No.) M89914(NF1, Neurofibromin 1(neurofibromatosis, von Recklinghausen disease, Watson disease)), 유전자 등록번호(GeneBank accession No.) NM_001005414(ZWINT, ZW10 interactor antisense), 유전자 등록번호(GeneBank accession No.) NM_001008491(Sep 2, Septin 2), 유전자 등록번호(GeneBank accession No.) NM_001274(CHEK1, CHK1 checkpoint homolog(S. pombe)), 유전자 등록번호(GeneBank accession No.) NM_002105(H2AFX, H2A histone family, member X), 유전자 등록번호(GeneBank accession No.) NM_002388(MCM3, MCM3 minichromosome maintenance deficient 3(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_002417(MKI67, Antigen identified by monoclonal antibody Ki-67), 유전자 등록번호(GeneBank accession No.) NM_002875(RAD51, RAD51 homolog(RecA homolog, E. coli)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(GeneBank accession No.) NM_004526(MCM2, MCM2 minichromosome maintenance deficient 2, mitotin(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_004847(AIF1, Allograft inflammatory factor 1), 유전자 등록번호(GeneBank accession No.) NM_005915(MCM6, MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_012090(MACF1, Microtubule-actin crosslinking factor 1), 유 전자 등록번호(GeneBank accession No.) NM_012415(RAD54B, RAD54 homolog B(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_014264(PLK4, Polo-like kinase 4(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015714(G0S2, G0/G1switch 2), 유전자 등록번호(GeneBank accession No.) NM_024680(FLJ23311, E2F transcription factor 8), 유전자 등록번호(GeneBank accession No.) XM_034274(MYBL1, V-myb myeloblastosis viral oncogene homolog(avian)-like 1), 유전자 등록번호(GeneBank accession No.) AK001720(FLJ10858, Nei endonuclease VIII-like 3(E. coli)), 유전자 등록번호(GeneBank accession No.) AY032677(POLQ, Polymerase(DNA directed), theta), 유전자 등록번호(GeneBank accession No.) BC034480(BLM, Bloom syndrome), 유전자 등록번호(GeneBank accession No.) BC073161(RAD51C, RAD51 homolog C(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) CR600021(HMGB2, High-mobility group box 2), 유전자 등록번호(GeneBank accession No.) CR625391(RAD51AP1, RAD51 associated protein 1), 유전자 등록번호(GeneBank accession No.) CR936783(FLJ40869, Hypothetical protein LOC284952), 유전자 등록번호(GeneBank accession No.) DQ140356(KIAA1596, Fanconi anemia, complementation group M), 유전자 등록번호(GeneBank accession No.) NM_001067(TOP2A, Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(GeneBank accession No.) NM_001618(PARP1, Poly(ADP-ribose) polymerase family, member 1), 유전자 등록번호(GeneBank accession No.) NM_003362(UNG, Uracil-DNA glycosylase), 유전자 등록번호(GeneBank accession No.) NM_006904(PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(GeneBank accession No.) NM_130398(EXO1, Exonuclease 1), 유전자 등록번호(GeneBank accession No.) AB020807(TLR6, Toll-like receptor 6), 유전자 등록번호(GeneBank accession No.) AB032980(DCDC2, Doublecortin domain containing 2), 유전자 등록번호(GeneBank accession No.) AB209866(TFPI, Tissue factor pathway inhibitor(lipoprotein-associated coagulation inhibitor)), 유전자 등록번호(GeneBank accession No.) AK057015(HSPA4, Heat shock 70kDa protein 4), 유전자 등록번호(GeneBank accession No.) AK095515(IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), 유전자 등록번호(GeneBank accession No.) AK122686(IF, I factor(complement)), 유전자 등록번호(GeneBank accession No.) AK123010(RRM2, Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(GeneBank accession No.) BC035582(TRIM22, Tripartite motif-containing 22), 유전자 등록번호(GeneBank accession No.) BX537894(LOC493869, Similar to RIKEN cDNA 2310016C16), 유전자 등록번호(GeneBank accession No.) M14338(PROS1, Protein S(alpha)), 유전자 등록번호(GeneBank accession No.) NM_000821(GGCX, Gamma-glutamyl carboxylase), 유전자 등록번호(GeneBank accession No.) NM_000963(PTGS2, Prostaglandin-endoperoxide synthase 2(prostaglandin G/H synthase and cyclooxygenase)), 유전자 등록번호(GeneBank accession No.) NM_001001547(CD36, CD36 antigen(collagen type I receptor, thrombospondin receptor)), 유전자 등록번호(GeneBank accession No.) NM_001512(GSTA4, Glutathione S-transferase A4), 유전자 등록번호(GeneBank accession No.) NM_001629(ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), 유전자 등록번호(GeneBank accession No.) NM_001752(CAT, Catalase), 유전자 등록번호(GeneBank accession No.) NM_001837(CCR3, Chemokine(C-C motif) receptor 3), 유전자 등록번호(GeneBank accession No.) NM_001979(EPHX2, Epoxide hydrolase 2, cytoplasmic), 유전자 등록번호(GeneBank accession No.) NM_001994(F13B, Coagulation factor XIII, B polypeptide), 유전자 등록번호(GeneBank accession No.) NM_002182(IL1RAP, Interleukin 1 receptor accessory protein), 유전자 등록번호(GeneBank accession No.) NM_006120(HLA-DMA, Major histocompatibility complex, class II, DM alpha), 유전자 등록번호(GeneBank accession No.) NM_173216(SIAT1, ST6 beta-galactosamide alpha-2,6-sialyltranferase 1), 유전자 등록번호(GeneBank accession No.) NM_202002(FOXM1, Forkhead box M1), 유전자 등록번호(GeneBank accession No.) AB163917(LRAP, Leukocyte-derived arginine aminopeptidase), 유전자 등록번호(GeneBank accession No.) BC027881(AFP, Alpha-fetoprotein), 유전자 등록번호(GeneBank accession No.) NM_015915(SPG3A, Spastic paraplegia 3A(autosomal dominant)), 유전자 등록번호(GeneBank accession No.) NM_000671(ADH5, Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(GeneBank accession No.) J05428(UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), 유전자 등록번호(GeneBank accession No.) NM_000672(ADH6, Alcohol dehydrogenase 6(class V)), 유전자 등록번호(GeneBank accession No.) M15943(ADH4, Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(GeneBank accession No.) AK223395(FBP1, Fructose-1,6-bisphosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_000151(G6PC, Glucose-6-phosphatase, catalytic(glycogen storage disease type I, von Gierke disease)), 유전자 등록번호(GeneBank accession No.) XM_113962(KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), 유전자 등록번호(GeneBank accession No.) AB020644(ACSL6, Acyl-CoA synthetase long-chain family member 6), 유전자 등록번호(GeneBank accession No.) AB209907(PLD1, Phospholipase D1, phophatidylcholine-specific), 유전자 등록번호(GeneBank accession No.) AF285167(ABCA1, ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(GeneBank accession No.) AF297872(TRERF1, Transcriptional regulating factor 1), 유전자 등록번호(GeneBank accession No.) AF303134(ALDH8A1, Aldehyde dehydrogenase 8 family, member A1), 유전자 등록번호(GeneBank accession No.) AF339053(PLA2G12B, Phospholipase A2, group XIIB), 유전자 등록번호(GeneBank accession No.) AK096018(HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), 유전자 등록번호(GeneBank accession No.) AK124635(PCSK9, Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(GeneBank accession No.) AK127346(SIAT9, ST3 beta-galactoside alpha-2,3- sialyltransferase 5), 유전자 등록번호(GeneBank accession No.) AL359559(AGPS, Alkylglycerone phosphate synthase), 유전자 등록번호(GeneBank accession No.) AY691170(PLCL3, Phospholipase C-like 3), 유전자 등록번호(GeneBank accession No.) BG567934(APOM, Apolipoprotein M), 유전자 등록번호(GeneBank accession No.) BX538214(C6orf167, Chromosome 6 open reading frame 167), 유전자 등록번호(GeneBank accession No.) BX640945(FADS2, Fatty acid desaturase 2), 유전자 등록번호(GeneBank accession No.) BX648473(PIGK, Phosphatidylinositol glycan, class K), 유전자 등록번호(GeneBank accession No.) BX648557(HSD17B2, Hydroxysteroid(17-beta) dehydrogenase 2), 유전자 등록번호(GeneBank accession No.) CR749601(ETNK1, Death-associated protein kinase 3), 유전자 등록번호(GeneBank accession No.) NM_000859(HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), 유전자 등록번호(GeneBank accession No.) NM_001443(FABP1, Fatty acid binding protein 1, liver), 유전자 등록번호(GeneBank accession No.) NM_002130(HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1(soluble)), 유전자 등록번호(GeneBank accession No.) NM_003725(RODH, Hydroxysteroid(17-beta) dehydrogenase 6), 유전자 등록번호(GeneBank accession No.) NM_004845(PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), 유전자 등록번호(GeneBank accession No.) NM_014762(DHCR24, 24-dehydrocholesterol reductase), 유전자 등록번호(GeneBank accession No.) NM_020139(DHRS6, Dehydrogenase/reductase(SDR family) member 6), 유전자 등록번 호(GeneBank accession No.) NM_020918(GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(GeneBank accession No.) NM_032523(OSBPL6, Oxysterol binding protein-like 6), 유전자 등록번호(GeneBank accession No.) NM_033505(SELI, Selenoprotein I), 유전자 등록번호(GeneBank accession No.) Z28339(AKR1D1, Aldo-keto reductase family 1, member D1(delta 4-3-ketosteroid-5-beta-reductase)), 유전자 등록번호(GeneBank accession No.) AK024899(ENPP3, Ectonucleotide pyrophosphatase/phosphodiesterase 3), 유전자 등록번호(GeneBank accession No.) AK025546(PTPN4, Protein tyrosine phosphatase, non-receptor type 4(megakaryocyte)), 유전자 등록번호(GeneBank accession No.) AK124910(ENPP2, Ectonucleotide pyrophosphatase/phosphodiesterase 2(autotaxin)), 유전자 등록번호(GeneBank accession No.) BC035116(FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), 유전자 등록번호(GeneBank accession No.) BC050565(PASK, PAS domain containing serine/threonine kinase), 유전자 등록번호(GeneBank accession No.) L13436(NPR2, Natriuretic peptide receptor B/guanylate cyclase B(atrionatriuretic peptide receptor B)), 유전자 등록번호(GeneBank accession No.) NM_001005862(ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog(avian)), 유전자 등록번호(GeneBank accession No.) NM_005012(ROR1, Receptor tyrosine kinase-like orphan receptor 1), 유전자 등록번호(GeneBank accession No.) NM_006035(CDC42BPB, CDC42 binding protein kinase beta(DMPK-like)), 유전자 등록번호(GeneBank accession No.) NM_014791(MELK, Maternal embryonic leucine zipper kinase), 유전자 등록번호(GeneBank accession No.) NM_023028(FGFR2, Fibroblast growth factor receptor 2(bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), 유전자 등록번호(GeneBank accession No.) NM_080836(STK35, Serine/threonine kinase 35), 유전자 등록번호(GeneBank accession No.) AF419331(FUSIP1, FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(GeneBank accession No.) AK091927(SFRS3, Splicing factor, arginine/serine-rich 3), 유전자 등록번호(GeneBank accession No.) BC010266(HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(GeneBank accession No.) BC012360(CTAGE5, CTAGE family, member 5), 유전자 등록번호(GeneBank accession No.) BC036046(PLRG1, Pleiotropic regulator 1(PRL1 homolog, Arabidopsis)), 유전자 등록번호(GeneBank accession No.) BC065384(PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BX537360(CPSF5, Nudix(nucleoside diphosphate linked moiety X)-type motif 21), 유전자 등록번호(GeneBank accession No.) BX537494(HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2/B1), 유전자 등록번호(GeneBank accession No.) BX647784(HNRPR, Heterogeneous nuclear ribonucleoprotein R), 유전자 등록번 호(GeneBank accession No.) CA455267(PPIH, Peptidyl prolyl isomerase H(cyclophilin H)), 유전자 등록번호(GeneBank accession No.) CR596214(HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), 유전자 등록번호(GeneBank accession No.) NM_001326(CSTF3, Hypothetical protein LOC283267), 유전자 등록번호(GeneBank accession No.) NM_004640(BAT1, HLA-B associated transcript 1), 유전자 등록번호(GeneBank accession No.) NM_005463(HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(GeneBank accession No.) NM_006924(SFRS1, Splicing factor, arginine/serine-rich 1(splicing factor 2, alternate splicing factor)), 유전자 등록번호(GeneBank accession No.) NM_012426(SF3B3, Splicing factor 3b, subunit 3, 130kDa), 유전자 등록번호(GeneBank accession No.) NM_018048(FLJ10292, Mago-nashi homolog), 유전자 등록번호(GeneBank accession No.) NM_030919(C20orf129, Chromosome 20 open reading frame 129), 유전자 등록번호(GeneBank accession No.) NM_031370(HNRPD, Heterogeneous nuclear ribonucleoprotein D(AU-rich element RNA binding protein 1, 37kDa)), 유전자 등록번호(GeneBank accession No.) NM_138933(ACF, Apobec-1 complementation factor), 유전자 등록번호(GeneBank accession No.) AB193259(ACE2, Angiotensin I converting enzyme(peptidyl-dipeptidase A) 2), 유전자 등록번호(GeneBank accession No.) BX648769(EWSR1, Ewing sarcoma breakpoint region 1), 유전자 등록번호(GeneBank accession No.) AB023154(DTX4, Deltex 4 homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) AL543755(VAV3, Vav 3 oncogene), 유전자 등록번호(GeneBank accession No.) M75106(CPB2, Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(GeneBank accession No.) NM_021045(ZNF248, Zinc finger protein 248), 유전자 등록번호(GeneBank accession No.) AB209194(B4GALT6, UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6), 유전자 등록번호(GeneBank accession No.) AF279145(ANTXR1, Anthrax toxin receptor 1), 유전자 등록번호(GeneBank accession No.) NM_025074(FRAS1, Fraser syndrome 1), 유전자 등록번호(GeneBank accession No.) AK025790(KIF20A, Kinesin family member 20A), 유전자 등록번호(GeneBank accession No.) NM_006152(LRMP, Lymphoid-restricted membrane protein), 유전자 등록번호(GeneBank accession No.) NM_000340(SLC2A2, Solute carrier family 2(facilitated glucose transporter), member 2), 유전자 등록번호(GeneBank accession No.) AF071592(KIF4A, Kinesin family member 4A), 유전자 등록번호(GeneBank accession No.) NM_013277(RACGAP1, Rac GTPase activating protein 1), 유전자 등록번호(GeneBank accession No.) AY043484(SCN1A, Sodium channel, voltage-gated, type I, alpha), 유전자 등록번호(GeneBank accession No.) AY791349(KIF18A, Kinesin family member 18A), 유전자 등록번호(GeneBank accession No.) NM_018018(SLC38A4, Solute carrier family 38, member 4), 유전자 등록번호(GeneBank accession No.) AK094603(FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(GeneBank accession No.) NM_021069(ARGBP2, Sorbin and SH3 domain containing 2), 유전자 등록번호(GeneBank accession No.) NM_001005747(CACNB4, Calcium channel, voltage-dependent, beta 4 subunit), 유전자 등록번호(GeneBank accession No.) AJ496568(SLC25A12, Solute carrier family 25(mitochondrial carrier, Aralar), member 12), 유전자 등록번호(GeneBank accession No.) NM_030641(APOL6, Apolipoprotein L, 6), 유전자 등록번호(GeneBank accession No.) NM_173512(FLJ39822, Hypothetical protein FLJ39822), 유전자 등록번호(GeneBank accession No.) NM_000037(ANK1, Ankyrin 1, erythrocytic), 유전자 등록번호(GeneBank accession No.) NM_001011554(SLC13A3, Solute carrier family 13(sodium-dependent dicarboxylate transporter), member 3), 유전자 등록번호(GeneBank accession No.) AB091343(C10orf3, Centrosomal protein 55kDa), 유전자 등록번호(GeneBank accession No.) AK000643(ASB9, Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(GeneBank accession No.) AK055221(FBXO5, F-box protein 5), 유전자 등록번호(GeneBank accession No.) AK075271(SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like(aminotransferase 2)), 유전자 등록번호(GeneBank accession No.) AK122685(GLUD1, Glutamate dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AK127098(FLJ10706, Chromosome 1 open reading frame 112), 유전자 등록번호(GeneBank accession No.) AL133031(MLR1, Transcription factor MLR1), 유전자 등록번호(GeneBank accession No.) AY007723(MAL2, Mal, T-cell differentiation protein 2), 유전자 등록번호(GeneBank accession No.) BC022255(Spc25, Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BC041882(ATF7IP2, Activating transcription factor 7 interacting protein 2), 유전자 등록번호(GeneBank accession No.) BC052951(LMNB1, Lamin B1), 유전자 등록번호(GeneBank accession No.) BC098313(FLJ20641, Hypothetical protein FLJ20641), 유전자 등록번호(GeneBank accession No.) NM_001809(CENPA, Centromere protein A, 17kDa), 유전자 등록번호(GeneBank accession No.) NM_145061(C13orf3, Chromosome 13 open reading frame 3), 유전자 등록번호(GeneBank accession No.) XM_372695(LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase(LOC390859), mRNA).Gene accession number (GeneBank accession No. ) NM_004420 (DUSP8, Dual specificity phosphatase 8), gene accession number (GeneBank accession No. ) L11329 (DUSP2, Dual specificity phosphatase 2), gene accession number (GeneBank accession No. ) BC094766 (PKN1, Protein kinase N1), gene accession number (GeneBank accession No. ) AY247738 (TRIB3, Tribbles homolog 3 (Drosophila)), gene accession number (GeneBank accession No. ) AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Gene Accession No. ) AB208849 (SHC1, Src homology 2 domain containing (SHC) transforming protein 1), gene accession number (GeneBank accession No. ) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease)), Gene Accession No. ) NM_198951 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (GeneBank accession No. NM_147780 (CTSB, Cathepsin B), gene accession number (GeneBank accession No. NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), gene accession number (GeneBank accession No. NM_033027 (AXUD1, AXIN1 up-regulated 1), gene accession number (GeneBank accession No. NM_032797 (AMID, Apoptosis-inducing factor (AIF) -like mitochondrion-associated inducer of death), GeneBank accession No. ) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (GeneBank accession No. ) NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), gene accession number (GeneBank accession No. ) NM_016222 (DDX41, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41), gene accession number (GeneBank accession No. ) NM_013246 (CLC, Cardiotrophin-like cytokine factor 1), gene accession number (GeneBank accession No. ) NM_004401 (DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), gene registration number (GeneBank accession No. ) NM_004281 (BAG3, BCL2-associated athanogene 3), gene accession number (GeneBank accession No. ) NM_003897 (IER3, Immediate early response 3), Gene accession number (GeneBank accession No. ) NM_003806 (HRK, Harakiri, BCL2 interacting protein (contains only BH3 domain)), gene accession number (GeneBank accession No. ) NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), GeneBank accession No. ) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), gene accession number (GeneBank accession No. ) NM_002737 (PRKCA, Protein Kinase C, alpha), Gene Accession Number (GeneBank accession No. NM_002648 (PIM1, Pim-1 oncogene), gene accession number (GeneBank accession No. NM_002507 (NGFR, Nerve growth factor receptor (TNFR superfamily, member 16)), gene accession number (GeneBank accession No. ) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), gene accession number (GeneBank accession No. ) NM_001013398 (IGFBP3, Insulin-like growth factor binding protein 3), gene registration number (GeneBank accession No. ) BX640923 (MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)), gene accession number (GeneBank accession No. ) BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), gene accession number (GeneBank accession No. ) BG284742 (P8, P8 protein (candidate of metastasis 1)), gene accession number (GeneBank accession No. ) BE903247 (PDCD6IP, Programmed cell death 6 interacting protein), gene accession number (GeneBank accession No. ) BC027949 (P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), gene accession number (GeneBank accession No. ) BC006365 (PSEN2, Presenilin 2 (Alzheimer disease 4)), gene accession number (GeneBank accession No. ) AY869712 (PPP1R13L, Protein phosphatase 1, regulatory (inhibitor) subunit 13 like), Gene Accession No. ) AY028896 (CARD10, Caspase recruitment domain family, member 10), gene accession number (GeneBank accession No. ) AK122614 (PPARD, Peroxisome proliferative activated receptor, delta), gene accession number (GeneBank accession No. ) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), gene registration number (GeneBank accession No. ) AK092808 (RRAGC, Ras-related GTP binding C), gene accession number (GeneBank accession No. ) AJ001898 (GDNF, Glial cell derived neurotrophic factor), gene accession number (GeneBank accession No. ) AF220656 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), gene accession number (GeneBank accession No. AF055634 (UNC5C, Unc-5 homolog C (C.  elegans), GeneBank accession No. ) AB209485 (Vescular endothelial growth factor), gene accession number (GeneBank accession No. ) AB096256 (UNC5B, Unc-5 homolog B (C.  elegans), GeneBank accession No. ) AB007960 (SH3GLB1, SH3-domain GRB2-like endophilin B1), gene accession number (GeneBank accession No. ) X06374 (PDGFA, Platelet-derived growth factor alpha polypeptide), Gene accession number (GeneBank accession No. ) S62138 (DDIT3, DNA-damage-inducible transcript 3), gene accession number (GeneBank accession No. NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), gene accession number (GeneBank accession No. ) NM_012127 (CIZ1, CDKN1A interacting zinc finger protein 1), gene accession number (GeneBank accession No. ) NM_005883 (APC2, Adenomatosis polyposis coli 2), gene accession number (GeneBank accession No. ) NM_004196 (CDKL1, Cyclin-dependent kinase-like 1 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_003236 (TGFA, Transforming growth factor, alpha), gene registration number (GeneBank accession No. ) NM_001261 (CDK9, Cyclin-dependent kinase 9 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_001007271 (DUSP13, Dual specificity phosphatase 13), gene accession number (GeneBank accession No. ) CR749511 (PARC, P53-associated parkin-like cytoplasmic protein), gene registration number (GeneBank accession No. CR623038 (ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), gene accession number (GeneBank accession No. CR618371 (EGFR, Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)), GeneBank accession No. ) BF965144 (IFITM1, Interferon induced transmembrane protein 1 (9-27)), gene accession number (GeneBank accession No. ) AK127679 (DUSP1, Dual specificity phosphatase 1), gene accession number (GeneBank accession No. ) AK096276 (CCND3, Cyclin D3), gene accession number (GeneBank accession No. ) AB209586 (MAPK13, Mitogen-activated protein kinase 13), gene accession number (GeneBank accession No. ) AB209465 (PCTK1, PCTAIRE protein kinase 1), gene accession number (GeneBank accession No. ) Z19588 (SKIL, SKI-like), gene accession number (GeneBank accession No. NM_020429 (SMURF1, SMAD specific E3 ubiquitin protein ligase 1), gene accession number (GeneBank accession No. ) NM_014767 (SPOCK2, Sparc / osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2), Gene Accession No. ) NM_005979 (S100A13, S100 calcium binding protein A13), gene registration number (GeneBank accession No. NM_005187 (CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), gene accession number (GeneBank accession No. ) NM_004364 (CEBPA, CCAAT / enhancer binding protein (C / EBP), alpha), gene registration number (GeneBank accession No. ) NM_001769 (CD9, CD9 antigen (p24)), gene accession number (GeneBank accession No. ) NM_001718 (BMP6, Bone morphogenetic protein 6), gene accession number (GeneBank accession No. ) NM_000641 (IL11, Interleukin 11), gene accession number (GeneBank accession No. ) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), gene registration number (GeneBank accession No. ) BQ066037 (RPS19, Ribosomal protein S19), gene accession number (GeneBank accession No. ) BE791300 (EDF1, Endothelial differentiation-related factor 1), Gene accession number (GeneBank accession No. ) BC038504 (SNF1LK, SNF1-like kinase), gene accession number (GeneBank accession No. ) AL832287 (ZAP70, Zeta-chain (TCR) associated protein kinase 70kDa), gene accession number (GeneBank accession No. ) AK125742 (PCGF1, Polycomb group ring finger 1), gene accession number (GeneBank accession No. ) AK124709 (NDRG1, N-myc downstream regulated gene 1), gene accession number (GeneBank accession No. ) AB011157 (PTDSR, Phosphatidylserine receptor), Gene Accession No. NM_013255 (MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), gene accession number (GeneBank accession No. ) NM_006572 (GNA13, Guanine nucleotide binding protein (G protein), alpha 13), gene registration number (GeneBank accession No. NM_002211 (ITGB1, Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), gene accession number (GeneBank accession No. ) CR601067 (PLAUR, Plasminogen activator, urokinase receptor), gene accession number (GeneBank accession No. ) BC050456 (THBS4, Thrombospondin 4), gene registration number (GeneBank accession No. ) AK027389 (CXCL16, Chemokine (C-X-C motif) ligand 16), gene accession number (GeneBank accession No. ) AJ132099 (VNN1, Vanin 1), gene accession number (GeneBank accession No. ) XM_371354 (FLJ10157, Hypothetical protein FLJ10157), gene accession number (GeneBank accession No. ) XM_208313 (TPM3, Similar to tropomyosin 4), gene accession number (GeneBank accession No. XM_208270 (ACR, Acrosin-like protease), gene accession number (GeneBank accession No. ) NM_203353 (PDLIM7, PDZ and LIM domain 7 (enigma)), gene accession number (GeneBank accession No. ) NM_201382 (PLEC1, Plectin 1, intermediate filament binding protein 500kDa), gene registration number (GeneBank accession No. ) NM_182961 (SYNE1, Spectrin repeat containing, nuclear envelope 1), gene accession number (GeneBank accession No. ) NM_181826 (NF2, Neurofibromin 2 (bilateral acoustic neuroma)), gene accession number (GeneBank accession No. NM_172069 (PLEKHH2, Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2), gene accession number (GeneBank accession No. ) NM_022648 (TNS, Tensin 1), gene accession number (GeneBank accession No. NM_017556 (FBLP-1, Filamin binding LIM protein 1), gene accession number (GeneBank accession No. NM_016081 (KIAA0992, Palladin, cytoskeletal associated protein), gene accession number (GeneBank accession No. ) NM_006617 (NES, Nestin), gene accession number (GeneBank accession No. ) NM_006262 (PRPH, Peripherin), gene accession number (GeneBank accession No. NM_005100 (AKAP12, A kinase (PRKA) anchor protein (gravin) 12), gene registration number (GeneBank accession No. NM_004368 (CNN2, Calponin 2), gene accession number (GeneBank accession No. ) NM_003388 (CYLN2, Cytoplasmic linker 2), gene accession number (GeneBank accession No. ) NM_003370 (VASP, Vasodilator-stimulated phosphoprotein), gene accession number (GeneBank accession No. ) NM_003128 (SPTBN1, Spectrin, beta, non-erythrocytic 1), gene accession number (GeneBank accession No. ) NM_002705 (PPL, Periplakin), gene accession number (GeneBank accession No. ) NM_002475 (MLC1SA, Myosin light chain 1 slow a), Gene accession number (GeneBank accession No. ) NM_002018 (FLII, Flightless I homolog (Drosophila)), Gene Accession Number (GeneBank accession No. ) NM_001465 (FYB, FYN binding protein (FYB-120 / 130)), gene registration number (GeneBank accession No. NM_001069 (TUBB2, Tubulin, beta 2A), gene accession number (GeneBank accession No. ) CR625172 (MGC8685, Tubulin, beta 2B), gene accession number (GeneBank accession No. CR616919 (KRT18, Keratin 18), gene accession number (GeneBank accession No. ) CR606241 (ACTG1, Actin, gamma 1), gene accession number (GeneBank accession No. ) CB240572 (MYH11, Myosin, heavy polypeptide 11, smooth muscle), gene accession number (GeneBank accession No. ) BX648253 (PTPN3, Protein tyrosine phosphatase, non-receptor type 3), Gene accession number (GeneBank accession No. ) BX648190 (WDR1, WD repeat domain 1), Gene accession number (GeneBank accession No. ) BX641076 (ACTN1, Actinin, alpha 1), gene accession number (GeneBank accession No. ) BX537978 (EPB41L1, Erythrocyte membrane protein band 4. 1-like 1), gene accession number (GeneBank accession No. ) BG121847 (NUDC, Nuclear distribution gene C homolog (A.  nidulans)), and GeneBank accession No. ) BC068013 (MYO1C, Myosin IC), gene accession number (GeneBank accession No. ) BC065499 (MAST2, Microtubule associated serine / threonine kinase 2), gene accession number (GeneBank accession No. ) BC051890 (TUBG2, Tubulin, gamma 2), gene accession number (GeneBank accession No. ) BC041874 (MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), gene accession number (GeneBank accession No. ) BC012597 (ACTA1, Actin, alpha 1, skeletal muscle), gene accession number (GeneBank accession No. ) AY484427 (KIF17, Kinesin family member 17), gene accession number (GeneBank accession No. ) AK130546 (STOML2, Stomatin (EPB72) -like 2), Gene accession number (GeneBank accession No. ) AK124711 (CORO2B, Coronin, actin binding protein, 2B), gene accession number (GeneBank accession No. ) AK123974 (MYL5, Myosin, light polypeptide 5, regulatory), gene accession number (GeneBank accession No. ) AK092792 (LOC389833, Similar to hypothetical protein MGC27019), gene accession number (GeneBank accession No. ) AK026518 (MYOHD1, Myosin head domain containing 1), gene accession number (GeneBank accession No. ) AK024500 (NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), gene accession number (GeneBank accession No. ) AF085886 (FLJ46675, Ribosomal protein L29 pseudogene 2), gene accession number (GeneBank accession No. ) AB209997 (MYO9B, Myosin IXB), gene accession number (GeneBank accession No. Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), gene accession number (GeneBank accession No. ) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), gene accession number (GeneBank accession No. X17033 (ITGA2, Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)), gene accession number (GeneBank accession No. ) U41763 (CLTCL1, Clathrin, heavy polypeptide-like 1), gene accession number (GeneBank accession No. NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene accession number (GeneBank accession No. ) NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse)), gene accession number (GeneBank accession No. ) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), gene accession number (GeneBank accession No. NM_017555 (EGLN2, Egl nine homolog 2 (C.  elegans), GeneBank accession No. NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), gene accession number (GeneBank accession No. NM_004148 (NINJ1, Ninjurin 1), gene accession number (GeneBank accession No. ) NM_003377 (VEGFB, Vascular endothelial growth factor B), gene accession number (GeneBank accession No. ) NM_001983 (ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)), GeneBank accession No. ) NM_001552 (IGFBP4, Insulin-like growth factor binding protein 4), gene registration number (GeneBank accession No. ) NM_001430 (EPAS1, Endothelial PAS domain protein 1), Gene accession number (GeneBank accession No. NM_001300 (KLF6, Kruppel-like factor 6), gene accession number (GeneBank accession No. ) NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2), gene accession number (GeneBank accession No. NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (GeneBank accession No. ) NM_000474 (TWIST1, Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila)), Gene Accession No. ) BX649103 (ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), Gene Accession No. ) BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), gene accession number (GeneBank accession No. ) BM904612 (S100A6, S100 calcium binding protein A6 (calcyclin)), gene accession number (GeneBank accession No. ) BM556279 (EMP3, Epithelial membrane protein 3), gene accession number (GeneBank accession No. ) BC015041 (VAT1, Family with sequence similarity 82, member C), gene accession number (GeneBank accession No. ) AY258066 (OKL38, Pregnancy-induced growth inhibitor), gene accession number (GeneBank accession No. ) AK126729 (NDRG4, NDRG family member 4), gene accession number (GeneBank accession No. ) AK090459 (NFE2L1, Nuclear factor (erythroid-derived 2) -like 1), gene accession number (GeneBank accession No. ) AK074163 (ROBO4, Roundabout homolog 4, magic roundabout (Drosophila)), Gene accession number (GeneBank accession No. ) AK024680 (FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), gene accession number (GeneBank accession No. ) AF176422 (HEY1, Hairy / enhancer-of-split related with YRPW motif 1), gene accession number (GeneBank accession No. ) AF003837 (JAG1, Jagged 1 (Alagille syndrome)), gene accession number (GeneBank accession No. ) AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), GeneBank accession No. ) AB011150 (NRXN1, Neurexin 1), gene accession number (GeneBank accession No. ) NM_201589 (MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)), gene accession number (GeneBank accession No. NM_052999 (CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), gene accession number (GeneBank accession No. NM_006644 (HSPH1, Heat shock 105kDa / 110kDa protein 1), gene registration number (GeneBank accession No. NM_005438 (FOSL1, FOS-like antigen 1), gene accession number (GeneBank accession No. ) NM_004996 (ABCC1, ATP-binding cassette, sub-family C (CFTR / MRP), member 1), gene accession number (GeneBank accession No. ) NM_002658 (PLAU, Plasminogen activator, urokinase), gene accession number (GeneBank accession No. ) NM_001353 (AKR1C1, Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)), gene accession number (GeneBank accession No. ) H18681 (C20orf139, Sulfiredoxin 1 homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) DR004094 (HAMP, Hepcidin antimicrobial peptide), gene accession number (GeneBank accession No. ) BC082272 (KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), Gene Accession No. ) BC040494 (DNAJB2, DnaJ (Hsp40) homolog, subfamily B, member 2), gene registration number (GeneBank accession No. ) BC018064 (ATF6, Activating transcription factor 6), gene accession number (GeneBank accession No. ) BC006523 (SGK2, Serum / glucocorticoid regulated kinase 2), gene registration number (GeneBank accession No. ) AK090482 (CXCL12, Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)), gene accession number (GeneBank accession No. ) AF219946 (TULP4, Tubby like protein 4), gene accession number (GeneBank accession No. ) AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), gene accession number (GeneBank accession No. ) NM_005242 (F2RL1, Coagulation factor II (thrombin) receptor-like 1), gene accession number (GeneBank accession No. ) NM_001002029 (C4A, Complement component 4B, telomeric), Gene accession number (GeneBank accession No. ) NM_000539 (RHO, Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)), gene accession number (GeneBank accession No. ) BX649164 (PAI, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene registration number (GeneBank accession No. ) BM918324 (LY96, Lymphocyte antigen 96), gene accession number (GeneBank accession No. ) AB209647 (NCF2, Neutrophil cytosolic factor 2 (65 kDa, chronic granulomatous disease, autosomal 2)), gene accession number (GeneBank accession No. ) NM_152221 (CSNK1E, Casein kinase 1, epsilon), Gene accession number (GeneBank accession No. ) NM_017999 (RNF31, Ring finger protein 31), gene accession number (GeneBank accession No. ) NM_016819 (OGG1, 8-oxoguanine DNA glycosylase), Gene Accession No. ) NM_016816 (OAS1, 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa), Gene Accession No. NM_012235 (SCAP, SREBP cleavage-activating protein), gene accession number (GeneBank accession No. ) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), gene accession number (GeneBank accession No. ) NM_001779 (CD58, CD58 antigen, (lymphocyte function-associated antigen 3)), gene accession number (GeneBank accession No. ) CB055213 (ICOSLG, Inducible T-cell co-stimulator ligand), Gene accession number (GeneBank accession No. ) BX641029 (MASP1, Mannan-binding lectin serine peptidase 1 (C4 / C2 activating component of Ra-reactive factor)), GeneBank accession No. ) BQ053419 (BATF, Basic leucine zipper transcription factor, ATF-like), Gene Accession No. ) BC039299 (STIP1, Stress-induced-phosphoprotein 1 (Hsp70 / Hsp90-organizing protein)), gene accession number (GeneBank accession No. ) AY055760 (DAF, Decay accelerating factor for complement (CD55, Cromer blood group system)), gene accession number (GeneBank accession No. ) AK130188 (FGR, Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog), Gene Accession No. ) AK095326 (MUS81, MUS81 endonuclease homolog (yeast)), gene accession number (GeneBank accession No. NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde binding 1), gene registration number (GeneBank accession No. ) NM_003004 (SECTM1, Secreted and transmembrane 1), gene accession number (GeneBank accession No. ) NM_002309 (LIF, Hypothetical protein MGC20647), gene accession number (GeneBank accession No. ) NM_001421 (ELF4, E74-like factor 4 (ets domain transcription factor)), gene accession number (GeneBank accession No. ) NM_000418 (IL4R, Interleukin 4 receptor), gene accession number (GeneBank accession No. ) BI909222 (FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), gene accession number (GeneBank accession No. ) BF569086 (NK4, Interleukin 32), gene accession number (GeneBank accession No. ) BC014470 (AZGP1, Alpha-2-glycoprotein 1, zinc), gene accession number (GeneBank accession No. ) BC020744 (AKR1C4, Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol), dehydrogenase 4), gene accession number (GeneBank accession No. ) BQ939577 (AKR1C3, Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)), gene accession number (GeneBank accession No. ) NM_000499 (CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) NM_030622 (CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), gene accession number (GeneBank accession No. ) NM_184041 (ALDOA, Aldolase A, fructose-bisphosphate), gene accession number (GeneBank accession No. ) NM_024307 (MGC4171, Hypothetical protein LOC283901), gene accession number (GeneBank accession No. ) NM_005336 (HDLBP, High density lipoprotein binding protein (vigilin)), gene registration number (GeneBank accession No. ) NM_002627 (PFKP, Phosphofructokinase, platelet), Gene Registration Number (GeneBank accession No. ) BX648281 (LDLR, low density lipoprotein receptor (familial hypercholesterolemia)), gene accession number (GeneBank accession No. ) BC069201 (FLJ22761, Hexokinase domain containing 1), gene accession number (GeneBank accession No. ) BC030207 (NR0B2, Nuclear receptor subfamily 0, group B, member 2), gene accession number (GeneBank accession No. ) AL833069 (KIAA1434, Hypothetical protein KIAA1434), gene accession number (GeneBank accession No. ) AK124656 (ENO2, Enolase 2 (gamma, neuronal)), gene accession number (GeneBank accession No. ) AK094474 (RHOC, Ras homolog gene family, member C), gene accession number (GeneBank accession No. ) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene accession number (GeneBank accession No. ) AB053232 (GAL3ST3, Galactose-3-O-sulfotransferase 3), gene accession number (GeneBank accession No. ) AB045292 (TMEM8, Transmembrane protein 8 (five membrane-spanning domains)), gene accession number (GeneBank accession No. ) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), Gene accession number (GeneBank accession No. ) NM_002900 (RBP3, Retinol binding protein 3, interstitial), gene accession number (GeneBank accession No. ) NM_001995 (ACSL1, Acyl-CoA synthetase long-chain family member 1), gene accession number (GeneBank accession No. NM_000018 (ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), gene accession number (GeneBank accession No. ) BC094756 (CRA, Myotubularin related protein 11), gene accession number (GeneBank accession No. ) BC050553 (NTE, Neuropathy target esterase), gene accession number (GeneBank accession No. ) BC033110 (HSD17B1, Hydroxysteroid (17-beta) dehydrogenase 1), Gene accession number (GeneBank accession No. ) AY268890 (TPP1, Tripeptidyl peptidase I), gene accession number (GeneBank accession No. ) AK172798 (CPT1A, Carnitine palmitoyltransferase 1A (liver)), gene accession number (GeneBank accession No. ) AK096809 (CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), gene accession number (GeneBank accession No. ) AK000600 (SIAT7D, ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), Gene accession number ) AB002454 (CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), gene accession number (GeneBank accession No. ) Z29093 (DDR1, Discoidin domain receptor family, member 1), gene accession number (GeneBank accession No. ) Z25424 (MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (GeneBank accession No. ) XM_291277 (DKFZp761P0423, Hypothetical protein DKFZp761P0423), gene accession number (GeneBank accession No. XM_038150 (MAST3, Microtubule associated serine / threonine kinase 3), gene accession number (GeneBank accession No. ) U88357 (ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)), gene accession number (GeneBank accession No. ) NM_025195 (TRIB1, Tribbles homolog 1 (Drosophila)), gene accession number (GeneBank accession No. ) NM_020639 (RIPK4, Receptor-interacting serine-threonine kinase 4), gene accession number (GeneBank accession No. ) NM_014172 (PHPT1, Phosphohistidine phosphatase 1), Gene accession number (GeneBank accession No. ) NM_006254 (PRKCD, Protein kinase C, delta), Gene accession number (GeneBank accession No. ) NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), gene accession number (GeneBank accession No. ) NM_005026 (PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), Gene accession number (GeneBank accession No. ) NM_004431 (EPHA2, EPH receptor A2), gene accession number (GeneBank accession No. ) NM_004419 (DUSP5, Dual specificity phosphatase 5), gene accession number (GeneBank accession No. ) NM_004327 (BCR, Breakpoint cluster region), Gene accession number (GeneBank accession No. ) NM_004231 (ATP6V1F, ATPase, H + transporting, lysosomal 14kDa, V1 subunit F), gene registration number (GeneBank accession No. ) NM_004090 (DUSP3, Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)), gene accession number (GeneBank accession No. ) NM_002843 (PTPRJ, Protein tyrosine phosphatase, receptor type, J), gene accession number (GeneBank accession No. NM_002496 (NDUFS8, NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23 kDa (NADH-coenzyme Q reductase)), gene accession number (GeneBank accession No. NM_001001852 (PIM3, Pim-3 oncogene), gene accession number (GeneBank accession No. ) L76191 (IRAK1, Interleukin-1 receptor-associated kinase 1), gene accession number (GeneBank accession No. ) D15049 (PTPRH, Protein tyrosine phosphatase, receptor type, H), gene accession number (GeneBank accession No. ) BC065207 (ATP6V0D2, ATPase, H + transporting, lysosomal 38kDa, V0 subunit d isoform 2), gene accession number (GeneBank accession No. ) BC035578 (STK24, Serine / threonine kinase 24 (STE20 homolog, yeast)), gene accession number (GeneBank accession No. ) BC028724 (DUSP18, Dual specificity phosphatase 18), gene accession number (GeneBank accession No. AL117482 (ULK3, Unc-51-like kinase 3 (C.  elegans), GeneBank accession No. ) AK126879 (PCTK3, PCTAIRE protein kinase 3), gene accession number (GeneBank accession No. ) AB209416 (ILK, Integrin-linked kinase-2), gene accession number (GeneBank accession No. ) NM_000782 (CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) CR597101 (ZFP36, Zinc finger protein 36, C3H type, homolog (mouse)), Gene accession number (GeneBank accession No. ) CR936799 (FHL2, Four and a half LIM domains 2), gene accession number (GeneBank accession No. ) M24898 (NR1D1, Nuclear receptor subfamily 1, group D, member 1), gene accession number (GeneBank accession No. ) AF132818 (KLF5, Kruppel-like factor 5 (intestinal)), gene accession number (GeneBank accession No. ) AK055337 (ZNF213, Zinc finger protein 213), Gene accession number (GeneBank accession No. ) BC008834 (PHF1, PHD finger protein 1), gene accession number (GeneBank accession No. ) AK126918 (GLIS2, GLIS family zinc finger 2), Gene accession number (GeneBank accession No. ) BC042692 (CTL2, Solute carrier family 44, member 2), gene accession number (GeneBank accession No. ) NM_002224 (ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), gene accession number (GeneBank accession No. ) AK095363 (AQP3, Aquaporin 3), gene accession number (GeneBank accession No. NM_174953 (ATP2A3, ATPase, Ca ++ transporting, ubiquitous), gene accession number (GeneBank accession No. ) BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)), GeneBank Accession No. NM_016113 (TRPV2, Transient receptor potential cation channel, subfamily V, member 2), gene accession number (GeneBank accession No. ) BM926478 (RBP1, Retinol binding protein 1, cellular), gene accession number (GeneBank accession No. NM_000069 (CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), Gene Registration Number (GeneBank accession No. ) AK002107 (RAB3B, RAB3B, member RAS oncogene family), gene accession number (GeneBank accession No. ) NM_013321 (SNX8, Sorting nexin 8), Gene accession number (GeneBank accession No. ) AK125026 (SLC6A12, Solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12), gene accession number (GeneBank accession No. ) NM_005843 (STAM2, Signal transducing adapter molecule (SH3 domain and ITAM motif) 2), gene accession number (GeneBank accession No. ) AK092512 (SLC16A5, Solute carrier family 16 (monocarboxylic acid transporters), member 5), gene accession number (GeneBank accession No. ) U49248 (ABCC2, ATP-binding cassette, sub-family C (CFTR / MRP), member 2), gene accession number (GeneBank accession No. ) AK172792 (SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), gene accession number (GeneBank accession No. ) BC044656 (CASC3, Cancer susceptibility candidate 3), gene accession number (GeneBank accession No. NM_203403 (C9orf150, Chromosome 9 open reading frame 150), gene accession number (GeneBank accession No. NM_080388 (S100A16, S100 calcium binding protein A16), gene registration number (GeneBank accession No. NM_031286 (SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), gene accession number (GeneBank accession No. NM_022153 (PP2135, Chromosome 10 open reading frame 54), gene accession number (GeneBank accession No. ) NM_004864 (GDF15, Growth differentiation factor 15), Gene accession number (GeneBank accession No. ) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene accession number (GeneBank accession No. ) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), gene accession number (GeneBank accession No. ) BX537968 (LOC51149, Hypothetical LOC51149), gene accession number (GeneBank accession No. BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), gene accession number (GeneBank accession No. ) BQ683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), gene accession number (GeneBank accession No. ) BQ276852 (TMSB10, Thymosin, beta 10), gene accession number (GeneBank accession No. ) AK126182 (KIAA1949, KIAA1949), gene accession number (GeneBank accession No. ) AK124751 (CAPN2, Calpain 2, (m / II) large subunit), gene accession number (GeneBank accession No. ) AK095079 (RGC32, Response gene to complement 32), gene accession number (GeneBank accession No. ) AB075871 (FLJ42654, Golgi transport 1 homolog A (S.  cerevisiae)), gene accession number (GeneBank accession No. ) AK125150 (MAPK8, Mitogen-activated protein kinase 8), gene registration number (GeneBank accession No. ) NM_002758 (MAP2K6, Mitogen-activated protein kinase kinase 6), gene accession number (GeneBank accession No. ) NM_004612 (TGFBR1, Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kDa)), gene accession number (GeneBank accession No. NM_145686 (MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4), gene accession number (GeneBank accession No. ) XM_042066 (MAP3K1, Mitogen-activated protein kinase kinase kinase 1), gene accession number (GeneBank accession No. ) AB011123 (TNIK, TRAF2 and NCK interacting kinase), gene accession number (GeneBank accession No. ) AB209031 (C5, Complement component 5), gene accession number (GeneBank accession No. NM_022740 (HIPK2, Homeodomain interacting protein kinase 2), gene accession number (GeneBank accession No. ) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), gene accession number (GeneBank accession No. ) AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)), GeneBank accession No. ) AB209211 (TIA1, TIA1 cytotoxic granule-associated RNA binding protein), gene accession number (GeneBank accession No. ) AB209613 (DNASE1L3, Deoxyribonuclease I-like 3), Gene accession number (GeneBank accession No. ) AK122825 (HMGB1, High-mobility group box 1), gene accession number (GeneBank accession No. ) AK127326 (PHF17, PHD finger protein 17), gene accession number (GeneBank accession No. ) AK223503 (CASP1, Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), gene accession number (GeneBank accession No. ) BC013326 (GAS2, Growth arrest-specific 2), Gene accession number (GeneBank accession No. ) BC047698 (IL7, Interleukin 7), gene accession number (GeneBank accession No. D79987 (ESPL1, Extra spindle poles like 1 (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_000893 (KNG1, Kininogen 1), gene accession number (GeneBank accession No. ) NM_001012271 (BIRC5, Effector cell peptidase receptor 1), gene accession number (GeneBank accession No. ) NM_004938 (DAPK1, Death-associated protein kinase 1), gene accession number (GeneBank accession No. NM_005879 (TRIP, TRAF interacting protein), gene accession number (GeneBank accession No. NM_014739 (BCLAF1, BCL2-associated transcription factor 1), gene accession number (GeneBank accession No. ) NM_018947 (CYCS, Cytochrome c, somatic), Gene accession number (GeneBank accession No. ) AB033337 (MPHOSPH1, M-phase phosphoprotein 1), gene accession number (GeneBank accession No. ) AB209179 (PLK1, Polo-like kinase 1 (Drosophila)), gene accession number (GeneBank accession No. ) AB209337 (CDC7, CDC7 cell division cycle 7 (S.  cerevisiae)), gene accession number (GeneBank accession No. ) AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)), gene accession number (GeneBank accession No. ) AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)), Gene Accession No. ) AF345347 (SPAG5, Sperm associated antigen 5), gene accession number (GeneBank accession No. ) AK092638 (CCNG2, Cyclin G2), gene accession number (GeneBank accession No. ) AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), gene accession number (GeneBank accession No. ) AL833191 (SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1 (yeast)), gene accession number (GeneBank accession No. ) AY257469 (CIT, Citron (rho-interacting, serine / threonine kinase 21)), gene accession number (GeneBank accession No. ) AY367065 (ASPM, Abnormal Spindle-like, microcephaly associated (Drosophila)), GeneBank Accession No. ) BC011000 (CDCA5, Cell division cycle associated 5), gene accession number (GeneBank accession No. ) BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), gene accession number (GeneBank accession No. ) BC043502 (NEK2, never in mitosis gene a) -related kinase 2), gene accession number (GeneBank accession No. BU675073 (PTTG1, Pituitary tumor-transforming 1), gene accession number (GeneBank accession No. ) BX647885 (STMN1, Stathmin 1 / oncoprotein 18), gene accession number (GeneBank accession No. ) CR592757 (BRRN1, Barren homolog 1 (Drosophila)), gene accession number (GeneBank accession No. CR597075 (MAPRE2, Microtubule-associated protein, RP / EB family, member 2), gene accession number (GeneBank accession No. ) CR604810 (CCNA2, Cyclin A2), gene accession number (GeneBank accession No. CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), Gene accession number (GeneBank accession No. ) NM_000919 (PAM, Peptidylglycine alpha-amidating monooxygenase), gene accession number (GeneBank accession No. ) NM_001790 (CDC25C, Cell division cycle 25C), Gene accession number (GeneBank accession No. NM_001798 (CDK2, Cyclin-dependent kinase 2), gene accession number (GeneBank accession No. ) NM_001813 (CENPE, Centromere protein E, 312kDa), Gene accession number (GeneBank accession No. ) NM_003318 (TTK, TTK protein kinase), gene accession number (GeneBank accession No. ) NM_003981 (PRC1, Protein regulator of cytokinesis 1), gene accession number (GeneBank accession No. NM_004523 (KIF11, Kinesin family member 11), gene accession number (GeneBank accession No. ) NM_004701 (CCNB2, Cyclin B2), gene accession number (GeneBank accession No. ) NM_005983 (SKP2, S-phase kinase-associated protein 2 (p45)), gene accession number (GeneBank accession No. NM_006101 (KNTC2, Kinetochore associated 2), gene accession number (GeneBank accession No. ) NM_006845 (KIF2C, Kinesin family member 2C), gene accession number (GeneBank accession No. ) NM_007375 (TARDBP, TAR DNA binding protein), gene registration number (GeneBank accession No. ) NM_012112 (TPX2, TPX2, microtubule-associated, homolog (Xenopus laevis)), gene accession number (GeneBank accession No. ) NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), gene accession number (GeneBank accession No. ) NM_015097 (CLASP2, Cytoplasmic linker associated protein 2), gene accession number (GeneBank accession No. ) NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), gene accession number (GeneBank accession No. NM_016426 (GTSE1, G-2 and S-phase expressed 1), gene accession number (GeneBank accession No. ) NM_018492 (PBK, PDZ binding kinase), gene accession number (GeneBank accession No. NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), gene accession number (GeneBank accession No. ) NM_020242 (KNSL7, Kinesin family member 15), gene accession number (GeneBank accession No. ) NM_031966 (CCNB1, Cyclin B1), gene accession number (GeneBank accession No. NM_138555 (KIF23, Kinesin family member 23), gene accession number (GeneBank accession No. ) U65410 (MAD2L1, MAD2 mitotic arrest deficient-like 1 (yeast)), gene accession number (GeneBank accession No. ) AB020656 (CYLD, Cylindromatosis (turban tumor syndrome)), Gene Accession Number (GeneBank accession No. ) AF033122 (SESN1, Sestrin 1), gene accession number (GeneBank accession No. ) AK074377 (UHRF1, Chromosome 19 open reading frame 31), gene accession number (GeneBank accession No. ) AK091170 (CDKN2C, Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)), gene accession number (GeneBank accession No. ) AK094323 (NFYC, Nuclear transcription factor Y, gamma), gene accession number (GeneBank accession No. ) AY366508 (LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), GeneBank accession No. ) BC033086 (TCF19, Transcription factor 19 (SC1)), gene accession number (GeneBank accession No. ) BC040303 (PTP4A1, Protein tyrosine phosphatase type IVA, member 1), Gene accession number (GeneBank accession No. ) BC040991 (TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2)), gene accession number (GeneBank accession No. BC092412 (SGOL2, Shugoshin-like 2 (S.  pombe), GeneBank accession No. ) BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), gene accession number (GeneBank accession No. ) BX649128 (SESN3, Sestrin 3), gene accession number (GeneBank accession No. ) CD049340 (AURKB, Aurora kinase B), gene accession number (GeneBank accession No. ) M89914 (NF1, Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)), gene accession number (GeneBank accession No. NM_001005414 (ZWINT, ZW10 interactor antisense), gene accession number (GeneBank accession No. ) NM_001008491 (Sep 2, Septin 2), gene accession number (GeneBank accession No. NM_001274 (CHEK1, CHK1 checkpoint homolog (S.  pombe), GeneBank accession No. NM_002105 (H2AFX, H2A histone family, member X), gene accession number (GeneBank accession No. NM_002388 (MCM3, MCM3 minichromosome maintenance deficient 3 (S.  cerevisiae)), gene accession number (GeneBank accession No. NM_002417 (MKI67, Antigen identified by monoclonal antibody Ki-67), gene accession number (GeneBank accession No. NM_002875 (RAD51, RAD51 homolog (RecA homolog, E.  coli) (S.  cerevisiae)), gene accession number (GeneBank accession No. NM_003884 (PCAF, P300 / CBP-associated factor), gene accession number (GeneBank accession No. NM_004526 (MCM2, MCM2 minichromosome maintenance deficient 2, mitotin (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_004847 (AIF1, Allograft inflammatory factor 1), gene accession number (GeneBank accession No. NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S.  pombe) (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_012090 (MACF1, Microtubule-actin crosslinking factor 1), Gene Registration Number (GeneBank accession No. NM_012415 (RAD54B, RAD54 homolog B (S.  cerevisiae)), gene accession number (GeneBank accession No. ) NM_014264 (PLK4, Polo-like kinase 4 (Drosophila)), gene accession number (GeneBank accession No. ) NM_015714 (G0S2, G0 / G1switch 2), gene accession number (GeneBank accession No. NM_024680 (FLJ23311, E2F transcription factor 8), gene accession number (GeneBank accession No. XM_034274 (MYBL1, V-myb myeloblastosis viral oncogene homolog (avian) -like 1), gene accession number (GeneBank accession No. ) AK001720 (FLJ10858, Nei endonuclease VIII-like 3 (E.  coli)), and GeneBank accession No. ) AY032677 (POLQ, Polymerase (DNA directed), theta), Gene Accession No. ) BC034480 (BLM, Bloom syndrome), Gene accession number (GeneBank accession No. BC073161 (RAD51C, RAD51 homolog C (S.  cerevisiae)), gene accession number (GeneBank accession No. CR600021 (HMGB2, High-mobility group box 2), gene accession number (GeneBank accession No. CR625391 (RAD51AP1, RAD51 associated protein 1), gene accession number (GeneBank accession No. CR936783 (FLJ40869, Hypothetical protein LOC284952), gene accession number (GeneBank accession No. ) DQ140356 (KIAA1596, Fanconi anemia, complementation group M), gene accession number (GeneBank accession No. ) NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), gene accession number (GeneBank accession No. ) NM_001618 (PARP1, Poly (ADP-ribose) polymerase family, member 1), gene accession number (GeneBank accession No. ) NM_003362 (UNG, Uracil-DNA glycosylase), gene accession number (GeneBank accession No. ) NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), Gene accession number (GeneBank accession No. ) NM_130398 (EXO1, Exonuclease 1), gene accession number (GeneBank accession No. ) AB020807 (TLR6, Toll-like receptor 6), gene accession number (GeneBank accession No. ) AB032980 (DCDC2, Doublecortin domain containing 2), gene accession number (GeneBank accession No. ) AB209866 (TFPI, Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)), gene accession number (GeneBank accession No. ) AK057015 (HSPA4, Heat shock 70kDa protein 4), Gene accession number (GeneBank accession No. ) AK095515 (IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), gene accession number (GeneBank accession No. ) AK122686 (IF, I factor (complement), gene accession number (GeneBank accession No. ) AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide), gene accession number (GeneBank accession No. ) BC035582 (TRIM22, Tripartite motif-containing 22), gene accession number (GeneBank accession No. ) BX537894 (LOC493869, Similar to RIKEN cDNA 2310016C16), gene accession number (GeneBank accession No. ) M14338 (PROS1, Protein S (alpha)), gene accession number (GeneBank accession No. ) NM_000821 (GGCX, Gamma-glutamyl carboxylase), gene accession number (GeneBank accession No. ) NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), Gene Accession No. NM_001001547 (CD36, CD36 antigen (collagen type I receptor, thrombospondin receptor)), gene accession number (GeneBank accession No. NM_001512 (GSTA4, Glutathione S-transferase A4), gene accession number (GeneBank accession No. NM_001629 (ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), gene accession number (GeneBank accession No. ) NM_001752 (CAT, Catalase), gene accession number (GeneBank accession No. NM_001837 (CCR3, Chemokine (C-C motif) receptor 3), gene accession number (GeneBank accession No. ) NM_001979 (EPHX2, Epoxide hydrolase 2, cytoplasmic), gene registration number (GeneBank accession No. ) NM_001994 (F13B, Coagulation factor XIII, B polypeptide), gene accession number (GeneBank accession No. ) NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), gene accession number (GeneBank accession No. ) NM_006120 (HLA-DMA, Major histocompatibility complex, class II, DM alpha), Gene accession number (GeneBank accession No. NM_173216 (SIAT1, ST6 beta-galactosamide alpha-2,6-sylyltranferase 1), gene accession number (GeneBank accession No. NM_202002 (FOXM1, Forkhead box M1), gene accession number (GeneBank accession No. ) AB163917 (LRAP, Leukocyte-derived arginine aminopeptidase), Gene accession number (GeneBank accession No. ) BC027881 (AFP, Alpha-fetoprotein), gene accession number (GeneBank accession No. ) NM_015915 (SPG3A, Spastic paraplegia 3A (autosomal dominant)), gene accession number (GeneBank accession No. ) NM_000671 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), gene registration number (GeneBank accession No. ) J05428 (UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), gene accession number (GeneBank accession No. ) NM_000672 (ADH6, Alcohol dehydrogenase 6 (class V)), gene accession number (GeneBank accession No. ) M15943 (ADH4, Alcohol dehydrogenase 4 (class II), pi polypeptide), gene accession number (GeneBank accession No. ) AK223395 (FBP1, Fructose-1,6-bisphosphatase 1), gene accession number (GeneBank accession No. NM_000151 (G6PC, Glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)), gene accession number (GeneBank accession No. XM_113962 (KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), gene accession number (GeneBank accession No. ) AB020644 (ACSL6, Acyl-CoA synthetase long-chain family member 6), gene accession number (GeneBank accession No. ) AB209907 (PLD1, Phospholipase D1, phophatidylcholine-specific), gene accession number (GeneBank accession No. ) AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1), member 1), gene accession number (GeneBank accession No. ) AF297872 (TRERF1, Transcriptional regulating factor 1), gene registration number (GeneBank accession No. ) AF303134 (ALDH8A1, Aldehyde dehydrogenase 8 family, member A1), gene accession number (GeneBank accession No. ) AF339053 (PLA2G12B, Phospholipase A2, group XIIB), gene accession number (GeneBank accession No. ) AK096018 (HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), gene accession number (GeneBank accession No. ) AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), gene registration number (GeneBank accession No. ) AK127346 (SIAT9, ST3 beta-galactoside alpha-2,3- sialyltransferase 5), gene accession number (GeneBank accession No. ) AL359559 (AGPS, Alkylglycerone phosphate synthase), gene accession number (GeneBank accession No. ) AY691170 (PLCL3, Phospholipase C-like 3), gene accession number (GeneBank accession No. ) BG567934 (APOM, Apolipoprotein M), gene accession number (GeneBank accession No. ) BX538214 (C6orf167, Chromosome 6 open reading frame 167), gene accession number (GeneBank accession No. ) BX640945 (FADS2, Fatty acid desaturase 2), gene accession number (GeneBank accession No. ) BX648473 (PIGK, Phosphatidylinositol glycan, class K), gene accession number (GeneBank accession No. ) BX648557 (HSD17B2, Hydroxysteroid (17-beta) dehydrogenase 2), Gene accession number (GeneBank accession No. ) CR749601 (ETNK1, Death-associated protein kinase 3), gene accession number (GeneBank accession No. ) NM_000859 (HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), gene accession number (GeneBank accession No. ) NM_001443 (FABP1, Fatty acid binding protein 1, liver), gene accession number (GeneBank accession No. ) NM_002130 (HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)), gene accession number (GeneBank accession No. ) NM_003725 (RODH, Hydroxysteroid (17-beta) dehydrogenase 6), Gene accession number (GeneBank accession No. NM_004845 (PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), Gene accession number (GeneBank accession No. ) NM_014762 (DHCR24, 24-dehydrocholesterol reductase), gene accession number (GeneBank accession No. ) NM_020139 (DHRS6, Dehydrogenase / reductase (SDR family) member 6), gene registration number (GeneBank accession No. NM_020918 (GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), gene accession number (GeneBank accession No. NM_032523 (OSBPL6, Oxysterol binding protein-like 6), gene accession number (GeneBank accession No. ) NM_033505 (SELI, Selenoprotein I), gene accession number (GeneBank accession No. ) Z28339 (AKR1D1, Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)), GeneBank accession No. ) AK024899 (ENPP3, Ectonucleotide pyrophosphatase / phosphodiesterase 3), gene accession number (GeneBank accession No. ) AK025546 (PTPN4, Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)), Gene accession number (GeneBank accession No. ) AK124910 (ENPP2, Ectonucleotide pyrophosphatase / phosphodiesterase 2 (autotaxin)), gene accession number (GeneBank accession No. ) BC035116 (FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), gene registration number (GeneBank accession No. ) BC050565 (PASK, PAS domain containing serine / threonine kinase), gene accession number (GeneBank accession No. ) L13436 (NPR2, Natriuretic peptide receptor B / guanylate cyclase B (atrionatriuretic peptide receptor B)), gene accession number (GeneBank accession No. ) NM_001005862 (ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro / glioblastoma derived oncogene homolog (avian)), gene accession number (GeneBank accession No. NM_005012 (ROR1, Receptor tyrosine kinase-like orphan receptor 1), gene accession number (GeneBank accession No. NM_006035 (CDC42BPB, CDC42 binding protein kinase beta (DMPK-like)), gene accession number (GeneBank accession No. NM_014791 (MELK, Maternal embryonic leucine zipper kinase), gene accession number (GeneBank accession No. NM_023028 (FGFR2, Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), gene registration number (GeneBank accession No. ) NM_080836 (STK35, Serine / threonine kinase 35), gene accession number (GeneBank accession No. ) AF419331 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), gene accession number (GeneBank accession No. ) AK091927 (SFRS3, Splicing factor, arginine / serine-rich 3), gene accession number (GeneBank accession No. ) BC010266 (HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), gene accession number (GeneBank accession No. ) BC012360 (CTAGE5, CTAGE family, member 5), gene accession number (GeneBank accession No. ) BC036046 (PLRG1, Pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)), gene accession number (GeneBank accession No. BC065384 (PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) BX537360 (CPSF5, Nudix (nucleoside diphosphate linked moiety X) -type motif 21), GeneBank accession No. ) BX537494 (HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2 / B1), gene accession number (GeneBank accession No. ) BX647784 (HNRPR, Heterogeneous nuclear ribonucleoprotein R), gene registration number (GeneBank accession No. ) CA455267 (PPIH, Peptidyl prolyl isomerase H (cyclophilin H)), gene accession number (GeneBank accession No. ) CR596214 (HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), gene accession number (GeneBank accession No. NM_001326 (CSTF3, Hypothetical protein LOC283267), gene accession number (GeneBank accession No. ) NM_004640 (BAT1, HLA-B associated transcript 1), gene accession number (GeneBank accession No. NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), gene accession number (GeneBank accession No. ) NM_006924 (SFRS1, Splicing factor, arginine / serine-rich 1 (splicing factor 2, alternate splicing factor)), gene accession number (GeneBank accession No. ) NM_012426 (SF3B3, Splicing factor 3b, subunit 3, 130 kDa), Gene accession number (GeneBank accession No. NM_018048 (FLJ10292, Mago-nashi homolog), gene accession number (GeneBank accession No. NM_030919 (C20orf129, Chromosome 20 open reading frame 129), gene accession number (GeneBank accession No. ) NM_031370 (HNRPD, Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa)), gene registration number (GeneBank accession No. ) NM_138933 (ACF, Apobec-1 complementation factor), gene accession number (GeneBank accession No. ) AB193259 (ACE2, Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2), gene accession number (GeneBank accession No. ) BX648769 (EWSR1, Ewing sarcoma breakpoint region 1), gene accession number (GeneBank accession No. ) AB023154 (DTX4, Deltex 4 homolog (Drosophila)), gene accession number (GeneBank accession No. ) AL543755 (VAV3, Vav 3 oncogene), gene accession number (GeneBank accession No. ) M75106 (CPB2, Carboxypeptidase B2 (plasma, carboxypeptidase U)), gene accession number (GeneBank accession No. NM_021045 (ZNF248, Zinc finger protein 248), gene accession number (GeneBank accession No. ) AB209194 (B4GALT6, UDP-Gal: betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6), gene accession number (GeneBank accession No. ) AF279145 (ANTXR1, Anthrax toxin receptor 1), gene accession number (GeneBank accession No. ) NM_025074 (FRAS1, Fraser syndrome 1), gene accession number (GeneBank accession No. ) AK025790 (KIF20A, Kinesin family member 20A), gene accession number (GeneBank accession No. ) NM_006152 (LRMP, Lymphoid-restricted membrane protein), gene accession number (GeneBank accession No. ) NM_000340 (SLC2A2, Solute carrier family 2 (facilitated glucose transporter), member 2), gene accession number (GeneBank accession No. ) AF071592 (KIF4A, Kinesin family member 4A), gene accession number (GeneBank accession No. NM_013277 (RACGAP1, Rac GTPase activating protein 1), gene accession number (GeneBank accession No. ) AY043484 (SCN1A, Sodium channel, voltage-gated, type I, alpha), Gene Registration Number (GeneBank accession No. ) AY791349 (KIF18A, Kinesin family member 18A), gene accession number (GeneBank accession No. ) NM_018018 (SLC38A4, Solute carrier family 38, member 4), gene accession number (GeneBank accession No. ) AK094603 (FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590. ), Gene accession number (GeneBank accession No. NM_021069 (ARGBP2, Sorbin and SH3 domain containing 2), gene accession number (GeneBank accession No. NM_001005747 (CACNB4, Calcium channel, voltage-dependent, beta 4 subunit), Gene accession number (GeneBank accession No. ) AJ496568 (SLC25A12, Solute carrier family 25 (mitochondrial carrier, Aralar), member 12), gene accession number (GeneBank accession No. ) NM_030641 (APOL6, Apolipoprotein L, 6), gene accession number (GeneBank accession No. NM_173512 (FLJ39822, Hypothetical protein FLJ39822), gene accession number (GeneBank accession No. ) NM_000037 (ANK1, Ankyrin 1, erythrocytic), gene accession number (GeneBank accession No. ) NM_001011554 (SLC13A3, Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3), gene accession number (GeneBank accession No. ) AB091343 (C10orf3, Centrosomal protein 55kDa), gene accession number (GeneBank accession No. ) AK000643 (ASB9, Ankyrin repeat and SOCS box-containing 9), gene accession number (GeneBank accession No. ) AK055221 (FBXO5, F-box protein 5), gene accession number (GeneBank accession No. ) AK075271 (SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like (aminotransferase 2)), gene accession number (GeneBank accession No. ) AK122685 (GLUD1, Glutamate dehydrogenase 1), gene accession number (GeneBank accession No. ) AK127098 (FLJ10706, Chromosome 1 open reading frame 112), gene accession number (GeneBank accession No. ) AL133031 (MLR1, Transcription factor MLR1), gene accession number (GeneBank accession No. ) AY007723 (MAL2, Mal, T-cell differentiation protein 2), gene accession number (GeneBank accession No. BC022255 (Spc25, Spindle pole body component 25 homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) BC041882 (ATF7IP2, Activating transcription factor 7 interacting protein 2), gene accession number (GeneBank accession No. ) BC052951 (LMNB1, Lamin B1), gene accession number (GeneBank accession No. ) BC098313 (FLJ20641, Hypothetical protein FLJ20641), gene accession number (GeneBank accession No. ) NM_001809 (CENPA, Centromere protein A, 17kDa), gene accession number (GeneBank accession No. NM_145061 (C13orf3, Chromosome 13 open reading frame 3), gene accession number (GeneBank accession No. XM_372695 (LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase (LOC390859), mRNA). 제 1항에 있어서, 하기 유전자가 페난트렌의 노출에 의해 발현이 증가하는 것을 특징으로 하는 바이오마커:The biomarker of claim 1, wherein the following genes are increased in expression by exposure to phenanthrene: 유전자 등록번호(GeneBank accession No.) NM_004420(DUSP8, Dual specificity phosphatase 8), 유전자 등록번호(GeneBank accession No.) L11329(DUSP2, Dual specificity phosphatase 2), 유전자 등록번호(GeneBank accession No.) BC094766(PKN1, Protein kinase N1), 유전자 등록번호(GeneBank accession No.) AY247738(TRIB3, Tribbles homolog 3(Drosophila)), 유전자 등록번 호(GeneBank accession No.) AK129595(GADD45B, Growth arrest and DNA-damage-inducible, beta), 유전자 등록번호(GeneBank accession No.) AB208849(SHC1, SHC(Src homology 2 domain containing) transforming protein 1), 유전자 등록번호(GeneBank accession No.) X02812(TGFB1, Transforming growth factor, beta 1(Camurati-Engelmann disease)),유전자 등록번호(GeneBank accession No.) NM_198951(TGM2, Transglutaminase 2(C polypeptide, protein-glutamine-gamma-glutamyltransferase)), 유전자 등록번호(GeneBank accession No.) NM_147780(CTSB, Cathepsin B), 유전자 등록번호(GeneBank accession No.) NM_078467(CDKN1A, Cyclin-dependent kinase inhibitor 1A(p21, Cip1)), 유전자 등록번호(GeneBank accession No.) NM_033027(AXUD1, AXIN1 up-regulated 1), 유전자 등록번호(GeneBank accession No.) NM_032797(AMID, Apoptosis-inducing factor(AIF)-like mitochondrion-associated inducer of death), 유전자 등록번호(GeneBank accession No.) NM_021960(MCL1, Myeloid cell leukemia sequence 1(BCL2-related)), 유전자 등록번호(GeneBank accession No.) NM_016639(TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), 유전자 등록번호(GeneBank accession No.) NM_016222(DDX41, DEAD(Asp-Glu-Ala-Asp) box polypeptide 41), 유전자 등록번호(GeneBank accession No.) NM_013246(CLC, Cardiotrophin-like cytokine factor 1), 유전자 등록번호(GeneBank accession No.) NM_004401(DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004281(BAG3, BCL2-associated athanogene 3), 유전자 등록번호(GeneBank accession No.) NM_003897(IER3, Immediate early response 3), 유전자 등록번호(GeneBank accession No.) NM_003806(HRK, Harakiri, BCL2 interacting protein(contains only BH3 domain)), 유전자 등록번호(GeneBank accession No.) NM_003639(IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), 유전자 등록번호(GeneBank accession No.) NM_003311(PHLDA2, Pleckstrin homology-like domain, family A, member 2), 유전자 등록번호(GeneBank accession No.) NM_002737(PRKCA, Protein kinase C, alpha), 유전자 등록번호(GeneBank accession No.) NM_002648(PIM1, Pim-1 oncogene), 유전자 등록번호(GeneBank accession No.) NM_002507(NGFR, Nerve growth factor receptor(TNFR superfamily, member 16)), 유전자 등록번호(GeneBank accession No.) NM_002305(LGALS1, Lectin, galactoside-binding, soluble, 1(galectin 1)), 유전자 등록번호(GeneBank accession No.) NM_001013398(IGFBP3, Insulin-like growth factor binding protein 3), 유전자 등록번호(GeneBank accession No.) BX640923(MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein(mouse)), 유전자 등록번호(GeneBank accession No.) BX537586(STK17A, Serine/threonine kinase 17a(apoptosis-inducing)), 유전자 등록번호(GeneBank accession No.) BG284742(P8, P8 protein(candidate of metastasis 1)), 유전자 등록번호(GeneBank accession No.) BE903247(PDCD6IP, Programmed cell death 6 interacting protein), 유전자 등록번호(GeneBank accession No.) BC027949(P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), 유전자 등록번호(GeneBank accession No.) BC006365(PSEN2, Presenilin 2(Alzheimer disease 4)), 유전자 등록번호(GeneBank accession No.) AY869712(PPP1R13L, Protein phosphatase 1, regulatory(inhibitor) subunit 13 like), 유전자 등록번호(GeneBank accession No.) AY028896(CARD10, Caspase recruitment domain family, member 10), 유전자 등록번호(GeneBank accession No.) AK122614(PPARD, Peroxisome proliferative activated receptor, delta), 유전자 등록번호(GeneBank accession No.) AK092872(ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2(xeroderma pigmentosum D)), 유전자 등록번호(GeneBank accession No.) AK092808(RRAGC, Ras-related GTP binding C), 유전자 등록번호(GeneBank accession No.) AJ001898(GDNF, Glial cell derived neurotrophic factor), 유전자 등록번호(GeneBank accession No.) AF220656(PHLDA1, Pleckstrin homology-like domain, family A, member 1), 유전자 등록번호(GeneBank accession No.) AF055634(UNC5C, Unc-5 homolog C(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB209485(VEGF, Vascular endothelial growth factor), 유전자 등록번호(GeneBank accession No.) AB096256(UNC5B, Unc-5 homolog B(C. elegans)), 유전자 등록번호(GeneBank accession No.) AB007960(SH3GLB1, SH3-domain GRB2-like endophilin B1), 유전자 등록번호(GeneBank accession No.) X06374(PDGFA, Platelet-derived growth factor alpha polypeptide), 유전자 등록번호(GeneBank accession No.) S62138(DDIT3, DNA-damage-inducible transcript 3), 유전자 등록 번호(GeneBank accession No.) NM_078487(CDKN2B, Cyclin-dependent kinase inhibitor 2B(p15, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) NM_012127(CIZ1, CDKN1A interacting zinc finger protein 1), 유전자 등록번호(GeneBank accession No.) NM_005883(APC2, Adenomatosis polyposis coli 2), 유전자 등록번호(GeneBank accession No.) NM_004196(CDKL1, Cyclin-dependent kinase-like 1(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_003236(TGFA, Transforming growth factor, alpha), 유전자 등록번호(GeneBank accession No.) NM_001261(CDK9, Cyclin-dependent kinase 9(CDC2-related kinase)), 유전자 등록번호(GeneBank accession No.) NM_001007271(DUSP13, Dual specificity phosphatase 13), 유전자 등록번호(GeneBank accession No.) CR749511(PARC, P53-associated parkin-like cytoplasmic protein), 유전자 등록번호(GeneBank accession No.) CR623038(ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), 유전자 등록번호(GeneBank accession No.) CR618371(EGFR, Epidermal growth factor receptor(erythroblastic leukemia viral(v-erb-b) oncogene homolog, avian)), 유전자 등록번호(GeneBank accession No.) BF965144(IFITM1, Interferon induced transmembrane protein 1(9-27)), 유전자 등록번호(GeneBank accession No.) AK127679(DUSP1, Dual specificity phosphatase 1), 유전자 등록번호(GeneBank accession No.) AK096276(CCND3, Cyclin D3), 유전자 등록번호(GeneBank accession No.) AB209586(MAPK13, Mitogen-activated protein kinase 13), 유전자 등록번호(GeneBank accession No.) AB209465(PCTK1, PCTAIRE protein kinase 1), 유전자 등록번호(GeneBank accession No.) Z19588(SKIL, SKI-like), 유전자 등록번호(GeneBank accession No.) NM_020429(SMURF1, SMAD specific E3 ubiquitin protein ligase 1), 유전자 등록번호(GeneBank accession No.) NM_014767(SPOCK2, Sparc/osteonectin, cwcv and kazal-like domains proteoglycan(testican) 2), 유전자 등록번호(GeneBank accession No.) NM_005979(S100A13, S100 calcium binding protein A13), 유전자 등록번호(GeneBank accession No.) NM_005187(CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), 유전자 등록번호(GeneBank accession No.) NM_004364(CEBPA, CCAAT/enhancer binding protein(C/EBP), alpha), 유전자 등록번호(GeneBank accession No.) NM_001769(CD9, CD9 antigen(p24)), 유전자 등록번호(GeneBank accession No.) NM_001718(BMP6, Bone morphogenetic protein 6), 유전자 등록번호(GeneBank accession No.) NM_000641(IL11, Interleukin 11), 유전자 등록번호(GeneBank accession No.) BX647459(SERPINE2, Serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 2), 유전자 등록번호(GeneBank accession No.) BQ066037(RPS19, Ribosomal protein S19), 유전자 등록번호(GeneBank accession No.) BE791300(EDF1, Endothelial differentiation-related factor 1), 유전자 등록번호(GeneBank accession No.) BC038504(SNF1LK, SNF1-like kinase), 유전자 등록번호(GeneBank accession No.) AL832287(ZAP70, Zeta-chain(TCR) associated protein kinase 70kDa), 유전자 등록번호(GeneBank accession No.) AK125742(PCGF1, Polycomb group ring finger 1), 유전자 등록번호(GeneBank accession No.) AK124709(NDRG1, N-myc downstream regulated gene 1), 유전자 등록번호(GeneBank accession No.) AB011157(PTDSR, Phosphatidylserine receptor), 유전자 등록번호(GeneBank accession No.) NM_013255(MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), 유전자 등록번호(GeneBank accession No.) NM_006572(GNA13, Guanine nucleotide binding protein(G protein), alpha 13), 유전자 등록번호(GeneBank accession No.) NM_002211(ITGB1, Integrin, beta 1(fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), 유전자 등록번호(GeneBank accession No.) CR601067(PLAUR, Plasminogen activator, urokinase receptor), 유전자 등록번호(GeneBank accession No.) BC050456(THBS4, Thrombospondin 4), 유전자 등록번호(GeneBank accession No.) AK027389(CXCL16, Chemokine(C-X-C motif) ligand 16), 유전자 등록번호(GeneBank accession No.) AJ132099(VNN1, Vanin 1), 유전자 등록번호(GeneBank accession No.) XM_371354(FLJ10157, Hypothetical protein FLJ10157), 유전자 등록번호(GeneBank accession No.) XM_208313(TPM3, Similar to tropomyosin 4), 유전자 등록번호(GeneBank accession No.) XM_208270(ACR, Acrosin-like protease), 유전자 등록번호(GeneBank accession No.) NM_203353(PDLIM7, PDZ and LIM domain 7(enigma)), 유전자 등록번호(GeneBank accession No.) NM_201382(PLEC1, Plectin 1, intermediate filament binding protein 500kDa), 유전자 등록번호(GeneBank accession No.) NM_182961(SYNE1, Spectrin repeat containing, nuclear envelope 1), 유전자 등록번호(GeneBank accession No.) NM_181826(NF2, Neurofibromin 2(bilateral acoustic neuroma)), 유전자 등록번호(GeneBank accession No.) NM_172069(PLEKHH2, Pleckstrin homology domain containing, family H(with MyTH4 domain) member 2), 유전자 등록번호(GeneBank accession No.) NM_022648(TNS, Tensin 1), 유전자 등록번호(GeneBank accession No.) NM_017556(FBLP-1, Filamin binding LIM protein 1), 유전자 등록번호(GeneBank accession No.) NM_016081(KIAA0992, Palladin, cytoskeletal associated protein), 유전자 등록번호(GeneBank accession No.) NM_006617(NES, Nestin), 유전자 등록번호(GeneBank accession No.) NM_006262(PRPH, Peripherin), 유전자 등록번호(GeneBank accession No.) NM_005100(AKAP12, A kinase(PRKA) anchor protein(gravin) 12), 유전자 등록번호(GeneBank accession No.) NM_004368(CNN2, Calponin 2), 유전자 등록번호(GeneBank accession No.) NM_003388(CYLN2, Cytoplasmic linker 2), 유전자 등록번호(GeneBank accession No.) NM_003370(VASP, Vasodilator-stimulated phosphoprotein), 유전자 등록번호(GeneBank accession No.) NM_003128(SPTBN1, Spectrin, beta, non-erythrocytic 1), 유전자 등록번호(GeneBank accession No.) NM_002705(PPL, Periplakin), 유전자 등록번호(GeneBank accession No.) NM_002475(MLC1SA, Myosin light chain 1 slow a), 유전자 등록번호(GeneBank accession No.) NM_002018(FLII, Flightless I homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_001465(FYB, FYN binding protein(FYB- 120/130)), 유전자 등록번호(GeneBank accession No.) NM_001069(TUBB2, Tubulin, beta 2A), 유전자 등록번호(GeneBank accession No.) CR625172(MGC8685, Tubulin, beta 2B), 유전자 등록번호(GeneBank accession No.) CR616919(KRT18, Keratin 18), 유전자 등록번호(GeneBank accession No.) CR606241(ACTG1, Actin, gamma 1), 유전자 등록번호(GeneBank accession No.) CB240572(MYH11, Myosin, heavy polypeptide 11, smooth muscle), 유전자 등록번호(GeneBank accession No.) BX648253(PTPN3, Protein tyrosine phosphatase, non-receptor type 3), 유전자 등록번호(GeneBank accession No.) BX648190(WDR1, WD repeat domain 1), 유전자 등록번호(GeneBank accession No.) BX641076(ACTN1, Actinin, alpha 1), 유전자 등록번호(GeneBank accession No.) BX537978(EPB41L1, Erythrocyte membrane protein band 4.1-like 1), 유전자 등록번호(GeneBank accession No.) BG121847(NUDC, Nuclear distribution gene C homolog(A. nidulans)), 유전자 등록번호(GeneBank accession No.) BC068013(MYO1C, Myosin IC), 유전자 등록번호(GeneBank accession No.) BC065499(MAST2, Microtubule associated serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) BC051890(TUBG2, Tubulin, gamma 2), 유전자 등록번호(GeneBank accession No.) BC041874(MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), 유전자 등록번호(GeneBank accession No.) BC012597(ACTA1, Actin, alpha 1, skeletal muscle), 유전자 등록번호(GeneBank accession No.) AY484427(KIF17, Kinesin family member 17), 유전자 등록번호(GeneBank accession No.) AK130546(STOML2, Stomatin(EPB72)-like 2), 유전자 등록번호(GeneBank accession No.) AK124711(CORO2B, Coronin, actin binding protein, 2B), 유전자 등록번호(GeneBank accession No.) AK123974(MYL5, Myosin, light polypeptide 5, regulatory), 유전자 등록번호(GeneBank accession No.) AK092792(LOC389833, Similar to hypothetical protein MGC27019), 유전자 등록번호(GeneBank accession No.) AK026518(MYOHD1, Myosin head domain containing 1), 유전자 등록번호(GeneBank accession No.) AK024500(NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), 유전자 등록번호(GeneBank accession No.) AF085886(FLJ46675, Ribosomal protein L29 pseudogene 2), 유전자 등록번호(GeneBank accession No.) AB209997(MYO9B, Myosin IXB), 유전자 등록번호(GeneBank accession No.) Y12692(WNT11, Wingless-type MMTV integration site family, member 11), 유전자 등록번호(GeneBank accession No.) Y11307(CYR61, Cysteine-rich, angiogenic inducer, 61), 유전자 등록번호(GeneBank accession No.) X17033(ITGA2, Integrin, alpha 2(CD49B, alpha 2 subunit of VLA-2 receptor)), 유전자 등록번호(GeneBank accession No.) U41763(CLTCL1, Clathrin, heavy polypeptide-like 1), 유전자 등록번호(GeneBank accession No.) NM_153609(TMPRSS6, Transmembrane protease, serine 6), 유전자 등록번호(GeneBank accession No.) NM_031483(ITCH, Itchy homolog E3 ubiquitin protein ligase(mouse)), 유전자 등록번호(GeneBank accession No.) NM_024342(GRLF1, Glucocorticoid receptor DNA binding factor 1), 유전자 등록번호(GeneBank accession No.) NM_017555(EGLN2, Egl nine homolog 2(C. elegans)), 유전자 등록번호(GeneBank accession No.) NM_016569(TBX3, T-box 3(ulnar mammary syndrome)), 유전자 등록번호(GeneBank accession No.) NM_004148(NINJ1, Ninjurin 1), 유전자 등록번호(GeneBank accession No.) NM_003377(VEGFB, Vascular endothelial growth factor B), 유전자 등록번호(GeneBank accession No.) NM_001983(ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1(includes overlapping antisense sequence)), 유전자 등록번호(GeneBank accession No.) NM_001552(IGFBP4, Insulin-like growth factor binding protein 4), 유전자 등록번호(GeneBank accession No.) NM_001430(EPAS1, Endothelial PAS domain protein 1), 유전자 등록번호(GeneBank accession No.) NM_001300(KLF6, Kruppel-like factor 6), 유전자 등록번호(GeneBank accession No.) NM_001012661(SLC3A2, Solute carrier family 3(activators of dibasic and neutral amino acid transport), member 2), 유전자 등록번호(GeneBank accession No.) NM_000596(IGFBP1, Insulin-like growth factor binding protein 1), 유전자 등록번호(GeneBank accession No.) NM_000474(TWIST1, Twist homolog 1(acrocephalosyndactyly 3; Saethre-Chotzen syndrome)(Drosophila)), 유전자 등록번호(GeneBank accession No.) BX649103(ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), 유전자 등록번호(GeneBank accession No.) BM913048(TIMP1, TIMP metallopeptidase inhibitor 1), 유전자 등록번호(GeneBank accession No.) BM904612(S100A6, S100 calcium binding protein A6(calcyclin)), 유전자 등록번호(GeneBank accession No.) BM556279(EMP3, Epithelial membrane protein 3), 유전자 등록번호(GeneBank accession No.) BC015041(VAT1, Family with sequence similarity 82, member C), 유전자 등록번호(GeneBank accession No.) AY258066(OKL38, Pregnancy-induced growth inhibitor), 유전자 등록번호(GeneBank accession No.) AK126729(NDRG4, NDRG family member 4), 유전자 등록번호(GeneBank accession No.) AK090459(NFE2L1, Nuclear factor(erythroid-derived 2)-like 1), 유전자 등록번호(GeneBank accession No.) AK074163(ROBO4, Roundabout homolog 4, magic roundabout(Drosophila)), 유전자 등록번호(GeneBank accession No.) AK024680(FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), 유전자 등록번호(GeneBank accession No.) AF176422(HEY1, Hairy/enhancer-of-split related with YRPW motif 1), 유전자 등록번호(GeneBank accession No.) AF003837(JAG1, Jagged 1(Alagille syndrome)), 유전자 등록번호(GeneBank accession No.) AB209322(SEMA3B, Sema domain, immunoglobulin domain(Ig), short basic domain, secreted,(semaphorin) 3B), 유전자 등록번호(GeneBank accession No.) AB011150(NRXN1, Neurexin 1), 유전자 등록번호(GeneBank accession No.) NM_201589(MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A(avian)), 유전자 등록번호(GeneBank accession No.) NM_052999(CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), 유전자 등록번호(GeneBank accession No.) NM_006644(HSPH1, Heat shock 105kDa/110kDa protein 1), 유전자 등록번호(GeneBank accession No.) NM_005438(FOSL1, FOS-like antigen 1), 유전자 등록번호(GeneBank accession No.) NM_004996(ABCC1, ATP-binding cassette, sub-family C(CFTR/MRP), member 1), 유전자 등록번호(GeneBank accession No.) NM_002658(PLAU, Plasminogen activator, urokinase), 유전자 등록번호(GeneBank accession No.) NM_001353(AKR1C1, Aldo-keto reductase family 1, member C1(dihydrodiol dehydrogenase 1; 20-alpha(3-alpha)-hydroxysteroid dehydrogenase)), 유전자 등록번호(GeneBank accession No.) H18681(C20orf139, Sulfiredoxin 1 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) DR004094(HAMP, Hepcidin antimicrobial peptide), 유전자 등록번호(GeneBank accession No.) BC082272(KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), 유전자 등록번호(GeneBank accession No.) BC040494(DNAJB2, DnaJ(Hsp40) homolog, subfamily B, member 2), 유전자 등록번호(GeneBank accession No.) BC018064(ATF6, Activating transcription factor 6), 유전자 등록번호(GeneBank accession No.) BC006523(SGK2, Serum/glucocorticoid regulated kinase 2), 유전자 등록번호(GeneBank accession No.) AK090482(CXCL12, Chemokine(C-X-C motif) ligand 12(stromal cell-derived factor 1)), 유전자 등록번호(GeneBank accession No.) AF219946(TULP4, Tubby like protein 4), 유전자 등록번호(GeneBank accession No.) AB209112(SLC2A8, Solute carrier family 2,(facilitated glucose transporter) member 8), 유전자 등록번호(GeneBank accession No.) NM_005242(F2RL1, Coagulation factor II(thrombin) receptor-like 1), 유전자 등록번호(GeneBank accession No.) NM_001002029(C4A, Complement component 4B, telomeric), 유전자 등록번호(GeneBank accession No.) NM_000539(RHO, Rhodopsin(opsin 2, rod pigment)(retinitis pigmentosa 4, autosomal dominant)), 유전자 등록번호(GeneBank accession No.) BX649164(PAI, serpin peptidase inhibitor, clade E(nexin, plasminogen activator inhibitor type 1), member 1), 유전자 등록번호(GeneBank accession No.) BM918324(LY96, Lymphocyte antigen 96), 유전자 등록번호(GeneBank accession No.) AB209647(NCF2, Neutrophil cytosolic factor 2(65kDa, chronic granulomatous disease, autosomal 2)), 유전자 등록번호(GeneBank accession No.) NM_152221(CSNK1E, Casein kinase 1, epsilon), 유전자 등록번호(GeneBank accession No.) NM_017999(RNF31, Ring finger protein 31), 유전자 등록번호(GeneBank accession No.) NM_016819(OGG1, 8-oxoguanine DNA glycosylase), 유전자 등록번호(GeneBank accession No.) NM_016816(OAS1, 2',5'-oligoadenylate synthetase 1, 40/46kDa), 유전자 등록번호(GeneBank accession No.) NM_012235(SCAP, SREBP cleavage-activating protein), 유전자 등록번호(GeneBank accession No.) NM_006384(CIB1, Calcium and integrin binding 1(calmyrin)), 유전자 등록번호(GeneBank accession No.) NM_001779(CD58, CD58 antigen,(lymphocyte function-associated antigen 3)), 유전자 등록번호(GeneBank accession No.) CB055213(ICOSLG, Inducible T-cell co-stimulator ligand), 유전자 등록번호(GeneBank accession No.) BX641029(MASP1, Mannan-binding lectin serine peptidase 1(C4/C2 activating component of Ra-reactive factor)), 유전자 등록번호(GeneBank accession No.) BQ053419(BATF, Basic leucine zipper transcription factor, ATF-like), 유전자 등록번호(GeneBank accession No.) BC039299(STIP1, Stress-induced-phosphoprotein 1(Hsp70/Hsp90-organizing protein)), 유전자 등록번호(GeneBank accession No.) AY055760(DAF, Decay accelerating factor for complement(CD55, Cromer blood group system)), 유전자 등록번호(GeneBank accession No.) AK130188(FGR, Gardner-Rasheed feline sarcoma viral(v-fgr) oncogene homolog), 유전자 등록번호(GeneBank accession No.) AK095326(MUS81, MUS81 endonuclease homolog(yeast)), 유전자 등록번호(GeneBank accession No.) NM_017670(OTUB1, OTU domain, ubiquitin aldehyde binding 1), 유전자 등록번호(GeneBank accession No.) NM_003004(SECTM1, Secreted and transmembrane 1), 유전자 등록번호(GeneBank accession No.) NM_002309(LIF, Hypothetical protein MGC20647), 유전자 등록번호(GeneBank accession No.) NM_001421(ELF4, E74-like factor 4(ets domain transcription factor)), 유전자 등록번호(GeneBank accession No.) NM_000418(IL4R, Interleukin 4 receptor), 유전자 등록번호(GeneBank accession No.) BI909222(FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), 유전자 등록번호(GeneBank accession No.) BF569086(NK4, Interleukin 32), 유전자 등록번호(GeneBank accession No.) BC014470(AZGP1, Alpha-2-glycoprotein 1, zinc), 유전자 등록번호(GeneBank accession No.) BC020744(AKR1C4, Aldo-keto reductase family 1, member C4(chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol),dehydrogenase 4), 유전자 등록번호(GeneBank accession No.) BQ939577(AKR1C3, Aldo-keto reductase family 1, member C3(3-alpha hydroxysteroid dehydrogenase, type II)), 유전자 등록번호(GeneBank accession No.) NM_000499(CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_030622(CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), 유전자 등록번호(GeneBank accession No.) NM_184041(ALDOA, Aldolase A, fructose-bisphosphate), 유전자 등록번호(GeneBank accession No.) NM_024307(MGC4171, Hypothetical protein LOC283901), 유전자 등록번호(GeneBank accession No.) NM_005336(HDLBP, High density lipoprotein binding protein(vigilin)), 유전자 등록번호(GeneBank accession No.) NM_002627(PFKP, Phosphofructokinase, platelet), 유전자 등록번호(GeneBank accession No.) BX648281(LDLR, Low density lipoprotein receptor(familial hypercholesterolemia)), 유전자 등록번호(GeneBank accession No.) BC069201(FLJ22761, Hexokinase domain containing 1), 유전자 등록번호(GeneBank accession No.) BC030207(NR0B2, Nuclear receptor subfamily 0, group B, member 2), 유전자 등록번호(GeneBank accession No.) AL833069(KIAA1434, Hypothetical protein KIAA1434), 유전자 등록번호(GeneBank accession No.) AK124656(ENO2, Enolase 2(gamma, neuronal)), 유전자 등록번호(GeneBank accession No.) AK094474(RHOC, Ras homolog gene family, member C), 유전자 등록번호(GeneBank accession No.) AK093461(ISYNA1, Myo-inositol 1- phosphate synthase A1), 유전자 등록번호(GeneBank accession No.) AB053232(GAL3ST3, Galactose-3-O-sulfotransferase 3), 유전자 등록번호(GeneBank accession No.) AB045292(TMEM8, Transmembrane protein 8(five membrane-spanning domains)), 유전자 등록번호(GeneBank accession No.) NM_004753(DHRS3, Dehydrogenase/reductase(SDR family) member 3), 유전자 등록번호(GeneBank accession No.) NM_002900(RBP3, Retinol binding protein 3, interstitial), 유전자 등록번호(GeneBank accession No.) NM_001995(ACSL1, Acyl-CoA synthetase long-chain family member 1), 유전자 등록번호(GeneBank accession No.) NM_000018(ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), 유전자 등록번호(GeneBank accession No.) BC094756(CRA, Myotubularin related protein 11), 유전자 등록번호(GeneBank accession No.) BC050553(NTE, Neuropathy target esterase), 유전자 등록번호(GeneBank accession No.) BC033110(HSD17B1, Hydroxysteroid(17-beta) dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AY268890(TPP1, Tripeptidyl peptidase I), 유전자 등록번호(GeneBank accession No.) AK172798(CPT1A, Carnitine palmitoyltransferase 1A(liver)), 유전자 등록번호(GeneBank accession No.) AK096809(CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), 유전자 등록번호(GeneBank accession No.) AK000600(SIAT7D, ST6(alpha-N-acetyl-neuraminyl-2,3-beta- galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), 유전자 등록번호(GeneBank accession No.) AB002454(CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), 유전자 등록번호(GeneBank accession No.) Z29093(DDR1, Discoidin domain receptor family, member 1), 유전자 등록번호(GeneBank accession No.) Z25424(MKNK2, MAP kinase interacting serine/threonine kinase 2), 유전자 등록번호(GeneBank accession No.) XM_291277(DKFZp761P0423, Hypothetical protein DKFZp761P0423), 유전자 등록번호(GeneBank accession No.) XM_038150(MAST3, Microtubule associated serine/threonine kinase 3), 유전자 등록번호(GeneBank accession No.) U88357(ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3(avian)), 유전자 등록번호(GeneBank accession No.) NM_025195(TRIB1, Tribbles homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020639(RIPK4, Receptor-interacting serine-threonine kinase 4), 유전자 등록번호(GeneBank accession No.) NM_014172(PHPT1, Phosphohistidine phosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_006254(PRKCD, Protein kinase C, delta), 유전자 등록번호(GeneBank accession No.) NM_005415(SLC20A1, Solute carrier family 20(phosphate transporter), member 1), 유전자 등록번호(GeneBank accession No.) NM_005026(PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), 유전자 등록번호(GeneBank accession No.) NM_004431(EPHA2, EPH receptor A2), 유전자 등록번호(GeneBank accession No.) NM_004419(DUSP5, Dual specificity phosphatase 5), 유전자 등록번호(GeneBank accession No.) NM_004327(BCR, Breakpoint cluster region), 유전자 등록번호(GeneBank accession No.) NM_004231(ATP6V1F, ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F), 유전자 등록번호(GeneBank accession No.) NM_004090(DUSP3, Dual specificity phosphatase 3(vaccinia virus phosphatase VH1-related)), 유전자 등록번호(GeneBank accession No.) NM_002843(PTPRJ, Protein tyrosine phosphatase, receptor type, J), 유전자 등록번호(GeneBank accession No.) NM_002496(NDUFS8, NADH dehydrogenase(ubiquinone) Fe-S protein 8, 23kDa(NADH-coenzyme Q reductase)), 유전자 등록번호(GeneBank accession No.) NM_001001852(PIM3, Pim-3 oncogene), 유전자 등록번호(GeneBank accession No.) L76191(IRAK1, Interleukin-1 receptor-associated kinase 1), 유전자 등록번호(GeneBank accession No.) D15049(PTPRH, Protein tyrosine phosphatase, receptor type, H), 유전자 등록번호(GeneBank accession No.) BC065207(ATP6V0D2, ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2), 유전자 등록번호(GeneBank accession No.) BC035578(STK24, Serine/threonine kinase 24(STE20 homolog, yeast)), 유전자 등록번호(GeneBank accession No.) BC028724(DUSP18, Dual specificity phosphatase 18), 유전자 등록번호(GeneBank accession No.) AL117482(ULK3, Unc-51-like kinase 3(C. elegans)), 유전자 등록번호(GeneBank accession No.) AK126879(PCTK3, PCTAIRE protein kinase 3), 유전자 등록번호(GeneBank accession No.) AB209416(ILK, Integrin-linked kinase-2), 유전자 등록번호(GeneBank accession No.) NM_000782(CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), 유전자 등록번호(GeneBank accession No.) CR597101(ZFP36, Zinc finger protein 36, C3H type, homolog(mouse)), 유전자 등록번호(GeneBank accession No.) CR936799(FHL2, Four and a half LIM domains 2), 유전자 등록번호(GeneBank accession No.) M24898(NR1D1, Nuclear receptor subfamily 1, group D, member 1), 유전자 등록번호(GeneBank accession No.) AF132818(KLF5, Kruppel-like factor 5(intestinal)), 유전자 등록번호(GeneBank accession No.) AK055337(ZNF213, Zinc finger protein 213), 유전자 등록번호(GeneBank accession No.) BC008834(PHF1, PHD finger protein 1), 유전자 등록번호(GeneBank accession No.) AK126918(GLIS2, GLIS family zinc finger 2), 유전자 등록번호(GeneBank accession No.) BC042692(CTL2, Solute carrier family 44, member 2), 유전자 등록번호(GeneBank accession No.) NM_002224(ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), 유전자 등록번호(GeneBank accession No.) AK095363(AQP3, Aquaporin 3), 유전자 등록번호(GeneBank accession No.) NM_174953(ATP2A3, ATPase, Ca++ transporting, ubiquitous), 유전자 등록번호(GeneBank accession No.) BC042390(VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B(yeast)), 유전자 등록번호(GeneBank accession No.) NM_016113(TRPV2, Transient receptor potential cation channel, subfamily V, member 2), 유전자 등록번호(GeneBank accession No.) BM926478(RBP1, Retinol binding protein 1, cellular), 유전자 등록번호(GeneBank accession No.) NM_000069(CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), 유전자 등록번호(GeneBank accession No.) AK002107(RAB3B, RAB3B, member RAS oncogene family), 유전자 등록번호(GeneBank accession No.) NM_013321(SNX8, Sorting nexin 8), 유전자 등록번호(GeneBank accession No.) AK125026(SLC6A12, Solute carrier family 6(neurotransmitter transporter, betaine/GABA), member 12), 유전자 등록번호(GeneBank accession No.) NM_005843(STAM2, Signal transducing adaptor molecule(SH3 domain and ITAM motif) 2), 유전자 등록번호(GeneBank accession No.) AK092512(SLC16A5, Solute carrier family 16(monocarboxylic acid transporters), member 5), 유전자 등록번호(GeneBank accession No.) U49248(ABCC2, ATP-binding cassette, sub-family C(CFTR/MRP), member 2), 유전자 등록번호(GeneBank accession No.) AK172792(SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), 유전자 등록번호(GeneBank accession No.) BC044656(CASC3, Cancer susceptibility candidate 3), 유전자 등록번호(GeneBank accession No.) NM_203403(C9orf150, Chromosome 9 open reading frame 150), 유전자 등록번호(GeneBank accession No.) NM_080388(S100A16, S100 calcium binding protein A16), 유전자 등록번호(GeneBank accession No.) NM_031286(SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), 유전자 등록번호(GeneBank accession No.) NM_022153(PP2135, Chromosome 10 open reading frame 54), 유전자 등록번호(GeneBank accession No.) NM_004864(GDF15, Growth differentiation factor 15), 유전자 등록번호(GeneBank accession No.) NM_003330(TXNRD1, Thioredoxin reductase 1), 유전자 등록번호(GeneBank accession No.) NM_001013632(LOC343521, Similar to hypothetical protein 4833401D15), 유전자 등록번호(GeneBank accession No.) BX537968(LOC51149, Hypothetical LOC51149), 유전자 등록번호(GeneBank accession No.) BU945318(MT2A, Hypothetical gene supported by X97260; BC070289), 유전자 등록번호(GeneBank accession No.) BQ683841(S100A11, S100 calcium binding protein A11(calgizzarin)), 유전자 등록번호(GeneBank accession No.) BQ276852(TMSB10, Thymosin, beta 10), 유전자 등록번호(GeneBank accession No.) AK126182(KIAA1949, KIAA1949), 유전자 등록번호(GeneBank accession No.) AK124751(CAPN2, Calpain 2,(m/II) large subunit), 유전자 등록번호(GeneBank accession No.) AK095079(RGC32, Response gene to complement 32), 유전자 등록번호(GeneBank accession No.) AB075871(FLJ42654, Golgi transport 1 homolog A(S. cerevisiae)).Gene accession number (GeneBank accession No. ) NM_004420 (DUSP8, Dual specificity phosphatase 8), gene accession number (GeneBank accession No. ) L11329 (DUSP2, Dual specificity phosphatase 2), gene accession number (GeneBank accession No. ) BC094766 (PKN1, Protein kinase N1), gene accession number (GeneBank accession No. ) AY247738 (TRIB3, Tribbles homolog 3 (Drosophila)), gene registration number (GeneBank accession No. ) AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Gene Accession No. ) AB208849 (SHC1, Src homology 2 domain containing (SHC) transforming protein 1), gene accession number (GeneBank accession No. ) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann disease)), Gene Accession No. ) NM_198951 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (GeneBank accession No. NM_147780 (CTSB, Cathepsin B), gene accession number (GeneBank accession No. NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), gene accession number (GeneBank accession No. NM_033027 (AXUD1, AXIN1 up-regulated 1), gene accession number (GeneBank accession No. NM_032797 (AMID, Apoptosis-inducing factor (AIF) -like mitochondrion-associated inducer of death), GeneBank accession No. ) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (GeneBank accession No. ) NM_016639 (TNFRSF12A, Tumor necrosis factor receptor superfamily, member 12A), gene accession number (GeneBank accession No. ) NM_016222 (DDX41, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41), gene accession number (GeneBank accession No. ) NM_013246 (CLC, Cardiotrophin-like cytokine factor 1), gene accession number (GeneBank accession No. ) NM_004401 (DFFA, DNA fragmentation factor, 45kDa, alpha polypeptide), gene registration number (GeneBank accession No. ) NM_004281 (BAG3, BCL2-associated athanogene 3), gene accession number (GeneBank accession No. ) NM_003897 (IER3, Immediate early response 3), Gene accession number (GeneBank accession No. ) NM_003806 (HRK, Harakiri, BCL2 interacting protein (contains only BH3 domain)), gene accession number (GeneBank accession No. ) NM_003639 (IKBKG, Inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma), GeneBank accession No. ) NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), gene accession number (GeneBank accession No. ) NM_002737 (PRKCA, Protein Kinase C, alpha), Gene Accession Number (GeneBank accession No. NM_002648 (PIM1, Pim-1 oncogene), gene accession number (GeneBank accession No. NM_002507 (NGFR, Nerve growth factor receptor (TNFR superfamily, member 16)), gene accession number (GeneBank accession No. ) NM_002305 (LGALS1, Lectin, galactoside-binding, soluble, 1 (galectin 1)), gene accession number (GeneBank accession No. ) NM_001013398 (IGFBP3, Insulin-like growth factor binding protein 3), gene registration number (GeneBank accession No. ) BX640923 (MDM4, Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)), gene accession number (GeneBank accession No. ) BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), gene accession number (GeneBank accession No. ) BG284742 (P8, P8 protein (candidate of metastasis 1)), gene accession number (GeneBank accession No. ) BE903247 (PDCD6IP, Programmed cell death 6 interacting protein), gene accession number (GeneBank accession No. ) BC027949 (P2RX1, Purinergic receptor P2X, ligand-gated ion channel, 1), gene accession number (GeneBank accession No. ) BC006365 (PSEN2, Presenilin 2 (Alzheimer disease 4)), gene accession number (GeneBank accession No. ) AY869712 (PPP1R13L, Protein phosphatase 1, regulatory (inhibitor) subunit 13 like), Gene Accession No. ) AY028896 (CARD10, Caspase recruitment domain family, member 10), gene accession number (GeneBank accession No. ) AK122614 (PPARD, Peroxisome proliferative activated receptor, delta), gene accession number (GeneBank accession No. ) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), gene registration number (GeneBank accession No. ) AK092808 (RRAGC, Ras-related GTP binding C), gene accession number (GeneBank accession No. ) AJ001898 (GDNF, Glial cell derived neurotrophic factor), gene accession number (GeneBank accession No. ) AF220656 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), gene accession number (GeneBank accession No. AF055634 (UNC5C, Unc-5 homolog C (C.  elegans), GeneBank accession No. ) AB209485 (Vescular endothelial growth factor), gene accession number (GeneBank accession No. ) AB096256 (UNC5B, Unc-5 homolog B (C.  elegans), GeneBank accession No. ) AB007960 (SH3GLB1, SH3-domain GRB2-like endophilin B1), gene accession number (GeneBank accession No. ) X06374 (PDGFA, Platelet-derived growth factor alpha polypeptide), Gene accession number (GeneBank accession No. ) S62138 (DDIT3, DNA-damage-inducible transcript 3), gene accession number (GeneBank accession No. NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), gene accession number (GeneBank accession No. ) NM_012127 (CIZ1, CDKN1A interacting zinc finger protein 1), gene accession number (GeneBank accession No. ) NM_005883 (APC2, Adenomatosis polyposis coli 2), gene accession number (GeneBank accession No. ) NM_004196 (CDKL1, Cyclin-dependent kinase-like 1 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_003236 (TGFA, Transforming growth factor, alpha), gene registration number (GeneBank accession No. ) NM_001261 (CDK9, Cyclin-dependent kinase 9 (CDC2-related kinase)), gene accession number (GeneBank accession No. ) NM_001007271 (DUSP13, Dual specificity phosphatase 13), gene accession number (GeneBank accession No. CR749511 (PARC, P53-associated parkin-like cytoplasmic protein), gene accession number (GeneBank accession No. CR623038 (ID2, Inhibitor of DNA binding 2, dominant negative helix-loop-helix protein), gene accession number (GeneBank accession No. CR618371 (EGFR, Epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)), GeneBank accession No. ) BF965144 (IFITM1, Interferon induced transmembrane protein 1 (9-27)), gene accession number (GeneBank accession No. ) AK127679 (DUSP1, Dual specificity phosphatase 1), gene accession number (GeneBank accession No. ) AK096276 (CCND3, Cyclin D3), gene accession number (GeneBank accession No. ) AB209586 (MAPK13, Mitogen-activated protein kinase 13), gene accession number (GeneBank accession No. ) AB209465 (PCTK1, PCTAIRE protein kinase 1), gene accession number (GeneBank accession No. ) Z19588 (SKIL, SKI-like), gene accession number (GeneBank accession No. NM_020429 (SMURF1, SMAD specific E3 ubiquitin protein ligase 1), gene accession number (GeneBank accession No. ) NM_014767 (SPOCK2, Sparc / osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2), Gene Accession No. ) NM_005979 (S100A13, S100 calcium binding protein A13), gene registration number (GeneBank accession No. NM_005187 (CBFA2T3, Core-binding factor, runt domain, alpha subunit 2; translocated to, 3), gene accession number (GeneBank accession No. ) NM_004364 (CEBPA, CCAAT / enhancer binding protein (C / EBP), alpha), gene registration number (GeneBank accession No. ) NM_001769 (CD9, CD9 antigen (p24)), gene accession number (GeneBank accession No. ) NM_001718 (BMP6, Bone morphogenetic protein 6), gene accession number (GeneBank accession No. ) NM_000641 (IL11, Interleukin 11), gene accession number (GeneBank accession No. ) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), gene registration number (GeneBank accession No. ) BQ066037 (RPS19, Ribosomal protein S19), gene accession number (GeneBank accession No. ) BE791300 (EDF1, Endothelial differentiation-related factor 1), Gene accession number (GeneBank accession No. ) BC038504 (SNF1LK, SNF1-like kinase), gene accession number (GeneBank accession No. ) AL832287 (ZAP70, Zeta-chain (TCR) associated protein kinase 70kDa), gene accession number (GeneBank accession No. ) AK125742 (PCGF1, Polycomb group ring finger 1), gene accession number (GeneBank accession No. ) AK124709 (NDRG1, N-myc downstream regulated gene 1), gene accession number (GeneBank accession No. ) AB011157 (PTDSR, Phosphatidylserine receptor), Gene Accession No. NM_013255 (MKLN1, Muskelin 1, intracellular mediator containing kelch motifs), gene accession number (GeneBank accession No. ) NM_006572 (GNA13, Guanine nucleotide binding protein (G protein), alpha 13), gene registration number (GeneBank accession No. NM_002211 (ITGB1, Integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)), gene accession number (GeneBank accession No. ) CR601067 (PLAUR, Plasminogen activator, urokinase receptor), gene accession number (GeneBank accession No. ) BC050456 (THBS4, Thrombospondin 4), gene accession number (GeneBank accession No. ) AK027389 (CXCL16, Chemokine (C-X-C motif) ligand 16), gene accession number (GeneBank accession No. ) AJ132099 (VNN1, Vanin 1), gene accession number (GeneBank accession No. ) XM_371354 (FLJ10157, Hypothetical protein FLJ10157), gene accession number (GeneBank accession No. ) XM_208313 (TPM3, Similar to tropomyosin 4), gene accession number (GeneBank accession No. XM_208270 (ACR, Acrosin-like protease), gene accession number (GeneBank accession No. ) NM_203353 (PDLIM7, PDZ and LIM domain 7 (enigma)), gene accession number (GeneBank accession No. ) NM_201382 (PLEC1, Plectin 1, intermediate filament binding protein 500kDa), gene registration number (GeneBank accession No. ) NM_182961 (SYNE1, Spectrin repeat containing, nuclear envelope 1), gene accession number (GeneBank accession No. ) NM_181826 (NF2, Neurofibromin 2 (bilateral acoustic neuroma)), gene accession number (GeneBank accession No. NM_172069 (PLEKHH2, Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2), gene accession number (GeneBank accession No. ) NM_022648 (TNS, Tensin 1), gene accession number (GeneBank accession No. NM_017556 (FBLP-1, Filamin binding LIM protein 1), gene accession number (GeneBank accession No. NM_016081 (KIAA0992, Palladin, cytoskeletal associated protein), gene accession number (GeneBank accession No. ) NM_006617 (NES, Nestin), gene accession number (GeneBank accession No. ) NM_006262 (PRPH, Peripherin), gene accession number (GeneBank accession No. NM_005100 (AKAP12, A kinase (PRKA) anchor protein (gravin) 12), gene accession number (GeneBank accession No. NM_004368 (CNN2, Calponin 2), gene accession number (GeneBank accession No. ) NM_003388 (CYLN2, Cytoplasmic linker 2), gene accession number (GeneBank accession No. ) NM_003370 (VASP, Vasodilator-stimulated phosphoprotein), gene accession number (GeneBank accession No. ) NM_003128 (SPTBN1, Spectrin, beta, non-erythrocytic 1), gene accession number (GeneBank accession No. ) NM_002705 (PPL, Periplakin), gene accession number (GeneBank accession No. ) NM_002475 (MLC1SA, Myosin light chain 1 slow a), Gene accession number (GeneBank accession No. ) NM_002018 (FLII, Flightless I homolog (Drosophila)), Gene Accession Number (GeneBank accession No. ) NM_001465 (FYB, FYN binding protein (FYB- 120/130)), gene registration number (GeneBank accession No. NM_001069 (TUBB2, Tubulin, beta 2A), gene accession number (GeneBank accession No. ) CR625172 (MGC8685, Tubulin, beta 2B), gene accession number (GeneBank accession No. CR616919 (KRT18, Keratin 18), gene accession number (GeneBank accession No. ) CR606241 (ACTG1, Actin, gamma 1), gene accession number (GeneBank accession No. ) CB240572 (MYH11, Myosin, heavy polypeptide 11, smooth muscle), gene accession number (GeneBank accession No. ) BX648253 (PTPN3, Protein tyrosine phosphatase, non-receptor type 3), Gene accession number (GeneBank accession No. ) BX648190 (WDR1, WD repeat domain 1), Gene accession number (GeneBank accession No. ) BX641076 (ACTN1, Actinin, alpha 1), gene accession number (GeneBank accession No. ) BX537978 (EPB41L1, Erythrocyte membrane protein band 4. 1-like 1), gene accession number (GeneBank accession No. ) BG121847 (NUDC, Nuclear distribution gene C homolog (A.  nidulans)), and GeneBank accession No. ) BC068013 (MYO1C, Myosin IC), gene accession number (GeneBank accession No. ) BC065499 (MAST2, Microtubule associated serine / threonine kinase 2), gene accession number (GeneBank accession No. ) BC051890 (TUBG2, Tubulin, gamma 2), gene accession number (GeneBank accession No. ) BC041874 (MAP1LC3B, Microtubule-associated protein 1 light chain 3 beta), gene accession number (GeneBank accession No. ) BC012597 (ACTA1, Actin, alpha 1, skeletal muscle), gene accession number (GeneBank accession No. ) AY484427 (KIF17, Kinesin family member 17), gene accession number (GeneBank accession No. ) AK130546 (STOML2, Stomatin (EPB72) -like 2), Gene accession number (GeneBank accession No. ) AK124711 (CORO2B, Coronin, actin binding protein, 2B), gene accession number (GeneBank accession No. ) AK123974 (MYL5, Myosin, light polypeptide 5, regulatory), gene accession number (GeneBank accession No. ) AK092792 (LOC389833, Similar to hypothetical protein MGC27019), gene accession number (GeneBank accession No. ) AK026518 (MYOHD1, Myosin head domain containing 1), gene accession number (GeneBank accession No. ) AK024500 (NICAL, Microtubule associated monoxygenase, calponin and LIM domain containing 1), gene accession number (GeneBank accession No. ) AF085886 (FLJ46675, Ribosomal protein L29 pseudogene 2), gene accession number (GeneBank accession No. ) AB209997 (MYO9B, Myosin IXB), gene accession number (GeneBank accession No. Y12692 (WNT11, Wingless-type MMTV integration site family, member 11), gene accession number (GeneBank accession No. ) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), gene accession number (GeneBank accession No. X17033 (ITGA2, Integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)), gene accession number (GeneBank accession No. ) U41763 (CLTCL1, Clathrin, heavy polypeptide-like 1), gene accession number (GeneBank accession No. NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene accession number (GeneBank accession No. ) NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse)), gene accession number (GeneBank accession No. ) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), gene accession number (GeneBank accession No. NM_017555 (EGLN2, Egl nine homolog 2 (C.  elegans), GeneBank accession No. NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), gene accession number (GeneBank accession No. NM_004148 (NINJ1, Ninjurin 1), gene accession number (GeneBank accession No. ) NM_003377 (VEGFB, Vascular endothelial growth factor B), gene accession number (GeneBank accession No. ) NM_001983 (ERCC1, Excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)), GeneBank accession No. ) NM_001552 (IGFBP4, Insulin-like growth factor binding protein 4), gene registration number (GeneBank accession No. ) NM_001430 (EPAS1, Endothelial PAS domain protein 1), Gene accession number (GeneBank accession No. NM_001300 (KLF6, Kruppel-like factor 6), gene accession number (GeneBank accession No. ) NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2), gene accession number (GeneBank accession No. NM_000596 (IGFBP1, Insulin-like growth factor binding protein 1), gene registration number (GeneBank accession No. ) NM_000474 (TWIST1, Twist homolog 1 (acrocephalosyndactyly 3; Saethre-Chotzen syndrome) (Drosophila)), Gene Accession No. ) BX649103 (ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase), Gene Accession No. ) BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), gene accession number (GeneBank accession No. ) BM904612 (S100A6, S100 calcium binding protein A6 (calcyclin)), gene accession number (GeneBank accession No. ) BM556279 (EMP3, Epithelial membrane protein 3), gene accession number (GeneBank accession No. ) BC015041 (VAT1, Family with sequence similarity 82, member C), gene accession number (GeneBank accession No. ) AY258066 (OKL38, Pregnancy-induced growth inhibitor), gene accession number (GeneBank accession No. ) AK126729 (NDRG4, NDRG family member 4), gene accession number (GeneBank accession No. ) AK090459 (NFE2L1, Nuclear factor (erythroid-derived 2) -like 1), gene accession number (GeneBank accession No. ) AK074163 (ROBO4, Roundabout homolog 4, magic roundabout (Drosophila)), Gene accession number (GeneBank accession No. ) AK024680 (FLJ21027 fis, CDNA: FLJ21027 fis, clone CAE07110), gene accession number (GeneBank accession No. ) AF176422 (HEY1, Hairy / enhancer-of-split related with YRPW motif 1), gene accession number (GeneBank accession No. ) AF003837 (JAG1, Jagged 1 (Alagille syndrome)), gene accession number (GeneBank accession No. ) AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), GeneBank accession No. ) AB011150 (NRXN1, Neurexin 1), gene accession number (GeneBank accession No. ) NM_201589 (MAFA, V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian)), gene accession number (GeneBank accession No. NM_052999 (CKLFSF1, CKLF-like MARVEL transmembrane domain containing 1), gene accession number (GeneBank accession No. NM_006644 (HSPH1, Heat shock 105kDa / 110kDa protein 1), gene registration number (GeneBank accession No. NM_005438 (FOSL1, FOS-like antigen 1), gene accession number (GeneBank accession No. ) NM_004996 (ABCC1, ATP-binding cassette, sub-family C (CFTR / MRP), member 1), gene accession number (GeneBank accession No. ) NM_002658 (PLAU, Plasminogen activator, urokinase), gene accession number (GeneBank accession No. ) NM_001353 (AKR1C1, Aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)), gene accession number (GeneBank accession No. ) H18681 (C20orf139, Sulfiredoxin 1 homolog (S.  cerevisiae)), gene accession number (GeneBank accession No. ) DR004094 (HAMP, Hepcidin antimicrobial peptide), gene accession number (GeneBank accession No. ) BC082272 (KCNMB3, Potassium large conductance calcium-activated channel, subfamily M beta member 3), Gene Accession No. ) BC040494 (DNAJB2, DnaJ (Hsp40) homolog, subfamily B, member 2), gene accession number (GeneBank accession No. ) BC018064 (ATF6, Activating transcription factor 6), gene accession number (GeneBank accession No. ) BC006523 (SGK2, Serum / glucocorticoid regulated kinase 2), gene registration number (GeneBank accession No. ) AK090482 (CXCL12, Chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1)), gene accession number (GeneBank accession No. ) AF219946 (TULP4, Tubby like protein 4), gene accession number (GeneBank accession No. ) AB209112 (SLC2A8, Solute carrier family 2, (facilitated glucose transporter) member 8), gene accession number (GeneBank accession No. ) NM_005242 (F2RL1, Coagulation factor II (thrombin) receptor-like 1), gene accession number (GeneBank accession No. ) NM_001002029 (C4A, Complement component 4B, telomeric), Gene accession number (GeneBank accession No. ) NM_000539 (RHO, Rhodopsin (opsin 2, rod pigment) (retinitis pigmentosa 4, autosomal dominant)), gene accession number (GeneBank accession No. ) BX649164 (PAI, serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1), gene registration number (GeneBank accession No. ) BM918324 (LY96, Lymphocyte antigen 96), gene accession number (GeneBank accession No. ) AB209647 (NCF2, Neutrophil cytosolic factor 2 (65 kDa, chronic granulomatous disease, autosomal 2)), gene accession number (GeneBank accession No. ) NM_152221 (CSNK1E, Casein kinase 1, epsilon), Gene accession number (GeneBank accession No. ) NM_017999 (RNF31, Ring finger protein 31), gene accession number (GeneBank accession No. ) NM_016819 (OGG1, 8-oxoguanine DNA glycosylase), gene accession number (GeneBank accession No. ) NM_016816 (OAS1, 2 ', 5'-oligoadenylate synthetase 1, 40 / 46kDa), Gene Accession No. NM_012235 (SCAP, SREBP cleavage-activating protein), gene accession number (GeneBank accession No. ) NM_006384 (CIB1, Calcium and integrin binding 1 (calmyrin)), gene accession number (GeneBank accession No. ) NM_001779 (CD58, CD58 antigen, (lymphocyte function-associated antigen 3)), gene accession number (GeneBank accession No. ) CB055213 (ICOSLG, Inducible T-cell co-stimulator ligand), Gene accession number (GeneBank accession No. ) BX641029 (MASP1, Mannan-binding lectin serine peptidase 1 (C4 / C2 activating component of Ra-reactive factor)), GeneBank accession No. ) BQ053419 (BATF, Basic leucine zipper transcription factor, ATF-like), Gene Accession No. ) BC039299 (STIP1, Stress-induced-phosphoprotein 1 (Hsp70 / Hsp90-organizing protein)), gene accession number (GeneBank accession No. ) AY055760 (DAF, Decay accelerating factor for complement (CD55, Cromer blood group system)), gene accession number (GeneBank accession No. ) AK130188 (FGR, Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog), Gene Accession No. ) AK095326 (MUS81, MUS81 endonuclease homolog (yeast)), gene accession number (GeneBank accession No. NM_017670 (OTUB1, OTU domain, ubiquitin aldehyde binding 1), gene registration number (GeneBank accession No. ) NM_003004 (SECTM1, Secreted and transmembrane 1), gene accession number (GeneBank accession No. ) NM_002309 (LIF, Hypothetical protein MGC20647), gene accession number (GeneBank accession No. ) NM_001421 (ELF4, E74-like factor 4 (ets domain transcription factor)), gene accession number (GeneBank accession No. ) NM_000418 (IL4R, Interleukin 4 receptor), gene accession number (GeneBank accession No. ) BI909222 (FCER1G, Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide), gene accession number (GeneBank accession No. ) BF569086 (NK4, Interleukin 32), gene accession number (GeneBank accession No. ) BC014470 (AZGP1, Alpha-2-glycoprotein 1, zinc), gene accession number (GeneBank accession No. ) BC020744 (AKR1C4, Aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol), dehydrogenase 4), gene accession number (GeneBank accession No. ) BQ939577 (AKR1C3, Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)), gene accession number (GeneBank accession No. ) NM_000499 (CYP1A1, Cytochrome P450, family 1, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) NM_030622 (CYP2S1, Cytochrome P450, family 2, subfamily S, polypeptide 1), gene accession number (GeneBank accession No. ) NM_184041 (ALDOA, Aldolase A, fructose-bisphosphate), gene accession number (GeneBank accession No. ) NM_024307 (MGC4171, Hypothetical protein LOC283901), gene accession number (GeneBank accession No. ) NM_005336 (HDLBP, High density lipoprotein binding protein (vigilin)), gene registration number (GeneBank accession No. NM_002627 (PFKP, Phosphofructokinase, platelet), Gene accession number (GeneBank accession No. ) BX648281 (LDLR, low density lipoprotein receptor (familial hypercholesterolemia)), gene accession number (GeneBank accession No. ) BC069201 (FLJ22761, Hexokinase domain containing 1), gene accession number (GeneBank accession No. ) BC030207 (NR0B2, Nuclear receptor subfamily 0, group B, member 2), gene accession number (GeneBank accession No. ) AL833069 (KIAA1434, Hypothetical protein KIAA1434), gene accession number (GeneBank accession No. ) AK124656 (ENO2, Enolase 2 (gamma, neuronal)), gene accession number (GeneBank accession No. ) AK094474 (RHOC, Ras homolog gene family, member C), gene accession number (GeneBank accession No. ) AK093461 (ISYNA1, Myo-inositol 1-phosphate synthase A1), gene accession number (GeneBank accession No. ) AB053232 (GAL3ST3, Galactose-3-O-sulfotransferase 3), gene accession number (GeneBank accession No. ) AB045292 (TMEM8, Transmembrane protein 8 (five membrane-spanning domains)), gene accession number (GeneBank accession No. ) NM_004753 (DHRS3, Dehydrogenase / reductase (SDR family) member 3), Gene accession number (GeneBank accession No. ) NM_002900 (RBP3, Retinol binding protein 3, interstitial), gene accession number (GeneBank accession No. ) NM_001995 (ACSL1, Acyl-CoA synthetase long-chain family member 1), gene accession number (GeneBank accession No. NM_000018 (ACADVL, Acyl-Coenzyme A dehydrogenase, very long chain), gene accession number (GeneBank accession No. ) BC094756 (CRA, Myotubularin related protein 11), gene accession number (GeneBank accession No. ) BC050553 (NTE, Neuropathy target esterase), gene accession number (GeneBank accession No. ) BC033110 (HSD17B1, Hydroxysteroid (17-beta) dehydrogenase 1), Gene accession number (GeneBank accession No. ) AY268890 (TPP1, Tripeptidyl peptidase I), gene accession number (GeneBank accession No. ) AK172798 (CPT1A, Carnitine palmitoyltransferase 1A (liver)), gene accession number (GeneBank accession No. ) AK096809 (CYP4F8, Cytochrome P450, family 4, subfamily F, polypeptide 8), gene accession number (GeneBank accession No. ) AK000600 (SIAT7D, ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3) -N-acetylgalactosaminide alpha-2,6-sialyltransferase 4), Gene accession number ) AB002454 (CYP4F3, Cytochrome P450, family 4, subfamily F, polypeptide 3), gene accession number (GeneBank accession No. ) Z29093 (DDR1, Discoidin domain receptor family, member 1), gene accession number (GeneBank accession No. ) Z25424 (MKNK2, MAP kinase interacting serine / threonine kinase 2), gene accession number (GeneBank accession No. ) XM_291277 (DKFZp761P0423, Hypothetical protein DKFZp761P0423), gene accession number (GeneBank accession No. XM_038150 (MAST3, Microtubule associated serine / threonine kinase 3), gene accession number (GeneBank accession No. ) U88357 (ERBB3, V-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian)), gene accession number (GeneBank accession No. ) NM_025195 (TRIB1, Tribbles homolog 1 (Drosophila)), gene accession number (GeneBank accession No. NM_020639 (RIPK4, Receptor-interacting serine-threonine kinase 4), gene accession number (GeneBank accession No. ) NM_014172 (PHPT1, Phosphohistidine phosphatase 1), Gene accession number (GeneBank accession No. ) NM_006254 (PRKCD, Protein kinase C, delta), Gene accession number (GeneBank accession No. ) NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), gene accession number (GeneBank accession No. ) NM_005026 (PIK3CD, Phosphoinositide-3-kinase, catalytic, delta polypeptide), Gene accession number (GeneBank accession No. ) NM_004431 (EPHA2, EPH receptor A2), gene accession number (GeneBank accession No. ) NM_004419 (DUSP5, Dual specificity phosphatase 5), gene accession number (GeneBank accession No. ) NM_004327 (BCR, Breakpoint cluster region), Gene accession number (GeneBank accession No. ) NM_004231 (ATP6V1F, ATPase, H + transporting, lysosomal 14kDa, V1 subunit F), gene registration number (GeneBank accession No. ) NM_004090 (DUSP3, Dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)), gene accession number (GeneBank accession No. ) NM_002843 (PTPRJ, Protein tyrosine phosphatase, receptor type, J), gene accession number (GeneBank accession No. NM_002496 (NDUFS8, NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23 kDa (NADH-coenzyme Q reductase)), gene accession number (GeneBank accession No. NM_001001852 (PIM3, Pim-3 oncogene), gene accession number (GeneBank accession No. ) L76191 (IRAK1, Interleukin-1 receptor-associated kinase 1), gene accession number (GeneBank accession No. ) D15049 (PTPRH, Protein tyrosine phosphatase, receptor type, H), gene accession number (GeneBank accession No. ) BC065207 (ATP6V0D2, ATPase, H + transporting, lysosomal 38kDa, V0 subunit d isoform 2), gene accession number (GeneBank accession No. ) BC035578 (STK24, Serine / threonine kinase 24 (STE20 homolog, yeast)), gene accession number (GeneBank accession No. ) BC028724 (DUSP18, Dual specificity phosphatase 18), gene accession number (GeneBank accession No. AL117482 (ULK3, Unc-51-like kinase 3 (C.  elegans), GeneBank accession No. ) AK126879 (PCTK3, PCTAIRE protein kinase 3), gene accession number (GeneBank accession No. ) AB209416 (ILK, Integrin-linked kinase-2), gene accession number (GeneBank accession No. ) NM_000782 (CYP24A1, Cytochrome P450, family 24, subfamily A, polypeptide 1), gene accession number (GeneBank accession No. ) CR597101 (ZFP36, Zinc finger protein 36, C3H type, homolog (mouse)), Gene accession number (GeneBank accession No. ) CR936799 (FHL2, Four and a half LIM domains 2), gene accession number (GeneBank accession No. ) M24898 (NR1D1, Nuclear receptor subfamily 1, group D, member 1), gene accession number (GeneBank accession No. ) AF132818 (KLF5, Kruppel-like factor 5 (intestinal)), gene accession number (GeneBank accession No. ) AK055337 (ZNF213, Zinc finger protein 213), Gene accession number (GeneBank accession No. ) BC008834 (PHF1, PHD finger protein 1), gene accession number (GeneBank accession No. ) AK126918 (GLIS2, GLIS family zinc finger 2), Gene accession number (GeneBank accession No. ) BC042692 (CTL2, Solute carrier family 44, member 2), gene accession number (GeneBank accession No. ) NM_002224 (ITPR3, Inositol 1,4,5-triphosphate receptor, type 3), gene accession number (GeneBank accession No. ) AK095363 (AQP3, Aquaporin 3), gene accession number (GeneBank accession No. NM_174953 (ATP2A3, ATPase, Ca ++ transporting, ubiquitous), gene accession number (GeneBank accession No. ) BC042390 (VTI1B, Vesicle transport through interaction with t-SNAREs homolog 1B (yeast)), GeneBank Accession No. NM_016113 (TRPV2, Transient receptor potential cation channel, subfamily V, member 2), gene accession number (GeneBank accession No. ) BM926478 (RBP1, Retinol binding protein 1, cellular), gene accession number (GeneBank accession No. NM_000069 (CACNA1S, Calcium channel, voltage-dependent, L type, alpha 1S subunit), Gene Registration Number (GeneBank accession No. ) AK002107 (RAB3B, RAB3B, member RAS oncogene family), gene accession number (GeneBank accession No. ) NM_013321 (SNX8, Sorting nexin 8), Gene accession number (GeneBank accession No. ) AK125026 (SLC6A12, Solute carrier family 6 (neurotransmitter transporter, betaine / GABA), member 12), gene accession number (GeneBank accession No. ) NM_005843 (STAM2, Signal transducing adapter molecule (SH3 domain and ITAM motif) 2), gene accession number (GeneBank accession No. ) AK092512 (SLC16A5, Solute carrier family 16 (monocarboxylic acid transporters), member 5), gene accession number (GeneBank accession No. ) U49248 (ABCC2, ATP-binding cassette, sub-family C (CFTR / MRP), member 2), gene accession number (GeneBank accession No. ) AK172792 (SCNN1A, Sodium channel, nonvoltage-gated 1 alpha), gene accession number (GeneBank accession No. ) BC044656 (CASC3, Cancer susceptibility candidate 3), gene accession number (GeneBank accession No. NM_203403 (C9orf150, Chromosome 9 open reading frame 150), gene accession number (GeneBank accession No. NM_080388 (S100A16, S100 calcium binding protein A16), gene registration number (GeneBank accession No. NM_031286 (SH3BGRL3, SH3 domain binding glutamic acid-rich protein like 3), gene accession number (GeneBank accession No. NM_022153 (PP2135, Chromosome 10 open reading frame 54), gene accession number (GeneBank accession No. ) NM_004864 (GDF15, Growth differentiation factor 15), Gene accession number (GeneBank accession No. ) NM_003330 (TXNRD1, Thioredoxin reductase 1), gene accession number (GeneBank accession No. ) NM_001013632 (LOC343521, Similar to hypothetical protein 4833401D15), gene accession number (GeneBank accession No. ) BX537968 (LOC51149, Hypothetical LOC51149), gene accession number (GeneBank accession No. BU945318 (MT2A, Hypothetical gene supported by X97260; BC070289), gene accession number (GeneBank accession No. ) BQ683841 (S100A11, S100 calcium binding protein A11 (calgizzarin)), gene accession number (GeneBank accession No. ) BQ276852 (TMSB10, Thymosin, beta 10), gene accession number (GeneBank accession No. ) AK126182 (KIAA1949, KIAA1949), gene accession number (GeneBank accession No. ) AK124751 (CAPN2, Calpain 2, (m / II) large subunit), gene accession number (GeneBank accession No. ) AK095079 (RGC32, Response gene to complement 32), gene accession number (GeneBank accession No. ) AB075871 (FLJ42654, Golgi transport 1 homolog A (S.  cerevisiae)). 제 1항에 있어서, 하기 유전자가 페난트렌의 노출에 의해 발현이 감소하는 것을 특징으로 하는 바이오마커:The biomarker of claim 1, wherein the following genes are decreased in expression by exposure to phenanthrene: 유전자 등록번호(GeneBank accession No.) AK125150(MAPK8, Mitogen-activated protein kinase 8), 유전자 등록번호(GeneBank accession No.) NM_002758(MAP2K6, Mitogen-activated protein kinase kinase 6), 유전자 등록번호(GeneBank accession No.) NM_004612(TGFBR1, Transforming growth factor, beta receptor I(activin A receptor type II-like kinase, 53kDa)), 유전자 등록번호(GeneBank accession No.) NM_145686(MAP4K4, Mitogen-activated protein kinase kinase kinase kinase 4), 유전자 등록번호(GeneBank accession No.) XM_042066(MAP3K1, Mitogen-activated protein kinase kinase kinase 1), 유전자 등록번호(GeneBank accession No.) AB011123(TNIK, TRAF2 and NCK interacting kinase), 유전자 등록번호(GeneBank accession No.) AB209031(C5, Complement component 5), 유전자 등록번호(GeneBank accession No.) NM_022740(HIPK2, Homeodomain interacting protein kinase 2), 유전자 등록번호(GeneBank accession No.) NM_148957(TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), 유전자 등록번호(GeneBank accession No.) AB208909(ITGB2, Integrin, beta 2(antigen CD18(p95), lymphocyte function-associated antigen 1; macrophage antigen 1(mac-1) beta subunit)), 유전자 등록번호(GeneBank accession No.) AB209211(TIA1, TIA1 cytotoxic granule-associated RNA binding protein), 유전자 등록번호(GeneBank accession No.) AB209613(DNASE1L3, Deoxyribonuclease I-like 3), 유전자 등록번호(GeneBank accession No.) AK122825(HMGB1, High-mobility group box 1), 유전자 등록번호(GeneBank accession No.) AK127326(PHF17, PHD finger protein 17), 유전자 등록번호(GeneBank accession No.) AK223503(CASP1, Caspase 1, apoptosis-related cysteine peptidase(interleukin 1, beta, convertase)), 유전자 등록번호(GeneBank accession No.) BC013326(GAS2, Growth arrest-specific 2), 유전자 등록번호(GeneBank accession No.) BC047698(IL7, Interleukin 7), 유전자 등록번호(GeneBank accession No.) D79987(ESPL1, Extra spindle poles like 1(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_000893(KNG1, Kininogen 1), 유전자 등록번호(GeneBank accession No.) NM_001012271(BIRC5, Effector cell peptidase receptor 1), 유전자 등록번호(GeneBank accession No.) NM_004938(DAPK1, Death-associated protein kinase 1), 유전자 등록번호(GeneBank accession No.) NM_005879(TRIP, TRAF interacting protein), 유전자 등록번호(GeneBank accession No.) NM_014739(BCLAF1, BCL2-associated transcription factor 1), 유전자 등록번호(GeneBank accession No.) NM_018947(CYCS, Cytochrome c, somatic), 유전자 등록번호(GeneBank accession No.) AB033337(MPHOSPH1, M-phase phosphoprotein 1), 유전자 등록번호(GeneBank accession No.) AB209179(PLK1, Polo-like kinase 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) AB209337(CDC7, CDC7 cell division cycle 7(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) AF053305(BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog(yeast)), 유전자 등록번호(GeneBank accession No.) AF053306(BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta(yeast)), 유전자 등록번호(GeneBank accession No.) AF345347(SPAG5, Sperm associated antigen 5), 유전자 등록번호(GeneBank accession No.) AK092638(CCNG2, Cyclin G2), 유전자 등록번호(GeneBank accession No.) AK222819(NUSAP1, Nucleolar and spindle associated protein 1), 유전자 등록번호(GeneBank accession No.) AL833191(SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AY257469(CIT, Citron(rho-interacting, serine/threonine kinase 21)), 유전자 등 록번호(GeneBank accession No.) AY367065(ASPM, Asp(abnormal spindle)-like, microcephaly associated(Drosophila)), 유전자 등록번호(GeneBank accession No.) BC011000(CDCA5, Cell division cycle associated 5), 유전자 등록번호(GeneBank accession No.) BC032677(UBE2C, Ubiquitin-conjugating enzyme E2C), 유전자 등록번호(GeneBank accession No.) BC043502(NEK2, NIMA(never in mitosis gene a)-related kinase 2), 유전자 등록번호(GeneBank accession No.) BU675073(PTTG1, Pituitary tumor-transforming 1), 유전자 등록번호(GeneBank accession No.) BX647885(STMN1, Stathmin 1/oncoprotein 18), 유전자 등록번호(GeneBank accession No.) CR592757(BRRN1, Barren homolog 1(Drosophila)), 유전자 등록번호(GeneBank accession No.) CR597075(MAPRE2, Microtubule-associated protein, RP/EB family, member 2), 유전자 등록번호(GeneBank accession No.) CR604810(CCNA2, Cyclin A2), 유전자 등록번호(GeneBank accession No.) CR933728(CDC2, Cell division cycle 2, G1 to S and G2 to M), 유전자 등록번호(GeneBank accession No.) NM_000919(PAM, Peptidylglycine alpha-amidating monooxygenase), 유전자 등록번호(GeneBank accession No.) NM_001790(CDC25C, Cell division cycle 25C), 유전자 등록번호(GeneBank accession No.) NM_001798(CDK2, Cyclin-dependent kinase 2), 유전자 등록번호(GeneBank accession No.) NM_001813(CENPE, Centromere protein E, 312kDa), 유전자 등록번호(GeneBank accession No.) NM_003318(TTK, TTK protein kinase), 유전자 등록번호(GeneBank accession No.) NM_003981(PRC1, Protein regulator of cytokinesis 1), 유전자 등록번호(GeneBank accession No.) NM_004523(KIF11, Kinesin family member 11), 유전자 등록번호(GeneBank accession No.) NM_004701(CCNB2, Cyclin B2), 유전자 등록번호(GeneBank accession No.) NM_005983(SKP2, S-phase kinase-associated protein 2(p45)), 유전자 등록번호(GeneBank accession No.) NM_006101(KNTC2, Kinetochore associated 2), 유전자 등록번호(GeneBank accession No.) NM_006845(KIF2C, Kinesin family member 2C), 유전자 등록번호(GeneBank accession No.) NM_007375(TARDBP, TAR DNA binding protein), 유전자 등록번호(GeneBank accession No.) NM_012112(TPX2, TPX2, microtubule-associated, homolog(Xenopus laevis)), 유전자 등록번호(GeneBank accession No.) NM_014750(DLG7, Discs, large homolog 7(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015097(CLASP2, Cytoplasmic linker associated protein 2), 유전자 등록번호(GeneBank accession No.) NM_016343(CENPF, Centromere protein F, 350/400ka(mitosin)), 유전자 등록번호(GeneBank accession No.) NM_016426(GTSE1, G-2 and S-phase expressed 1), 유전자 등록번호(GeneBank accession No.) NM_018492(PBK, PDZ binding kinase), 유전자 등록번호(GeneBank accession No.) NM_018685(ANLN, Anillin, actin binding protein(scraps homolog, Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_020242(KNSL7, Kinesin family member 15), 유전자 등록번호(GeneBank accession No.) NM_031966(CCNB1, Cyclin B1), 유전자 등록번호(GeneBank accession No.) NM_138555(KIF23, Kinesin family member 23), 유전자 등록번호(GeneBank accession No.) U65410(MAD2L1, MAD2 mitotic arrest deficient-like 1(yeast)), 유전자 등록번호(GeneBank accession No.) AB020656(CYLD, Cylindromatosis(turban tumor syndrome)), 유전자 등록번호(GeneBank accession No.) AF033122(SESN1, Sestrin 1), 유전자 등록번호(GeneBank accession No.) AK074377(UHRF1, Chromosome 19 open reading frame 31), 유전자 등록번호(GeneBank accession No.) AK091170(CDKN2C, Cyclin-dependent kinase inhibitor 2C(p18, inhibits CDK4)), 유전자 등록번호(GeneBank accession No.) AK094323(NFYC, Nuclear transcription factor Y, gamma), 유전자 등록번호(GeneBank accession No.) AY366508(LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), 유전자 등록번호(GeneBank accession No.) BC033086(TCF19, Transcription factor 19(SC1)), 유전자 등록번호(GeneBank accession No.) BC040303(PTP4A1, Protein tyrosine phosphatase type IVA, member 1), 유전자 등록번호(GeneBank accession No.) BC040991(TFDP2, Transcription factor Dp-2(E2F dimerization partner 2)), 유전자 등록번호(GeneBank accession No.) BC092412(SGOL2, Shugoshin-like 2(S. pombe)), 유전자 등록번호(GeneBank accession No.) BQ278454(CKS1B, CDC28 protein kinase regulatory subunit 1B), 유전자 등록번호(GeneBank accession No.) BX649128(SESN3, Sestrin 3), 유전자 등록번호(GeneBank accession No.) CD049340(AURKB, Aurora kinase B), 유전자 등록번호(GeneBank accession No.) M89914(NF1, Neurofibromin 1(neurofibromatosis, von Recklinghausen disease, Watson disease)), 유전자 등록번호(GeneBank accession No.) NM_001005414(ZWINT, ZW10 interactor antisense), 유전자 등록번 호(GeneBank accession No.) NM_001008491(Sep 2, Septin 2), 유전자 등록번호(GeneBank accession No.) NM_001274(CHEK1, CHK1 checkpoint homolog(S. pombe)), 유전자 등록번호(GeneBank accession No.) NM_002105(H2AFX, H2A histone family, member X), 유전자 등록번호(GeneBank accession No.) NM_002388(MCM3, MCM3 minichromosome maintenance deficient 3(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_002417(MKI67, Antigen identified by monoclonal antibody Ki-67), 유전자 등록번호(GeneBank accession No.) NM_002875(RAD51, RAD51 homolog(RecA homolog, E. coli)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_003884(PCAF, P300/CBP-associated factor), 유전자 등록번호(GeneBank accession No.) NM_004526(MCM2, MCM2 minichromosome maintenance deficient 2, mitotin(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_004847(AIF1, Allograft inflammatory factor 1), 유전자 등록번호(GeneBank accession No.) NM_005915(MCM6, MCM6 minichromosome maintenance deficient 6(MIS5 homolog, S. pombe)(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_012090(MACF1, Microtubule-actin crosslinking factor 1), 유전자 등록번호(GeneBank accession No.) NM_012415(RAD54B, RAD54 homolog B(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) NM_014264(PLK4, Polo-like kinase 4(Drosophila)), 유전자 등록번호(GeneBank accession No.) NM_015714(G0S2, G0/G1switch 2), 유전자 등록번호(GeneBank accession No.) NM_024680(FLJ23311, E2F transcription factor 8), 유전자 등록번호(GeneBank accession No.) XM_034274(MYBL1, V-myb myeloblastosis viral oncogene homolog(avian)-like 1), 유전자 등록번호(GeneBank accession No.) AK001720(FLJ10858, Nei endonuclease VIII-like 3(E. coli)), 유전자 등록번호(GeneBank accession No.) AY032677(POLQ, Polymerase(DNA directed), theta), 유전자 등록번호(GeneBank accession No.) BC034480(BLM, Bloom syndrome), 유전자 등록번호(GeneBank accession No.) BC073161(RAD51C, RAD51 homolog C(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) CR600021(HMGB2, High-mobility group box 2), 유전자 등록번호(GeneBank accession No.) CR625391(RAD51AP1, RAD51 associated protein 1), 유전자 등록번호(GeneBank accession No.) CR936783(FLJ40869, Hypothetical protein LOC284952), 유전자 등록번호(GeneBank accession No.) DQ140356(KIAA1596, Fanconi anemia, complementation group M), 유전자 등록번호(GeneBank accession No.) NM_001067(TOP2A, Topoisomerase(DNA) II alpha 170kDa), 유전자 등록번호(GeneBank accession No.) NM_001618(PARP1, Poly(ADP-ribose) polymerase family, member 1), 유전자 등록번호(GeneBank accession No.) NM_003362(UNG, Uracil-DNA glycosylase), 유전자 등록번호(GeneBank accession No.) NM_006904(PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), 유전자 등록번호(GeneBank accession No.) NM_130398(EXO1, Exonuclease 1), 유전자 등록번호(GeneBank accession No.) AB020807(TLR6, Toll-like receptor 6), 유전자 등록번호(GeneBank accession No.) AB032980(DCDC2, Doublecortin domain containing 2), 유전자 등록번호(GeneBank accession No.) AB209866(TFPI, Tissue factor pathway inhibitor(lipoprotein-associated coagulation inhibitor)), 유전자 등록번호(GeneBank accession No.) AK057015(HSPA4, Heat shock 70kDa protein 4), 유전자 등록번호(GeneBank accession No.) AK095515(IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), 유전자 등록번호(GeneBank accession No.) AK122686(IF, I factor(complement)), 유전자 등록번호(GeneBank accession No.) AK123010(RRM2, Ribonucleotide reductase M2 polypeptide), 유전자 등록번호(GeneBank accession No.) BC035582(TRIM22, Tripartite motif-containing 22), 유전자 등록번호(GeneBank accession No.) BX537894(LOC493869, Similar to RIKEN cDNA 2310016C16), 유전자 등록번호(GeneBank accession No.) M14338(PROS1, Protein S(alpha)), 유전자 등록번호(GeneBank accession No.) NM_000821(GGCX, Gamma-glutamyl carboxylase), 유전자 등록번호(GeneBank accession No.) NM_000963(PTGS2, Prostaglandin-endoperoxide synthase 2(prostaglandin G/H synthase and cyclooxygenase)), 유전자 등록번호(GeneBank accession No.) NM_001001547(CD36, CD36 antigen(collagen type I receptor, thrombospondin receptor)), 유전자 등록번호(GeneBank accession No.) NM_001512(GSTA4, Glutathione S-transferase A4), 유전자 등록번호(GeneBank accession No.) NM_001629(ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), 유전자 등록번호(GeneBank accession No.) NM_001752(CAT, Catalase), 유전자 등록번호(GeneBank accession No.) NM_001837(CCR3, Chemokine(C-C motif) receptor 3), 유전자 등록번호(GeneBank accession No.) NM_001979(EPHX2, Epoxide hydrolase 2, cytoplasmic), 유전자 등록번호(GeneBank accession No.) NM_001994(F13B, Coagulation factor XIII, B polypeptide), 유전자 등록번호(GeneBank accession No.) NM_002182(IL1RAP, Interleukin 1 receptor accessory protein), 유전자 등록번호(GeneBank accession No.) NM_006120(HLA-DMA, Major histocompatibility complex, class II, DM alpha), 유전자 등록번호(GeneBank accession No.) NM_173216(SIAT1, ST6 beta-galactosamide alpha-2,6-sialyltranferase 1), 유전자 등록번호(GeneBank accession No.) NM_202002(FOXM1, Forkhead box M1), 유전자 등록번호(GeneBank accession No.) AB163917(LRAP, Leukocyte-derived arginine aminopeptidase), 유전자 등록번호(GeneBank accession No.) BC027881(AFP, Alpha-fetoprotein), 유전자 등록번호(GeneBank accession No.) NM_015915(SPG3A, Spastic paraplegia 3A(autosomal dominant)), 유전자 등록번호(GeneBank accession No.) NM_000671(ADH5, Alcohol dehydrogenase 5(class III), chi polypeptide), 유전자 등록번호(GeneBank accession No.) J05428(UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), 유전자 등록번호(GeneBank accession No.) NM_000672(ADH6, Alcohol dehydrogenase 6(class V)), 유전자 등록번호(GeneBank accession No.) M15943(ADH4, Alcohol dehydrogenase 4(class II), pi polypeptide), 유전자 등록번호(GeneBank accession No.) AK223395(FBP1, Fructose-1,6-bisphosphatase 1), 유전자 등록번호(GeneBank accession No.) NM_000151(G6PC, Glucose-6-phosphatase, catalytic(glycogen storage disease type I, von Gierke disease)), 유전자 등록번호(GeneBank accession No.) XM_113962(KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), 유전자 등록번호(GeneBank accession No.) AB020644(ACSL6, Acyl-CoA synthetase long-chain family member 6), 유전자 등록번호(GeneBank accession No.) AB209907(PLD1, Phospholipase D1, phophatidylcholine-specific), 유전자 등록번호(GeneBank accession No.) AF285167(ABCA1, ATP-binding cassette, sub-family A(ABC1), member 1), 유전자 등록번호(GeneBank accession No.) AF297872(TRERF1, Transcriptional regulating factor 1), 유전자 등록번호(GeneBank accession No.) AF303134(ALDH8A1, Aldehyde dehydrogenase 8 family, member A1), 유전자 등록번호(GeneBank accession No.) AF339053(PLA2G12B, Phospholipase A2, group XIIB), 유전자 등록번호(GeneBank accession No.) AK096018(HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), 유전자 등록번호(GeneBank accession No.) AK124635(PCSK9, Proprotein convertase subtilisin/kexin type 9), 유전자 등록번호(GeneBank accession No.) AK127346(SIAT9, ST3 beta-galactoside alpha-2,3-sialyltransferase 5), 유전자 등록번호(GeneBank accession No.) AL359559(AGPS, Alkylglycerone phosphate synthase), 유전자 등록번호(GeneBank accession No.) AY691170(PLCL3, Phospholipase C-like 3), 유전자 등록번호(GeneBank accession No.) BG567934(APOM, Apolipoprotein M), 유전자 등록번호(GeneBank accession No.) BX538214(C6orf167, Chromosome 6 open reading frame 167), 유전자 등록번 호(GeneBank accession No.) BX640945(FADS2, Fatty acid desaturase 2), 유전자 등록번호(GeneBank accession No.) BX648473(PIGK, Phosphatidylinositol glycan, class K), 유전자 등록번호(GeneBank accession No.) BX648557(HSD17B2, Hydroxysteroid(17-beta) dehydrogenase 2), 유전자 등록번호(GeneBank accession No.) CR749601(ETNK1, Death-associated protein kinase 3), 유전자 등록번호(GeneBank accession No.) NM_000859(HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), 유전자 등록번호(GeneBank accession No.) NM_001443(FABP1, Fatty acid binding protein 1, liver), 유전자 등록번호(GeneBank accession No.) NM_002130(HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1(soluble)), 유전자 등록번호(GeneBank accession No.) NM_003725(RODH, Hydroxysteroid(17-beta) dehydrogenase 6), 유전자 등록번호(GeneBank accession No.) NM_004845(PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), 유전자 등록번호(GeneBank accession No.) NM_014762(DHCR24, 24-dehydrocholesterol reductase), 유전자 등록번호(GeneBank accession No.) NM_020139(DHRS6, Dehydrogenase/reductase(SDR family) member 6), 유전자 등록번호(GeneBank accession No.) NM_020918(GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), 유전자 등록번호(GeneBank accession No.) NM_032523(OSBPL6, Oxysterol binding protein-like 6), 유전자 등록번호(GeneBank accession No.) NM_033505(SELI, Selenoprotein I), 유전자 등록번호(GeneBank accession No.) Z28339(AKR1D1, Aldo-keto reductase family 1, member D1(delta 4-3-ketosteroid-5-beta-reductase)), 유전자 등록번호(GeneBank accession No.) AK024899(ENPP3, Ectonucleotide pyrophosphatase/ phosphodiesterase 3), 유전자 등록번호(GeneBank accession No.) AK025546(PTPN4, Protein tyrosine phosphatase, non-receptor type 4(megakaryocyte)), 유전자 등록번호(GeneBank accession No.) AK124910(ENPP2, Ectonucleotide pyrophosphatase/phosphodiesterase 2(autotaxin)), 유전자 등록번호(GeneBank accession No.) BC035116(FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), 유전자 등록번호(GeneBank accession No.) BC050565(PASK, PAS domain containing serine/threonine kinase), 유전자 등록번호(GeneBank accession No.) L13436(NPR2, Natriuretic peptide receptor B/guanylate cyclase B(atrionatriuretic peptide receptor B)), 유전자 등록번호(GeneBank accession No.) NM_001005862(ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog(avian)), 유전자 등록번호(GeneBank accession No.) NM_005012(ROR1, Receptor tyrosine kinase-like orphan receptor 1), 유전자 등록번호(GeneBank accession No.) NM_006035(CDC42BPB, CDC42 binding protein kinase beta(DMPK-like)), 유전자 등록번호(GeneBank accession No.) NM_014791(MELK, Maternal embryonic leucine zipper kinase), 유전자 등록번호(GeneBank accession No.) NM_023028(FGFR2, Fibroblast growth factor receptor 2(bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), 유전자 등록번호(GeneBank accession No.) NM_080836(STK35, Serine/threonine kinase 35), 유전자 등록번호(GeneBank accession No.) AF419331(FUSIP1, FUS interacting protein(serine/arginine-rich) 1), 유전자 등록번호(GeneBank accession No.) AK091927(SFRS3, Splicing factor, arginine/serine-rich 3), 유전자 등록번호(GeneBank accession No.) BC010266(HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), 유전자 등록번호(GeneBank accession No.) BC012360(CTAGE5, CTAGE family, member 5), 유전자 등록번호(GeneBank accession No.) BC036046(PLRG1, Pleiotropic regulator 1(PRL1 homolog, Arabidopsis)), 유전자 등록번호(GeneBank accession No.) BC065384(PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BX537360(CPSF5, Nudix(nucleoside diphosphate linked moiety X)-type motif 21), 유전자 등록번호(GeneBank accession No.) BX537494(HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2/B1), 유전자 등록번호(GeneBank accession No.) BX647784(HNRPR, Heterogeneous nuclear ribonucleoprotein R), 유전자 등록번호(GeneBank accession No.) CA455267(PPIH, Peptidyl prolyl isomerase H(cyclophilin H)), 유전자 등록번호(GeneBank accession No.) CR596214(HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), 유전자 등록번호(GeneBank accession No.) NM_001326(CSTF3, Hypothetical protein LOC283267), 유전자 등록번호(GeneBank accession No.) NM_004640(BAT1, HLA-B associated transcript 1), 유전자 등록번호(GeneBank accession No.) NM_005463(HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), 유전자 등록번호(GeneBank accession No.) NM_006924(SFRS1, Splicing factor, arginine/serine-rich 1(splicing factor 2, alternate splicing factor)), 유전자 등록번호(GeneBank accession No.) NM_012426(SF3B3, Splicing factor 3b, subunit 3, 130kDa), 유전자 등록번호(GeneBank accession No.) NM_018048(FLJ10292, Mago-nashi homolog), 유전자 등록번호(GeneBank accession No.) NM_030919(C20orf129, Chromosome 20 open reading frame 129), 유전자 등록번호(GeneBank accession No.) NM_031370(HNRPD, Heterogeneous nuclear ribonucleoprotein D(AU-rich element RNA binding protein 1, 37kDa)), 유전자 등록번호(GeneBank accession No.) NM_138933(ACF, Apobec-1 complementation factor), 유전자 등록번호(GeneBank accession No.) AB193259(ACE2, Angiotensin I converting enzyme(peptidyl-dipeptidase A) 2), 유전자 등록번호(GeneBank accession No.) BX648769(EWSR1, Ewing sarcoma breakpoint region 1), 유전자 등록번호(GeneBank accession No.) AB023154(DTX4, Deltex 4 homolog(Drosophila)), 유전자 등록번호(GeneBank accession No.) AL543755(VAV3, Vav 3 oncogene), 유전자 등록번호(GeneBank accession No.) M75106(CPB2, Carboxypeptidase B2(plasma, carboxypeptidase U)), 유전자 등록번호(GeneBank accession No.) NM_021045(ZNF248, Zinc finger protein 248), 유전자 등록번호(GeneBank accession No.) AB209194(B4GALT6, UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6), 유전자 등록번호(GeneBank accession No.) AF279145(ANTXR1, Anthrax toxin receptor 1), 유전자 등록번호(GeneBank accession No.) NM_025074(FRAS1, Fraser syndrome 1), 유전자 등록번호(GeneBank accession No.) AK025790(KIF20A, Kinesin family member 20A), 유전자 등록번호(GeneBank accession No.) NM_006152(LRMP, Lymphoid-restricted membrane protein), 유전자 등록번호(GeneBank accession No.) NM_000340(SLC2A2, Solute carrier family 2(facilitated glucose transporter), member 2), 유전자 등록번호(GeneBank accession No.) AF071592(KIF4A, Kinesin family member 4A), 유전자 등록번호(GeneBank accession No.) NM_013277(RACGAP1, Rac GTPase activating protein 1), 유전자 등록번호(GeneBank accession No.) AY043484(SCN1A, Sodium channel, voltage-gated, type I, alpha), 유전자 등록번호(GeneBank accession No.) AY791349(KIF18A, Kinesin family member 18A), 유전자 등록번호(GeneBank accession No.) NM_018018(SLC38A4, Solute carrier family 38, member 4), 유전자 등록번호(GeneBank accession No.) AK094603(FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), 유전자 등록번호(GeneBank accession No.) NM_021069(ARGBP2, Sorbin and SH3 domain containing 2), 유전자 등록번호(GeneBank accession No.) NM_001005747(CACNB4, Calcium channel, voltage-dependent, beta 4 subunit), 유전자 등록번호(GeneBank accession No.) AJ496568(SLC25A12, Solute carrier family 25(mitochondrial carrier, Aralar), member 12), 유전자 등록번호(GeneBank accession No.) NM_030641(APOL6, Apolipoprotein L, 6), 유전자 등록 번호(GeneBank accession No.) NM_173512(FLJ39822, Hypothetical protein FLJ39822), 유전자 등록번호(GeneBank accession No.) NM_000037(ANK1, Ankyrin 1, erythrocytic), 유전자 등록번호(GeneBank accession No.) NM_001011554(SLC13A3, Solute carrier family 13(sodium-dependent dicarboxylate transporter), member 3), 유전자 등록번호(GeneBank accession No.) AB091343(C10orf3, Centrosomal protein 55kDa), 유전자 등록번호(GeneBank accession No.) AK000643(ASB9, Ankyrin repeat and SOCS box-containing 9), 유전자 등록번호(GeneBank accession No.) AK055221(FBXO5, F-box protein 5), 유전자 등록번호(GeneBank accession No.) AK075271(SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2-like(aminotransferase 2)), 유전자 등록번호(GeneBank accession No.) AK122685(GLUD1, Glutamate dehydrogenase 1), 유전자 등록번호(GeneBank accession No.) AK127098(FLJ10706, Chromosome 1 open reading frame 112), 유전자 등록번호(GeneBank accession No.) AL133031(MLR1, Transcription factor MLR1), 유전자 등록번호(GeneBank accession No.) AY007723(MAL2, Mal, T-cell differentiation protein 2), 유전자 등록번호(GeneBank accession No.) BC022255(Spc25, Spindle pole body component 25 homolog(S. cerevisiae)), 유전자 등록번호(GeneBank accession No.) BC041882(ATF7IP2, Activating transcription factor 7 interacting protein 2), 유전자 등록번호(GeneBank accession No.) BC052951(LMNB1, Lamin B1), 유전자 등록번호(GeneBank accession No.) BC098313(FLJ20641, Hypothetical protein FLJ20641), 유전자 등록번 호(GeneBank accession No.) NM_001809(CENPA, Centromere protein A, 17kDa), 유전자 등록번호(GeneBank accession No.) NM_145061(C13orf3, Chromosome 13 open reading frame 3), 유전자 등록번호(GeneBank accession No.) XM_372695(LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase(LOC390859), mRNA).GeneBank accession No.AK125150 (MAPK8, Mitogen-activated protein kinase 8), GeneBank accession No. NM_002758 (MAP2K6, Mitogen-activated protein kinase kinase 6), Gene accession number (GeneBank accession No. NM_004612 (TGFBR1, Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kDa)), gene accession number (GeneBank accession No.) NM_145686 (MAP4K4, Mitogen-activated protein kinase kinase kinase 4) , GeneBank accession No. XM_042066 (MAP3K1, Mitogen-activated protein kinase kinase kinase 1), GeneBank accession No. AB011123 (TNIK, TRAF2 and NCK interacting kinase), Gene accession number (GeneBank accession No.) AB209031 (C5, Complement component 5), GeneBank accession No. NM_022740 (HIPK2, Homeodomain interacting protein kinase 2), GeneBank accession No. NM_148957 (TNFRSF19, Tumor necrosis factor receptor superf amily, member 19), GeneBank accession No. AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1); macrophage antigen 1 (mac-1) beta subunit)), GeneBank accession No. AB209211 (TIA1, TIA1 cytotoxic granule-associated RNA binding protein), GeneBank accession No. AB209613 (DNASE1L3, Deoxyribonuclease) I-like 3), GeneBank accession No. AK122825 (HMGB1, High-mobility group box 1), GeneBank accession No. AK127326 (PHF17, PHD finger protein 17), Gene accession number ( GeneBank accession No.) AK223503 (CASP1, Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), GeneBank accession No. BC013326 (GAS2, Growth arrest-specific 2), gene registration number GeneBank accession No. BC047698 (IL7, Interleukin 7), GeneBank accession No. D79987 (ESPL1, Extra spindle poles like 1 (S. cerevisiae)), GeneBank accession No. NM_000893 ( KNG1, Kininogen 1), GeneBank accession No. NM_001012271 (BIRC5, Eff ector cell peptidase receptor 1), GeneBank accession No. NM_004938 (DAPK1, Death-associated protein kinase 1), GeneBank accession No. NM_005879 (TRIP, TRAF interacting protein), Gene accession number ( GeneBank accession No.) NM_014739 (BCLAF1, BCL2-associated transcription factor 1), GeneBank accession No. NM_018947 (CYCS, Cytochrome c, somatic), Gene accession number AB033337 (MPHOSPH1, M -phase phosphoprotein 1), GeneBank accession No. AB209179 (PLK1, Polo-like kinase 1 (Drosophila)), Gene accession number (GeneBank accession No.) AB209337 (CDC7, CDC7 cell division cycle 7 (S. cerevisiae)), GeneBank accession No. AF053305 (BUB1, BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)), GeneBank accession No. AF053306 (BUB1B, BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast), GeneBank accession No. AF345347 (SPAG5, Sperm associated antigen 5), GeneBank accession No. AK092638 (CCNG2, Cyclin G2), GeneBank accession No. AK222819 (NUSAP1, Nucleolar and spindle associated protein 1), GeneBank accession No. AL833191 (SMC2L1, SMC2 structural maintenance of chromosomes 2-like 1 (yeast)), GeneBank accession No. AY257469 ( CIT, Citron (rho-interacting, serine / threonine kinase 21), GeneBank accession No. AY367065 (ASPM, Asp (abnormal spindle) -like, microcephaly associated (Drosophila)), GeneBank accession No.) BC011000 (CDCA5, Cell division cycle asso ciated 5), GeneBank accession No. BC032677 (UBE2C, Ubiquitin-conjugating enzyme E2C), GeneBank accession No. BC043502 (NEK2, never in mitosis gene a) -related kinase 2 , GeneBank accession No. BU675073 (PTTG1, Pituitary tumor-transforming 1), GeneBank accession No. BX647885 (STMN1, Stathmin 1 / oncoprotein 18), GeneBank accession No. CR592757 (BRRN1, Barren homolog 1 (Drosophila)), GeneBank accession No. CR597075 (MAPRE2, Microtubule-associated protein, RP / EB family, member 2), GeneBank accession No. CR604810 ( CCNA2, Cyclin A2), GeneBank accession No. CR933728 (CDC2, Cell division cycle 2, G1 to S and G2 to M), GeneBank accession No. NM_000919 (PAM, Peptidylglycine alpha-amidating monooxygenase), GeneBank accession No. NM_001790 (CDC25C, Cell division cycle 2 5C), GeneBank accession No. NM_001798 (CDK2, Cyclin-dependent kinase 2), GeneBank accession No. NM_001813 (CENPE, Centromere protein E, 312kDa), GeneBank accession No. NM_003318 (TTK, TTK protein kinase), GeneBank accession No. NM_003981 (PRC1, Protein regulator of cytokinesis 1), GeneBank accession No. NM_004523 (KIF11, Kinesin family member 11) GeneBank accession No. NM_004701 (CCNB2, Cyclin B2), GeneBank accession No. NM_005983 (SKP2, S-phase kinase-associated protein 2 (p45)), GeneBank accession No. NM_006101 (KNTC2, Kinetochore associated 2), GeneBank accession No. NM_006845 (KIF2C, Kinesin family member 2C), GeneBank accession No. NM_007375 (TARDBP, TAR DNA binding protein), Gene Registration number (GeneBank accession No.) NM_012112 (TPX2, TPX2, microtubul e-associated, homolog (Xenopus laevis)), GeneBank accession No. NM_014750 (DLG7, Discs, large homolog 7 (Drosophila)), GeneBank accession No. NM_015097 (CLASP2, Cytoplasmic linker associated protein 2), GeneBank accession No. NM_016343 (CENPF, Centromere protein F, 350 / 400ka (mitosin)), GeneBank accession No. NM_016426 (GTSE1, G-2 and S-phase expressed 1), Gene Registration Number (GeneBank accession No.) NM_018492 (PBK, PDZ binding kinase), Gene Registration Number (GeneBank accession No.) NM_018685 (ANLN, Anillin, actin binding protein (scraps homolog, Drosophila)), Gene Registration Number GeneBank accession No. NM_020242 (KNSL7, Kinesin family member 15), GeneBank accession No. NM_031966 (CCNB1, Cyclin B1), GeneBank accession No. NM_138555 (KIF23, Kinesin family member 23 ), GeneBank accession No. U65410 (MAD2L1, MAD2 mitotic arrest defi cient-like 1 (yeast)), GeneBank accession No. AB020656 (CYLD, Cylindromatosis (turban tumor syndrome)), GeneBank accession No. AF033122 (SESN1, Sestrin 1), Gene accession number GeneBank accession No. AK074377 (UHRF1, Chromosome 19 open reading frame 31), GeneBank accession No. AK091170 (CDKN2C, Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4)), Gene accession number (GeneBank accession No.) AK094323 (NFYC, Nuclear transcription factor Y, gamma), GeneBank accession No. AY366508 (LOH11CR2A, Loss of heterozygosity, 11, chromosomal region 2, gene A), GeneBank accession No. BC033086 (TCF19, Transcription factor 19 (SC1)), GeneBank accession No. BC040303 (PTP4A1, Protein tyrosine phosphatase type IVA, member 1), GeneBank accession No. BC040991 (TFDP2, Transcription factor Dp-2 (E2F dimerization partner 2), gene registration number (GeneBank accession No.) BC092412 (SGOL2, Shugoshin-like 2 (S. pombe), GeneBank accession No. BQ278454 (CKS1B, CDC28 protein kinase regulatory subunit 1B), GeneBank accession No. BX649128 (SESN3, Sestrin 3), GeneBank accession No. ) CD049340 (AURKB, Aurora kinase B), GeneBank accession No. M89914 (NF1, Neurofibromin 1 (neurofibromatosis, von Recklinghausen disease, Watson disease)), GeneBank accession No. NM_001005414 (ZWINT, ZW10 interactor antisense), GeneBank accession No. NM_001008491 (Sep 2, Septin 2), GeneBank accession No. NM_001274 (CHEK1, CHK1 checkpoint homolog (S. pombe)), gene registration number GeneBank accession No.NM_002105 (H2AFX, H2A histone family, member X), GeneBank accession No.NM_002388 (MCM3, MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)), Gene accession number (GeneBank accession No. NM_002417 (MKI67, Antigen identified by monoclon al antibody Ki-67), GeneBank accession No. NM_002875 (RAD51, RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)), GeneBank accession No. NM_003884 (PCAF, P300 / CBP-associated factor), GeneBank accession No. NM_004526 (MCM2, MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)), GeneBank accession No. NM_004847 (AIF1, Allograft inflammatory factor 1), GeneBank accession No. NM_005915 (MCM6, MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) ( S. cerevisiae)), GeneBank accession No. NM_012090 (MACF1, Microtubule-actin crosslinking factor 1), GeneBank accession No. NM_012415 (RAD54B, RAD54 homolog B (S. cerevisiae)), GeneBank accession No. NM_014264 (PLK4, Polo-like kinase 4 (Drosophila)), GeneBank accession No. NM_015714 (G0S2, G0 / G1switch 2), GeneBank accession No. NM_024680 (FLJ23311, E2F transcription factor 8), GeneBank accession No. XM_034274 (MYBL1, V-myb myeloblastosis viral oncogene homolog (avian) -like 1), GeneBank accession No. AK001720 ( FLJ10858, Nei endonuclease VIII-like 3 (E. coli)), gene registration number (GeneBank acc ession No.) AY032677 (POLQ, Polymerase (DNA directed), theta), GeneBank accession No. BC034480 (BLM, Bloom syndrome), GeneBank accession No. BC073161 (RAD51C, RAD51 homolog C (S. cerevisiae)), GeneBank accession No. CR600021 (HMGB2, High-mobility group box 2), GeneBank accession No. CR625391 (RAD51AP1, RAD51 associated protein 1), GeneBank accession No.) CR936783 (FLJ40869, Hypothetical protein LOC284952), GeneBank accession No. DQ140356 (KIAA1596, Fanconi anemia, complementation group M), GeneBank accession No. NM_001067 (TOP2A, Topoisomerase (DNA) II alpha 170kDa), GeneBank accession No. NM_001618 (PARP1, Poly (ADP-ribose) polymerase family, member 1), GeneBank accession No. NM_003362 (UNG, Uracil-DNA glycosylase), GeneBank accession No. NM_006904 (PRKDC, Protein kinase, DNA-activated, catalytic polypeptide), GeneBank accession No. NM_130398 (EXO1, Exonuclease 1), GeneBank accession No. AB020807 (TLR6, Toll-like receptor 6), gene GeneBank accession No. AB032980 (DCDC2, Doublecortin domain containing 2), GeneBank accession No. AB209866 (TFPI, Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)), GeneBank accession No.) AK057015 (HSPA4, Heat shock 70kDa protein 4), GeneBank accession No. AK095515 (IFIT1, Interferon-induced protein with tetratricopeptide repeats 1), GeneBank accession No. AK122686 (IF, I factor (complement), GeneBank accession No. AK123010 (RRM2, Ribonucleotide reductase M2 polypeptide), GeneBank accession No. BC035582 (TRIM22, Tripartite motif-containing 22), Gene accession number ( GeneBank accession No. BX537894 (LOC493869, Similar to RIKEN cDNA 2310016C16), GeneBank accession No. M14338 (PROS1, Protein S (alpha)), GeneBank accession No. NM_000821 (GGCX, Gamma -glutamyl carboxyla se), GeneBank accession No. NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), GeneBank accession No. NM_001001547 (CD36, CD36 antigen (collagen type) I receptor, thrombospondin receptor), GeneBank accession No. NM_001512 (GSTA4, Glutathione S-transferase A4), GeneBank accession No. NM_001629 (ALOX5AP, Arachidonate 5-lipoxygenase-activating protein), GeneBank accession No. NM_001752 (CAT, Catalase), GeneBank accession No. NM_001837 (CCR3, Chemokine (CC motif) receptor 3), GeneBank accession No. NM_001979 (EPHX2 , Epoxide hydrolase 2, cytoplasmic), GeneBank accession No. NM_001994 (F13B, Coagulation factor XIII, B polypeptide), GeneBank accession No. NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), gene Registration number GeneBank accession No. NM_006120 (HLA-DMA, Major histocompatibility complex, class II, DM alpha), GeneBank accession No. NM_173216 (SIAT1, ST6 beta-galactosamide alpha-2,6-sylyltranferase 1), GeneBank accession No. NM_202002 (FOXM1, Forkhead box M1), GeneBank accession No. AB163917 (LRAP, Leukocyte-derived arginine aminopeptidase), GeneBank accession No. BC027881 (AFP) , Alpha-fetoprotein, GeneBank accession No. NM_015915 (SPG3A, Spastic paraplegia 3A (autosomal dominant)), GeneBank accession No. NM_000671 (ADH5, Alcohol dehydrogenase 5 (class III), chi polypeptide), GeneBank accession No. J05428 (UGT2B7, UDP glucuronosyltransferase 2 family, polypeptide B7), GeneBank accession No. NM_000672 (ADH6, Alcohol dehydrogenase 6 (class V)), gene registration number (GeneBank accession No.) M15943 (ADH4, Alcohol dehy drogenase 4 (class II), pi polypeptide), gene accession number (GeneBank accession No.) AK223395 (FBP1, Fructose-1,6-bisphosphatase 1), gene accession number (GeneBank accession No.) NM_000151 (G6PC, Glucose-6 -phosphatase, catalytic (glycogen storage disease type I, von Gierke disease), GeneBank accession No. XM_113962 (KIAA0650, Structural maintenance of chromosomes flexible hinge domain containing 1), GeneBank accession No. AB020644 (ACSL6, Acyl-CoA synthetase long-chain family member 6), GeneBank accession No. AB209907 (PLD1, Phospholipase D1, phophatidylcholine-specific), GeneBank accession No. AF285167 (ABCA1, ATP-binding cassette, sub-family A (ABC1), member 1), GeneBank accession No. AF297872 (TRERF1, Transcriptional regulating factor 1), GeneBank accession No. AF303134 (ALDH8A1, Aldehyde) dehydrogenase 8 family, member A1), gene registration number GeneBank accession No.AF339053 (PLA2G12B, Phospholipase A2, group XIIB), GeneBank accession No.AK096018 (HADHSC, L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain), Gene accession number (GeneBank accession No.) AK124635 (PCSK9, Proprotein convertase subtilisin / kexin type 9), GeneBank accession No. AK127346 (SIAT9, ST3 beta-galactoside alpha-2,3-sialyltransferase 5), GeneBank accession No. AL359559 (AGPS, Alkylglycerone phosphate synthase), GeneBank accession No. AY691170 (PLCL3, Phospholipase C-like 3), GeneBank accession No. BG567934 (APOM, Apolipoprotein M), Gene Registration Number (GeneBank accession No.) BX538214 (C6orf167, Chromosome 6 open reading frame 167), GeneBank accession No. BX640945 (FADS2, Fatty acid desaturase 2), Gene accession number BX648473 ( PIGK, Phosphatidylinositol glycan, class K), gene registration GeneBank accession No. BX648557 (HSD17B2, Hydroxysteroid (17-beta) dehydrogenase 2), GeneBank accession No. CR749601 (ETNK1, Death-associated protein kinase 3), Gene accession No. ) NM_000859 (HMGCR, 3-hydroxy-3-methylglutaryl-Coenzyme A reductase), GeneBank accession No. NM_001443 (FABP1, Fatty acid binding protein 1, liver), GeneBank accession No. NM_002130 (HMGCS1, 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble), GeneBank accession No.) NM_003725 (RODH, Hydroxysteroid (17-beta) dehydrogenase 6), Gene accession number (GeneBank accession No NM_004845 (PCYT1B, Phosphate cytidylyltransferase 1, choline, beta), GeneBank accession No. NM_014762 (DHCR24, 24-dehydrocholesterol reductase), GeneBank accession No. NM_020139 (DHRS6ductase) (SDR family) member 6), GeneBank accessi on No.) NM_020918 (GPAM, Glycerol-3-phosphate acyltransferase, mitochondrial), GeneBank accession No. NM_032523 (OSBPL6, Oxysterol binding protein-like 6), GeneBank accession No. NM_033505 ( SELI, Selenoprotein I), GeneBank accession No. Z28339 (AKR1D1, Aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)), GeneBank accession No.) AK024899 (ENPP3, Ectonucleotide pyrophosphatase / phosphodiesterase 3), GeneBank accession No. AK025546 (PTPN4, Protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)), Gene Accession No. AK124910 (ENPP2, Ectonucleotide pyrophosphatase / phosphodiesterase 2 (autotaxin)), gene accession number (GeneBank accession No.) BC035116 (FLJ35059 fis, CDNA FLJ30761 fis, clone FEBRA2000538), gene accession number (GeneBank accession No.) BC050565 (PASK, PAS domain containing serine / threonine kinase), GeneBank accession No. L13436 (NPR2, Natriuretic peptide receptor B / guanylate cyclase B (atrionatriuretic peptide receptor B)), GeneBank accession No. NM_001005862 (ERBB2, V-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro / glioblastoma derived oncogene homolog (avian), GeneBank accession No. NM_005012 (ROR1, Receptor tyrosine kinase-like orphan receptor 1), GeneBank accession No. NM_006035 (CDC42BPB , CDC42 binding protein kinase beta (DMPK-like), GeneBank accession No. NM_014791 (MELK, Maternal embryonic leucine zipper kinase), GeneBank accession No. NM_023028 (FGFR2, Fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer yndrome, Jackson-Weiss syndrome)), GeneBank accession No. NM_080836 (STK35, Serine / threonine kinas) e 35), GeneBank accession No. AF419331 (FUSIP1, FUS interacting protein (serine / arginine-rich) 1), GeneBank accession No. AK091927 (SFRS3, Splicing factor, arginine / serine- rich 3), GeneBank accession No. BC010266 (HNRNPA1, Heterogeneous nuclear ribonucleoprotein A1), GeneBank accession No. BC012360 (CTAGE5, CTAGE family, member 5), GeneBank accession No. BC036046 (PLRG1, Pleiotropic regulator 1 (PRL1 homolog, Arabidopsis)), GeneBank accession No. BC065384 (PCF11, PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)), GeneBank accession No. BX537360 (CPSF5, Nudix (nucleoside diphosphate linked moiety X) -type motif 21), GeneBank accession No. BX537494 (HNRPA2B1, Heterogeneous nuclear ribonucleoprotein A2 / B1 GeneBank accession No. BX647784 (HNRPR, Heterogeneous nuclear ribonucleoprotein R), GeneBank accession No. CA455267 (PPIH, Peptidyl prolyl isomerase H (cyclophilin H), GeneBank accession No.) CR596214 (HNRPA0, Heterogeneous nuclear ribonucleoprotein A0), GeneBank accession No. NM_001326 (CSTF3, Hypothetical protein LOC283267), GeneBank accession No. NM_004640 (BAT1, HLA-B associated transcript 1 GeneBank accession No. NM_005463 (HNRPDL, Heterogeneous nuclear ribonucleoprotein D-like), GeneBank accession No. NM_006924 (SFRS1, Splicing factor, arginine / serine-rich 1 (splicing fact) or 2, alternate splicing factor), GeneBank accession No. NM_012426 (SF3B3, Splicing factor 3b, subunit 3, 130 kDa), GeneBank accession No. NM_018048 (FLJ10292, Mago-nashi homolog) , GeneBank accession No. NM_030919 (C20orf129, Chromosome 20 open reading frame 129), GeneBank accession No. NM_031370 (HNRPD, Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa) GeneBank accession No. NM_138933 (ACF, Apobec-1 complementation factor), GeneBank accession No. AB193259 (ACE2, Angiotensin I converting enzyme (peptidyl-dipeptidase A) 2), gene GeneBank accession No. BX648769 (EWSR1, Ewing sarcoma breakpoint region 1), GeneBank accession No. AB023154 (DTX4, Deltex 4 homolog (Drosophila)), GeneBank accession No. AL543755 (VAV3, Vav 3 oncogene), gene registration number ( GeneBank accession No.) M75106 (CPB2, Carboxypeptidase B2 (plasma, carboxypeptidase U)), gene accession number (GeneBank accession No.) NM_021045 (ZNF248, Zinc finger protein 248), gene accession number (GeneBank accession No.) AB209194 (B4GALT6 , UDP-Gal: betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6), gene accession number (GeneBank accession No.) AF279145 (ANTXR1, Anthrax toxin receptor 1), gene accession number (GeneBank accession No.) NM_025074 (FRAS1, Fraser syndrome 1), gene accession number (GeneBank accession No.) AK025790 (KIF20A, Kinesin family member 20A), gene accession number (GeneBank accession No.) NM_006152 (LRMP, Lymphoid-restricted membrane protein), gene accession number (GeneBank accession No. NM_000340 (SLC2A2, Solute carrier family 2 (facilitated glucose transporter), member 2), GeneBank accession No. AF071592 (KIF4A, Kinesin family member 4A), GeneBank accession No. NM_013277 ( RACGAP1, Rac GTPase activating protein 1), GeneBank accession No. AY043484 (SCN1A, Sodium channel, voltage-gated, type I, alpha), GeneBank accession No. AY791349 (KIF18A, Kinesin family member 18A), gene registration Number (GeneBank accession No.) NM_018018 (SLC38A4, Solute carrier family 38, member 4), GeneBank accession No. AK094603 (FLJ37284 fis, unnamed protein product; Homo sapiens cDNA FLJ37284 fis, clone BRAMY2013590.), GeneBank accession No. NM_021069 (ARGBP2, Sorbin and SH3 domain containing 2), GeneBank accession No. NM_001005747 (CACNB4, Calcium channel, voltage- dependent, beta 4 subunit), GeneBank accession No. AJ496568 (SLC25A12, Solute carrier family 25 (mitochondrial carrier, Aralar), member 12), GeneBank accession No. NM_030641 (APOL6, Apolipoprotein L , 6), GeneBank accession No. NM_173512 (FLJ39822, Hypothetical protein FLJ39822), GeneBank accession No. NM_000037 (ANK1, Ankyrin 1, erythrocytic), Gene accession number (GeneBank accession No.) NM_001011554 (SLC13A3, Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3), Gene Accession No. , Ankyrin repeat and SOCS box-containing 9), GeneBank accession No. AK055221 (FBXO5, F-box protein 5), GeneBank accession No. AK075271 (SPTLC2L, Serine palmitoyltransferase, long chain base subunit 2 -like (aminotransferase 2)), gene accession number (GeneBank accession No.) AK122685 (GLUD1, Glutamate dehydrogenase 1), gene accession number (GeneBank accession No.) AK127098 (FLJ10706, Chromosome 1 open reading frame 112), gene accession number GeneBank accession No.AL133031 (MLR1, Transcription factor MLR1), GeneBank accession No. AY007723 (MAL2, Mal, T-cell differentiation protein 2), GeneBank accession No. BC022255 (Spc25 Spindle pole body component 25 homolog (S. cerevisiae)), GeneBank accession No. BC041882 (ATF7IP2, Activating transcription factor 7 interacting protein 2), GeneBank accession No. BC052951 (LMNB1, Lamin B1), Gene accession No. BC098313 (FLJ20641, Hypothetical protein FLJ20641), GeneBank accession No. NM_001809 (CENPA, Centromere protein A, 17kDa), GeneBank accession No. NM_145061 (C13orf3, Chromosome 13 open reading frame 3), GeneBank accession No. XM_372695 (LOC390859, PREDICTED: Homo sapiens similar to Chain A, Crystal Structure Of The R463a Mutant Of Human Glutamate Dehydrogenase (LOC390859), mRNA). 제 1항의 바이오마커 유전자 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보적인 올리고뉴클레오티드가 집적된 페난트렌에 대한 노출 여부 확인용 DNA 마이크로어레이 칩.Claim 1 DNA microarray chip for confirming the exposure to the oligonucleotide containing all or part of the biomarker gene sequence or phenanthrene integrated with its complementary oligonucleotide. 1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;1) separating RNA from test subject-derived human somatic cells and control somatic cells; 2) 단계 1)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;2) labeling the experimental group and the control group with different fluorescent substances while synthesizing RNA of the experimental group and the control group of step 1) with cDNA; 3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 제 4항의 DNA 마이크로어레이칩과 혼성화 시키는 단계;3) hybridizing cDNA labeled with different fluorescent materials of step 2) with DNA microarray chip of claim 4; 4) 단계 3)의 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및4) analyzing the reacted DNA microarray chip of step 3); And 5) 단계 4)의 분석한 데이터에서 제 1항의 바이오마커의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.5) The method of detecting the biomarker of claim 1 in order to confirm the exposure to phenanthrene comprising the step of confirming the expression level of the biomarker of claim 1 in the analyzed data of step 4) compared to the control. 제 5항에 있어서, 단계 1)의 인간 체세포는 인간의 간 또는 간암의 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.The method according to claim 5, wherein the human somatic cells of step 1) are cells derived from cells and tissues of human liver or liver cancer, wherein the biomarker of claim 1 is detected to confirm exposure to phenanthrene. . 제 6항에 있어서, 상기 인간 간암 세포는 HepG2인 것을 특징으로 하는 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.The method of claim 6, wherein the human liver cancer cells are HepG2, the method of detecting the biomarker of claim 1 to determine whether the exposure to phenanthrene. 제 5항에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택하여 사용하는 것을 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.The method of claim 5, wherein the fluorescent material of step 3) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine) Method of detecting the biomarker of claim 1 to determine whether the exposure to phenanthrene. 1) 실험군인 피검체 유래 인간 체세포와 대조군 체세포에서 RNA를 분리하는 단계;1) separating RNA from test subject-derived human somatic cells and control somatic cells; 2) 단계 1)의 RNA를 대상으로, 제 1항의 바이오마커 유전자를 증폭할 수 있는 프라이머쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및2) performing real-time reverse transcript polymerase chain reaction (RT-PCR) on the RNA of step 1) using a primer pair capable of amplifying the biomarker gene of claim 1; And 3) 단계 2)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계를 포함하는 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.3) The method of detecting the biomarker of claim 1 to determine whether the exposure to the phenanthrene comprising the step of comparing the gene product of step 2) with the control to confirm the expression level. 제 9항에 있어서, 단계 1)의 인간 체세포는 간 또는 간암의 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.10. The method according to claim 9, wherein the human somatic cells of step 1) are cells derived from cells or tissues of liver or liver cancer, wherein the biomarker of claim 1 is detected to confirm exposure to phenanthrene. 제 10항에 있어서, 상기 인간 간암 세포는 HepG2인 것을 특징으로 하는 페난트렌에 대한 노출 여부를 확인하기 위해 제 1항의 바이오마커를 검출하는 방법.The method of claim 10, wherein the human liver cancer cells are HepG2. 12. 제 4항의 DNA 마이크로어레이 칩을 포함하는 페난트렌에 대한 노출 여부 확 인용 키트.Claim 4 kit for confirming exposure to phenanthrene comprising the DNA microarray chip of claim 4. 제 12항에 있어서, 인간 간 세포 또는 간암 세포를 추가적으로 포함하는 것을 특징으로 하는 페난트렌에 대한 노출 여부 확인용 키트.The kit for confirming exposure to phenanthrene according to claim 12, further comprising human liver cells or liver cancer cells. 제 1항의 바이오마커 유전자를 증폭할 수 있는 프라이머쌍을 포함하는 페난트렌에 대한 노출 여부 확인용 키트.Kit for confirming exposure to phenanthrene comprising a primer pair capable of amplifying the biomarker gene of claim 1. 제 14항에 있어서, 상기 프라이머쌍은 서열번호 1 내지 56으로 기재되는 서열로 구성된 군으로부터 선택되는 2개 이상의 정방향 및 역방향인 것을 특징으로 하는 페난트렌에 대한 노출 여부 확인용 키트.The kit for confirming exposure to phenanthrene according to claim 14, wherein the primer pairs are two or more forward and reverse directions selected from the group consisting of sequences represented by SEQ ID NOs: 1 to 56.
KR20080076917A 2008-08-06 2008-08-06 Biomarkers for identification of exposure to phenanthrene and the method of identification using the same KR100994996B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR20080076917A KR100994996B1 (en) 2008-08-06 2008-08-06 Biomarkers for identification of exposure to phenanthrene and the method of identification using the same
PCT/KR2008/005022 WO2010016634A2 (en) 2008-08-06 2008-08-27 Kits for identification of exposure to phenanthrene and the method of identification of exposure to phenanthrene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR20080076917A KR100994996B1 (en) 2008-08-06 2008-08-06 Biomarkers for identification of exposure to phenanthrene and the method of identification using the same

Publications (2)

Publication Number Publication Date
KR20100018237A true KR20100018237A (en) 2010-02-17
KR100994996B1 KR100994996B1 (en) 2010-11-18

Family

ID=41664046

Family Applications (1)

Application Number Title Priority Date Filing Date
KR20080076917A KR100994996B1 (en) 2008-08-06 2008-08-06 Biomarkers for identification of exposure to phenanthrene and the method of identification using the same

Country Status (2)

Country Link
KR (1) KR100994996B1 (en)
WO (1) WO2010016634A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017061828A1 (en) * 2015-10-08 2017-04-13 한국원자력의학원 Pharmaceutical composition for preventing or treating cancer comprising inhibitor of plrg1 (pleiotropic regulator 1) as active ingredient

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102348462B (en) 2008-12-19 2015-06-17 巴克斯特国际公司 TFPI inhibitors and methods of use
CN105566490A (en) 2010-03-19 2016-05-11 巴克斯特国际公司 TFPI inhibitors and method of using the same
AU2013235741C1 (en) 2012-03-21 2017-12-21 Takeda Pharmaceutical Company Limited TFPI inhibitors and methods of use
CN108884160B (en) 2015-10-30 2023-02-03 恩比伊治疗股份公司 anti-ROR 1 antibodies
UA125718C2 (en) 2016-01-20 2022-05-25 Зе Скріппс Ресеарч Інстітьют Ror1 antibody compositions and related methods
BR112020002368A2 (en) 2017-08-07 2020-09-01 Nbe-Therapeutics Ag antibody-drug conjugates having high in vivo tolerability

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100671005B1 (en) 2004-01-15 2007-01-18 고려대학교 산학협력단 Biomarker proteins for diagnosing the exposure to PAH

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017061828A1 (en) * 2015-10-08 2017-04-13 한국원자력의학원 Pharmaceutical composition for preventing or treating cancer comprising inhibitor of plrg1 (pleiotropic regulator 1) as active ingredient

Also Published As

Publication number Publication date
KR100994996B1 (en) 2010-11-18
WO2010016634A2 (en) 2010-02-11

Similar Documents

Publication Publication Date Title
KR100985090B1 (en) Biomarker for identification of exposure to chrysene and the method of identification using thereof
KR100994996B1 (en) Biomarkers for identification of exposure to phenanthrene and the method of identification using the same
KR101008385B1 (en) Biomarker for identification of exposure to Polycyclic Aromatic Hydrocarbons and the method of identification using thereof
KR100968762B1 (en) Biomarker for identification of exposure to naphthalene and the method of identification using thereof
KR100967546B1 (en) Biomarker for identification of exposure to benzo[a]anthracene and the method of identification using thereof
KR100957055B1 (en) Biomarker for identification of exposure to Trichloroethylene and the method of identification using thereof
KR100961487B1 (en) Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof
KR100958545B1 (en) Biomarker for identification of exposure to benzo[k]fluoranthene and the method of identification using thereof
KR101018788B1 (en) Biomarker for identification of exposure to chlordane and the method of identification using thereof
KR100962185B1 (en) Marker genes based on daunorubicin treatment for screening of drug inducing cardio toxicity and screening method using thereof
KR101749566B1 (en) Biomarker for identification of genes related to inflammatory response after exposure to diesel exhaust particle and the method of identification using thesame
KR101017060B1 (en) Biomarker for identification of exposure to toxaphene and the method of identification using thereof
US6746843B2 (en) Methods of screening novel agents for use in cancer therapy and prevention
KR101108694B1 (en) A Biomarker based on methotrexate treatment for screening of drug inducing teratogenicity and screening method using thereof
KR100915898B1 (en) Biomarker for diagonosis of exposure to 3-methylcholanthrene and the method of diagonosis using thereof
KR101383653B1 (en) Specific biomarker for identification of exposure to Propionaldehyde and the method of identification using thesame
KR20080038583A (en) Biomaker and screening method of volatile organic compounds having toxicity using thereof
KR100962209B1 (en) Biomarker for identification of exposure to malachite green and the method of identification using thereof
KR100985447B1 (en) Biomarker for identification of exposure to Indeno[1,2,3-c,d]pyrene and the method of identification using thereof
KR100978791B1 (en) Biomarker for identification of exposure to dichloromethane and the method of identification using thereof
KR101386075B1 (en) Biomarkers for identification of exposure to Hexachlorobenzene and the method of identification using thereof
KR20230028619A (en) Biomarker for diagnosing atopic dermatitis and use thereof
KR101457481B1 (en) The biomarkers for identification of exposure to deiodinase inhibiting disruptors and the identification method of deiodinase inhibiting disruptors exposure using the same biomarkers
KR20090081234A (en) Biomarker for identification of exposure to Ethylbenzene and the method of identification using thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20131029

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20141103

Year of fee payment: 5

LAPS Lapse due to unpaid annual fee