KR100962209B1 - Biomarker for identification of exposure to malachite green and the method of identification using thereof - Google Patents

Abstract

The present invention relates to a biomarker for confirming exposure to malachite green (malachite green) and a method of identifying the same, and specifically, to a biomarker for increasing or decreasing gene expression specifically by malachite green and a malachite green using the same. It relates to how to check the exposure. The biomarker of the present invention can be usefully used to monitor and determine the contamination of malachite green in environmental samples by using the reaction genes selected through gene phishing as biomarkers, and to identify the mechanism of toxic effects caused by malachite green. It can be used as a tool.

Malachite Green, Biomarker, Ginsing

Description

Biomarker for identification of malachite green exposure and identification method using the same {Biomarker for identification of exposure to malachite green and the method of identification using YoY}

The present invention relates to a biomarker for confirming exposure to malachite green and a method of identifying the same.

From the past to the present, more than acceptable malachite green has been detected in fish, which raises the issue of food safety. The malachite green is a green industrial pigment and antibacterial agent, which has been used in aquaculture as a parasite, fungus and bacterial infection inhibitor, but was banned in the United States in 1991 when it was found to be extremely toxic to fish. Europe and China also regulated the use of malachite greens for food fish in 2002, and Korea also regulates them as toxic chemicals.

Malachite Green acts as a liver cancer promoter (Rao KVKet al.,Tumori  82: 280-286, 1996) and are known to form free radicals (Panandiker Aet al ., Carcinogenesis 15: 2445-2448, 1994). In addition, when the malachite green is treated with SHE (Syrian hamster embryo) cells, p53 and bcl, known as genes that induce apoptosis (apoptosis) as the treatment time and treatment concentration are increased compared to the control group, promote tumor formation by apoptosis. -2 has been reported to be overexpressed upon malachite green exposure (Rao KVet al .,J Exp Clin Cancer Res 19: 89-98, 2000). In addition, cdk4 and cdc2 genes have also been reported to increase expression by malachite green (Gupta S).et al.,Teratog Carcinog Mutagen 1: 301-312, 2003). In addition, malachite green has been reported to affect the cell cycle and to stop G0 / G1 and G2 / M phases (Rao KV).et al.,J Exp Clin Cancer Res 19: 89-98, 2000; Rao KVet al.,J Environ Pathol Toxicol Oncol 20: 177-88, 2001). In addition, leucomalachite green, known to be metabolized and formed in the body of aquatic animals, has genotoxicity in vivo (in vivo genotoxicants have been reported to cause mutations and cancer in the human body (NIH publication No. 04-4416).

As described above, some studies on the degree of carcinogenicity and gene expression of malachite green have been reported, but there are not enough data on risk assessment in humans about the possibility of malachite green carcinogenesis in humans. It is. Therefore, it is important to take appropriate measures and control against malachite green exposure by discovering and using molecular indicators that can explore toxic effects in the human body through rapid risk assessment using faster and easier screening methods. It's a task.

Accordingly, the present inventors detect and analyze malachite green by discovering genes overexpressed or underexpressed by malachite green by observing and analyzing gene expression profiles by malachite green treatment using HepG2 cell line, which is a human liver cancer cell line, using GeneFishing method. The present invention was completed by establishing a biomarker that can be used and a method for confirming exposure using the same.

It is an object of the present invention to provide a biomarker that is overexpressed or underexpressed by exposure of malachite green and a method for confirming exposure to malachite green using the biomarker.

In order to achieve the above object, the present invention provides a biomarker for confirming the exposure to malachite green, characterized in that the expression changes by exposure to malachite green (malachite green).

In addition, the present invention provides a DNA microarray chip for confirming exposure to malachite green in which an oligonucleotide or its complementary strand molecule including all or part of the biomarker gene sequence is integrated.

The present invention also provides a method for confirming exposure to malachite green using the biomarker.

In addition, the present invention provides a search kit for confirming exposure to malachite green.

Hereinafter, the present invention will be described in detail.

The present invention provides a biomarker for confirming exposure to malachite green, which is characterized by causing a change in expression by exposure to malachite green.

The biomarker is composed of a gene whose expression is increased or decreased in comparison with the control group (malachite green untreated group) at a concentration showing 80% cell survival rate (IC ₂₀ ) upon malachite green treatment.

The present inventors, in order to find a biomarker for confirming the exposure to malachite green, was treated to human liver cancer cell line (HepG2) to confirm cytotoxicity. As a result, the malachite green was confirmed to be toxic to human liver cancer cell line (see FIG. 1), and the concentration of malachite green showing an 80% cell survival rate (IC ₂₀ ) was determined based on the experiment. Thereafter, malachite green was treated to human liver cancer cell line at the determined concentration, mRNA was isolated from the cell line treated with the substance to synthesize cDNA, and the 'differential display reverse transcription polymerase chain reaction (differential display reverse) using the synthesized cDNA as a template. transcription polymerase chain reaction) 'a binary phishing DEG ^TM kit (GeneFishing DEG ^TM kit, (weeks) was carried out with primers 120 Seegene, Korea). As a result of electrophoresis of the DNA fragments obtained through the PCR on a 2% agarose gel (see FIG. 2), 7 DNA fragments with increased expression compared to the control group and 4 with reduced expression by malachite green treatment were applied to human liver cancer cell lines. DNA fragments were found. After cloning these 11 DNA fragments (see FIG. 3), the base sequences of the cloned DNA fragments were analyzed (see Table 1), and the sequences were subjected to a blast search in a GeneBank database. The results (see Table 2),

1) DNA fragments whose expression is increased by exposure to malachite green are as follows:

SEQ ID NO: 1 (Up 1): GeneBank NM_000030 (Homo sapiens alanine-glyoxylate aminotransferase); GeneBank X53414 (Human mRNA for peroxisomal L-alanine: glycoxylate aminotransferase), SEQ ID NO: 2 (Up 2): GeneBank BC007507 (Homo sapiens ribosomal protein S20), SEQ ID NO: 3 (Up 3) : GeneBank AB000584 (Growth differentiation factor 15); GeneBank AF019770 [Homo sapiens macrophage inhibitory cytokine-1], SEQ ID NO: 4 (Up 4): GeneBank NM_030581 [Homo sapiens WD repeat domain 59 (WDR59)]; GeneBank AF370390 (Homo sapiens FP977), SEQ ID NO: 5 (Up 5): GeneBank DT219620 (KB-EST0004704 BPS7 Homo sapiens cDNA); GeneBank EF060354 [Homo sapiens isolate 43_M1b1a (Tor259) mitochondrion, complete genome], SEQ ID NO: 6 (Up 6): GeneBank XM001133335 [Homo sapiens unc-51-like kinase1 ( C. elegans ) And SEQ ID NO: 7 (GeneBank) AK026623 (Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit).

2) DNA fragments whose expression is reduced by exposure to malachite green are as follows:

SEQ ID NO: 8 (Down 1): GeneBank DQ862537 (Homo sapiens isolate RS3K mitochondrion), SEQ ID NO: 9 (Down 2): GeneBank AF465980 (Homo sapiens clone YAN0637 mitochondrion), SEQ ID NO: 10 ( Down 3): GeneBank DQ862536 (Homo sapiens isolate 3179 mitochondrion) and SEQ ID NO: 11 (Down 4): GeneBank DQ282439 [Homo sapiens isolate B2-1-06 mitochondrion (cytochrome C oxidase subunit1) ].

In addition, by designing a primer (see Table 3) capable of amplifying a DNA fragment whose expression is increased or decreased by exposure of the malachite green, real-time RT-PCR expression of the DNA fragments during the concentration-specific treatment of malachite green (real-time RT-PCR),

1) DNA fragments whose expression is increased by exposure to malachite green are as follows:

GeneBank AB000584 (Growth differentiation factor 15), GeneBank NM_030581 [Homo sapiens WD repeat domain 59 (WDR59) and GeneBank AK026623 (Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit).

2) DNA fragments whose expression is reduced by exposure to malachite green are as follows:

GeneBank DQ282439 [Homo sapiens isolate B2-1-06 mitochondrion (cytochrome C oxidase subunit1)].

In addition, the genes whose expression increased due to the malachite green exposure during malachite green concentration were found to be increased as the concentration increased, and the genes whose expression decreased due to the malachite green exposure were increased. As a result, the expression was reduced (see Table 4).

Therefore, the nucleotide sequence of the cloned DNA fragment and the genes showed 99-100% homology, and the genes including the four DNA fragments were very suitable as biomarkers specifically expressed by malachite green. Judging.

In addition, the genes are not reported to be associated with toxicity in human liver cancer cell lines when treated with malachite green used in the present invention.

In addition, the present invention provides a DNA microarray chip for confirming exposure to malachite green in which an oligonucleotide or its complementary strand molecule including all or part of the biomarker gene sequence is integrated.

The oligonucleotide or its complementary strand molecule comprises 18 to 30 nucleic acids of the biomarker gene, preferably 20 to 25 nucleic acids.

DNA microarray chip for confirming the exposure to malachite green of the present invention can be produced by methods known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method or a pin-shaped spotter using a piezoelectric method is used. It is preferable to use the method used, but is not limited thereto. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It is not limited. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto.

The present invention also provides a method for confirming exposure to malachite green using the biomarker.

The present invention provides a method for confirming exposure to malachite green, comprising the following process:

1) separating RNA from test subject-derived human somatic cells and control somatic cells;

2) synthesizing RNA of the experimental group and the control group of step 1) with cDNA and labeling the fluorescent substance of each of the experimental group and the control group;

3) hybridizing cDNA labeled with different fluorescent materials of step 2) with DNA microarray chips;

4) analyzing the reacted DNA microarray chip of step 3); And

5) confirming the expression level of the biomarker of the present invention in the analyzed data of step 4) compared to the control group,

In the method for confirming the exposure, the somatic cells of step 1) is preferably using cells derived from human liver or liver cancer cells and tissues, more preferably using a human liver cancer cell line (HepG2) It is not limited. At this time, the subject is a subject suspected of being exposed to malachite green, and the control group will be a healthy human subject.

In the method for confirming the exposure, the fluorescent material of step 2) is Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), RITC (rhodamine-B-isothiocyanate) and rhodamine (rhodamine) It is preferable that the selected one is not limited thereto, and any fluorescent substance known to those skilled in the art may be used.

In the method for confirming the exposure, the DNA microarray chip of step 4) is preferably used, such as Whole Human Genome Oligo Microarray (Agilent, USA), but is not limited thereto, the overexpression of the human genome in the present invention Or a microarray chip loaded with a low expression gene (see Tables 1 and 2), and it is most preferable to use a DNA microarray chip produced by the present inventors. In addition, the analysis method of step 4) preferably uses GenePix 4.1 software (Axon Instruments, USA), but is not limited thereto, and analysis software known to those skilled in the art may be used.

In addition, the present invention provides a method for confirming exposure to malachite green, comprising the following process:

1) separating RNA from test subject-derived human somatic cells and control somatic cells;

2) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 1) using a primer complementary to the biomarker gene of the present invention and capable of amplifying the biomarker gene; And

3) confirming the expression level by comparing the gene product of step 2) with the control,

In the method for confirming the exposure, the somatic cells of step 1) is preferably using cells derived from human liver or liver cancer cells and tissues, more preferably using a human liver cancer cell line (HepG2) It is not limited. At this time, the subject is a subject suspected of being exposed to malachite green, and the control group will be a healthy human subject.

In the method of confirming the exposure, the primer of step 2) is complementary to the biomarker gene found in the present invention, and any primer that can amplify the biomarker can be used. In the present invention, four pairs of forward and reverse primers set forth in SEQ ID NOs: 12 to 19 are provided, but the present invention is not limited thereto.

In addition, the present invention provides a search kit for confirming exposure to malachite green.

The present invention provides a detection kit for detecting exposure to malachite green, comprising a DNA microarray chip prepared in the present invention.

In addition to the identification kit provides a kit for confirming the exposure to malachite green including human hepatocytes. The human hepatocyte is preferably HepG2, but is not limited thereto. Any human hepatocyte may be used as long as it is derived from cells and tissues of human liver or liver cancer.

In addition, the kit may further include a fluorescent material, and the fluorescent material may be a streptavidin-alkaline phosphatase conjugate, a chemifluorenscent material, and a chemiluminescent material. It is preferably selected from the group consisting of, but is not limited thereto.

In addition, the kit may further include a reaction reagent, the reaction reagent used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (pre-mixed or separated feed), fluorescent dye It may be composed of a labeling reagent, such as a chemical inducing agent and a washing buffer, but is not limited thereto. The reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art may be included.

In addition, the present invention provides a search kit for confirming exposure to malachite green, which is complementary to the biomarker gene and comprises a primer capable of amplifying the biomarker gene.

The primer is preferably used as two or more forward and reverse primers selected from the group consisting of the sequences set forth in SEQ ID NOs: 12 to 19, but is not limited thereto, and is complementary to the biomarker gene, biomarker gene It is possible to amplify and both the forward and reverse primer pairs designed so that the amplification product is 100 to 300bp can be used.

The present invention is useful for determining the risk and monitoring of malachite green by using a DNA fragment whose expression is specifically increased or decreased when exposed to malachite green as a biomarker for exposure to malachite green. It can be used as a tool to identify the mechanism of toxic effects caused.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> Cell Culture and Chemical Treatment

<1-1> Cell Culture and Chemical Preparation

HepG2 cells (KCLB 88065), a human liver cancer cell line, were cultured to about 80% in 100 mm dish using DMEM medium (Gibro-BRL, USA) to which 10% FBS was added. The present inventors have selected malachite green as a bactericide and used as a water fungus, aquatic bacterium preventive agent in aquaculture industry as a anti-bacterial agent, and has a problem about food safety and has carcinogenicity, and dissolved it in water. . Vehicle concentration was less than 0.1% in all experiments.

<1-2> cytotoxicity test ( MTT assay ) And chemical processing

MTT experiment using HepG2 cell line was performed by the method of Mossman et al . ( J. Immunol . Methods , 65: 55-63, 1983). Cells were treated with malachite green in water in DMEM medium (Gibro-BRL, USA) at 4 × 10 ⁵ cell / ml cell numbers in 24-well plates, and after 48 hours, MTT (3-4, 5-dimethylthiazol-2 and 5-diphenyltetra zolium bromide) 4 mg / ml were mixed and incubated at 37 ° C. for 3 hours. Thereafter, the medium was removed and the formed formazan crystal was dissolved in 500 µl of DMSO. Transfer to a 96-well plate was aliquoted and the OD value was measured at absorbance 540 nm.

Results in HepG2 cell line examined the cytotoxicity of malachite green, and the concentration (IC ₂₀₎ showing 80% survival rate was carried out phishing (Genefishing ^TM) experiments to determine a binary was 0.867 μM (Fig. 1), the concentration.

< Example  2> Jin Phishing ( Genefishing ^TM ) Experiment

<2-1> RNA Separation of

After dispensing HepG2 cells in a 100 mm dish at a concentration of 6 × 10 ⁶ cells / ml, malachite green (0.867 μM) of the concentration determined in Example 1-2 was treated for 48 hours. Thereafter, total RNA was isolated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using an RNeasy mini kit (Qiagen, USA). Genomic DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The amount and purity of each total RNA sample was measured by spectrophotometer.

<2-2> First - strand cDNA  synthesis

CDNA was prepared using the total RNA of the malachite green treated group and the malachite green treated group obtained in Example 2-1 for the gene phishing analysis. Specifically, 4 μl of 5 × reaction buffer, 5 μl of 2 mM dNTP, 2 μl of 10 μM oligo-dT ACP1, 40 U / μl RNasin RNase inhibitor in 3 μg total RNA of the obtained total RNA. 0.5 ㎕, 200 U / ㎕ MMLV -RT (Moloney murine leukemia virus reverse transcriptase) were mixed for 1 ㎕ by 90 min at 42 ℃ was synthesized cDNA, the synthesized first-strand cDNA is a second purification for GeneFishing ^TM PCR It was performed by diluting 80 ㎕ of water. Reagents and primers used in the above synthesis were purchased from Seegene (Korea).

<2-3> GeneFishing ^TM PCR

PCR using GeneFishing ^™ DEG kit [Seegene, Korea] was performed according to the manufacturer's instructions. 3-5 μl of diluted first-strand cDNA, 1 μl of 10 μM oligo-dT ACP2, 1 μl of 10 μM arbitrary ACP (1 to 120; Cat.No. K1021-K1026), 10 μl of 2 × master mix Step 1: 94 ° C., 1 min; Step 2: 50 ° C., 3 minutes; Step 3: 72 ° C., 1 minute; Step 4 (40 repetitions): Step 4-1: 94 ° C., 40 seconds; Step 4-2: 65 ° C., 40 seconds; Step 4-3: 72 ° C., 40 seconds: Step 5: After setting the program to 72 ° C. for 5 minutes, the reaction was performed in a PCR machine. The amplified PCR product was confirmed by staining with EtBr (ethidium bromide) on 2% agarose gel.

<2-4> Band Separation and Sequencing

A band having a difference in expression between the control group and the malachite green treatment group identified by the method of Example 2-3 was cut out, and cDNA was eluted from agarose gel using GENCLEAN II Kit (Q-BIO gene, USA). It was amplified and subjected to automatic sequencing by ABI Prism 3100- Avant Genetic Analyzer (Applied Biosystems, USA) (see Table 1) and analyzed using BLAST software (see Table 2).

As a result,

1) DNA fragments whose expression is increased by exposure to malachite green are as follows:

SEQ ID NO: 1 (Up 1): GeneBank NM_000030 (Homo sapiens alanine-glyoxylate aminotransferase); GeneBank X53414 (Human mRNA for peroxisomal L-alanine: glycoxylate aminotransferase), SEQ ID NO: 2 (Up 2): GeneBank BC007507 (Homo sapiens ribosomal protein S20), SEQ ID NO: 3 (Up 3) : GeneBank AB000584 (Growth differentiation factor 15); GeneBank AF019770 [Homo sapiens macrophage inhibitory cytokine-1], SEQ ID NO: 4 (Up 4): GeneBank NM_030581 [Homo sapiens WD repeat domain 59 (WDR59)]; GeneBank AF370390 (Homo sapiens FP977), SEQ ID NO: 5 (Up 5): GeneBank DT219620 (KB-EST0004704 BPS7 Homo sapiens cDNA); GeneBank EF060354 [Homo sapiens isolate 43_M1b1a (Tor259) mitochondrion, complete genome], SEQ ID NO: 6 (Up 6): GeneBank XM001133335 [Homo sapiens unc-51-like kinase1 ( C. elegans ) And SEQ ID NO: 7 (GeneBank) AK026623 (Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit).

2) DNA fragments whose expression is reduced by exposure to malachite green are as follows:

SEQ ID NO: 8 (Down 1): GeneBank DQ862537 (Homo sapiens isolate RS3K mitochondrion), SEQ ID NO: 9 (Down 2): GeneBank AF465980 (Homo sapiens clone YAN0637 mitochondrion), SEQ ID NO: 10 ( Down 3): GeneBank DQ862536 (Homo sapiens isolate 3179 mitochondrion) and SEQ ID NO: 11 (Down 4): GeneBank DQ282439 [Homo sapiens isolate B2- 1-06 mitochondrion (cytochrome C oxidase subunit1) ].

Sequence ( Sequence ) SEQ ID NO: 1
Up 1 CGACACGGTGCCAGCGCCCTGCTGCGTGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCCAGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATAGAGCAGTCCTGGTCCTTCCACTGTGCACCTGCGCGGGGGAGGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAAGGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTTGTTATTTATTATTAATTTATTGGGGTGACCTTCTTGGGGACTCGGGGGCTGGTCTGATGGAACTGTGTATTTATTTAAAACTCTGGTGATAAAAATAAAGCTGTCTGAACTGTTAAAAAAAAAAAAAAAA SEQ ID NO: 2
Up 2 GTGGGTAGGAATTTCATCAACAAATGGACCTATGGCATCATGGCTTTAGAAGCTGGTACATTTACTGAGCTGATGGACAGTGGCCTTCTAAAATATGACACTTAAATTGTAAATATGCACTGTACTTAGGATTCTTAAGATGTATTTTTTTGTTATTTCTCCTCCAGCTGCTATCCCTTGGCTAATAAAATTAAAAAAAAAATAAAAAA SEQ ID NO: 3
Up 3 CTGCTGGGCTGCAATGCCACCCGCGAGAATGTGGACCGCGTGACGGAGGCCCTGAGGGCGGCCCTGCAGCACTGCCCCAAGAAGAAGCTGTGACCTGCCCACTGGCACACAGCTGGCACTGGCACACCCTGTACCATGCCCACCCTGAGGGATCAGGAGCAAACAGACCCTGCAAGGTCCTCCAGGCCTGGGGACAGGAAAGCCACTGACCCAGCCCGGGAGGCAGAACCAGGCAGCCTCCCTGGCCCCAGGCACCCTTTTCCCTCCAGTGGCACCTCCTGGAAACAGTCCACTTGGGCGCAAAACCCAGTGCCTTCCAAATGAGCTGCAGTCCCCAGGCCATGAGCCTCCCGGGAATGTTTAATAAAGGGCCTGGCCACCCTCCAAAAAAAAAAAAAAAAAA SEQ ID NO: 4
Up 4 CCGAATTCGAATCACCCTAACAAGCCGCAACGTAAAATCCTTGGAAAAGGTGTGTGCTGACTTGATAAGAGGCGCAAAAGAAAAGAATCTCAAAGTGAAAGGACCAGTTCGAATGCCTACCAAGACTTGAGAATCACTACAAGAAAAACTCCTTGTGGTGAAGGTTCTAAGACGTGGGATCGTTTCCAGATGAGAATTCACAAGCGACTCATTGACTTGCACAGTCCTTCTGAGATTGTTAAGCAGATTACTTCATCAGTATTGAGCCAGGAGTTGAGGTGGAAGTCACCATTGCAGATGCTTAAGTCAACTATTTTAATAAATTGATGACCAGTTGTTAAAAAACAAAAAAAAAAAAAAA SEQ ID NO: 5
Up 5 GATGAGGAGTTTGATGCTCGCTGGGTAACATACTTCAACAAGCCAGATATAGATGCCTGGGAATTGCGTAAAGGGATAAACACACTTGTTACCTATGATATGGTTCCAGAGCCCAAAATCATTGATGTGCTTTGCGGGCATGCAGACGGTTAAATGATTTTGCTAGTACAGTTCGTATCCTAAAGGTTGTTAAGGACAAAGCAGGACCTCATAAGGAAATCTACCCCTATGTCATCCAGGAACTTAGACCAACTTAAATGAACTGGGAATCTCCACTCCGGAGGAACTGGGCCTTGACAAAGTGTAAACCGCATGGATGGGCTTCCCCAAGGATTTATTGACATTGCTACTTGAGTGTGAACAGTTACCTGGAAATACTGAGATAACATATTACCTTATTTGAACAAGTTTTCCTTTATTGAGTACCAAGCCATGTAATGGTAACTTGGACTTTAATAAAAGGGAAATGAGTTTGAACTG SEQ ID NO: 6
Up 6 GCTGGTTGTCCAAGATAGAATCTTAGTTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGTCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTGAGAGAGTAAAAAATTTAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGCCAATCTATCACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGCCTGCAAAAAAAAAAAAAAAAA SEQ ID NO: 7
Up 7 TCTGCGGGAGGCAGTGGTGGGGCCATGGACCCATGCGGGGGGTTCCAGGGTCACACGCCACATAACAGACAAAAATACACACACGTGTGTTTTTCTTTGCAATACTTGAAATATTGCCACTGTGCTTGACTTAGAAGAAGAAAATCCCCGTGACTTCTTCCTCATCACCTTGATGGCTTTATTCTCACCTTGTGGGGCATGTTTGTATTTATTGCTTCATGGCCGACTGGAATCCTGAGTCCTGGGAAGCTGGCCTGCGGGGATCTTGCCCGGTGTCCTGGTCCTCTTGCTTCCGTCGCGGCCGCATGTGCGTGTGTCCAAGCAGGTCCTGGGCGCCTCAACTGCTGCCCCTGGTTGAATGTTCTCTTGATAGTGCTGGACCTTTGTCTATTTTAAAGCGAATTTTGTGTGATTTCCTGCCCTTTGCGTTATATTGTATAATACCAACGTAAGGAAATAAACCTTTGGAATTGTTAAAAAAAAAAAAAAAAA SEQ ID NO: 8
Down 1 AGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCACACTAGACATCGTACTACACGACACGTACTACGTTGTAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCTAGACCAAACCTACGCCAAAATCCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCGTCACCACATGAAACATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCTAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCTCCATGACTTTTTCAAAAAAAAAAAAAAAAA SEQ ID NO: 9
Down 2 AAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTACCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCAAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCACTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATCACTTTGGCTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTCTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTAAAAAAAAAAAAAAAAAA SEQ ID NO: 10
Down 3 ATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGAATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCACCCCGACATCATTACCGGGTTTTCCTCTTAAAAAAAAAAAAAAAAAA SEQ ID NO: 11
Down 4 ATCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCGCAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTATTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAAAAAAAAAAAAAAAAA

DEG No . gene
Abbreviation gene
Registration Number
( GeneBank ) Sequencing gene Homology
( Homo
sapiens ) SEQ ID NO: 1
Up 1 AGXT NM_000030 Homo sapiens alanine-glyoxylate aminotransferase (oxalosis I; hyperoxaluria I; glycolicaciduria; serine-pyruvate aminotransferase) (AGXT), mRNA 387/388
(99%) PAGA X53414 Human mRNA for peroxisomal L-alanine: glyoxylate aminotransferase 387/388
(99%) SEQ ID NO: 2
Up 2 RPS20 BC007507 Homo sapiens ribosomal protein S20, mRNA 347/347
(100%) SEQ ID NO: 3
Up 3 GDF15 AB000584 Growthdifferentiation factor 15 371/371
(100%) MIC-1 AF019770 Homo sapiens macrophage inhibitory cytokine-1 (MIC-1), mRNA 371/371
(100%) SEQ ID NO: 4
Up 4 WDR59 NM_030581 Homo sapiens WD repeat domain 59 (WDR59), mRNA 204/204
(100%) FP977 AF370390 Homo sapiens FP977, mRNA
204/204
(100%) SEQ ID NO: 5
Up 5 KB-EST BPS7 DT219620 KB-EST0004704 BPS7 Homo sapiens cDNA, mRNA sequence. 330/330
(100%) 43 M1b1a EF060354 Homo sapiens isolate 43_M1b1a (Tor259) mitochondrion, complete genome 330/330
(100%) SEQ ID NO: 6
Up 6 ULK1 XM001133335 Homo sapiens unc-51-like kinase1 ( C. elegans ) (ULK1), mRNA 478/478
(100%) SEQ ID NO: 7
Up 7 COX5A AK026623 Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit, mRNA 482/483
(99%) SEQ ID NO: 8
Down 1 RS3K DQ862537 Homo sapiens isolate RS3K mitochondrion, complete genome 412/413
(99%) SEQ ID NO: 9
Down 2 YAN0637 AF465980 Homo sapiens clone YAN0637 mitochondrion, partial genome 593/593
(100%) SEQ ID NO: 10
Down 3 3719 DQ862536 Homo sapiens isolate 3179 mitochondrion, complete genome 637/637
(100%) SEQ ID NO: 11
Down 4 B2-1-06 DQ282439 Homosapiens isolate B2-1-06 mitochondrion. Complete genome (cytochrome Coxidasesubunit1) 655/655
(100%)

< Example  3> Real time RT -PCR ( Real - time reverse transcriptase polymerase chain  reaction)

Using My IQ Real-time PCR (Bio-rad, USA) to investigate and quantify the expression change of the overexpressed and underexpressed genes of Example 2 induced by malachite green Quantitative real-time RT-PCR was performed. In this case, the expression level of malachite green treated in human liver cancer cell line was expressed at a concentration of 90% (IC ₁₀ ; 0.532 μM) and 70% (IC ₃₀ ; 1.202 μM) in addition to the concentration of 80% cell viability. Also confirmed as.

Specifically, cDNA was synthesized by performing a reverse transcription reaction at 42 ° C. for 90 minutes using an oligo dT primer and a Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). 0.2 μl of the cDNA and 3.8 μl of water, 0.5 μl of forward primer (F of Table 3), 0.5 μl of reverse primer (R of Table 3), 5 μl of SYBR Green I staining supermix (Bio-rad, USA) Mix, put in a PCR tube Step 1: 95 ℃, 3 minutes; Step 2 (repeat 45): Step 2-1: 95 ° C., 10 seconds; Step 2-2: 55 to 65 ° C. 45 seconds; Step 3: 95 ° C., 1 minute; Step 4: 55 ° C., 1 minute; Step 5 (80 repetitions): The reaction was performed on a My IQ real-time PCR machine designed program at 55 ° C., 10 seconds. At this time, the primers for the primers and endogenous control (GAPDH) of Table 3 (SEQ ID NO: 19 (F); After performing PCR using SEQ ID NO: 21 (R)], primer concentration was determined through primer optimization to select an appropriate concentration, and then PCR was performed, using quantitative software. Analyzed.

As a result, as shown in Table 4, the true phishing results and the real-time PCR results of Example 2 were identical.

1) Genes whose expression is increased by exposure to malachite green are as follows:

GeneBank AB000584 (Growth differentiation factor 15), GeneBank NM_030581 [Homo sapiens WD repeat domain 59 (WDR59) and GeneBank AK026623 (Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit).

2) Genes whose expression is reduced by exposure to malachite green are as follows:

GeneBank DQ282439 [Homo sapiens isolate B2-1-06 mitochondrion (cytochrome C oxidase subunit1)].

primer  order DEG
No. Gene Registration Number
(GeneBank) Gene abbreviation PCR primer sequence
(5 '-> 3') Gene product size
(bp) primer
density
(pmole) Up 3 AB000584 GDF15 F GTTAGCCAAAGACTGCCACTGCAT (SEQ ID NO: 12) 117 3 R TGTCTCAGGAACCTTGAGCCCATT (SEQ ID NO: 13) Up 4 NM_030581
WDR59 F AGGAGCGGAAATCAAGACGATGGA (SEQ ID NO: 14) 123 3 R ATTTGTGAACAGGCAGGAGGCAAG (SEQ ID NO: 15) Up 7 AK026623 COX5A F  CAAAGTGTAAACCGCATGGA (SEQ ID NO: 16) 76 3 R TCCAGGTAACTGTTCACACTCAA (SEQ ID NO: 17) Down 4 DQ282439 B2-1-06 F TAGGTGGCCTGACTGGCATTGTAT (SEQ ID NO: 18) 185 3 R TTTGGCGTAGGTTTGGTCTAGGGT (SEQ ID NO: 19) GAPDH F TGCACCACCAACTGCTTAGC (SEQ ID NO: 20) 87 3 R GGCATGGACTGTGGTCATGA (SEQ ID NO: 21)

gene
Registration Number Gene name real time PCR
(Relative magnification) IC ₁₀ IC ₂₀ IC ₃₀ AB000584 Growth differentiation factor 15 0.98 4.10 6.25 NM_030581 Homo sapiens WD repeat domain 59 0.92 1.41 1.53 AK026623 Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit 1.03 1.75 2.02 DQ282439 Homo sapiens isolate B2-1-06 mitochondrion (cytochrome C oxidase subunit1) 0.56 0.36 0.31

1 is a graph illustrating the cytotoxicity of malachite green in human liver cancer cell lines.

Figure 2 is an electrophoresis picture showing the expression of the control group and the treatment group in the human liver cancer cell line treated with malachite green using Jin phishing (GP 1-120 = arbitrary ACP 1 to 120; 1: control; 2: treatment County ).

Figure 3 is an electrophoresis picture showing the results of cloning genes showing an increase or decrease in expression in the treated group compared to the control group in the human liver cancer cell line treated with malachite green.

<110> Korea Institute of Science and Technology <120> Biomarker for identification of exoposure to malachite green and          the method of identification using <130> 8P-02-68 <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 385 <212> DNA <213> Artificial Sequence <220> <223> up 1 <400> 1 cgacacggtg ccagcgccct gctgcgtgcc cgccagctac aatcccatgg tgctcattca 60 aaagaccgac accggggtgt cgctccagac ctatgatgac ttgttagcca aagactgcca 120 ctgcatagag cagtcctggt ccttccactg tgcacctgcg cgggggaggc gacctcagtt 180 gtcctgccct gtggaatggg ctcaaggttc ctgagacacc cgattcctgc ccaaacagct 240 gtatttatat aagttgttat ttattattaa tttattgggg tgaccttctt ggggactcgg 300 gggctggtct gatggaactg tgtatttatt taaaactctg gtgataaaaa taaagctgtc 360 tgaactgtta aaaaaaaaaa aaaaa 385 <210> 2 <211> 222 <212> DNA <213> Artificial Sequence <220> <223> up 2 <400> 2 gtgggtagga atttcatcaa caaatggacc tatggcatca tggctttaga agctggtaca 60 tttactgagc tgatggacag tggccttcta aaatatgaca cttaaattgt aaatatgcac 120 tgtacttagg attcttaaga tgtatttttt tgttatttct cctccagctg ctatcccttg 180 gctaataaaa ttctagtaat ttgaaaaaaa aaaaaaaaaa aa 222 <210> 3 <211> 403 <212> DNA <213> Artificial Sequence <220> <223> up 3 <400> 3 ctgctgggct gcaatgccac ccgcgagaat gtggaccgcg tgacggaggc cctgagggcg 60 gccctgcagc actgccccaa gaagaagctg tgacctgccc actggcacac agctggcact 120 ggcacaccct gtaccatgcc caccctgagg gatcaggagc aaacagaccc tgcaaggtcc 180 tccaggcctg gggacaggaa agccactgac ccagcccggg aggcagaacc aggcagcctc 240 cctggcccca ggcacccttt tccctccagt ggcacctcct ggaaacagtc cacttgggcg 300 caaaacccag tgccttccaa atgagctgca gtccccaggc catgagcctc ccgggaatgt 360 ttaataaagg gcctggccac cctccaaaaa aaaaaaaaaa aaa 403 <210> 4 <211> 361 <212> DNA <213> Artificial Sequence <220> <223> up 4 <400> 4 ccgaattcga atcaccctaa caagccgcaa cgtaaaatcc ttggaaaagg tgtgtgctga 60 cttgataaga ggcgcaaaag aaaagaatct caaagtgaaa ggaccagttc gaatgcctac 120 caagacttga gaatcactac aagaaaaact ccttgtggtg aaggttctaa gacgtgggat 180 cgtttccaga tgagaattca caagcgactc attgacttgc acagtccttc tgagattgtt 240 aagcagatta cttcatcagt attgagccag gagttgaggt ggaagtcacc attgcagatg 300 cttaagtcaa ctattttaat aaattgatga ccagttgtta aaaaacaaaa aaaaaaaaaa 360 a 361 <210> 5 <211> 480 <212> DNA <213> Artificial Sequence <220> <223> up 5 <400> 5 gatgaggagt ttgatgctcg ctgggtaaca tacttcaaca agccagatat agatgcctgg 60 gaattgcgta aagggataaa cacacttgtt acctatgata tggttccaga gcccaaaatc 120 attgatgtgc tttgcgggca tgcagacggt taaatgattt tgctagtaca gttcgtatcc 180 taaaggttgt taaggacaaa gcaggacctc ataaggaaat ctacccctat gtcatccagg 240 aacttagacc aacttaaatg aactgggaat ctccactccg gaggaactgg gccttgacaa 300 agtgtaaacc gcatggatgg gcttccccaa ggatttattg acattgctac ttgagtgtga 360 acagttacct ggaaatactg agataacata ttaccttatt tgaacaagtt ttcctttatt 420 gagtaccaag ccatgtaatg gtaacttgga ctttaataaa agggaaatga gtttgaactg 480                                                                          480 <210> 6 <211> 345 <212> DNA <213> Artificial Sequence <220> <223> up 6 <400> 6 gctggttgtc caagatagaa tcttagttca actttaaatt tgcccacaga accctctaaa 60 tccccttgta aatttaactg ttagtccaaa gaggaacagc tctttggaca ctaggaaaaa 120 accttgtgag agagtaaaaa atttaacacc catagtaggc ctaaaagcag ccaccaatta 180 agaaagcgtt caagctcaac acccactacc taaaaaatcc caaacatata actgaactcc 240 tcacacccaa ttggccaatc tatcacccta tagaagaact aatgttagta taagtaacat 300 gaaaacattc tcctccgcat aagcctgcaa aaaaaaaaaa aaaaa 345 <210> 7 <211> 492 <212> DNA <213> Artificial Sequence <220> <223> up 7 <400> 7 tctgcgggag gcagtggtgg ggccatggac ccatgcgggg ggttccaggg tcacacgcca 60 cataacagac aaaaatacac acacgtgtgt ttttctttgc aatacttgaa atattgccac 120 tgtgcttgac ttagaagaag aaaatccccg tgacttcttc ctcatcacct tgatggcttt 180 attctcacct tgtggggcat gtttgtattt attgcttcat ggccgactgg aatcctgagt 240 cctgggaagc tggcctgcgg ggatcttgcc cggtgtcctg gtcctcttgc ttccgtcgcg 300 gccgcatgtg cgtgtgtcca agcaggtcct gggcgcctca actgctgccc ctggttgaat 360 gttctcttga tagtgctgga cctttgtcta ttttaaagcg aattttgtgt gatttcctgc 420 cctttgcgtt atattgtata ataccaacgt aaggaaataa acctttggaa ttgttaaaaa 480 aaaaaaaaaa aa 492 <210> 8 <211> 667 <212> DNA <213> Artificial Sequence <220> <223> Down 1 <400> 8 agtatttagc tgactcgcca cactccacgg aagcaatatg aaatgatctg ctgcagtgct 60 ctgagcccta ggattcatct ttcttttcac cgtaggtggc ctgactggca ttgtattagc 120 aaactcacac tagacatcgt actacacgac acgtactacg ttgtagctca cttccactat 180 gtcctatcaa taggagctgt atttgccatc ataggaggct tcattcactg atttccccta 240 ttctcaggct acacctagac caaacctacg ccaaaatcca tttcactatc atattcatcg 300 gcgtaaatct aactttcttc ccacaacact ttctcggcct atccggaatg ccccgacgtt 360 actcggacta ccccgatgcg tcaccacatg aaacatccta tcatctgtag gctcattcat 420 ttctctaaca gcagtaatat taataatttt catgatttga gaagccttcg cttcgaagcg 480 aaaagtccta atagtagaag aaccctccta aacctggagt gactatatgg atgcccccca 540 ccctaccaca cattcgaaga acccgtatac ataaaatcta gacaaaaaag gaaggaatcg 600 aaccccccaa agctggtttc aagccaaccc catggctcca tgactttttc aaaaaaaaaa 660 aaaaaaa 667 <210> 9 <211> 607 <212> DNA <213> Artificial Sequence <220> <223> Down 2 <400> 9 aagcacatac caaggccacc acacaccacc tgtccaaaaa ggccttcgat acgggataat 60 cctatttatt acctcagaag tttttttctt cgcaggattt ttctgagcct tttaccactc 120 cagcctaccc ctacccccca attaggaggg cactggcccc caacaggcat caccccgcta 180 aatcccctag aagtcccact cctaaacaca tccgtattac tcgcatcagg agtatcaatc 240 acctgagctc accaagtcta atagaaaaca accgaaacca aataattcaa gcactgctta 300 ttacaatttt actgggtctc tattttaccc tcctacaagc ctcagagtac ttcgagtctc 360 ccttcaccat ttccgacggc actacggctc aacatttttt gtagccacag gcttccacgg 420 acttcacgtc attattggct caactttcct cactatctgc ttcatccgcc aactaatatt 480 tcactttaca tccaaacatc actttggctc gaagccgccg cctgatactg gcattttgta 540 gatgtggtct gactatttct gtatgtctcc atctattgat gagggtctta aaaaaaaaaa 600 aaaaaaa 607 <210> 10 <211> 428 <212> DNA <213> Artificial Sequence <220> <223> Down 3 <400> 10 atcctcatta ctattctgcc tagcaaactc aaactacgaa cgcactcaca gtcgaatcat 60 aatcctctct caaggacttc aaactctact cccactaata gctttttgat gacttctagc 120 aagcctccta acctcgcctt accccccact attaacctac tgggagaact ctctgtgcta 180 gtaaccacgt tctcctgatc aaatatcact ctcctactta caggactcaa catactagtc 240 acagccctat actcctctac atatttacca caacacaatg gggctcactc acccaccaca 300 ttaacaacat aaaaccctca ttcacacgag aaaacaccct catgttcata cacctatccc 360 ccattctcct cctatccctc accccgacat cattaccggg ttttcctctt aaaaaaaaaa 420 aaaaaaaa 428 <210> 11 <211> 652 <212> DNA <213> Artificial Sequence <220> <223> Down 4 <400> 11 atctaggcct acccgccgca gtactgatca ttctatttcc ccctctattg atccccacct 60 ccaaatatct catcaacaac cgactaatca ccacccaaca atgactaatc aaactaacct 120 caaaacaatg ataaccatac acaacactaa aggacgaacc tgatctctta tactagtatc 180 cttaatcatt tttattgcca caactaacct cctcggactc ctgcctcact catttacacc 240 aaccacccaa ctattataaa cctagccatg gccatcccct tatgagcggg cgcagtgatt 300 ataggctttc gctctaagat taaaaatgcc ctagcccact tcttaccaca aggcacacct 360 acacccctta tccccatact attattatcg aaaccatcag cctactcatt caaccaatag 420 ccctggccgt acgcctaacc gctaacatta ctgcaggcca cctactcatg cacctaattg 480 gaagcgccac cctagcaata tcaaccataa ccttccctct acacttatca tcttcacaat 540 tctaattcta ctgactatcc tagaaatcgc tgtcgcctta atccaagcct acgttttcac 600 acttctagta agcctctacc tgcacgacaa cacataaaaa aaaaaaaaaa aa 652 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GDF15 Forward primer <400> 12 gttagccaaa gactgccact gcat 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GDF15 reverse primer <400> 13 tgtctcagga accttgagcc catt 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> WDR59 forward primer <400> 14 aggagcggaa atcaagacga tgga 24 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> WDR59 reverse primer <400> 15 atttgtgaac aggcaggagg caag 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> COX5A forward primer <400> 16 caaagtgtaa accgcatgga 20 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> COX5A reverse primer <400> 17 tccaggtaac tgttcacact caa 23 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> B2-1-06 forward primer <400> 18 taggtggcct gactggcatt gtat 24 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> B2-1-06 reverse primer <400> 19 tttggcgtag gtttggtcta gggt 24 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH forward primer <400> 20 tgcaccacca actgcttagc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH reverse primer <400> 21 ggcatggact gtggtcatga 20  

Claims (15)

GeneBank DNA microarray chip for confirming exposure to malachite green, in which all of the nucleic acid sequences of the GeneBank AB000584 (Growth differentiation factor 15) gene or its complementary strand molecules are integrated. delete delete delete RNA samples isolated from individuals suspected of exposure to malachite green (experimental groups) and controls 1) labeling the experimental and control groups with different fluorescent materials while synthesizing with cDNA; 2) hybridizing cDNA labeled with different fluorescent materials of step 1) with the DNA microarray chip of claim 1; 3) analyzing the reacted DNA microarray chip of step 2); And, 4) comparing the expression level of the gene integrated in the DNA microarray chip of claim 1 in the analyzed data of step 3) with the control group to determine whether the exposure to malachite green comprising measuring the exposure to malachite green Gene detection method for. delete delete The method of claim 5, wherein the fluorescent material of step 2) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC) and rhodamine (rhodamine) Gene detection method, characterized in that. RNA samples isolated from individuals suspected of exposure to malachite green (experimental groups) and controls 1) Real-time reverse transcription using RT-PCR using 18 to 30mer long primer pairs complementary to the gene integrated in the DNA microarray chip of claim 1 and capable of amplifying the gene. performing a polymerase chain reaction; And, 2) Gene detection method for confirming the exposure to malachite green comprising the step of measuring the exposure to malachite green by comparing the gene product of step 1) with the control. 10. The gene detection method according to claim 5 or 9, wherein the RNA sample is a cell derived from cells and tissues of human liver or liver cancer. The method of claim 10, wherein the human liver cancer cells are HepG2. Whether or not exposed to malachite green, characterized in that it comprises a primer pair of 18 to 30mer length, complementary to the gene integrated in the DNA microarray chip of claim 1 or the DNA microarray chip, and capable of amplifying the gene. Identification kit. 13. The kit according to claim 12, further comprising normal human liver cells or liver cancer cells as a control. delete The kit for confirming exposure to malachite green according to claim 12, wherein the primer pair is composed of a forward primer of SEQ ID NO: 12 and a reverse primer of SEQ ID NO: 13.

Images