KR101342035B1 - Biomaker and screening method of drug having nephyrotoxicity and side effects using thereof - Google Patents

Abstract

The present invention relates to a biomarker for searching for renal toxicity and side effects-inducing drugs and a search method using the same. Specifically, a biomarker for increasing or decreasing gene expression in common to various renal toxicity-inducing drugs and a renal toxicity and side effects-inducing drug using the same It is about a search method. The biomarker of the present invention can be usefully used to monitor and determine drugs or chemicals having new kidney toxicity and side effects risk by using the reaction genes selected through the DNA microarray chip as biomarkers. It can be used as a tool to identify mechanisms of action.

Renal Toxicity Drugs, Microarrays

Description

Biomarkers for Drug Searching for Renal Toxicity and Side Effects-inducing Drugs and Methods for Screening Drugs for Renal Toxicity and Side-effects Using Same

1 is a graph of cytotoxicity of nephrotoxicity-inducing drugs (amphotericin B and cisplatin) in human normal kidney cell lines.

Figure 2 is a view showing the results of analyzing the expression of human normal kidney cell line treated with a nephrotoxic agent using a microarray chip.

3 is a band diagram showing the number of genes that are commonly expressed and changed by nephrotoxicity-inducing drugs.

The present invention relates to a biomarker for searching for renal toxicity and side effects-inducing drugs and a method for searching for renal toxicity and side effects-inducing drugs using the same. More specifically, a biomarker for increasing or decreasing gene expression in common to renal toxicity-inducing drugs and the same The present invention relates to a method for searching for nephrotoxicity and side effects causing drugs.

Kidney toxicity is a side effect of antibiotics and various medications. This nephrotoxicity causes toxic injuries to cells in various nephron sites and affects specific cells in the glomeruli (Toback, Kidney). Int . 41: 226-246, 1992). Renal toxicity-related genes are more known in animals than in humans. In the case of mitogen-activated protein kinase kinase (MAPKK) 6, SD rats are known to target cell growth by inhibiting cell division and inhibiting cell growth. Yan et al ., J. Ethnopharmacol . 2006 Apr 15). Kidney injury molecule-1 is a well-known renal virulence marker gene and is known to remove proteins present in the cell membranes on the extracellular surface when the kidney is damaged (Bailly et al. al ., J. Biol . Chem . 277: 39739-39748, 2002). Clusterin, EGF (Epidermal growth factor), TIMP-3 (Tissue inhibitor of metalloproteinases-3), and IGFBP-1 (Insulin-like growth factor binding protein 1) are genes that are expressed to regenerate kidneys in acute kidney disorders. Bohe et al ., Kidney Int . 54: 1070-1082, 1998; Gobe et al ., Kidney Int. 4: 411-420. 1995; Lee et al ., Proc . Soc . Exp . Biol . Med . 216: 319-357, 1997; Leonard et al ., Ren . Fail . 16: 583-608., 1994; Silkensen et al ., J. Am . Soc . Nephrol . 8: 302-305, 1997). However, these genes alone are still insufficient to detect and evaluate renal toxicants.

Several genome sequencing projects, including six mammals and 292 microbes, have been completed and reported to the National Center for Biotechnology Information (NCBI). Genome-wide expression studies have been conducted to study the function of genes based on the vast amount of data thus obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment (Schena, M., et. al ., Proc. Natl . Acad . Sci . USA 93: 10614-10619,1996).

Microarrays integrate a set of oligonucleotides of complementary DNA (cDNA) or 20-25 base pairs in length on glass. cDNA microarrays are produced by labs in schools or by companies such as Agilent and Genomic Solutions, by mechanically immobilizing cDNA collections on chips or by using ink jetting (Sellheyer, K and Belbin, TJ, J. Am). . Acad Dermatol 51:.. 681-692 , 2004). Oligonucleotide microarrays are made by Affymetrix using a photolithography method directly on the chip, and Agillent, etc. are produced by immobilizing synthesized oligonucleotides (Sellheyer, K. and Belbin). , TJ, J. Am . Acad . Dermatol . 51: 681-692, 2004).

To analyze gene expression, RNA is obtained from samples such as tissues and hybridized with oligonucleotides in DNA microarrays. The obtained RNA is labeled with fluorescence or isotope and converted to cDNA. The cDNA microarray is mainly labeled with two different fluorescences (eg, Cye3 and Cye5) to perform the hybridization reaction on the same chip at the same time. . Gene expression is determined according to the ratio of the two fluorescence intensities (Somasundaram, K., et al ., Genomics Proteomics I: 1-10, 2002).

In combination with the recent research on toxic genomics (Toxicogenomics), which is an advanced technique using DNA macroarray technology, the expression pattern of genes expressed in specific tissues or cell lines by all chemicals as well as drug and new drug candidates in high throughput. Analysis and quantitative analysis are now possible. Accordingly, by analyzing the frequency of expression of specific genes in specific cells, it is possible to discover genes related to side effects of drugs, and through this, we will understand the molecular mechanisms according to the actions and side effects of drugs, Search and diagnosis of the material will be possible.

In this regard, the present inventors observed and analyzed gene expression profiles of two representative drugs that induce nephrotoxicity using oligomicroarrays in which 36,000 human genes were accumulated. The biomarker and detection method using the same can be used to detect overexpressed or underexpressed genes and to detect the expression of the genes by real-time RT-PCR. The present invention has been completed.

It is an object of the present invention to provide a biomarker commonly overexpressed or low expressed by a renal toxicity and side effect causing drug, and a method for searching for renal toxicity and side effect causing drug using the biomarker.

In order to achieve the above object, the present invention provides a biomarker for renal toxicity and side effects induced drug search characterized in that the expression changes in human kidney cells stimulated by the renal toxicity and side effects causing drugs.

In another aspect, the present invention provides a DNA microarray chip for renal toxicity and side effect-induced drug search in which the oligonucleotide or its complementary strand molecules containing all or part of the biomarker gene sequence are integrated.

In addition, the present invention provides a method for screening a drug for renal toxicity and side effects using the biobarker.

In addition, the present invention provides a kit for searching for nephrotoxicity and side effects.

Hereinafter, the present invention will be described in detail.

The present invention provides a biomarker for renal toxicity and side effects induced drug search characterized in that the expression changes in human kidney cells stimulated by the renal toxicity and side effects causing drugs.

The drug for causing nephrotoxicity and side effects is preferably selected from the group consisting of amphotericin B and cisplatin, but is not limited thereto. The biomarker consists of genes related to apoptosis, transcriptional regulation, signal transduction, transduction, and metabolism.

The present invention provides a biomarker, characterized in that selected from the group consisting of: Genebank (Genebank) XM_498383 (similar to Aldo-keto reductase family 1, member B1), gene accession number AK001361 [Protein phosphatase 1 , regulatory (inhibitor) subunit 15A], gene accession number AJ002535 (Obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF), gene accession number AK095253 (Bystin-like), gene accession number AK026909 (Disrupter of silencing 10), gene accession number CR612719 (Growth arrest and DNA-damage-inducible, alpha), gene registration number NM_138417 (KTI12 homolog, chromatin associated (S. cerevisiae)), gene registration number CR601067 (Plasminogen activator, urokinase receptor), gene registration number AK074052 (Tripartite motif- containing 41), gene registration number XM_039495 [(synonym: DJ347H13.4; Homo sapiens DNA segment, Chr 15, Wayne State University 75, expressed (D15Wsu75e)], gene registration BC067751 [V-maf mu sculoaponeurotic fibrosarcoma oncogene homolog F (avian)], gene accession number BM555452 (Tumor necrosis factor receptor superfamily, member 12A), gene accession number AK025974 (Hypothetical protein MGC2574), gene accession number NM_152392 [AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)], gene registration number CR613579 (Growth arrest and DNA-damage-inducible, gamma), gene registration number NM_031298 (Transmembrane protein 93), gene registration number BU673968 [RIO kinase 3 (yeast)], gene registration number D67025 [Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3], gene registration number BC040191 (Solute carrier family 35, member E4), gene registration number XM_371569 [Similar to Probable mitochondrial import receptor subunit TOM40 homolog (p38.5) ], Gene registration number NM_015946 [Pelota homolog (Drosophila)], gene registration number BX537620 [3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)], gene registration number NM_005203 (Collagen, type XIII, alpha 1),Gene accession number BC004102 (Aldehyde dehydrogenase 3 family, member A1), gene accession number AB075871 [Golgi transport 1 homolog A (S. cerevisiae)], gene registration number NM_005310 (Growth factor receptor-bound protein 7), gene registration number NM_173160 (FXYD domain containing ion transport regulator 4), gene registration number XM_499262 (similar to procollagen, type VI, alpha 2), gene registration No. NM_080542 [Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase], gene accession number AY203954 [RNA binding motif (RNP1, RRM) protein 3], gene accession number NM_001005190 (Olfactory receptor, family 7, subfamily A, member 10), gene registration number NM_005247 [Fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)], gene registration number BC033515 (LysM, putative peptidoglycan-binding, domain containing 2), gene Registration number NM_000134 (Fatty acid binding protein 2, intestinal), gene registration number BC051890 (Tubulin, gamma 2), gene registration number AY008294 [Zinc finger protein, subfamily 1A, 2 (Helios)], gene registration number NM_0143 23 (Zinc finger protein 278), gene accession number NM_001215 (Carbonic anhydrase VI), gene accession number AY706204 [SIN3 homolog B, transcription regulator (yeast)], gene accession number NM_001004703 (Olfactory receptor, family 4, subfamily C, member 46 ), Gene registration number NM_002409 [Mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase], gene registration number AK094580 (Serine / threonine kinase 32A), gene registration number NM_002918 [Regulatory factor X, 1 (influences HLA class II expression)], gene accession number AF097935 (Desmoglein 1), gene accession number NM_012110 (Cysteine-rich hydrophobic domain 2), gene accession number NM_001001524 (Transmembrane 6 superfamily member 2), gene accession number BE889572 (28kD interferon responsive protein), gene accession number BX640959 (Hypothetical protein FLJ14213), gene accession number AK122912 (Zinc finger, CCCH-type with G patch domain), gene accession number XM_495909 (Ovostatin), gene accession number NM_0204 58 (Tetrictricopeptide repeat domain 7A), gene accession number NM_145202 (Proline-rich acidic protein 1), gene accession number AF307451 (Cat eye syndrome chromosome region, candidate 6), gene accession number AK024144 (Hypothetical protein FLJ14082), gene accession number AB040955 (KIAA1522), gene registration number AL833764 [Fer-1-like 4 (C. elegans)], gene accession number AY129013 (TBC1 domain family, member 17), gene accession number AK096289 (Thrombospondin, type I, domain containing 1), gene accession number BM542003 (WD repeat domain 54), gene accession number AB018270 (Myosin ID ), Gene registration number BC073828 [Protein phosphatase 1J (PP2C domain containing)], gene registration number AF279145 (Anthrax toxin receptor 1), gene registration number AY358993 (Keratinocyte associated protein 3), gene registration number BG167195 (Similar to D-PCa- 2 protein), gene accession number XM_498695 (LOC440488), gene accession number XM_373266 (Similar to sphingomyelin phosphodiesterase 3, neutral membrane), gene accession number AK096265 (Sushi domain containing 4), gene accession number XM_378608 (Hypothetical gene supported by AK096066), Gene registration number AW575256 (LOC441281), gene registration number NM_001010867, gene registration number AK023662, gene registration number XM_290629, gene registration number AL136662 and gene registration No. BC025741.

1) Among the biomarkers, biomarker genes whose expression is increased by stimulation with neurotoxicity and side effect-inducing drugs are as follows: Genebank No. XM_498383 (similar to Aldo-keto reductase family 1, member B1), gene registration AK001361 [Protein phosphatase 1, regulatory (inhibitor) subunit 15A], gene accession number AJ002535 (Obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF), gene accession number AK095253 (Bystin-like), gene accession number AK026909 (Disrupter of silencing 10 ), Gene registration number CR612719 (Growth arrest and DNA-damage-inducible, alpha), gene registration number NM_138417 [KTI12 homolog, chromatin associated (S. cerevisiae)], gene registration number CR601067 (Plasminogen activator, urokinase receptor), gene registration No. AK074052 from Tripartite motif-containing 41, gene accession No. XM_039495 [synonym: DJ347H13.4; Homo sapiens DNA segment, Chr 15, Wayne State University 75, expressed (D15Wsu75e)], gene accession number BC067751 [V-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)], gene accession number BM555452 (Tumor necrosis factor receptor superfamily, member 12A ), Gene registration number AK025974 (Hypothetical protein MGC2574), gene registration number NM_152392 [AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)], gene registration number CR613579 (Growth arrest and DNA-damage-inducible, gamma), Gene registration number NM_031298 (Transmembrane protein 93), gene registration number BU673968 [RIO kinase 3 (yeast)], gene registration number D67025 [Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3], gene registration number BC040191 (Solute carrier family 35, member E4), gene accession number XM_371569 [Similar to Probable mitochondrial import receptor subunit TOM40 homolog (p38.5)] and gene accession number NM_015946 [Pelota homolog (Drosophila)].

2) Among the biomarkers, biomarker genes whose expression is reduced by stimulation with neurotoxic and adverse drug-inducing drugs are as follows: gene registration number BX537620 [3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)], Gene registration number NM_005203 (Collagen, type XIII, alpha 1), gene registration number BC004102 (Aldehyde dehydrogenase 3 family, member A1), gene registration number AB075871 [Golgi transport 1 homolog A (S. cerevisiae)], gene registration number NM_005310 (Growth factor receptor-bound protein 7), gene accession number NM_173160 (FXYD domain containing ion transport regulator 4), gene accession number XM_499262 (similar to procollagen, type VI, alpha 2), gene accession number NM_080542 [Collagen-like tail subunit (single) strand of homotrimer) of asymmetric acetylcholinesterase], gene accession number AY203954 [RNA binding motif (RNP1, RRM) protein 3], gene accession number NM_001005190 (Olfactory receptor, family 7, subfamily A, member 10), Gene accession number NM_005247 [Fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)], gene accession number BC033515 (LysM, putative peptidoglycan-binding, domain containing 2), gene accession number NM_000134 ( Fatty acid binding protein 2, intestinal), gene registration number BC051890 (Tubulin, gamma 2), gene registration number AY008294 [Zinc finger protein, subfamily 1A, 2 (Helios)], gene registration number NM_014323 (Zinc finger protein 278), gene Accession number NM_001215 (Carbonic anhydrase VI), gene accession number AY706204 [SIN3 homolog B, transcription regulator (yeast)], gene accession number NM_001004703 (Olfactory receptor, family 4, subfamily C, member 46), gene accession number NM_002409 [Mannosyl (Mannosyl) beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase], gene registration number AK094580 (Serine / threonine kinase 32A), gene registration number NM_002918 [Regulatory factor X, 1 (influences HLA class II expression)] , Genes, etc. AF097935 (Desmoglein 1), gene registration number NM_012110 (Cysteine-rich hydrophobic domain 2), gene registration number NM_001001524 (Transmembrane 6 superfamily member 2), gene registration number BE889572 (28 kD interferon responsive protein), gene registration number BX640959 (Hypothetical protein FLJ14213), gene accession number AK122912 (Zinc finger, CCCH-type with G patch domain), gene accession number XM_495909 (Ovostatin), gene accession number NM_020458 (Tetratricopeptide repeat domain 7A), gene accession number NM_145202 (Proline-rich acidic protein 1 ), Gene accession number AF307451 (Cat eye syndrome chromosome region, candidate 6), gene accession number AK024144 (Hypothetical protein FLJ14082), gene accession number AB040955 (KIAA1522), gene accession number AL833764 [Fer-1-like 4 (C. elegans)], gene accession number AY129013 (TBC1 domain family, member 17), gene accession number AK096289 (Thrombospondin, type I, domain containing 1), gene accession number BM542003 (WD repeat domain 54), gene accession number AB018270 (Myosin ID ), Gene registration number BC073828 [Protein phosphatase 1J (PP2C domain containing)], gene registration number AF279145 (Anthrax toxin receptor 1), gene registration number AY358993 (Keratinocyte associated protein 3), gene registration number BG167195 (Similar to D-PCa- 2 protein), gene accession number XM_498695 (LOC440488), gene accession number XM_373266 (Similar to sphingomyelin phosphodiesterase 3, neutral membrane), gene accession number AK096265 (Sushi domain containing 4), gene accession number XM_378608 (Hypothetical gene supported by AK096066) , Gene registration number AW575256 (LOC441281), gene registration number NM_001010867, gene registration number AK023662, gene registration number XM_290629, gene registration number AL136662 and gene registration No. BC025741.

In order to discover biomarkers for renal toxicity and side effects-inducing drug screening, the present inventors have previously treated neurotoxicity with amphotericine B and cisplatin in human normal kidney cell lines (HK-2). Was confirmed for cytotoxicity. As a result, the two neurotoxic drugs were confirmed to be toxic to human normal kidney cell lines (see FIG. 1), and the concentration of each drug was determined based on the experiment. Each neurotoxic inducing drug was then treated in human normal kidney cell lines at the determined concentration, mRNA was isolated from the drug treated cell line, and labeled with fluorescent material while synthesizing cDNA. The fluorescently labeled cDNA was hybridized with a 36k oligomicroarray chip Human V4.0 OpArray (Operon, Germany), and the fluorescence images were scanned to analyze differences in gene expression patterns (see FIG. 2). In analysis, the Cy5 / Cy3 ratio was classified as 1.5 times or more genes with increased expression, and 0.5 times or less as genes with reduced expression. As a result, it was confirmed that the expression increased gene was 2.94% (1086 of 36910 genes) for amphotericin B and 2.58% (954 of 36910 genes) with cisplatin. In addition, it was confirmed that the genes with reduced expression were 9.92% (3657 out of 36910 genes) and 4.74% (1747 out of 36910 genes) for amphotericin B (see FIG. 3). In this case, genes overexpressed or underexpressed by 1.5 times or more by two kinds of nephrotoxic drugs were classified, 127 gene expressions increased, and 781 gene expressions decreased. Classifying these genes by function was those involved in apoptosis, transcription, signal transduction, metabolism and transport (see Tables 2, 3 and 3). . Although these genes have been reported to be associated with acute renal failure, they have been associated with renal toxicity in human renal cell lines when treated with drugs that induce nephrotoxicity (amphotericin B and cisplatin) used in the present invention. There is no report of this.

Then, the inventors separated the four apoptosis-related genes and the kidney-associated genes of the genes and examined the expression pattern by real-time reverse transcript polymerase chain reaction (RT-PCR) method. As a result, it was confirmed that the gene expression patterns of the four overexpressed genes appeared similar to the oligomicroarray chip results (see Table 5).

In another aspect, the present invention provides a DNA microarray chip for renal toxicity and side effect-induced drug search in which the oligonucleotide or its complementary strand molecules containing all or part of the biomarker gene sequence are integrated.

The DNA microarray chip for renal toxicity and drug-induced drug screening of the present invention can be manufactured by methods known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method or a pin-shaped spotter using a piezoelectric method is used. It is preferable to use the method, but the present invention is not limited thereto. In a preferred embodiment of the present invention, a microarray which is a pin-shaped spotter is used. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde, It is not limited to this. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto, and in the preferred embodiment of the present invention, amino-silane may be used. Coated slide glass was used.

In addition, the present invention provides a method for screening a drug for renal toxicity and side effects using the biobarker.

The present invention provides a method for screening for renal toxicity and side effects-inducing drugs comprising the following steps: 1) treating a test compound with human normal kidney cells; 2) separating RNA from the experimental group cells treated with the test compound of step 1) and control cells not treated with the test compound; 3) labeling the fluorescent substance of the experimental group and the control group while synthesizing the RNA of the experimental group and the control group of step 2) with cDNA; 4) hybridizing cDNA labeled with different fluorescent materials of step 3) with DNA microarray chips; 5) analyzing the reacted DNA microarray chip of step 4); And 6) confirming the expression level of the biomarker of claim 1 in the analyzed data of step 5) by comparing with the control group.

In the above search method, the human normal kidney cells of step 1) preferably use HK-2, but are not limited thereto. Any cell can be used.

In the above-mentioned search method, the fluorescent material of step 3) is preferably selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (RITC), rhodamine-B-isothiocyanate (RITC), and rhodamine But it is not limited thereto, and fluorescent materials known to those skilled in the art are all usable.

In the search method, the DNA microarray chip of step 5) is preferably using 36k oligomicroarray Human V4.0 OpArray (Operon, Germany), Whole human genome oligo microarray (Agilent, USA), but not limited thereto. In the present invention, it is possible to use a microarray chip equipped with the above-described overexpression or low expression gene (see Tables 2 and 4) among the human genomes, and use the DNA microarray chip manufactured by the present inventors. Most preferred. In addition, although the analysis method of step 5) is preferably GenePix 4.1 software (Axon Instruments, USA), it is not limited thereto, and analysis software known to those skilled in the art may be used.

In addition, the present invention provides a method for screening for nephrotoxicity and side effect-inducing drugs comprising the following steps: 1) treating a test compound with human normal kidney cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using a primer complementary to the biomarker of claim 1 and amplifying the biomarker gene using the RNA of step 2); And 4) confirming the expression level by comparing the gene product of step 3) with the control.

In the above search method, the human normal kidney cells of step 1) preferably use HK-2, but are not limited thereto. Any cell can be used.

In the above search method, primers can be used as long as they are complementary to the biomarker genes found in the present invention and can amplify the biomarker. In the present invention, four pairs of forward and reverse primers set forth in SEQ ID NOs: 1 to 8 are provided, but the present invention is not limited thereto.

In addition, the present invention provides a kit for screening drug for nephrotoxicity and side effects.

The present invention provides a kit for detecting nephrotoxicity and side effect-inducing drug comprising the DNA microarray chip prepared in the present invention.

The present invention provides a kit for searching for nephrotoxicity and side effect-inducing drugs including human normal kidney cells in addition to the search kit. The human normal kidney cells are preferably HK-2, but are not limited thereto. Any human kidney cells may be used as long as they are derived from normal human kidney tissue.

In addition to the search kit, the fluorescent substance may include a strepavidin-like phosphatease conjugate, a chemiluminescent substance, and a chemiluminescent substance. But it is not limited thereto. In a preferred embodiment of the present invention, Cy3 and Cy5 are used. In addition, the detection kit may further include a reaction reagent, which is a buffer solution used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), fluorescent dye It may be composed of a labeling reagent, such as a chemical inducing agent, washing buffer, and the like, but is not limited thereto, and any reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art may be included.

The present invention also provides a kit for renal toxicity and side effects-inducing drug search comprising a primer that is complementary to the biomarker gene, and can amplify the biomarker gene.

Primer of the search kit is preferably to use two or more forward and reverse primers selected from the group consisting of the sequence described in SEQ ID NO: 1 to 8, but is not limited to, complementary to the biomarker, Both forward and reverse primer pairs capable of amplifying biomarker genes can be used.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> Cell culture and chemical treatment

<1-1> Cell culture

Human normal kidney cell line HK-2 cells (Seoul National University Urology) were incubated in DMEM medium (Gibro-BRL, USA) with 10% FBS until 80% of the dish was filled. The present inventors have selected two types of drugs, amphotericin B and cisplatin, which are drugs that show nephrotoxicity as a side effect of drug administration through existing studies and reports, and were dissolved in DMSO. Vehicle concentration was less than 0.1% in all experiments.

<1-2> Cytotoxicity Test ( MTT assay ) And chemical treatment

MTT experiment using HK-2 cell line was performed by the method of Mossman et al. (1995). Cells were attached to 24-well plates by treatment for 24 hours in DMEM medium (Gibro-BRL, USA) at 3 × 10 ⁴ cells per well. After 24 hours of treatment with two nephrotoxic drugs (amphotericin B, cisplatin) dissolved in each medium, MTT (3- (4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 mg / ml The mixture was added to the plate and incubated for 3 hours at 37 ° C. Then, the medium was removed and the formed formazan crystal was dissolved in 500 µl of DMSO, transferred to a 96-well plate, aliquoted, and had an absorbance of 540 nm. OD value was measured at.

As a result of examining the cytotoxicity of each nephrotoxic drug in HK-2 cell line, the concentration showing 30% survival rate (IC ₃₀ ) was 4.23 μg / ml for amphotericin B and 8.84 μg / ml for cisplatin (FIG. 1). The microarray experiment was performed by determining the concentrations.

< Example  2> Microarray  Experiment

<2-1> target RNA Separation of fluorescent material and labeling

After dispensing HK-2 cells in 100 mm dishes at a concentration of 1 × 10 ⁶ cells / ml, 24 hours later, each kidney toxicity-inducing drug was treated for 24 hours at the concentration of each kidney-inducing drug determined in Example 1-2. It was. Thereafter, the whole cells were separated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using the RNeasy mini kit (Qiagen, USA). Genomic DNA was removed using an RNase-free DNase set (Qiagen, USA) during RNA purification. The amount of each total RNA sample was measured by spectrophotometer and the concentration was confirmed by Agilent 2100 Bioanalyzer (Agilent Technologies, USA) and agarose gel electrophoresis.

<2-2> Labeled cDNA  Produce

CDNA was prepared using the total RNA of the nephrogenicity-inducing drug treatment group obtained in Example 2-1 for oligo microarray analysis. The total RNA obtained above was mixed with 30 μg of oligo (dT) primer and 2 μg (1 μg / μl), reacted at 65 ° C. for 10 minutes, and then annealed in ice. Reagents were mixed as shown in Table 1 for Reverse Transcript reaction of the annealed RNA.

Configuration Volume ([mu] l) 5X first strand buffer 6 dNTPs 0.6 0.1 M DDT 3 SuperScript II enzyme 3 Cy-3 or Cy-5 dUTP 2

Total RNA isolated from control HK-2 cell line was labeled with Cy3-dUTP (green), and RNA isolated from HK-2 cell line treated with nephrotoxic drugs was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

<2-3> Hybridization  reaction

Hybridization and washing procedures were carried out according to the instructions of Genome Co., Ltd .. Hybridization was performed in a 62 ° C. oven for 12 hours. As a DNA microarray chip, a 36k microarray Human V4.0 OpArray (Operon, Germany) was used. After washing (washing in 2 × SSC / 0.1% SDS for 2 minutes, washing in 1 × SSC for 3 minutes, 0.2 × SSC for 2 minutes), the slides were dried by centrifugation at 800 rpm for 3 minutes.

<2-4> Fluorescence image acquisition

Hybridization images on the slides were scanned with the Genepix 4000B (Axon Instruments, USA). Chips washed with unbound genes were obtained with a fluorescence image using a laser fluorescence scanner. In this case, the green fluorescence image in the control group, the red fluorescence image represents the activity level of the gene specifically expressed only in the experimental group, and the yellow fluorescence image is the complementary color of green and red, which means that there is no significant difference between the two groups. Scanned images were analyzed with GenePix 4.1 software (Axon Instruments, USA) to obtain gene expression rates. Marker genes for each nephrotoxic drug were selected from the data thus obtained (FIG. 2).

As a result, among the approximately 36,000 genes present on the oligo chip, the ratio of Cy5 / Cy3 increased by 1.5 times or more was 2.94% for amphotericin B (1086 genes among 36910 genes). Cisplatin was 2.58% (954 out of 36910 genes). In addition, the genes showing a decrease in the expression of Cy5 / Cy3 by 0.5 times or less were 9.92% (3657 out of 36910 genes) and cisplatin (4747 out of 36910 genes) for amphotericin B. It was confirmed (FIG. 3).

At this time, when classifying genes overexpressed or underexpressed by 1.5 times or more in common by renal toxicity-inducing drugs of the species, 21 gene expressions increased and 53 gene expressions decreased (Tables 2 and 3, FIG. 2). . These genes were grouped by function in terms of apoptosis, transcription, signal transduction, metabolism, and transport.

Genes with Increased Expression by Nephrotoxic Drugs Registration Number
(GeneBank) Genetic Gene name Intermediate value ratio AmpB ^* Cis ^* Apoptosis AK001361 PPP1R15A (GADD34) Protein phosphatase 1, regulatory (inhibitor) subunit 15A 2.77 2.72 CR612719 GADD45A Growth arrest and DNA-damage-inducible, alpha 1.73 3.59 CR613579 GADD45G Growth arrest and DNA-damage-inducible, gamma 1.68 1.76 BM555452 TNFRSF12A Tumor necrosis factor receptor superfamily, member 12A 1.57 2.97 Transcription regulation BC067751 MAFF V-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) 1.68 2.33 Etc NM_015946 PELO Pelota homolog (Drosophila) 1.62 1.71 CR601067 PLAUR Plasminogen activator, urokinase receptor 1.69 2.3 AK095253 BYSL Bystin-like 1.75 2.05 AK074052 TRIM41 Tripartite motif-containing 41 1.63 1.66 XM_371569 LOC389049 Similar to Probable mitochondrial import receptor subunit TOM40 homolog (p38.5) 2.05 1.66 BU673968 RIOK3 RIO kinase 3 (yeast) 1.56 1.7 AK026909 SAS10 Disrupter of silencing 10 1.7 1.6 Biological function unknown BC040191 SLC35E4 Solute carrier family 35, member E4 2.38 2 AJ002535 OBSCN Obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF 1.65 1.52 D67025 PSMD3 Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 1.6 1.98 AK025974 MGC2574 Hypothetical protein MGC2574 2.14 1.72 XM_039495 D15Wsu75e synonym: DJ347H13.4; Homo sapiens DNA segment, Chr 15 1.58 1.79 NM_152392 AHSA2 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) 1.52 2.33 NM_031298 MGC2963 Transmembrane protein 93 2.24 1.95 XM_498383 LOC392525 similar to Aldo-keto reductase family 1, member B1 17.8 1.64 NM_138417 MGC20419 KTI12 homolog, chromatin associated (S. cerevisiae) 1.94 1.76

AmpB: amphotericin B

  Cis: Cisplatin

delete

Genes whose expression is reduced by nephrotoxic drugs Registration Number
(GeneBank) Genetic Gene name Intermediate value ratio AmpB ^* Cis ^* Transcription regulation AY706204 SIN3B SIN3 homolog B, transcription regulator (yeast) 0.4 0.39 AY008294 ZNFN1A2 Zinc finger protein, subfamily 1A, 2 (Helios) 0.51 0.64 NM_014323 ZNF278 Zinc finger protein 278 0.53 0.58 NM_002918 RFX1 Regulatory factor X, 1 (influences HLA class II expression) 0.53 0.57 AY203954 RBM3 RNA binding motif (RNP1, RRM) protein 3 0.51 0.66  Signal transduction NM_005310 GRB7 Growth factor receptor-bound protein 7 0.45 0.39 NM_001005190 OR7A10 Olfactory receptor, family 7, subfamily A, member 10 0.29 0.5 NM_001004703 OR4C46 Olfactory receptor, family 4, subfamily C, member 46 0.51 0.55  Transport NM_000134 FABP2 Fatty acid binding protein 2, intestinal 0.55 0.55 NM_005203 COL13A1 Collagen, type XIII, alpha 1 0.38 0.36 XM_499262 LOC442508 similar to procollagen, type VI, alpha 2 0.51 0.39 NM_080542 COLQ Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase 0.34 0.4 NM_173160 FXYD4 FXYD domain containing ion transport regulator 4 0.52 0.45 AB075871 FLJ42654 Golgi transport 1 homolog A (S. cerevisiae) 0.48 0.45  Metabolism BX537620 HMGCS1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) 0.63 0.38 NM_001215 CA6 Carbonic anhydrase VI 0.38 0.6 BC004102 ALDH3A1 Aldehyde dehydrogenase 3 family, memberA1 0.44 0.57 Etc AF097935 DSG1 Desmoglein 1 0.64 0.52 NM_005247 FGF3 Fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog) 0.39 0.42 BC033515 MGC35274 LysM, putative peptidoglycan-binding, domain containing 2 0.44 0.45 BC051890 TUBG2 Tubulin, gamma 2 0.32 0.64 NM_002409 MGAT3 Mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase 0.61 0.63 AK094580 STK32A Serine / threonine kinase 32A 0.42 0.52 Biological process unknown NM_012110 CHIC2 Cysteine-rich hydrophobic domain 2 0.2 0.32 NM_001001524 TM6SF2 Transmembrane 6 superfamily member 2 0.46 0.42 BE889572 IFRG28 28kD interferon responsive protein 0.41 0.35 BX640959 FLJ14213 Hypothetical protein FLJ14213 0.37 0.39 AK122912 ZGPAT Zinc finger, CCCH-type with G patch domain 0.42 0.38 XM_495909 OVOS Ovostatin 0.58 0.56 NM_020458 TTC7A Tetratricopeptide repeat domain 7A 0.48 0.52 NM_145202 PRAP1 Proline-rich acidic protein 1 0.4 0.42 AF307451 CECR6 Cat eye syndrome chromosome region, candidate 6 0.29 0.29 AK024144 FLJ14082 Hypothetical protein FLJ14082 0.42 0.45 AB040955 KIAA1522 KIAA1522 0.35 0.59 AL833764 FER1L4 Fer-1-like 4 (C. elegans) 0.64 0.59 AY129013 TBC1D17 TBC1 domain family, member 17 0.46 0.47 AK096289 THSD1 Thrombospondin, type I, domain containing 1 0.39 0.36 BM542003 FLJ12953 WD repeat domain 54 0.4 0.41 AB018270 MYO1D Myosin ID 0.56 0.51 BC073828 PPP2CZ Protein phosphatase 1J (PP2C domain containing) 0.4 0.4 AY358993 KRTCAP3 Keratinocyte associated protein 3 0.29 0.44 AF279145 ANTXR1 Anthrax toxin receptor 1 0.63 0.52 ESTs BG167195 Similar to D-PCa-2 protein 0.42 0.62 XM_498695 LOC440488 LOC440488 0.66 0.54 XM_373266 LOC392275 Similar to sphingomyelin phosphodiesterase 3, neutral membrane 0.48 0.39 AK096265 FLJ10052 Sushi domain containing 4 0.47 0.52 XM_378608 LOC400541 Hypothetical gene supported by AK096066 0.52 0.42 AW575256 LOC441281 LOC441281 0.51 0.51 NM_001010867 LOC200205 Chromosome 1 open reading frame 69 0.55 0.41 AK023662 C9orf44 Chromosome 9 open reading frame 44 0.62 0.52 XM_290629 C14orf78 Chromosome 14 open reading frame 78 0.39 0.4 AL136662 DKFZP564O1664 Chromosome 15 open reading frame 44 0.62 0.44 BC025741 FLJ35681 Chromosome 16 open reading frame 54 0.39 0.52

AmpB: amphotericin B

  Cis: Cisplatin

delete

< Example  3> Real time RT -PCR ( Real - time reverse transcriptase 중합체 chain  reaction)

Among the overexpressed genes of Example 2 induced by nephrotoxicity-inducing drugs, four genes in which apoptosis-related genes, which are characteristic of nephrotoxicity, and association with nephrotoxicity were reported were selected. These genes include gene registration number NM_152392 (AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) (AHSA2)), gene registration number S62138 (DNA-damage-inducible transcript 3 (DDIT3)), gene registration number BM555452 (Tumor necrosis factor receptor superfamily, member 12A (TNFRS12A)), gene accession number CR612719 (Growth arrest and DNA-damage-inducible, alpha (GADD45A)). The GARD45A (Growth arrest and DNA-damage-inducible, alpha) is a gene that affects chromatin regeneration of templates concurrent in DNA repair, and has been reported to be involved in the binding between chromatin synthesis and DNA repair. Smith et al ., Mol . Cell . Biol . 20 (10): 3705-14, 2000). Tumor necrosis factor receptor superfamily (member 12A) is known to cause death of tumor cell lines (Chicheportiche et. al ., J. Biol . Chem . 272: 32401-32410, 1997), recent studies have reported that it acts as a multifunctional cytokine that regulates cell proliferation, angiogenesis, and inflammation (Wiley et. al ., Cytokine Growth Factor Rev. 14: 241-249, 2003). DNA-damage-inducible transcript 3 (DDIT3) has been reported to significantly increase expression when cell damage or cell division is inhibited (Gately et al. al ., Br J. Cancer . 73 (1): 18-23, 1996). ASHA2 (AHA1, an activator of heat shock 90kDa protein ATPase homolog 2 (yeast)) is an adjuvant chaperone of Hsp90 that regulates Hsp90 ATPase activity and has been reported to be a gene expressed under various stress conditions (Gasch et. al ., Mol . Biol . Cell 11: 4241-4257, 2000). Quantitative real-time RT-PCR was performed using My IQ Real-time PCR (Bio-rad, USA) to investigate and quantify the expression changes of the genes.

Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). To quantify the PCR products were stained with SYBR Green I stain (Bio-rad, USA). Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, primers for the target gene and endogenous control (GAPDH) used for PCR were added to the Cyberrin master mix, followed by PCR, followed by a primer optimization process to select an appropriate concentration. Was performed. Synthesized cDNA samples and each primer (Table 4) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (Table 5).

primer  order Registration Number Gene name PCR primer  order
(5 '-> 3') NM_152392 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) (AHSA2) sense
(SEQ ID NO: 1) gctgattttcttctatgagtggaac Antisense
(SEQ ID NO: 2) cttgtgcttcactccagattctt S62138 DNA-damage-inducible transcript 3 (DDIT3) sense
(SEQ ID NO: 3) aaggcactgagcgtatcatgt Antisense
(SEQ ID NO: 4) tgaagatacacttccttcttgaaca BM555452 Tumor necrosis factor receptor superfamily, member 12A (TNFRS12A) sense
(SEQ ID NO: 5) gcaggagagagaagttcacca Antisense
(SEQ ID NO: 6) ggcacattgtcactggatca CR612719 Growth arrest and DNA-damage-inducible, alpha (GADD45A) sense
(SEQ ID NO: 7) tcagcgcacgatcactgtc Antisense
(SEQ ID NO: 8) ccagcaggcacaacaccac

Real-time RT-PCR Quantification Results Registration Number Gene name Real-time PCR
(Relative magnification) cDNA Microarray
(Cy3 / Cy5 ratio) NM_152392 AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast) (AHSA2) Amphotericin B 3.31 Amphotericin B 1.52 Cisplatin 2.61 Cisplatin 2.33 S62138 DNA-damage-inducible transcript 3 (DDIT3) Amphotericin B 2.06 Amphotericin B 1.10 Cisplatin 2.37 Cisplatin 2.16 BM555452 Tumor necrosis factor receptor superfamily, member 12A (TNFS12A) Amphotericin B 2.38 Amphotericin B 1.57 Cisplatin 1.83 Cisplatin 2.97 CR612719 Growth arrest and DNA-damage-inducible, alpha (GADD45A) Amphotericin B 1.73 Amphotericin B 1.73 Cisplatin 10.73 Cisplatin 3.59

As a result, it was confirmed that the gene expression patterns of the four overexpressed genes were very similar to the oligo microarray results of the gene expression by the nephrotoxic drugs.

The biomarker for detecting nephrotoxicity and side effect-inducing drugs of the present invention and the method for renal toxicity and side-effect drug searching using the same have new risks of nephrotoxicity and side effects by using the reaction genes selected through DNA microarray chips as biomarkers. Useful for monitoring and determining drugs or chemicals, and as a tool for identifying mechanisms of action that cause renal toxicity.

<110> Korea Institute of Science and Technology <120> Biomaker and screening method of drug having nephyrotoxicity and          side effects using pretty <130> 6p-06-36 <160> 8 <170> Kopatentin 1.71 <210> 1 <211> 25 <212> DNA <213> AHSA2 sense primer <400> 1 gctgattttc ttctatgagt ggaac 25 <210> 2 <211> 23 <212> DNA <213> AHSA2 antisense primer <400> 2 cttgtgcttc actccagatt ctt 23 <210> 3 <211> 21 <212> DNA 213 DDIT3 sense primer <400> 3 aaggcactga gcgtatcatg t 21 <210> 4 <211> 25 <212> DNA <213> DDIT3 antisense primer <400> 4 tgaagataca cttccttctt gaaca 25 <210> 5 <211> 21 <212> DNA <213> TNFRS12A sense primer <400> 5 gcaggagaga gaagttcacc a 21 <210> 6 <211> 20 <212> DNA <213> TNFRS12A antisense primer <400> 6 ggcacattgt cactggatca 20 <210> 7 <211> 19 <212> DNA <213> GADD45A sense primer <400> 7 tcagcgcacg atcactgtc 19 <210> 8 <211> 19 <212> DNA <213> GADD45A antisense primer <400> 8 ccagcaggca caacaccac 19

Claims (14)

DNA microarray chip for searching for amphotericin B or cisplatin in which all of the following sequences of all genes or their complementary strand molecules are integrated: Genebank XM_498383 (similar to Aldo-keto reductase family 1, member B1), gene accession number AK001361 [Protein phosphatase 1, regulatory (inhibitor) subunit 15A], gene accession number AJ002535 (Obscurin, cytoskeletal calmodulin and titin- interacting RhoGEF), gene accession number AK095253 (Bystin-like), gene accession number AK026909 (Disrupter of silencing 10), gene accession number CR612719 (Growth arrest and DNA-damage-inducible, alpha), gene accession number NM_138417 [KTI12 homolog, chromatin associated (S. cerevisiae)], gene accession no. CR601067 (Plasminogen activator, urokinase receptor), gene accession No. AK074052 (Tripartite motif-containing 41), gene accession No. XM_039495 [synonym: DJ347H13.4; Homo sapiens DNA segment, Chr 15, Wayne State University 75, expressed (D15Wsu75e)], gene accession number BC067751 [V-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)], gene accession number BM555452 (Tumor necrosis factor receptor superfamily, member 12A ), Gene registration number AK025974 (Hypothetical protein MGC2574), gene registration number NM_152392 [AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)], gene registration number CR613579 (Growth arrest and DNA-damage-inducible, gamma), Gene registration number NM_031298 (Transmembrane protein 93), gene registration number BU673968 [RIO kinase 3 (yeast)], gene registration number D67025 [Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3], gene registration number BC040191 (Solute carrier family 35, member E4), gene accession number XM_371569 [Similar to Probable mitochondrial import receptor subunit TOM40 homolog (p38.5)], gene accession number NM_015946 [Pelota homolog (Drosophila)], gene accession number BX537620 [ 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)], gene accession number NM_005203 (Collagen, type XIII, alpha 1), gene accession number BC004102 (Aldehyde dehydrogenase 3 family, memberA1), gene accession number AB075871 [Golgi transport 1 homolog A (S. cerevisiae)], gene registration number NM_005310 (Growth factor receptor-bound protein 7), gene registration number NM_173160 (FXYD domain containing ion transport regulator 4), gene registration number XM_499262 (similar to procollagen, type VI, alpha 2), gene registration No. NM_080542 [Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase], gene accession number AY203954 [RNA binding motif (RNP1, RRM) protein 3], gene accession number NM_001005190 (Olfactory receptor, family 7, subfamily A, member 10), gene registration number NM_005247 [Fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)], gene registration number BC033515 (LysM, putative peptidoglycan-binding, domain containing 2), gene Registration number NM_000134 (Fatty acid binding protein 2, intestinal), gene registration number BC051890 (Tubulin, gamma 2), gene registration number AY008294 [Zinc finger protein, subfamily 1A, 2 (Helios)], gene registration number NM_01432 3 (Zinc finger protein 278), gene accession number NM_001215 Carbonic anhydrase VI), gene accession number AY706204 [SIN3 homolog B, transcription regulator (yeast)], gene accession number NM_001004703 (Olfactory receptor, family 4, subfamily C, member 46), Gene registration number NM_002409 [Mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase], gene registration number AK094580 (Serine / threonine kinase 32A), gene registration number NM_002918 [Regulatory factor X, 1 ( influences HLA class II expression)], gene accession number AF097935 (Desmoglein 1), gene accession number NM_012110 (Cysteine-rich hydrophobic domain 2), gene accession number NM_001001524 (Transmembrane 6 superfamily member 2), gene accession number BE889572 (28kD interferon responsive protein), gene registration number BX640959 (Hypothetical protein FLJ14213), gene registration number AK122912 (Zinc finger, CCCH-type with G patch domain), gene registration number XM_495909 (Ovostatin), gene registration number NM_020458 (Tetratricopeptide repeat domain 7A), gene registration number NM_145202 (Proline-rich acidic protein 1), gene registration number AF307451 (Cat eye syndrome chromosome region, candidate 6), gene registration number AK024144 (Hypothetical protein FLJ14082), gene registration number AB040955 ( KIAA1522), gene registration number AL833764 [Fer-1-like 4 (C. elegans)], gene accession number AY129013 (TBC1 domain family, member 17), gene accession number AK096289 (Thrombospondin, type I, domain containing 1), gene accession number BM542003 (WD repeat domain 54), gene accession number AB018270 (Myosin ID ), Gene registration number BC073828 [Protein phosphatase 1J (PP2C domain containing)], gene registration number AF279145 (Anthrax toxin receptor 1), gene registration number AY358993 (Keratinocyte associated protein 3), gene registration number BG167195 (Similar to D-PCa- 2 protein), gene accession number XM_498695 (LOC440488), gene accession number XM_373266 (Similar to sphingomyelin phosphodiesterase 3, neutral membrane), gene accession number AK096265 (Sushi domain containing 4), gene accession number XM_378608 (Hypothetical gene supported by AK096066), Gene registration number AW575256 (LOC441281), gene registration number NM_001010867, gene registration number AK023662, gene registration number XM_290629, gene registration number AL136662 and gene registration No. BC025741. The DNA microarray chip according to claim 1, wherein the following genes have increased expression by amphotericin B or cisplatin treatment: Genebank XM_498383 (similar to Aldo-keto reductase family 1, member B1), gene accession number AK001361 [Protein phosphatase 1, regulatory (inhibitor) subunit 15A], gene accession number AJ002535 (Obscurin, cytoskeletal calmodulin and titin- interacting RhoGEF), gene accession number AK095253 (Bystin-like), gene accession number AK026909 (Disrupter of silencing 10), gene accession number CR612719 (Growth arrest and DNA-damage-inducible, alpha), gene accession number NM_138417 [KTI12 homolog, chromatin associated (S. cerevisiae)], gene accession no. CR601067 (Plasminogen activator, urokinase receptor), gene accession No. AK074052 (Tripartite motif-containing 41), gene accession No. XM_039495 [synonym: DJ347H13.4; Homo sapiens DNA segment, Chr 15, Wayne State University 75, expressed (D15Wsu75e)], gene accession number BC067751 [V-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)], gene accession number BM555452 (Tumor necrosis factor receptor superfamily, member 12A ), Gene registration number AK025974 (Hypothetical protein MGC2574), gene registration number NM_152392 [AHA1, activator of heat shock 90kDa protein ATPase homolog 2 (yeast)], gene registration number CR613579 (Growth arrest and DNA-damage-inducible, gamma), Gene registration number NM_031298 (Transmembrane protein 93), gene registration number BU673968 [RIO kinase 3 (yeast)], gene registration number D67025 [Proteasome (prosome, macropain) 26S subunit, non-ATPase, 3], gene registration number BC040191 (Solute carrier family 35, member E4), gene accession number XM_371569 [Similar to Probable mitochondrial import receptor subunit TOM40 homolog (p38.5)] and gene accession number NM_015946 [Pelota homolog (Drosophila)]. [Claim 2] The DNA microarray chip according to claim 1, wherein the following genes are reduced in expression by amphotericin B or cisplatin treatment: Gene registration number BX537620 [3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)], gene registration number NM_005203 (Collagen, type XIII, alpha 1), gene registration number BC004102 (Aldehyde dehydrogenase 3 family, memberA1), gene Accession number AB075871 [Golgi transport 1 homolog A (S. cerevisiae)], gene accession number NM_005310 (Growth factor receptor-bound protein 7), gene accession number NM_173160 (FXYD domain containing ion transport regulator 4), gene accession number XM_499262 (similar to procollagen, type VI, alpha 2), gene registration number NM_080542 [Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase], gene registration number AY203954 [RNA binding motif (RNP1, RRM) protein 3], gene registration No. NM_001005190 (Olfactory receptor, family 7, subfamily A, member 10), gene registration number NM_005247 [Fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)], gene registration number BC033515 (L ysM, putative peptidoglycan-binding, domain containing 2), gene registration number NM_000134 (Fatty acid binding protein 2, intestinal), gene registration number BC051890 (Tubulin, gamma 2), gene registration number AY008294 [Zinc finger protein, subfamily 1A, 2 (Helios)], gene accession number NM_014323 (Zinc finger protein 278), gene accession number NM_001215 (Carbonic anhydrase VI), gene accession number AY706204 [SIN3 homolog B, transcription regulator (yeast)], gene accession number NM_001004703 (Olfactory receptor, family 4, subfamily C, member 46), gene registration number NM_002409 [Mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase], gene registration number AK094580 (Serine / threonine kinase 32A), gene Registry number NM_002918 [Regulatory factor X, 1 (influences HLA class II expression)], gene registration number AF097935 (Desmoglein 1), gene registration number NM_012110 (Cysteine-rich hydrophobic domain 2), gene registration number NM_001001524 (Transmembrane 6 superfamily member 2), gene accession number BE889572 (28 kD interferon responsive protein), gene accession number BX640959 (Hypothetical protein FLJ14213), gene accession number AK122912 (Zinc finger, CCCH-type with G patch domain), gene accession number XM_495909 (Ovostatin), Gene registration number NM_020458 (Tetratricopeptide repeat domain 7A), gene registration number NM_145202 (Proline-rich acidic protein 1), gene registration number AF307451 (Cat eye syndrome chromosome region, candidate 6), gene registration number AK024144 (Hypothetical protein FLJ14082), gene Accession number AB040955 (KIAA1522), gene accession number AL833764 [Fer-1-like 4 (C. elegans)], gene accession number AY129013 (TBC1 domain family, member 17), gene accession number AK096289 (Thrombospondin, type I, domain containing 1), gene accession number BM542003 (WD repeat domain 54), gene accession number AB018270 (Myosin ID ), Gene registration number BC073828 [Protein phosphatase 1J (PP2C domain containing)], gene registration number AF279145 (Anthrax toxin receptor 1), gene registration number AY358993 (Keratinocyte associated protein 3), gene registration number BG167195 (Similar to D-PCa- 2 protein), gene accession number XM_498695 (LOC440488), gene accession number XM_373266 (Similar to sphingomyelin phosphodiesterase 3, neutral membrane), gene accession number AK096265 (Sushi domain containing 4), gene accession number XM_378608 (Hypothetical gene supported by AK096066), Gene registration number AW575256 (LOC441281), gene registration number NM_001010867, gene registration number AK023662, gene registration number XM_290629, gene registration number AL136662 and gene registration No. BC025741. delete delete 1) treating the test compound to the isolated human normal kidney cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) labeling the experimental group and the control group with different fluorescent materials while synthesizing the RNA of the experimental group and the control group of step 2) with cDNA; 4) hybridizing cDNA labeled with different fluorescent materials of step 3) with the DNA microarray chip of claim 1; 5) analyzing the reacted DNA microarray chip of step 4); And 6) Gene expression level confirmation method for the treatment of amphotericin B or cisplatin comprising the step of confirming the expression level of the gene integrated in the DNA microarray chip of claim 1 in the analyzed data of step 5) compared to the control. 7. The amphotericin B or cisplatin according to claim 6, wherein the isolated human kidney cells of step 1) are selected from the group consisting of HK-2 cells, primary human kidney cells, and isolated kidney tissues. Method of confirming gene expression level for treatment. The method of claim 6, wherein the fluorescent material of step 3) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). Method for confirming the gene expression level for amphotericin B or cisplatin treatment, characterized in that. 1) treating the test compound to the isolated human normal kidney cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using a primer complementary to the gene of claim 1 and amplifying the RNA of step 2); 4) A method for confirming gene expression level for amphotericin B or cisplatin treatment comprising comparing the gene product of step 3) with a control to confirm the expression level. 10. The method according to claim 9, wherein the isolated human kidney cells of step 1) are selected from the group consisting of HK-2 cells, primary human kidney cells, and isolated kidney tissue, and used for amphotericin B or cisplatin. Method of confirming gene expression level for treatment. A kit for amphotericin B or cisplatin detection comprising the DNA microarray chip of claim 1. 12. The kit for searching for amphotericin B or cisplatin according to claim 11, further comprising human normal cells selected from the group consisting of human normal cells, HK2, primary human kidney cells, and kidney tissue. A kit for searching for amphotericin B or cisplatin comprising all of the primers complementary to the gene of claim 1 and amplifying the gene. The kit for searching for amphotericin B or cisplatin according to claim 13, wherein the primers are two or more forward and reverse directions selected from the group consisting of the sequences set forth in SEQ ID NOs: 1-8.

Images