KR101383641B1 - Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame - Google Patents

Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame Download PDF

Info

Publication number
KR101383641B1
KR101383641B1 KR1020120029432A KR20120029432A KR101383641B1 KR 101383641 B1 KR101383641 B1 KR 101383641B1 KR 1020120029432 A KR1020120029432 A KR 1020120029432A KR 20120029432 A KR20120029432 A KR 20120029432A KR 101383641 B1 KR101383641 B1 KR 101383641B1
Authority
KR
South Korea
Prior art keywords
butylaldehyde
exposure
gene
cells
exposed
Prior art date
Application number
KR1020120029432A
Other languages
Korean (ko)
Other versions
KR20130107552A (en
Inventor
류재천
송미
윤지성
신찬영
이효선
류우인
Original Assignee
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술연구원 filed Critical 한국과학기술연구원
Priority to KR1020120029432A priority Critical patent/KR101383641B1/en
Publication of KR20130107552A publication Critical patent/KR20130107552A/en
Application granted granted Critical
Publication of KR101383641B1 publication Critical patent/KR101383641B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6834Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 환경 중 노출되는 휘발성 유기화합물 중의 하나인 부틸알데히드(Butylaldehyde) 특이적 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 구체적으로 부틸알데히드에 의해 특이적으로 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 부틸알데히드에 특이적 노출 여부를 확인하는 방법에 관한 것이며, 본 발명의 바이오마커는 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자들을 바이오마커로 이용하여 환경 시료에서 부틸알데히드의 오염을 모니터링 및 판정하는데 유용하게 사용될 수 있으며, 부틸알데히드에 의해 특이적으로 유발되는 독성 작용 기작을 규명하는 도구로 이용될 수 있다.The present invention relates to a biomarker for confirming whether butylaldehyde is one of volatile organic compounds exposed to the environment and a method of identifying the same, specifically, increasing or decreasing gene expression specifically by butylaldehyde. The present invention relates to a biomarker and a method for identifying specific exposure to butylaldehyde using the same, and the biomarker of the present invention uses a reaction gene selected through a DNA microarray chip as a biomarker to contaminate butylaldehyde in an environmental sample. It can be usefully used to monitor and determine the toxic effects and can be used as a tool for identifying the mechanism of toxic action specifically induced by butylaldehyde.

Description

부틸알데히드 특이적 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법{Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame}Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame}

본 발명은 부틸알데히드(Butylaldehyde) 특이적 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 더욱 상세하게는 부틸알데히드에 의해 특이적으로 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 부틸알데히드 특이적 노출 여부를 확인하는 방법에 관한 것이다.
The present invention relates to a biomarker for confirming the butylaldehyde-specific exposure and a method of identifying the same, and more particularly, to a biomarker that specifically increases or decreases gene expression by butylaldehyde and butylaldehyde using the same. The present invention relates to a method for confirming specific exposure.

부틸알데히드는 고무 및 플라스틱 가소제, 고무 촉진제, 용제 및 고분자(high polymers) 제조에 의해 각종 폐기물 스트림을 통해, 또는 디젤, 가솔린 등의 연소, 석유 정제를 통해 환경 중에 노출되며, 이 외에도 미생물 대사의 부사 산물로서도 환경 중에 배출되는 것으로 알려져 있다. 부틸알데히드는 인체 후각을 자극하여 불쾌감 및 혐오감을 주는 냄새 때문에, 2005년 국내 악취방지법에 지정된 악취물질로서, 공업지역 0.1 ppm 이하, 기타지역 0.029 ppm 이하로 배출허용 기준을 0.029 ~ 0.1 ppm으로 환경 중 배출 허용기준이 설정되었다. 2008년 보고에 따르면 부틸알데히드는 국내 일반 대기 중 평균 13.0 ppb 농도로 노출되는 것으로 보고되었다(Pal R., et al., Journal of Hazardous Materials 153(3):1122-1135, 2008). Butylaldehyde is exposed to the environment through the manufacture of rubber and plastic plasticizers, rubber accelerators, solvents and high polymers through various waste streams or through combustion and petroleum refining of diesel and gasoline. It is also known to be released into the environment as a product. Butylaldehyde is a malodorous substance specified by the National Odor Prevention Act of 2005 due to the smell of discomfort and aversion by stimulating the sense of smell of human body, and it is less than 0.1 ppm in industrial area and 0.029 ppm or less in other areas. Emission limits have been established. In 2008, butylaldehyde was reported to be exposed to an average concentration of 13.0 ppb in the domestic general atmosphere (Pal R., et al., Journal of Hazardous Materials 153 (3): 1122-1135, 2008).

부틸알데히드는 대부분 대기를 통한 흡입, 음식 및 음용수 섭취, 부틸알데히드를 함유하는 제품 피부 접촉에 의해 인체에 노출된다. 부틸알데히드는 호흡기의 상부기도 및 점막은 물론 눈과 피부 조직에 영향을 미치는 것으로 보고되고 있다. 특히, 부틸알데히드는 인체 호흡기를 통한 흡입을 통해 후두 및 기관지의 염증(inflammation) 유발, 화학물질에 의한 폐렴(chemical pneumonia)과 폐부종 등 인체 미치는 영향 큰 것으로 보고되고 있다(Bingham, E.; Cohrssen, B.; Powell, C.H.; Patty's Toxicology Volumes 1-9 5th ed. John Wiley & Sons. New York, N.Y. (2001). p. V5:978). 노출농도가 높은 경우 기침, 천명(wheezing), 후두염, 호흡, 두통, 메스꺼움, 구토 등의 증상을 유발하는 것으로 보고되었다.Butylaldehyde is most often exposed to the human body by inhalation through the air, ingestion of food and drinking water, and skin contact of products containing butylaldehyde. Butylaldehyde has been reported to affect the upper respiratory tract and mucous membranes of the respiratory tract, as well as eye and skin tissues. In particular, butylaldehyde has been reported to have a great effect on the human body, such as inflammation of the larynx and bronchus through inhalation through the human respiratory tract, chemical pneumonia and pulmonary edema caused by chemicals (Bingham, E .; Cohrssen, B .; Powell, CH; Patty's Toxicology Volumes 1-9 5th ed.John Wiley & Sons.New York, NY (2001) .p. V5: 978). High exposure levels have been reported to cause symptoms such as coughing, wheezing, laryngitis, breathing, headache, nausea and vomiting.

혈류를 타고 흐르는 휘발성 유기화합물은 폐포막의 확산현상에 의해 폐에 영향을 미치게 되며, 헥산(hexane), 메틸펜탄(methylpentan), 이소프로펜(isopropene), 벤젠(benzene) 등은 질환의 마커로 사용되고 있으며(J Vet Sci 5(1):11-18, 2004), 최근 날숨 테스트(exhaled breath analysis)를 통해 포집된 물질의 휘발성 유기화합물류 분석 결과로부터 간단한 폐암 진단법이 개발되어 이용되고 있다. 휘발성 유기화합물류 중 알데히드류(Aldehydes)는 폐암질환자들에게 나타나는 대표적 물질로 보고되고 있다(J Chromatogr B Analyt Technol Biomed Life Sci. 878(27):2643-2651, 2010). 따라서, 부틸알데히드 등의 알데히드류 특이적 바이오마커 발굴은 폐질환 및 부틸알데히드의 환경 중 노출을 스크리닝하는데 활용될 수 있다. The volatile organic compounds that flow in the blood flow affect the lungs by diffusion of the alveolar membrane. Hexane, methylpentan, isopropene, and benzene are used as markers of the disease And ( J Vet Sci 5 (1): 11-18, 2004). Recently, a simple lung cancer diagnosis method has been developed and used from the results of analysis of volatile organic compounds of recently collected substances through exhaled breath analysis. Aldehydes in volatile organic compounds have been reported as a representative substance in lung cancer patients ( J Chromatogr B Analyt Technol Biomed Life Sci . 878 (27): 2643-2651, 2010). Therefore, aldehyde specific biomarker discovery, such as butylaldehyde, can be utilized to screen lung exposure and environmental exposure of butylaldehyde.

부틸알데히드의 인간에 대한 위해성에도 불구하고 인체에서의 위해도 평가 데이터가 충분하지 않고, 노출에 대한 검색 방법 역시 GC-MS(Gas Chromatography-Mass Spectrometer) 또는 HPLC(High Performance Liquid Chromatography) 등의 고전적인 방법에 국한되어 있다. GC-MS 또는 HPLC 방법 등을 이용하면 정량은 가능하나 분석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 보다 빠르고 간편한 스크리닝(screening) 방법, 예를 들면 프라이머(primer)를 이용하는 실시간(real-time) PCR(Real-time reverse transcript polymerase chain reaction) 또는 DNA 마이크로어레이 칩 등으로 신속한 위해성 평가를 통해 인체에서의 독성작용, 유전자 발현 여부 등을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 부틸알데히드의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다.
Despite the risk of butylaldehyde to humans, there is not enough risk assessment data in humans, and the detection method for exposure is also classical, such as Gas Chromatography-Mass Spectrometer (GC-MS) or High Performance Liquid Chromatography (HPLC). It is confined to the method. Quantification is possible using GC-MS or HPLC method, but appropriate conditions for analysis are required and expensive equipment is required. Therefore, faster and easier screening methods, such as real-time reverse transcript polymerase chain reaction (PCR) or DNA microarray chips using primers, can be used in humans through rapid risk assessment. It is an important task to discover and utilize molecular indicators that can detect toxic effects and gene expression, and to take appropriate measures and control against butylaldehyde exposure.

포유류 6종, 미생물 292종 등 여러 종의 게놈(genome) 염기서열 프로젝트가 완성되어 NCBI(National Center for Biotechnology Information)에 보고되었다. 이렇게 얻어진 막대한 양의 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 한 번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 DNA 마이크로어레이(microarray) 분석을 수행한다(Proc . Natl . Acad . Sci . USA 93:10614-10619, 1996).
The genome sequencing project of several species, including 6 mammals and 292 microbes, has been completed and reported in the National Center for Biotechnology Information (NCBI). Genome-wide expression studies have been conducted to study the function of genes based on the vast amount of data thus obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment ( Proc . Natl . Acad . Sci . USA 93: 10614-10619,1996).

마이크로어레이는 cDNA(complementary DNA)나 20 - 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 Agilent, Genomic Solutions 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(J. Am . Acad . Dermatol. 51:681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 Affymetrix사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어지고 있으며, Agillent사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(J. Am . Acad . Dermatol. 51:681-692, 2004).
A microarray is a collection of cDNA (complementary DNA) or a set of oligonucleotides of 20-25 base pairs in length on glass. cDNA microarrays are produced either by in-house laboratories or by companies such as Agilent, Genomic Solutions, etc., by mechanically immobilizing cDNA collections onto chips or by using ink jetting ( J. Am . Acad . Dermatol . 51: 681 -692, 2004). The oligonucleotide microarray is prepared by a direct synthesis method on a chip using photolithography in Affymetrix, and the oligonucleotide is produced by a method of immobilizing a synthesized oligonucleotide in Agillent ( J. Am . Acad Dermatol 51: 681-692, 2004).

유전자의 발현을 분석을 위해서는 조직, 세포 등 시료에서 RNA를 얻어 DNA 마이크로어레이에 있는 올리고뉴클레오티드와 교잡반응을 수행한다. 얻어진 RNA는 형광이나 동위원소로 표지화하며 cDNA로 전환시킨다. 올리고 마이크로어레이는 주로 두 개의 다른 형광(예: Cye3 및 Cye5)으로 대조군과 실험군을 각각 표지화하여 같은 칩 상에서 동시에 교잡 반응을 수행한 후 광학적으로 이미지를 스캔하여 형광의 세기를 얻고 그 결과를 분석한다. 두 개의 형광 세기의 비율에 따라 유전자의 발현 여부를 결정한다(Genomics Proteomics I:1-10, 2002). 최근 DNA 마이크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신의약 후보물질은 물론 대표적인 환경오염물질을 비롯한 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 유전자들의 발현 패턴의 분석, 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 유전자의 발현 빈도를 분석함으로써 약물의 부작용 및 환경오염물질의 유해작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 환경오염물질의 유해작용과 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색 및 확인할 수 있게 될 것이다.
In order to analyze the expression of the gene, RNA is obtained from a sample such as a tissue or a cell, and an oligonucleotide is hybridized with the oligonucleotide in the DNA microarray. The resulting RNA is labeled with fluorescence or isotopes and converted to cDNA. The oligo microarray is mainly labeled with two different fluorescences (eg, Cye3 and Cye5), and the control and experimental groups are labeled, and the hybridization reaction is performed simultaneously on the same chip. The fluorescence intensity is obtained by optically scanning the image and the result is analyzed . The ratio of the two fluorescence intensities determines the expression of the gene ( Genomics Proteomics I: 1-10, 2002). Recently, it has been applied to toxic genomics research which is a cutting-edge technique using DNA microarray technology, and it can be expressed in a large amount (high throughput) in a specific tissue or cell line due to all chemical substances, including representative drug candidates, And the quantitative analysis of the expression patterns of the genes. Thus, by analyzing the frequency of expression of a specific gene in a specific cell, it is possible to identify a gene related with adverse effects of drugs and harmful effects of environmental pollutants, and thereby, harmful effects of environmental pollutants, And will be able to search for and identify substances that cause toxicity and side effects.

이에 본 발명자들은 인간 유전자 4만 2천여 개가 집적된 올리고마이크로어레이를 이용하여 부틸알데히드의 유전자 발현 프로파일을 인간 폐암조직 유래 세포인 A549 세포주에서 관찰 및 분석하여 환경 중 부틸알데히드에 의해서만 특이적으로 과발현 혹은 저발현되는 유전자를 발굴하여 부틸알데히드만을 특이적으로 검출할 수 있는 바이오마커 및 이를 이용한 노출 여부를 확인하는 방법을 확립하여 본 발명을 완성하였다.
Therefore, the present inventors observed and analyzed the gene expression profile of butylaldehyde in human lung cancer tissue-derived A549 cell line using oligomicroarray in which 42,000 human genes were accumulated, and specifically overexpressed or only by butylaldehyde in the environment. The present invention has been completed by establishing a biomarker capable of specifically detecting butylaldehyde and detecting exposure using the same by discovering a low-expressing gene.

본 발명의 목적은 부틸알데히드(Butylaldehyde)의 노출에 의해 특이적으로 과발현 또는 저발현되는 바이오마커 및 상기 바이오마커를 이용한 부틸알데히드 특이적 노출 여부를 확인하는 방법을 제공하는 것이다.
An object of the present invention is to provide a biomarker that is specifically overexpressed or low expressed by exposure of butylaldehyde and a method for identifying butylaldehyde specific exposure using the biomarker.

상기 목적을 달성하기 위하여, 본 발명은 부틸알데히드(Butylaldehyde)의 노출에 의해 특이적으로 발현 변화를 일으키는 부틸알데히드 특이적 노출 여부 확인용 바이오마커를 제공한다. In order to achieve the above object, the present invention provides a biomarker for confirming whether or not butylaldehyde-specific exposure that specifically changes the expression by exposure of butylaldehyde (Butylaldehyde).

또한, 본 발명은 하기 유전자의 핵산 서열 또는 그 상보 가닥 분자가 집적된 부틸알데히드 특이적 노출 여부 확인용 DNA 마이크로어레이칩을 제공한다:The present invention also provides a DNA microarray chip for confirming whether butylaldehyde-specific exposure is integrated with a nucleic acid sequence of the following gene or its complementary strand molecule:

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

또한, 본 발명은,Further, according to the present invention,

1) 부틸알데히드 노출이 의심되는 실험군 및 정상 대조군의 체세포에서 각각의 RNA를 분리하는 단계;1) separating each RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

2) 단계 1)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;2) labeling the experimental group and the control group with different fluorescent substances while synthesizing the RNA of the experimental group and the control group of step 1) with cDNA;

3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 본 발명의 DNA 마이크로어레이칩과 혼성화시키는 단계;3) hybridizing the cDNA labeled with different fluorescent substances of step 2) with the DNA microarray chip of the present invention;

4) 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및4) analyzing the reacted DNA microarray chip; And

5) 분석한 데이터에서 본 발명의 DNA 마이크로어레이칩에 직접된 유전자의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 부틸알데히드에 대한 노출 여부를 확인하는 방법을 제공한다.5) Provides a method for confirming the exposure to butylaldehyde comprising the step of confirming the expression level of the gene directly on the DNA microarray chip of the present invention in the analyzed data compared to the control.

또한, 본 발명은,Further, according to the present invention,

1) 부틸알데히드 노출이 의심되는 실험군 및 정상 대조군의 체세포에서 각각의 RNA을 분리하는 단계;1) separating each RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

2) 상기 RNA를 하기 유전자에 상보적이고 하기 유전자를 증폭할 수 있는 프라이머쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계:2) Real-time reverse transcript polymerase chain reaction (RT-PCR) using primer pairs complementary to the following genes and capable of amplifying the following genes:

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2); 및Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2); And

3) 단계 2)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계를 포함하는 부틸알데히드에 대한 노출 여부를 확인하는 방법을 제공한다.3) comparing the gene product of step 2) to the control to provide a method for confirming the exposure to butylaldehyde comprising the step of confirming the expression level.

또한, 본 발명은 본 발명의 DNA 마이크로어레이 칩을 포함하는 부틸알데히드에 대한 노출 여부 확인용 키트를 제공한다.In addition, the present invention provides a kit for confirming exposure to butylaldehyde including the DNA microarray chip of the present invention.

아울러, 본 발명은 하기 유전자에 상보적이고 하기 유전자를 증폭할 수 있는 프라이머 쌍을 포함하는 부틸알데히드에 대한 노출 여부 확인용 키트를 제공한다:In addition, the present invention provides a kit for confirming exposure to butylaldehyde comprising a primer pair capable of amplifying the following genes and complementary to the following genes:

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

본 발명의 부틸알데히드(Butylaldehyde) 특이적 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법은 DNA 마이크로어레이 칩을 통하여 선별된 반응 유전자를 바이오마커로 이용하여 부틸알데히드의 모니터링 및 위해성을 판정하는데 유용하며, 부틸알데히드에 의해 야기되는 특이적인 독성 작용 기작을 규명하는 도구로 유용하게 이용할 수 있다.
Butylaldehyde (Butylaldehyde) specific exposure of the biomarker of the present invention and the identification method using the same is useful for determining the butylaldehyde monitoring and risk by using the reaction gene selected through the DNA microarray chip as a biomarker, It can be usefully used as a tool for identifying specific mechanisms of toxic effects caused by butylaldehyde.

도 1은 부틸알데히드(Butylaldehyde)의 인간 폐암조직 유래 세포주에서의 세포 독성 결과를 나타낸 도이다.
도 2는 마이크로어레이 칩을 이용한 부틸알데히드를 처리한 인간 폐암조직 유래 세포주의 유전자 발현 양상을 분석한 결과를 나타내는 도이다:
가운데 선(M=0)은 R(시험군 형광 세기 값) = G(대조군 형광 세기 값) 선을 표시한다;
M=1인 경우 G(대조군 형광 세기 값)값 보다 R(시험군 형광 세기 값)값이 1.5배 높은 값을 가진 프로브(probes) 들이 분포하고 있는 것을 나타내며, 그 이상의 점(spots)은 1.5배 이상 높은 신호 강도(signal intensity) 값을 가진 프로브들의 분포를 나타낸다.
도 3은 부틸알데히드 노출에 의해서만 발현이 증가 혹은 감소하는 유전자를 선별하기 위하여, 프로피온알데히드(Propionaldehyde), 발러알데히드(Valeradehyde), 헥사날(Hexanal), 헵타날(Heptanal), 옥타날(Octanal)과 유전자발현을 비교 분석한 도이다.
1 is a diagram showing the cytotoxicity results of butylaldehyde (Butylaldehyde) in human lung cancer tissue-derived cell line.
Figure 2 is a diagram showing the results of analyzing the gene expression patterns of human lung cancer tissue-derived cell line treated with butylaldehyde using a microarray chip:
Middle line (M = 0) denotes R (test group fluorescence intensity value) = G (control fluorescence intensity value) line;
In case of M = 1, it indicates that the probes with the value of R (test group fluorescence intensity value) is 1.5 times higher than G (control fluorescence intensity value) value, and the spots more than 1.5 times This shows the distribution of probes with higher signal intensity values.
FIG. 3 shows propionaldehyde, valeradehyde, hexanal, heptanal, octanal and octanal in order to select genes whose expression is increased or decreased only by butylaldehyde exposure. This is a comparative analysis of gene expression.

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 부틸알데히드의 노출에 의해 특이적으로 발현 변화를 일으키는 부틸알데히드(Butylaldehyde) 특이적 노출 여부 확인용 바이오마커를 제공한다.The present invention provides a biomarker for confirming whether or not butylaldehyde (Butylaldehyde) specific exposure causing a specific expression change by exposure of butylaldehyde.

상기 바이오마커는 1.5배 이상 발현이 증가 또는 감소한 유전자로써, 부틸알데히드에 의해서만 특이적으로 발현이 변화하는 1종의 유전자로 구성되어 있다.The biomarker is a gene whose expression is increased or decreased 1.5 times or more, and is composed of one gene whose expression is changed only by butylaldehyde.

상기 부틸알데히드 노출 정도에 따라 특이적으로 발현 변화를 나타내는 바이오마커는 하기 유전자인 것이 바람직하나, 이에 한정되지 않는다:According to the butylaldehyde exposure degree, a biomarker that specifically expresses a change in expression is preferably the following gene, but is not limited thereto:

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

본 발명의 구체적인 실시예에서, 본 발명자들은 부틸알데히드 특이적 노출 여부 확인용 바이오마커를 발굴하기 위하여, 부틸알데히드를 인간 폐암조직 유래 세포인 A549 세포주에 처리하여 세포 독성을 확인하였다. 그 결과, 상기 부틸알데히드는 인간 폐암조직 유래 세포주에 독성을 가짐이 확인되었고(도 1 참조), 상기 실험을 바탕으로 부틸알데히드의 농도를 결정하였다. 이후 상기 결정된 농도로 부틸알데히드를 인간 폐암조직 유래 세포주에 처리하고, 상기 물질을 처리한 세포주에서 mRNA를 분리하여 cDNA를 합성하면서 형광물질(Cy5)로 표지하였으며, 상기 물질을 처리하지 않은 대조군의 경우 Cy3로 표지하였다. 상기 형광표지된 cDNA를 8 × 60k 올리고마이크로어레이 칩 Human whole genome oligo microarray(Agilent, 미국)와 혼성화하였고, 형광 이미지를 스캔하여 유전자 발현 양상의 차이를 분석하였다(도 2 참조). 분석시 Cy5/Cy3 비율이 1.5배 이상인 경우 발현 증가된 유전자로 분류하였고, 0.66배 이하인 경우 발현 감소된 유전자로 분류하였다. 분석 결과, 발현 증가된 유전자는 4.23%(42,405개의 유전자 중 1,793개) 발현이 감소된 유전자는 7.25%(42,405개의 유전자 중 3,076개)임을 확인하였다. 발현 변화를 나타내는 유전자들의 생물학적 기능 분류 중 마이토젠 유도 단백질 키나제 케스케이드(mitogen activated protein kinase(MAPK) Cascade) 에 속하는 유전자 1종을 선별하였으며, 실시간 정량 PCR을 이용하여 부틸알데히드 외의 5종의 알데히드류(프로피온알데히드, 발러알데히드, 헥사날, 헵타날, 옥타날) 노출에 의해 부틸알데히드에서만 특이적으로 발현이 변한(증가 또는 감소) 유전자 1종을 선별하였다(도 3, 표3 및 표 4 참조). 상기 유전자는 기존의 다른 연구들에서 다른 화학물질들에 의한 폐 독성과 관련 질병을 유발시키는데 관여한다는 보고는 있으나 본 발명에서 사용한 부틸알데히드를 처리했을 때, 인간 폐암조직 유래 세포에서 독성과 관련이 있다는 보고는 없다.
In a specific embodiment of the present invention, the present inventors confirmed the cytotoxicity by treating butylaldehyde to human lung cancer tissue-derived A549 cell line in order to discover a butylaldehyde-specific exposure biomarker. As a result, the butylaldehyde was confirmed to be toxic to human lung cancer tissue-derived cell line (see Fig. 1), the concentration of butylaldehyde was determined based on the experiment. Then, butylaldehyde was treated to human lung cancer tissue-derived cell line at the determined concentration, mRNA was isolated from the cell line treated with the substance, and labeled with fluorescent substance (Cy5) while synthesizing cDNA. Labeled with Cy3. The fluorescently-labeled cDNA was hybridized with a human whole genome oligo microarray (Agilent, USA) of 8 × 60 k oligo microarray chip, and fluorescence images were scanned for differences in gene expression patterns (see FIG. 2). When the ratio of Cy5 / Cy3 was 1.5 times or more, it was classified as an increased expression gene. When the Cy5 / Cy3 ratio was 0.66 or less, it was classified as a decreased expression gene. As a result, it was confirmed that the increased expression of the gene was 4.23% (1,793 of 42,405 genes) and the decreased expression of the gene was 7.25% (3,076 of 42,405 genes). One of the genes belonging to the mitogen activated protein kinase (MAPK) Cascade was selected from the classification of biological functions of genes expressing expression changes, and five kinds of aldehydes other than butylaldehyde ( Proionaldehyde, baleraldehyde, hexanal, heptanol, octanal) exposure was selected for one gene whose expression was specifically changed (increased or decreased) only in butylaldehyde (see Figure 3, Table 3 and Table 4). Although the gene has been reported to be involved in causing lung toxicity and other diseases caused by other chemicals in previous studies, it is associated with toxicity in human lung cancer tissue-derived cells when treated with butylaldehyde used in the present invention. There is no report.

또한, 본 발명은 하기 유전자의 핵산 서열 또는 그 상보 가닥 분자가 집적된 부틸알데히드 특이적 노출 여부 확인용 DNA 마이크로어레이 칩을 제공한다:The present invention also provides a DNA microarray chip for confirming whether butylaldehyde-specific exposure is integrated with a nucleic acid sequence of the following gene or a complementary strand molecule thereof.

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

본 발명의 부틸알데히드 검색용 DNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 상기 탐색된 바이오마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로피펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 핀 형태의 스폿터인 마이크로어레이를 이용하였다. 상기 DNA 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이 바람직하나 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나 이에 제한되는 것은 아니며, 본 발명의 바람직한 실시예에서는 아미노-실란이 코팅된 슬라이드 글래스를 이용하였다.
The butylaldehyde DNA microarray chip of the present invention can be produced by a method known to those skilled in the art. A method of fabricating the microarray chip is as follows. A micropipetting method using a piezo electric method or a pin-type spotter for immobilizing the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, But the present invention is not limited thereto. In a preferred embodiment of the present invention, a micro array, which is a pin-shaped spotter, is used. The substrate of the DNA microarray chip is preferably coated with one activator selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde, But is not limited thereto. The substrate may be selected from the group consisting of a slide glass, a plastic, a metal, a silicon, a nylon film, and a nitrocellulose membrane, but the present invention is not limited thereto. In a preferred embodiment of the present invention, Coated slide glass was used.

또한, 본 발명은 본 발명의 바이오마커를 이용한 부틸알데히드 특이적 노출 여부를 확인하는 방법을 제공한다.In addition, the present invention provides a method for determining whether butylaldehyde-specific exposure using the biomarker of the present invention.

본 발명은 하기와 같은 과정을 포함하는 부틸알데히드 특이적 노출 여부를 확인하는 방법을 제공한다: The present invention provides a method for determining whether butylaldehyde specific exposure comprising the following steps:

1) 부틸알데히드 노출이 의심되는 실험군 및 정상 대조군의 체세포에서 RNA를 분리하는 단계;1) separating RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

2) 단계 1)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;2) labeling the experimental group and the control group with different fluorescent substances while synthesizing the RNA of the experimental group and the control group of step 1) with cDNA;

3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 본 발명의 DNA 마이크로어레이칩과 혼성화시키는 단계;3) hybridizing the cDNA labeled with different fluorescent substances of step 2) with the DNA microarray chip of the present invention;

4) 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및4) analyzing the reacted DNA microarray chip; And

5) 분석한 데이터에서 본 발명의 유전자의 발현 정도를 대조군과 비교하여 확인하는 단계.5) confirming the expression level of the gene of the present invention in the analyzed data compared to the control.

상기 노출 여부를 확인하는 방법에 있어서, 단계 1)의 체세포는 인간 폐암조직 유래 세포인 A549 세포주를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간 폐세포 또는 인간 폐암세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.In the method for confirming the exposure, the somatic cell of step 1) is preferably a human lung cancer tissue-derived cell A549 cell line, but is not limited to this, if the cells derived from human lung cells or human lung cancer cells and tissues All are available.

상기 노출 여부를 확인하는 방법에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되어지는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다.Wherein the fluorescent material of step 3) is selected from the group consisting of Cy3, Cy5, FITC (poly L-lysine-fluorescein isothiocyanate), RITC (rhodamine-B-isothiocyanate) and rhodamine But it is not limited thereto, and fluorescent materials known to those skilled in the art are all usable.

상기 노출 여부를 확인하는 방법에 있어서, 단계 4)의 DNA 마이크로어레이 칩은 Whole Human Genome Oligo Microarray(Agilent, 미국)등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간 게놈 중 본 발명에서 상기 과발현 혹은 저발현 유전자(표 4)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, 상기 본 발명자가 제작한 DNA 마이크로어레이 칩을 사용하는 것이 가장 바람직하다. 또한, 단계 4)의 분석 방법은 Agilent Feature Extraction 10.7.3.1(Agilent technologies, CA, 미국), Agilent GeneSpring GX 11.5.1(Agilent technologies, CA, 미국)를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.
In the method for confirming the exposure, the DNA microarray chip of step 4) is preferably used, such as Whole Human Genome Oligo Microarray (Agilent, USA), but is not limited thereto, the overexpression of the human genome in the present invention Alternatively, any microarray chip loaded with a low expression gene (Table 4) can be used, and it is most preferable to use a DNA microarray chip produced by the present inventor. It is preferable to use Agilent Feature Extraction 10.7.3.1 (Agilent technologies, CA, USA) or Agilent GeneSpring GX 11.5.1 (Agilent technologies, CA, USA) for the analysis method of step 4) Analytical software known to those skilled in the art may be used.

또한, 본 발명은,Further, according to the present invention,

1) 부틸알데히드 노출이 의심되는 실험군 및 정상 대조군의 체세포에서 각각 RNA를 분리하는 단계;1) separating RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

1) 상기 RNA를 하기 유전자에 상보적이고 하기 유전자를 증폭할 수 있는 프라이머쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계:1) real-time reverse transcript polymerase chain reaction (RT-PCR) using a pair of primers complementary to the following genes and capable of amplifying the following genes:

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2); 및Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2); And

3) 단계 2)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계를 포함하는 부틸알데히드에 대한 노출 여부 확인방법을 제공한다.3) provides a method of confirming the exposure to butylaldehyde comprising the step of comparing the gene product of step 2) with the control to confirm the expression level.

상기 단계 2)의 프라이머 쌍은 단계 2)의 유전자를 증폭할 수 있는, 18 내지 30머 길이의 정방향 및 역방향 프라이머 쌍인 것이 바람직하고, 하기 프라이머 쌍 1인 것이 보다 바람직하나 이에 한정되지 않는다:Preferably, the primer pair of step 2) is a forward and reverse primer pair of 18 to 30mer length, capable of amplifying the gene of step 2), and more preferably, but not limited to the following primer pair 1.

프라이머 쌍 1: 서열번호 1로 기재되는 정방향 프라이머 및 서열번호 2로 기재되는 역방향 프라이머.Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.

따라서, 본 발명의 바이오마커는 부틸알데히드에 특이적으로 유전자 발현이 증가 또는 감소되므로, 환경시료에서 부틸알데히드의 오염을 모니터링 및 판정하는데 유용하게 사용될 수 있다.
Therefore, the biomarker of the present invention can be usefully used for monitoring and determining contamination of butylaldehyde in environmental samples, since the gene expression is increased or decreased specifically for butylaldehyde.

또한, 본 발명은 본 발명에서 제작한 DNA 마이크로어레이 칩을 포함하는 부틸알데히드 특이적 노출 여부 확인용 키트를 제공한다. In addition, the present invention provides a kit for confirming whether the butylaldehyde-specific exposure comprising the DNA microarray chip produced in the present invention.

상기 키트는 추가적으로 인간 체세포를 포함하는 것이 바람직하나 이에 한정되지 않는다.The kit preferably further comprises human somatic cells, but is not limited thereto.

상기 인간 체세포는 A549인 것이 바람직하나 이에 한정되는 것은 아니며, 인간 폐세포 또는 인간 폐암세포 및 조직에서 유래한 세포라면 모두 사용 가능하다. The human somatic cell is preferably A549, but is not limited thereto. Any cell derived from human lung cells or human lung cancer cells and tissues can be used.

상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시 예에서는 Cy3와 Cy5를 사용하였다. The kit may further comprise a fluorescent material, wherein the fluorescent material is selected from the group consisting of a strepavidin-like phosphatease conjugate, a chemiluminescent substance, and a chemiluminescent substance But it is not limited thereto. In a preferred embodiment of the present invention, Cy3 and Cy5 are used.

상기 키트에 추가적으로 반응 시약을 포함시킬 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 DNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함시킬 수 있다.The reaction reagent may further include a buffer solution used for hybridization, a reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (pre-mixed or separate feed type), a chemical inducer for fluorescent dye And a washing buffer solution. However, the present invention is not limited thereto. Any reaction reagent necessary for hybridization reaction of a DNA microarray chip known to a person skilled in the art can be included.

본 발명의 바이오마커는 부틸알데히드에 특이적으로 유전자 발현이 증가 또는 감소되므로, 환경시료에서 부틸알데히드의 오염을 모니터링 및 판정하는데 유용하게 사용될 수 있으며, 부틸알데히드에 의해 특이적으로 유발되는 독성 작용 기작을 규명하는 도구로 이용될 수 있다.
Since the biomarker of the present invention increases or decreases gene expression specifically for butylaldehyde, it can be usefully used for monitoring and determining the contamination of butylaldehyde in environmental samples, and the toxic action mechanisms specifically induced by butylaldehyde. It can be used as a tool to identify.

또한, 본 발명은,Further, according to the present invention,

하기 유전자에 상보적이고, 하기 유전자를 증폭할 수 있는 프라이머 쌍을 포함하는 부틸알데히드에 대한 노출 여부 확인용 키트를 제공한다:Provided are kits for confirming exposure to butylaldehyde, comprising primer pairs complementary to the following genes and capable of amplifying the following genes:

유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

상기 확인용 키트의 프라이머 쌍은 하기 프라이머 쌍 1인 것이 바람직하나 이에 한정되는 것은 아니며, 상기 바이오마커 유전자의 증폭 산물이 100 내지 300 bp가 되도록 설계된 15 내지 50머 길이, 바람직하게는 15 내지 30머의 길의, 더욱 바람직하게는 18 내지 25머의 길이의 정방향 및 역방향 프라이머 쌍은 모두 사용 가능하다:Preferably, the primer pair of the identification kit is the following primer pair 1, but is not limited thereto, and is 15 to 50 mer long, preferably 15 to 30 mer designed to have an amplification product of the biomarker gene 100 to 300 bp. Both forward and reverse primer pairs of the length of, more preferably 18-25 mer in length, are available:

프라이머 쌍 1: 서열번호 1로 기재되는 정방향 프라이머 및 서열번호 2로 기재되는 역방향 프라이머.Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.

상기 확인용 키트에 추가적으로 인간 체세포를 포함하는 것이 바람직하나 이에 한정되지 않는다.In addition to the above-mentioned confirmation kit, it is preferable to include human somatic cells but not limited thereto.

상기 인간 체세포는 인간 폐암조직 유래 세포인 A549 세포주를 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 인간 폐세포 또는 인간 폐암세포 및 조직에서 유래한 세포라면 모두 사용 가능하다.The human somatic cell is preferably an A549 cell line, which is a cell derived from human lung cancer tissue, but not limited thereto, and any cell derived from human lung cells or human lung cancer cells and tissues can be used.

아울러, 상기 키트에 추가적으로 반응 시약을 포함할 수 있으며, 상기 반응 시약은 RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 RT-PCR 반응에 필요한 반응 시약은 모두 포함할 수 있다.
In addition, the kit may further comprise a reaction reagent, and the reaction reagent may be a labeling reagent such as reverse transcriptase, cNTPs and rNTP (pre-mixed or separate feed type) for synthesizing cDNA from RNA, chemical inducer of fluorescent dye, Washing buffer solution, and the like, but not limited thereto, and may include all reaction reagents necessary for RT-PCR reaction known to those skilled in the art.

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail with reference to examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.
However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

<< 실시예Example 1> 세포 배양 및 화학물질 처리 1> Cell culture and chemical treatment

<1-1> 세포배양<1-1> Cell culture

인간 폐암조직 유래 세포주인 A549 세포(한국 세포주 은행)를 10% FBS가 첨가된 RPMI 배지(Gibro-BRL, 미국)를 이용하여 100 ㎜ 디쉬(dish)에서 80% 정도 자랄 때까지 배양하였다. 본 발명자들은 기존의 연구와 보고를 통해 환경 중 노출되는 휘발성 유기화합물 중 알데하이드류의 하나인 부틸알데히드(Prorionaldehyde)를 선정하였으며, DMSO(Dimethyl sulfoxide)에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.
A549 cells (Korean Cell Line Bank), a human lung cancer tissue-derived cell line, were cultured in a 100 mm dish using 80% FBS-supplemented RPMI medium (Gibro-BRL, USA) until it grew to about 80%. The present inventors have selected butylaldehyde (Prorionaldehyde) which is one of the aldehydes among the volatile organic compounds exposed to the environment through existing research and reports, and dissolved in dimethyl sulfoxide (DMSO). The vehicle concentration was less than 0.1% in all experiments.

<1-2> 세포 독성 실험(<1-2> Cytotoxicity Test MTTMTT assayassay ) 및 화학 물질 처리) And chemical treatment

Mossman 등(J. Immunol . Methods, 65, 55-63, 1983)의 방법으로 A549 세포주를 이용한 MTT 실험을 수행하였다. MTT experiment using the A549 cell line was performed by the method of Mossman et al . ( J. Immunol . Methods , 65, 55-63, 1983).

구체적으로, 세포는 24-웰 플레이트에 3.5 × 104/웰 세포수로 RPMI 배지(Gibro-BRL, 미국)에서 DMSO에 용해된 부틸알데히드를 처리하고 48시간 후에 MTT(3-4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3 시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해한 후, 96-웰 플레이트로 옮겨 분주(aliquot)하고 흡광도 540 nm에서 O.D.값을 측정하였다.Specifically, cells were treated with butylaldehyde dissolved in DMSO in RPMI medium (Gibro-BRL, USA) at 3.5 × 10 4 / well cell number in 24-well plates, and after 48 hours, MTT (3-4,5-dimethylthiazol 5 mg / ml of -2,5-diphenyltetra zolium bromide) was added to the tube and incubated at 37 ° C. for 3 hours. After the medium was removed, the formed formazan crystal was dissolved in 500 μl of DMSO, transferred to a 96-well plate, aliquoted, and the OD value was measured at an absorbance of 540 nm.

그 결과, 도 1에 나타낸 바와 같이 A549 세포주에서 부틸알데히드의 세포독성을 살펴본 결과, 20% 생존율을 보이는 농도(IC20)는 4.6 mM 이었으며, 상기 결과를 바탕으로 하기 마이크로어레이 실험을 수행하였다(도 1).
As a result, as shown in FIG. 1, as a result of examining the cytotoxicity of butylaldehyde in the A549 cell line, a concentration (IC 20 ) showing 20% survival rate was 4.6 mM, and the following microarray experiment was performed based on the results (FIG. One).

<< 실시예Example 2>  2> 마이크로어레이Microarray 실험 Experiment

<2-1> 표적 <2-1> Target RNARNA 의 분리 및 형광 물질 표지Separation of fluorescent material and labeling

25 × 104 cell/㎖ 농도로 6-웰 플레이트에 A549 세포를 분주한 후, 상기 실시예 <1-2>에서 결정한 부틸알데히드의 농도를 48 시간 동안 처리하였다. 이후, 상기 처리한 세포에서 트리졸(trizol) 시약(Invitrogen life technologies, 미국)을 사용하여 제조사의 방법대로 전체 RNA를 분리하고, RNeasy mini kit(Qiagen, 미국)를 사용하여 정제하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase set(Qiagen, 미국)를 사용하여 제거하였다. 각 전체 RNA 시료의 양은 분광광도계로 측정하였고, 농도는 ND-1000 Spectrophotometer(Thermo Fisher Scientific Inc., 미국)와 Agilent 2100 Bioanalyzer(Agilent)로 확인하였다.
After dispensing A549 cells in 6-well plates at a concentration of 25 × 10 4 cells / ml, the concentration of butylaldehyde determined in Example <1-2> was treated for 48 hours. Subsequently, total RNA was isolated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using an RNeasy mini kit (Qiagen, USA). Genomic DNA was removed during RNA purification using an RNase-free DNase set (Qiagen, USA). The amount of each total RNA sample was measured by spectrophotometer, the concentration was confirmed by ND-1000 Spectrophotometer (Thermo Fisher Scientific Inc., USA) and Agilent 2100 Bioanalyzer (Agilent).

<2-2> <2-2> 표지된Labeled cDNAcDNA 제조  Produce

올리고 마이크로어레이 분석을 위하여 상기 실시예 <2-1>에서 수득한 부틸알데히드 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. 상기 수득한 전체 RNA 30 ㎍과 올리고(dT) 프라이머 2 ㎍(1 ㎍/㎕)과 혼합하고 65℃에서 10분간 반응시킨 후 바로 얼음에 넣어 어닐링(annealing)시켰다. 상기 어닐링된 RNA의 역전사(Reverse Transcript) 반응을 위해 하기 [표 1]과 같이 시약을 혼합하였다. 대조군인 A549 세포주에서 분리한 전체 RNA는 Cy3-dUTP(녹색)로 표지화하였고, 부틸알데히드를 처리한 A549 세포주로부터 분리한 RNA는 Cy5-dUTP(적색)로 표지화하였다. 이때 두 시료는 Microcon YM-30 컬럼(Millipore, 미국)을 사용하여 혼합, 정제하였다.
For oligo microarray analysis, cDNA was prepared using total RNA of the butylaldehyde treatment group obtained in Example <2-1>. The resulting total RNA was mixed with 30 μg of the obtained oligonucleotide (dT) primer and 2 μg (1 μg / μl) of the oligonucleotide (dT) primer, reacted at 65 ° C. for 10 minutes, and immediately annealed by ice. For the reverse transcription of the annealed RNA, the reagents were mixed as shown in Table 1 below. Total RNA isolated from control A549 cell line was labeled with Cy3-dUTP (green) and RNA isolated from butylaldehyde treated A549 cell line was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

구성Configuration 부피(㎕)Volume ([mu] l) 5X first strand buffer5X first strand buffer 66 dNTPsdNTPs 0.60.6 0.1 M DDT0.1 M DDT 33 SuperScript II enzymeSuperScript II enzyme 33 Cy-3 또는 Cy-5 dUTPCy-3 or Cy-5 dUTP 22

<2-3> <2-3> 혼성화Hybridization 반응 reaction

혼성화 및 세척 과정은 (주)이바이오젠의 지시방법에 따라 수행되었다. Hybridization and washing were carried out according to the instructions of BIOJEN.

구체적으로, 하기 [표 2]와 같은 Transcription Master Mix를 만들어 넣고 잘 섞은 뒤 40℃에서 2시간 동안 반응시킨 후, 라벨링(Labeling)된 cRNA를 정제(purification)하는 과정을 진행한 다음, 정제과정을 거친 cRNA 600 ng을 60℃에서 30분간 반응하여, 단편화(Fragmentation) 과정을 수행하였다. 위와 같이 준비된 cRNA에 2 x GEx Hybridization Buffer HI-RPM을 넣고 잘 섞은 뒤 칩(chip)에 잘 넣고 65℃에서 17시간 동안 오븐에서 혼성화(hybridization)를 하였다. 17시간 뒤 세척과정(GE Wash Buffer 1에서 1분, GE Wash Buffer 2에서 1분)을 거친 후 상기 칩을 3분간 800 rpm으로 원심분리하여 건조하였다.
Specifically, a Transcription Master Mix as shown in Table 2 below was prepared, mixed well, reacted at 40 ° C for 2 hours, purified, and the purified cRNA was purified. 600 ng of coarse cRNA was reacted at 60 DEG C for 30 minutes to perform a fragmentation process. 2 x GEx Hybridization Buffer HI-RPM was added to the prepared cRNA, mixed well, and then hybridized in an oven at 65 ° C for 17 hours. After 17 hours of washing (1 minute in GE Wash Buffer 1 and 1 minute in GE Wash Buffer 2), the chip was centrifuged at 800 rpm for 3 minutes and dried.

ComponentComponent Volume(㎕) per reactionVolume (μl) per reaction nuclease-free waterNuclease-free water 0.750.75 5X Transcription Buffer5X Transcription Buffer 3.23.2 0.1 M DTT0.1 M DTT 0.60.6 TP mixTP mix 1One T7 RNA Polymerase BlendT7 RNA Polymerase Blend 0.210.21 Cyanine 3-CTPCyanine 3-CTP 0.240.24

<2-4> 형광 이미지 획득<2-4> Fluorescence image acquisition

슬라이드 상의 혼성화 이미지는 Agilent C scanner(Agilent technologies, CA, 미국)로 스캔하였다. 이때 녹색 형광 이미지는 대조군에서, 적색 형광 이미지는 실험군에서만 특이하게 발현되는 유전자의 활성 정도를 나타내게 되며, 노란색 형광 이미지는 녹색과 적색의 보색으로 두 군의 발현이 큰 차이가 없음을 의미한다. 스캔한 이미지들은 유전자 발현 비율을 얻기 위하여 Agilent Feature Extraction 10.7.3.1(Agilent technologies, CA, 미국)로 분석하였다. 추출된 데이터는 Agilent GeneSpring GX 11.5.1(Agilent technologies, CA, 미국)을 이용하여 정량화(normalization)를 거쳐 각 유전자의 발현양상을 분석하였다. 이렇게 하여 얻어진 데이터로부터 부틸알데히드에 대한 마커 유전자를 선별하였다.Hybridization images on slides were scanned with an Agilent C scanner (Agilent Technologies, CA, USA). At this time, the green fluorescence image shows the activity of the gene specifically expressed in the control group, and the red fluorescence image shows the specific activity of the gene only in the experimental group. The yellow fluorescence image means green and red complementary colors, and the expression of the two groups is not significantly different. The scanned images were analyzed with Agilent Feature Extraction 10.7.3.1 (Agilent technologies, CA, USA) to obtain gene expression ratios. The extracted data were analyzed by normalization using Agilent GeneSpring GX 11.5.1 (Agilent technologies, CA, USA) to analyze the expression patterns of each gene. Marker genes for butylaldehyde were selected from the data thus obtained.

그 결과, 도 2에 나타낸 바와 같이 올리고 칩 상에 존재하는 대략 4만 2천여 개의 유전자 중에서 부틸알데히드에 의해 Cy5/Cy3의 비율이 1.5배 이상으로 유전자 발현 증가를 보이는 유전자는 4.23%(42,405개의 유전자 중 1,793개) 발현이 감소된 유전자는 7.25%(42,405개의 유전자 중 3,076개)임을 확인하였다(도 2). As a result, as shown in FIG. 2, among the approximately 42,000 genes present on the oligo chip, 4.23% (42,405 genes) showed a gene expression increase of 1.5 times or more by the ratio of Cy5 / Cy3 by butylaldehyde. 1,793 of the genes reduced expression was found to be 7.25% (3,076 of 42,405 genes) (Fig. 2).

또한, 부틸알데히드에서만 특이적으로 발현이 증가 혹은 감소한 유전자를 선별하기 위하여, 하기 [표 3]에 기재된 다른 5종의 알데히드류인 프로피온알데히드(Propionaldehyde), 발러알데히드(Valeradehyde), 헥사날(Hexanal), 헵타날(Heptanal), 옥타날(Octanal)과 유전자발현을 비교 분석한 결과, 하기 [도 3]에 나타낸 바와 같이 부틸알데히드에서만 특이적으로 발현이 증가 혹은 감소한 유전자 1종을 선별하였다(도 3 및 표 4). 아울러, 상기 유전자는 본 발명에서 사용한 부틸알데히드를 처리했을 때, 인간 폐암조직 유래 세포에서 독성과 관련이 있다는 보고는 없었다.
In addition, in order to select genes whose expression is specifically increased or decreased only in butylaldehyde, propionaldehyde, valeralhyde, hexanal, Hexalal, five other aldehydes shown in Table 3 below. As a result of comparative analysis of heptanal, octanal and gene expression, as shown in [FIG. 3], only one kind of gene whose expression was specifically increased or decreased was selected (FIG. 3 and Table 4). In addition, the gene has not been reported to be associated with toxicity in human lung cancer tissue-derived cells when the butylaldehyde used in the present invention is treated.

물질명Material name 노출 농도Exposure concentration
알데히드류
(Aldehydes)

Aldehydes
(Aldehydes)
Propionaldehyde(프로피온알데히드)Propionaldehyde 2.5 mM2.5 mM
Valeraldehyde(발러알데히드)Valeraldehyde 3.4 mM3.4 mM Hexanal(헥사날)Hexanal 1.6 mM1.6 mM Heptanal(헵타날)Heptanal (heptanal) 0.6 mM0.6 mM Octanal(옥타날)Octanal 0.58 mM0.58 mM


등록번호Registration Number

유전자 약어Gene abbreviation

유전자 명Gene name
부틸알데히드노출에Butylaldehyde exposure 의한 by
마이크로어레이Microarray
중간값의 비Intermediate value ratio
NM_022740NM_022740 HIPK2HIPK2 homeodomain interacting protein kinase 2homeodomain interacting protein kinase 2 0.370.37

<< 실시예Example 3> 실시간  3> Real time RTRT -- PCRPCR 정량 dose

상기 마이크로어레이 결과로부터 부틸알데히드에 의해 특이적으로 발현이 변화된 상기 <실시예 2>의 과발현 및 저발현된 유전자 중 부틸알데히드에 의해 특이적으로 발현되는 1종의 유전자[유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2)]의 발현변화 정도를 조사 및 정량하기 위해 My IQ 실시간 PCR(My IQ Real-time PCR)(Bio-rad, 미국)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다. 이때, 부틸알데히드 특이적으로 발현이 변화되는 것을 확인하기 위해 추가 5종의 물질(표3)로부터 위 1종 유전자에 대한 발현변화는 확인하였다. One type of gene specifically expressed by butylaldehyde among the over-expressed and low-expressed genes of <Example 2> whose expression was specifically changed by butylaldehyde from the microarray result [Genebank NM_022740 (IIPK2, homeodomain interacting protein kinase 2)] To investigate and quantify the level of expression change, My IQ Real-time PCR (Bio-rad, USA) was used for quantitative real-time RT-PCR. It was. At this time, in order to confirm that the expression is changed specifically butylaldehyde, the expression change for the above one gene from five additional substances (Table 3) was confirmed.

구체적으로, 올리고 dT 프라이머와 Superscript kit(Omniscipt™ kit, Qiagen, Co., 미국)를 이용하여 역전사반응을 수행하여 cDNA를 합성하였다. 상기 cDNA 0.2 ㎕와 물 3.8 ㎕, 센스 프라이머 0.5 ㎕, 안티센스 프라이머 0.5 ㎕, 사이버그린 I 염색 수퍼믹스(Bio-rad, 미국) 5 ㎕를 혼합하여, PCR 튜브에 담아 단계 1: 95℃, 3분; 단계 2(45회 반복): 단계 2-1: 95℃, 10초; 단계 2-2: 57℃ 45초; 단계 3: 95℃, 1분; 단계 4: 55℃, 1분; 단계 5(반복 80회): 55℃, 10초로 프로그램을 설계한 My IQ 실시간 PCR 기계에서 반응을 수행하였다. PCR 산물을 정량하기 위하여 사이버그린(SYBR Green) I 염색(Bio-rad, 미국)으로 염색하였다. 사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, PCR 과정 동안 이중나선 DNA가 생성될수록 형광강도(fluroscense intensity)가 증가하게 된다. 먼저 PCR에 이용한 표적 유전자와 내재성(endogenous) 대조군(MDH1)에 대한 프라이머를 사이버그린 마스터 믹스(Master mix)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 합성된 cDNA 시료와 각각의 프라이머(표 5)를 혼합하고, 사이버그린 마스터 믹스를 첨가한 후 PCR를 수행하였고, 정량 소프트웨어(software)를 사용하여 분석하였다(도 3 참조).Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). The mixture was mixed with 0.2 μl of the cDNA, 3.8 μl of water, 0.5 μl of a sense primer, 0.5 μl of an antisense primer and 5 μl of CyberGreen I Dye Supersmix (Bio-Rad, USA) ; Step 2 (repeated 45 times): Step 2-1: 95 ° C, 10 seconds; Step 2-2: 57 ° C. 45 seconds; Step 3: 95 캜, 1 min; Step 4: 55 [deg.] C, 1 min; Step 5 (repeated 80 times): The reaction was performed in a My IQ real-time PCR machine designed at 55 ° C for 10 seconds. The PCR products were stained with SYBR Green I staining (Bio-rad, USA). CyberGreen I staining binds to double helix DNA. As the double helix DNA is generated during the PCR process, the fluorescence intensity is increased. First, primers for the target gene and endogenous control (MDH1) used for PCR were added to the Cyberrin master mix, followed by PCR, followed by primer optimization to select an appropriate concentration. Was performed. Synthesized cDNA samples and each primer (Table 5) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (see FIG. 3).

그 결과, 유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2) 유전자의 발현 양상은 상기 실시예 <2-4>의 마이크로어레이 칩 결과와 매우 유사하게 나타남을 확인하였으며, 또한, 추가 알데히드류 5종에 대한 각 1종 유전자의 발현양상을 확인한 결과, 부틸알데히드의 유전자 발현양상과는 다른 양상(부틸알데히드와 다른 과발현 양상을 보임)을 보이는 것을 확인하였다(도 3 참조).
As a result, it was confirmed that the expression pattern of Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2) gene was very similar to that of the microarray chip of Example <2-4>. As a result of confirming the expression pattern of each one gene for five species, it was confirmed that the gene expression pattern of butyl aldehyde (different over-expression pattern with butyl aldehyde) was shown (see Fig. 3).

Genbank
등록번호
Genbank
Registration Number
유전자명Gene name PCR 프라이머 서열
(5'->3')
PCR primer sequence
(5 '->3')

NM_022740

NM_022740

HIPK2(homeodomain interacting protein kinase 2)

HIPK2 (homeodomain interacting protein kinase 2)
센스
(서열번호 1)
sense
(SEQ ID NO: 1)
AGATCTGCAAGCGTCGGGTGAATAAGATCTGCAAGCGTCGGGTGAATA
안티센스
(서열번호 2)
Antisense
(SEQ ID NO: 2)
TGGACAGTGGTCAGCTGGTTGTTATGGACAGTGGTCAGCTGGTTGTTA

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (14)

하기 유전자의 핵산 서열 또는 그 상보 가닥 서열이 기판상에 고정된, 부틸알데히드(Butylaldehyde)에 노출됨 여부 확인용 DNA 마이크로어레이칩:
유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).
DNA microarray chip for confirming whether the nucleic acid sequence of the following gene or its complementary strand sequence is exposed to butylaldehyde, immobilized on a substrate:
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).
1) 시험관 내(in vitro)에서 실험군으로서 부틸알데히드에 노출된 체세포, 및 대조군으로서 정상 체세포에서 각각의 RNA를 분리하는 단계;
2) 단계 1)의 실험군 및 대조군의 RNA를 cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;
3) 단계 2)의 각기 다른 형광물질로 표지된 cDNA를 제 1항의 DNA 마이크로어레이칩과 혼성화시키는 단계;
4) 반응한 DNA 마이크로어레이칩을 분석하는 단계; 및
5) 분석한 데이터에서 제 1항의 DNA 마이크로어레이칩에 고정된 유전자들의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 시험관 내에서 부틸알데히드에 노출됨 여부를 확인하는 방법.
1) separating each RNA from somatic cells exposed to butylaldehyde as an experimental group in vitro and normal somatic cells as a control;
2) labeling the experimental group and the control group with different fluorescent substances while synthesizing the RNA of the experimental group and the control group of step 1) with cDNA;
3) hybridizing the cDNA labeled with different fluorescent substances of step 2) with the DNA microarray chip of claim 1;
4) analyzing the reacted DNA microarray chip; And
5) A method of confirming whether exposed to butylaldehyde in vitro comprising the step of confirming the expression level of the genes immobilized on the DNA microarray chip of claim 1 in the analyzed data compared to the control.
제 2항에 있어서, 단계 1)의 체세포는 인간 폐세포 또는 인간 폐암조직 유래 세포인 것을 특징으로 하는 시험관 내에서 부틸알데히드에 노출됨 여부를 확인하는 방법.
The method of claim 2, wherein the somatic cells of step 1) are human lung cells or human lung cancer tissue-derived cells.
제 3항에 있어서, 인간 폐암조직 유래 세포는 A549인 것을 특징으로 하는 시험관 내에서 부틸알데히드에 노출됨 여부를 확인하는 방법.
The method of claim 3, wherein the human lung cancer tissue-derived cell is A549.
제 2항에 있어서, 단계 3)의 형광물질은 Cy3, Cy5, 폴리-L-라이신-플로오르세인 이소티오시아네이트(poly L-lysine-fluorescein isothiocyanate; FITC), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 시험관 내에서 부틸알데히드에 노출됨 여부를 확인하는 방법.
The method of claim 2, wherein the fluorescent material of step 3) is Cy3, Cy5, poly-L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC). And rhodamine (rhodamine) is a method for confirming whether exposed to butylaldehyde in vitro characterized in that it is selected from the group consisting of.
1) 시험관 내에서 실험군으로서 부틸알데히드에 노출된 체세포, 및 대조군으로서 정상 체세포에서 각각의 RNA를 분리하는 단계;
2) 상기 RNA를 하기 유전자에 상보적이고 하기 유전자를 증폭할 수 있는 프라이머쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계:
유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2); 및
3) 단계 2)의 유전자 산물을 대조군과 비교하여 발현 정도를 확인하는 단계를 포함하는 시험관 내에서 부틸알데히드에 노출됨 여부를 확인하는 방법.
1) isolating each RNA from somatic cells exposed to butylaldehyde as an experimental group in vitro and normal somatic cells as a control;
2) real-time reverse transcript polymerase chain reaction (RT-PCR) using a pair of primers complementary to the following genes and capable of amplifying the following genes:
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2); And
3) A method for confirming whether or not exposed to the butylaldehyde in vitro comprising the step of comparing the gene product of step 2) with the control to confirm the expression level.
삭제delete 제 6항에 있어서, 단계 1)의 프라이머 쌍은 하기 프라이머 쌍 1로 이루어지는 것을 특징으로 하는 시험관 내에서 부틸알데히드에 노출됨 여부를 확인하는 방법:
프라이머 쌍 1: 서열번호 1로 기재되는 정방향 프라이머 및 서열번호 2로 기재되는 역방향 프라이머.
7. The method of claim 6, wherein the primer pair of step 1) consists of the following primer pair 1.
Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.
제 1항의 DNA 마이크로어레이 칩을 포함하는 부틸알데히드에 노출됨 여부 확인용 키트.
Claim 1 kit for confirming whether exposed to butylaldehyde containing the DNA microarray chip.
제 9항에 있어서, 인간 체세포를 추가적으로 포함하는 것을 특징으로 하는 부틸알데히드에 노출됨 여부 확인용 키트.
10. The kit according to claim 9, further comprising human somatic cells.
제 10항에 있어서, 인간 체세포는 인간 폐세포 또는 인간 폐암조직 유래 세포인 것을 특징으로 하는 부틸알데히드에 노출됨 여부 확인용 키트.
The kit for confirming exposure to butylaldehyde according to claim 10, wherein the human somatic cells are human lung cells or human lung cancer tissue-derived cells.
하기 유전자에 상보적이고 하기 유전자를 증폭할 수 있는 프라이머 쌍을 포함하는 부틸알데히드에 노출됨 여부 확인용 키트:
유전자 등록번호(Genebank) NM_022740(HIPK2, homeodomain interacting protein kinase 2).
Kit for confirming exposure to butylaldehyde comprising primer pairs complementary to the following genes and capable of amplifying the following genes:
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).
삭제delete 제 12항에 있어서, 프라이머 쌍은 하기 프라이머 쌍 1로 이루어지는 것을 특징으로 하는 부틸알데히드에 노출됨 여부 확인용 키트:
프라이머 쌍 1: 서열번호 1로 기재되는 정방향 프라이머 및 서열번호 2로 기재되는 역방향 프라이머.
13. The kit according to claim 12, wherein the primer pair consists of the following primer pair 1.
Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.
KR1020120029432A 2012-03-22 2012-03-22 Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame KR101383641B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020120029432A KR101383641B1 (en) 2012-03-22 2012-03-22 Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120029432A KR101383641B1 (en) 2012-03-22 2012-03-22 Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame

Publications (2)

Publication Number Publication Date
KR20130107552A KR20130107552A (en) 2013-10-02
KR101383641B1 true KR101383641B1 (en) 2014-04-09

Family

ID=49630829

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120029432A KR101383641B1 (en) 2012-03-22 2012-03-22 Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame

Country Status (1)

Country Link
KR (1) KR101383641B1 (en)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Bingham, E. et al. Patty's Toxicology Volumes 1-9 5th ed. John Wiley & Sons. New York, *
J Chromatogr B Analyt Technol Biomed Life Sci. 878(27):2643-2651, 2010 *
Pal R. et al., Journal of Hazardous Materials 153(3):1122-1135 *
Proc. Natl. Acad. Sci. USA 93:10614-10619, 1996 *

Also Published As

Publication number Publication date
KR20130107552A (en) 2013-10-02

Similar Documents

Publication Publication Date Title
KR101008385B1 (en) Biomarker for identification of exposure to Polycyclic Aromatic Hydrocarbons and the method of identification using thereof
KR101398548B1 (en) Specific biomarker for identification of exposure to Lower aliphatic saturated aldehydes and the method of identification using the same
KR101463900B1 (en) Specific biomarker for identification of exposure to particulate matter 2.5 and the method of identification using the same
KR101301255B1 (en) Specific biomarker for identification of exposure to Perfluorooctane Sulfonates and the method of identification using thesame
KR100957055B1 (en) Biomarker for identification of exposure to Trichloroethylene and the method of identification using thereof
KR101749566B1 (en) Biomarker for identification of genes related to inflammatory response after exposure to diesel exhaust particle and the method of identification using thesame
KR101383641B1 (en) Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame
KR101398547B1 (en) microRNAs for identification of exposure to lower alipatic saturated aldeydes the method of identification using thereof
KR101757174B1 (en) Specific methylation biomarker for identification by time of exposure to volatile organic compounds and the method of identification using thereof
KR101383653B1 (en) Specific biomarker for identification of exposure to Propionaldehyde and the method of identification using thesame
KR101271598B1 (en) microRNAs for identification of exposure to benzo[k]fluoranthene and the method of identification using thereof
KR101294787B1 (en) microRNAs for identification of exposure to benzo[a]anthracene and the method of identification using thereof
KR101301254B1 (en) Specific biomarker for identification of exposure to Perfluorooctanoic acid and the method of identification using thesame
KR101144199B1 (en) Specific biomarker for identification of exposure to Persistent organic pollutants and the method of identification using the same
JP6166247B2 (en) Hexanal-specific biomarker for confirmation of exposure and confirmation method using the same
KR101138954B1 (en) The biomarkers for identification of exposure to disruptors inhibiting thyroid peroxidase and the identification method of disruptors inhibiting thyroid peroxidase exposure using the same biomarkers
KR20160091262A (en) Specific biomarker for identification of exposure to volatile organic compounds and the method of identification using thereof
KR101079250B1 (en) Biomarker for identification of exposure to carbaryl and the method of identification using thereof
KR101609373B1 (en) Methylation marker for identification of exposure to Lower aliphatic saturated aldehydes and the method of identification using thereof
KR101927141B1 (en) Kit for identification of exposure to xylene and the method of identification using thereof
KR101062784B1 (en) Biomarker for Identifying Mirex Specific Exposure and Identification Method Using the Same
KR101292840B1 (en) Biomarker for identification of genes related cancer cell migration after exposure to benz[a]anthracene, benzo[k]fluoranthene and indeno(1,2,3-c,d)pyrene, and the method of identification using thereof
KR100978791B1 (en) Biomarker for identification of exposure to dichloromethane and the method of identification using thereof
KR101138953B1 (en) The biomarkers for identification of exposure to disruptors activating thyroid peroxidase and the identification method of disruptors activating thyroid peroxidase exposure using the same biomarkers
KR101276733B1 (en) 17β-estradiol(E2) responsive genes in Oryzias javanicus and the method for diagnosing environment pollution using the same

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20170403

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20180403

Year of fee payment: 5

LAPS Lapse due to unpaid annual fee