KR20130107552A - Specific biomarker for identification of exposure to butylaldehyde and the method of identification using thesame - Google Patents

Abstract

PURPOSE: A biomarker for detecting butylaldehyde-specific exposure is provided to monitor and determine butylaldehyde contamination in an environmental sample using response genes selected by a DNA microarray chip. CONSTITUTION: A DNA microarray chip containing integrated nucleic acid sequences of a gene or molecules of complementary strands thereof is used for detecting butylaldehyde-specific exposure. The gene has gene registration number of Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2). A method for detecting butylaldehyde exposure comprises the steps of: isolating each RNA from somatic cells of an experimental group which is suspected to be exposed by butylaldehyde and a control group; synthesizing cDNAs of the experimental group and the control group from the RNAs; labeling each cDNA with different fluorescent materials; hybridizing the labeled cDNAs onto the DNA microarray chip; analyzing the reacted DNA microarray chip; and comparing the expression levels of genes which are integrated on the DNA microarray chip between the experimental group and the control group.

Description

Specific biomarker for identification of exposure to Butylaldehyde and the method of identification using thesame}

The present invention relates to a biomarker for confirming the butylaldehyde-specific exposure and a method of identifying the same, and more particularly, to a biomarker that specifically increases or decreases gene expression by butylaldehyde and butylaldehyde using the same. The present invention relates to a method for confirming specific exposure.

Butylaldehyde is exposed to the environment through the manufacture of rubber and plastic plasticizers, rubber accelerators, solvents and high polymers through various waste streams or through combustion and petroleum refining of diesel and gasoline. It is also known to be released into the environment as a product. Butylaldehyde is a malodorous substance specified by the National Odor Prevention Act of 2005 due to the smell of discomfort and aversion by stimulating the sense of smell of human body, and it is less than 0.1 ppm in industrial area and 0.029 ppm or less in other areas. Emission limits have been established. In 2008, butylaldehyde was reported to be exposed to an average concentration of 13.0 ppb in the domestic general atmosphere (Pal R., et al., Journal of Hazardous Materials 153 (3): 1122-1135, 2008).

Butylaldehyde is most often exposed to the human body by inhalation through the air, ingestion of food and drinking water, and skin contact of products containing butylaldehyde. Butylaldehyde has been reported to affect the upper respiratory tract and mucous membranes of the respiratory tract, as well as eye and skin tissues. In particular, butylaldehyde has been reported to have a great effect on the human body, such as inflammation of the larynx and bronchus through inhalation through the human respiratory tract, chemical pneumonia and pulmonary edema caused by chemicals (Bingham, E .; Cohrssen, B .; Powell, CH; Patty's Toxicology Volumes 1-9 5th ed.John Wiley & Sons.New York, NY (2001) .p. V5: 978). High exposure levels have been reported to cause symptoms such as coughing, wheezing, laryngitis, breathing, headache, nausea and vomiting.

The volatile organic compounds that flow in the blood flow affect the lungs by diffusion of the alveolar membrane. Hexane, methylpentan, isopropene, and benzene are used as markers of the disease And ( J Vet Sci 5 (1): 11-18, 2004). Recently, a simple lung cancer diagnosis method has been developed and used from the results of analysis of volatile organic compounds of recently collected substances through exhaled breath analysis. Aldehydes in volatile organic compounds have been reported as a representative substance in lung cancer patients ( J Chromatogr B Analyt Technol Biomed Life Sci . 878 (27): 2643-2651, 2010). Therefore, aldehyde specific biomarker discovery, such as butylaldehyde, can be utilized to screen lung exposure and environmental exposure of butylaldehyde.

Despite the risk of butylaldehyde to humans, there is not enough risk assessment data in humans, and the detection method for exposure is also classical, such as Gas Chromatography-Mass Spectrometer (GC-MS) or High Performance Liquid Chromatography (HPLC). It is confined to the method. Quantification is possible using GC-MS or HPLC method, but appropriate conditions for analysis are required and expensive equipment is required. Therefore, faster and easier screening methods, such as real-time reverse transcript polymerase chain reaction (PCR) or DNA microarray chips using primers, can be used in humans through rapid risk assessment. It is an important task to discover and utilize molecular indicators that can detect toxic effects and gene expression, and to take appropriate measures and control against butylaldehyde exposure.

The genome sequencing project of several species, including 6 mammals and 292 microbes, has been completed and reported in the National Center for Biotechnology Information (NCBI). Genome-wide expression studies have been conducted to study the function of genes based on the vast amount of data thus obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment ( Proc . Natl . Acad . Sci . USA 93: 10614-10619,1996).

A microarray is a collection of cDNA (complementary DNA) or a set of oligonucleotides of 20-25 base pairs in length on glass. cDNA microarrays are produced either by in-house laboratories or by companies such as Agilent, Genomic Solutions, etc., by mechanically immobilizing cDNA collections onto chips or by using ink jetting ( J. Am . Acad . Dermatol . 51: 681 -692, 2004). The oligonucleotide microarray is prepared by a direct synthesis method on a chip using photolithography in Affymetrix, and the oligonucleotide is produced by a method of immobilizing a synthesized oligonucleotide in Agillent ( J. Am . Acad Dermatol 51: 681-692, 2004).

In order to analyze the expression of the gene, RNA is obtained from a sample such as a tissue or a cell, and an oligonucleotide is hybridized with the oligonucleotide in the DNA microarray. The resulting RNA is labeled with fluorescence or isotopes and converted to cDNA. The oligo microarray is mainly labeled with two different fluorescences (eg, Cye3 and Cye5), and the control and experimental groups are labeled, and the hybridization reaction is performed simultaneously on the same chip. The fluorescence intensity is obtained by optically scanning the image and the result is analyzed . The ratio of the two fluorescence intensities determines the expression of the gene ( Genomics Proteomics I: 1-10, 2002). Recently, it has been applied to toxic genomics research which is a cutting-edge technique using DNA microarray technology, and it can be expressed in a large amount (high throughput) in a specific tissue or cell line due to all chemical substances, including representative drug candidates, And the quantitative analysis of the expression patterns of the genes. Thus, by analyzing the frequency of expression of a specific gene in a specific cell, it is possible to identify a gene related with adverse effects of drugs and harmful effects of environmental pollutants, and thereby, harmful effects of environmental pollutants, And will be able to search for and identify substances that cause toxicity and side effects.

Therefore, the present inventors observed and analyzed the gene expression profile of butylaldehyde in human lung cancer tissue-derived A549 cell line using oligomicroarray in which 42,000 human genes were accumulated, and specifically overexpressed or only by butylaldehyde in the environment. The present invention has been completed by establishing a biomarker capable of specifically detecting butylaldehyde and detecting exposure using the same by discovering a low-expressing gene.

An object of the present invention is to provide a biomarker that is specifically overexpressed or low expressed by exposure of butylaldehyde and a method for identifying butylaldehyde specific exposure using the biomarker.

In order to achieve the above object, the present invention provides a biomarker for confirming whether or not butylaldehyde-specific exposure that specifically changes the expression by exposure of butylaldehyde (Butylaldehyde).

The present invention also provides a DNA microarray chip for confirming whether butylaldehyde-specific exposure is integrated with a nucleic acid sequence of the following gene or its complementary strand molecule:

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

Further, according to the present invention,

1) separating each RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

2) labeling the experimental group and the control group with different fluorescent substances while synthesizing the RNA of the experimental group and the control group of step 1) with cDNA;

3) hybridizing the cDNA labeled with different fluorescent substances of step 2) with the DNA microarray chip of the present invention;

4) analyzing the reacted DNA microarray chip; And

5) Provides a method for confirming the exposure to butylaldehyde comprising the step of confirming the expression level of the gene directly on the DNA microarray chip of the present invention in the analyzed data compared to the control.

Further, according to the present invention,

1) separating each RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

2) Real-time reverse transcript polymerase chain reaction (RT-PCR) using primer pairs complementary to the following genes and capable of amplifying the following genes:

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2); And

3) comparing the gene product of step 2) to the control to provide a method for confirming the exposure to butylaldehyde comprising the step of confirming the expression level.

In addition, the present invention provides a kit for confirming exposure to butylaldehyde including the DNA microarray chip of the present invention.

In addition, the present invention provides a kit for confirming exposure to butylaldehyde comprising a primer pair capable of amplifying the following genes and complementary to the following genes:

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

Butylaldehyde (Butylaldehyde) specific exposure of the biomarker of the present invention and the identification method using the same is useful for determining the butylaldehyde monitoring and risk by using the reaction gene selected through the DNA microarray chip as a biomarker, It can be usefully used as a tool for identifying specific mechanisms of toxic effects caused by butylaldehyde.

1 is a diagram showing the cytotoxicity results of butylaldehyde (Butylaldehyde) in human lung cancer tissue-derived cell line.
Figure 2 is a diagram showing the results of analyzing the gene expression patterns of human lung cancer tissue-derived cell line treated with butylaldehyde using a microarray chip:
Middle line (M = 0) denotes R (test group fluorescence intensity value) = G (control fluorescence intensity value) line;
In case of M = 1, it indicates that the probes with the value of R (test group fluorescence intensity value) is 1.5 times higher than G (control fluorescence intensity value) value, and the spots more than 1.5 times This shows the distribution of probes with higher signal intensity values.
FIG. 3 shows propionaldehyde, valeradehyde, hexanal, heptanal, octanal and octanal in order to select genes whose expression is increased or decreased only by butylaldehyde exposure. This is a comparative analysis of gene expression.

Hereinafter, the present invention will be described in detail.

The present invention provides a biomarker for confirming whether or not butylaldehyde (Butylaldehyde) specific exposure causing a specific expression change by exposure of butylaldehyde.

The biomarker is a gene whose expression is increased or decreased 1.5 times or more, and is composed of one gene whose expression is changed only by butylaldehyde.

According to the butylaldehyde exposure degree, a biomarker that specifically expresses a change in expression is preferably the following gene, but is not limited thereto:

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

In a specific embodiment of the present invention, the present inventors confirmed the cytotoxicity by treating butylaldehyde to human lung cancer tissue-derived A549 cell line in order to discover a butylaldehyde-specific exposure biomarker. As a result, the butylaldehyde was confirmed to be toxic to human lung cancer tissue-derived cell line (see Fig. 1), the concentration of butylaldehyde was determined based on the experiment. Then, butylaldehyde was treated to human lung cancer tissue-derived cell line at the determined concentration, mRNA was isolated from the cell line treated with the substance, and labeled with fluorescent substance (Cy5) while synthesizing cDNA. Labeled with Cy3. The fluorescently-labeled cDNA was hybridized with a human whole genome oligo microarray (Agilent, USA) of 8 × 60 k oligo microarray chip, and fluorescence images were scanned for differences in gene expression patterns (see FIG. 2). When the ratio of Cy5 / Cy3 was 1.5 times or more, it was classified as an increased expression gene. When the Cy5 / Cy3 ratio was 0.66 or less, it was classified as a decreased expression gene. As a result, it was confirmed that the increased expression of the gene was 4.23% (1,793 of 42,405 genes) and the decreased expression of the gene was 7.25% (3,076 of 42,405 genes). One of the genes belonging to the mitogen activated protein kinase (MAPK) Cascade was selected from the classification of biological functions of genes expressing expression changes, and five kinds of aldehydes other than butylaldehyde ( Proionaldehyde, baleraldehyde, hexanal, heptanol, octanal) exposure was selected for one gene whose expression was specifically changed (increased or decreased) only in butylaldehyde (see Figure 3, Table 3 and Table 4). Although the gene has been reported to be involved in causing lung toxicity and other diseases caused by other chemicals in previous studies, it is associated with toxicity in human lung cancer tissue-derived cells when treated with butylaldehyde used in the present invention. There is no report.

The present invention also provides a DNA microarray chip for confirming whether butylaldehyde-specific exposure is integrated with a nucleic acid sequence of the following gene or a complementary strand molecule thereof.

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

The butylaldehyde DNA microarray chip of the present invention can be produced by a method known to those skilled in the art. A method of fabricating the microarray chip is as follows. A micropipetting method using a piezo electric method or a pin-type spotter for immobilizing the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, But the present invention is not limited thereto. In a preferred embodiment of the present invention, a micro array, which is a pin-shaped spotter, is used. The substrate of the DNA microarray chip is preferably coated with one activator selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde, But is not limited thereto. The substrate may be selected from the group consisting of a slide glass, a plastic, a metal, a silicon, a nylon film, and a nitrocellulose membrane, but the present invention is not limited thereto. In a preferred embodiment of the present invention, Coated slide glass was used.

In addition, the present invention provides a method for determining whether butylaldehyde-specific exposure using the biomarker of the present invention.

The present invention provides a method for determining whether butylaldehyde specific exposure comprising the following steps:

1) separating RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

2) labeling the experimental group and the control group with different fluorescent substances while synthesizing the RNA of the experimental group and the control group of step 1) with cDNA;

3) hybridizing the cDNA labeled with different fluorescent substances of step 2) with the DNA microarray chip of the present invention;

4) analyzing the reacted DNA microarray chip; And

5) confirming the expression level of the gene of the present invention in the analyzed data compared to the control.

In the method for confirming the exposure, the somatic cell of step 1) is preferably a human lung cancer tissue-derived cell A549 cell line, but is not limited to this, if the cells derived from human lung cells or human lung cancer cells and tissues All are available.

Wherein the fluorescent material of step 3) is selected from the group consisting of Cy3, Cy5, FITC (poly L-lysine-fluorescein isothiocyanate), RITC (rhodamine-B-isothiocyanate) and rhodamine But it is not limited thereto, and fluorescent materials known to those skilled in the art are all usable.

In the method for confirming the exposure, the DNA microarray chip of step 4) is preferably used, such as Whole Human Genome Oligo Microarray (Agilent, USA), but is not limited thereto, the overexpression of the human genome in the present invention Alternatively, any microarray chip loaded with a low expression gene (Table 4) can be used, and it is most preferable to use a DNA microarray chip produced by the present inventor. It is preferable to use Agilent Feature Extraction 10.7.3.1 (Agilent technologies, CA, USA) or Agilent GeneSpring GX 11.5.1 (Agilent technologies, CA, USA) for the analysis method of step 4) Analytical software known to those skilled in the art may be used.

Further, according to the present invention,

1) separating RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;

1) real-time reverse transcript polymerase chain reaction (RT-PCR) using a pair of primers complementary to the following genes and capable of amplifying the following genes:

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2); And

3) provides a method of confirming the exposure to butylaldehyde comprising the step of comparing the gene product of step 2) with the control to confirm the expression level.

Preferably, the primer pair of step 2) is a forward and reverse primer pair of 18 to 30mer length, capable of amplifying the gene of step 2), and more preferably, but not limited to the following primer pair 1.

Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.

Therefore, the biomarker of the present invention can be usefully used for monitoring and determining contamination of butylaldehyde in environmental samples, since the gene expression is increased or decreased specifically for butylaldehyde.

In addition, the present invention provides a kit for confirming whether the butylaldehyde-specific exposure comprising the DNA microarray chip produced in the present invention.

The kit preferably further comprises human somatic cells, but is not limited thereto.

The human somatic cell is preferably A549, but is not limited thereto. Any cell derived from human lung cells or human lung cancer cells and tissues can be used.

The kit may further comprise a fluorescent material, wherein the fluorescent material is selected from the group consisting of a strepavidin-like phosphatease conjugate, a chemiluminescent substance, and a chemiluminescent substance But it is not limited thereto. In a preferred embodiment of the present invention, Cy3 and Cy5 are used.

The reaction reagent may further include a buffer solution used for hybridization, a reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (pre-mixed or separate feed type), a chemical inducer for fluorescent dye And a washing buffer solution. However, the present invention is not limited thereto. Any reaction reagent necessary for hybridization reaction of a DNA microarray chip known to a person skilled in the art can be included.

Since the biomarker of the present invention increases or decreases gene expression specifically for butylaldehyde, it can be usefully used for monitoring and determining the contamination of butylaldehyde in environmental samples, and the toxic action mechanisms specifically induced by butylaldehyde. It can be used as a tool to identify.

Further, according to the present invention,

Provided are kits for confirming exposure to butylaldehyde, comprising primer pairs complementary to the following genes and capable of amplifying the following genes:

Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).

Preferably, the primer pair of the identification kit is the following primer pair 1, but is not limited thereto, and is 15 to 50 mer long, preferably 15 to 30 mer designed to have an amplification product of the biomarker gene 100 to 300 bp. Both forward and reverse primer pairs of the length of, more preferably 18-25 mer in length, are available:

Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.

In addition to the above-mentioned confirmation kit, it is preferable to include human somatic cells but not limited thereto.

The human somatic cell is preferably an A549 cell line, which is a cell derived from human lung cancer tissue, but not limited thereto, and any cell derived from human lung cells or human lung cancer cells and tissues can be used.

In addition, the kit may further comprise a reaction reagent, and the reaction reagent may be a labeling reagent such as reverse transcriptase, cNTPs and rNTP (pre-mixed or separate feed type) for synthesizing cDNA from RNA, chemical inducer of fluorescent dye, Washing buffer solution, and the like, but not limited thereto, and may include all reaction reagents necessary for RT-PCR reaction known to those skilled in the art.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

< Example  1> Cell culture and chemical treatment

<1-1> Cell culture

A549 cells (Korean Cell Line Bank), a human lung cancer tissue-derived cell line, were cultured in a 100 mm dish using 80% FBS-supplemented RPMI medium (Gibro-BRL, USA) until it grew to about 80%. The present inventors have selected butylaldehyde (Prorionaldehyde) which is one of the aldehydes among the volatile organic compounds exposed to the environment through existing research and reports, and dissolved in dimethyl sulfoxide (DMSO). The vehicle concentration was less than 0.1% in all experiments.

<1-2> Cytotoxicity Test MTT assay ) And chemical treatment

MTT experiment using the A549 cell line was performed by the method of Mossman et al . ( J. Immunol . Methods , 65, 55-63, 1983).

Specifically, cells were treated with butylaldehyde dissolved in DMSO in RPMI medium (Gibro-BRL, USA) at 3.5 × 10 ⁴ / well cell number in 24-well plates, and after 48 hours, MTT (3-4,5-dimethylthiazol 5 mg / ml of -2,5-diphenyltetra zolium bromide) was added to the tube and incubated at 37 ° C. for 3 hours. After the medium was removed, the formed formazan crystal was dissolved in 500 μl of DMSO, transferred to a 96-well plate, aliquoted, and the OD value was measured at an absorbance of 540 nm.

As a result, as shown in FIG. 1, as a result of examining the cytotoxicity of butylaldehyde in the A549 cell line, a concentration (IC ₂₀ ) showing 20% survival rate was 4.6 mM, and the following microarray experiment was performed based on the results (FIG. One).

< Example  2> Microarray  Experiment

<2-1> target RNA Separation of fluorescent material and labeling

After dispensing A549 cells in 6-well plates at a concentration of 25 × 10 ⁴ cells / ml, the concentration of butylaldehyde determined in Example <1-2> was treated for 48 hours. Subsequently, total RNA was isolated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using an RNeasy mini kit (Qiagen, USA). Genomic DNA was removed during RNA purification using an RNase-free DNase set (Qiagen, USA). The amount of each total RNA sample was measured by spectrophotometer, the concentration was confirmed by ND-1000 Spectrophotometer (Thermo Fisher Scientific Inc., USA) and Agilent 2100 Bioanalyzer (Agilent).

<2-2> Labeled cDNA  Produce

For oligo microarray analysis, cDNA was prepared using total RNA of the butylaldehyde treatment group obtained in Example <2-1>. The resulting total RNA was mixed with 30 μg of the obtained oligonucleotide (dT) primer and 2 μg (1 μg / μl) of the oligonucleotide (dT) primer, reacted at 65 ° C. for 10 minutes, and immediately annealed by ice. For the reverse transcription of the annealed RNA, the reagents were mixed as shown in Table 1 below. Total RNA isolated from control A549 cell line was labeled with Cy3-dUTP (green) and RNA isolated from butylaldehyde treated A549 cell line was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

Configuration Volume ([mu] l) 5X first strand buffer 6 dNTPs 0.6 0.1 M DDT 3 SuperScript II enzyme 3 Cy-3 or Cy-5 dUTP 2

<2-3> Hybridization  reaction

Hybridization and washing were carried out according to the instructions of BIOJEN.

Specifically, a Transcription Master Mix as shown in Table 2 below was prepared, mixed well, reacted at 40 ° C for 2 hours, purified, and the purified cRNA was purified. 600 ng of coarse cRNA was reacted at 60 DEG C for 30 minutes to perform a fragmentation process. 2 x GEx Hybridization Buffer HI-RPM was added to the prepared cRNA, mixed well, and then hybridized in an oven at 65 ° C for 17 hours. After 17 hours of washing (1 minute in GE Wash Buffer 1 and 1 minute in GE Wash Buffer 2), the chip was centrifuged at 800 rpm for 3 minutes and dried.

Component Volume (μl) per reaction Nuclease-free water 0.75 5X Transcription Buffer 3.2 0.1 M DTT 0.6 TP mix One T7 RNA Polymerase Blend 0.21 Cyanine 3-CTP 0.24

<2-4> Fluorescence image acquisition

Hybridization images on slides were scanned with an Agilent C scanner (Agilent Technologies, CA, USA). At this time, the green fluorescence image shows the activity of the gene specifically expressed in the control group, and the red fluorescence image shows the specific activity of the gene only in the experimental group. The yellow fluorescence image means green and red complementary colors, and the expression of the two groups is not significantly different. The scanned images were analyzed with Agilent Feature Extraction 10.7.3.1 (Agilent technologies, CA, USA) to obtain gene expression ratios. The extracted data were analyzed by normalization using Agilent GeneSpring GX 11.5.1 (Agilent technologies, CA, USA) to analyze the expression patterns of each gene. Marker genes for butylaldehyde were selected from the data thus obtained.

As a result, as shown in FIG. 2, among the approximately 42,000 genes present on the oligo chip, 4.23% (42,405 genes) showed a gene expression increase of 1.5 times or more by the ratio of Cy5 / Cy3 by butylaldehyde. 1,793 of the genes reduced expression was found to be 7.25% (3,076 of 42,405 genes) (Fig. 2).

In addition, in order to select genes whose expression is specifically increased or decreased only in butylaldehyde, propionaldehyde, valeralhyde, hexanal, Hexalal, five other aldehydes shown in Table 3 below. As a result of comparative analysis of heptanal, octanal and gene expression, as shown in [FIG. 3], only one kind of gene whose expression was specifically increased or decreased was selected (FIG. 3 and Table 4). In addition, the gene has not been reported to be associated with toxicity in human lung cancer tissue-derived cells when the butylaldehyde used in the present invention is treated.

Material name Exposure concentration
Aldehydes
(Aldehydes) Propionaldehyde 2.5 mM Valeraldehyde 3.4 mM Hexanal 1.6 mM Heptanal (heptanal) 0.6 mM Octanal 0.58 mM

Registration Number
Gene abbreviation
Gene name Butylaldehyde exposure  by
Microarray
Intermediate value ratio NM_022740 HIPK2 homeodomain interacting protein kinase 2 0.37

< Example  3> Real time RT - PCR  dose

One type of gene specifically expressed by butylaldehyde among the over-expressed and low-expressed genes of <Example 2> whose expression was specifically changed by butylaldehyde from the microarray result [Genebank NM_022740 (IIPK2, homeodomain interacting protein kinase 2)] To investigate and quantify the level of expression change, My IQ Real-time PCR (Bio-rad, USA) was used for quantitative real-time RT-PCR. It was. At this time, in order to confirm that the expression is changed specifically butylaldehyde, the expression change for the above one gene from five additional substances (Table 3) was confirmed.

Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). The mixture was mixed with 0.2 μl of the cDNA, 3.8 μl of water, 0.5 μl of a sense primer, 0.5 μl of an antisense primer and 5 μl of CyberGreen I Dye Supersmix (Bio-Rad, USA) ; Step 2 (repeated 45 times): Step 2-1: 95 ° C, 10 seconds; Step 2-2: 57 ° C. 45 seconds; Step 3: 95 캜, 1 min; Step 4: 55 [deg.] C, 1 min; Step 5 (repeated 80 times): The reaction was performed in a My IQ real-time PCR machine designed at 55 ° C for 10 seconds. The PCR products were stained with SYBR Green I staining (Bio-rad, USA). Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, primers for the target gene and endogenous control (MDH1) used for PCR were added to the Cyberrin master mix, followed by PCR, followed by primer optimization to select an appropriate concentration. Was performed. Synthesized cDNA samples and each primer (Table 5) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (see FIG. 3).

As a result, it was confirmed that the expression pattern of Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2) gene was very similar to that of the microarray chip of Example <2-4>. As a result of confirming the expression pattern of each one gene for five species, it was confirmed that the gene expression pattern of butyl aldehyde (different over-expression pattern with butyl aldehyde) was shown (see Fig. 3).

Genbank
Registration Number Gene name PCR primer sequence
(5 '->3')
NM_022740
HIPK2 (homeodomain interacting protein kinase 2) sense
(SEQ ID NO: 1) AGATCTGCAAGCGTCGGGTGAATA Antisense
(SEQ ID NO: 2) TGGACAGTGGTCAGCTGGTTGTTA

<110> korea institute of science and technology <120> Specific biomarker for identification of exposure to          Butylaldehyde and the method of identification using thesame <130> 12p-03-01 <160> 2 <170> Kopatentin 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sense primer <400> 1 agatctgcaa gcgtcgggtg aata 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> antisense primer <400> 2 tggacagtgg tcagctggtt gtta 24

Claims (14)

DNA microarray chip for identification of butylaldehyde-specific exposure in which the nucleic acid sequence of the following gene or its complementary strand molecule is integrated:
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).
1) separating each RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;
2) labeling the experimental group and the control group with different fluorescent substances while synthesizing the RNA of the experimental group and the control group of step 1) with cDNA;
3) hybridizing the cDNA labeled with different fluorescent substances of step 2) with the DNA microarray chip of claim 1;
4) analyzing the reacted DNA microarray chip; And
5) Method of confirming the exposure to butylaldehyde comprising the step of confirming the expression level of the genes integrated in the DNA microarray chip of claim 1 in the analyzed data compared to the control.
The method of claim 2, wherein the somatic cells of step 1) are human lung cells or human lung cancer tissue-derived cells.
4. The method of claim 3, wherein the human lung cancer tissue-derived cells are A549.
The method of claim 2, wherein the fluorescent material of step 3) is Cy3, Cy5, poly-L-lysine-fluorescein isothiocyanate (FITC), or rhodamine-B-isothiocyanate (RITC). And rhodamine.
1) separating each RNA from the somatic cells of the experimental group and the normal control group suspected of butylaldehyde exposure;
2) real-time reverse transcript polymerase chain reaction (RT-PCR) using a pair of primers complementary to the following genes and capable of amplifying the following genes:
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2); And
3) Method of confirming the exposure to butylaldehyde comprising the step of confirming the expression level by comparing the gene product of step 2) with the control.
7. The method of claim 6, wherein the primer pair of step 2) is a forward and reverse primer pair of 18 to 30 mer length, capable of amplifying the gene of step 2).
The method of claim 6, wherein the primer pair of step 1) comprises the following primer pair 1.
Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.
Claim 1 kit for checking the exposure to butylaldehyde comprising the DNA microarray chip.
The kit for confirming exposure to butylaldehyde according to claim 9, further comprising human somatic cells.
The kit for confirming exposure to butylaldehyde according to claim 10, wherein the human somatic cells are human lung cells or human lung cancer tissue-derived cells.
Kit for confirming exposure to butylaldehyde comprising primer pairs that are complementary to the following genes and capable of amplifying the following genes:
Genebank NM_022740 (HIPK2, homeodomain interacting protein kinase 2).
13. The kit according to claim 12, wherein the primer pairs are 18-30 mer long forward and reverse primer pairs designed to have an amplification product of 100-300 bp.
The kit for confirming exposure to butylaldehyde according to claim 12, wherein the primer pair consists of the following primer pair 1.
Primer pair 1: Forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2.

Images