KR101271598B1

KR101271598B1 - microRNAs for identification of exposure to benzo[k]fluoranthene and the method of identification using thereof

Info

Publication number: KR101271598B1
Application number: KR1020110092902A
Authority: KR
Inventors: 류재천; 송미경; 송미; 최한샘
Original assignee: 한국과학기술연구원
Priority date: 2011-09-15
Filing date: 2011-09-15
Publication date: 2013-06-04
Also published as: KR20130029566A

Abstract

본 발명은 마이크로 RNA를 이용한 다환 방향족 탄화수소류 중의 하나인 벤조케이플루오란텐(benzo[k]fluoranthene) 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 보다 상세하게는 벤조케이플루오란텐 노출에 의해 발현수준이 2배 이상 과발현되는 마이크로 RNA를 선별함으로써, 이들 26종의 마이크로 RNA를 바이오마커로 이용하여 벤조케이플루오란텐의 모니터링 및 위해성을 판정하는데 유용하게 사용할 수 있으며, 벤조케이플루오란텐에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있음을 알 수 있다. The present invention relates to a biomarker for confirming the exposure of benzo [k] fluoranthene, which is one of polycyclic aromatic hydrocarbons using microRNA, and a confirmation method using the same, and more particularly, to benzokayfluoranthene. By selecting microRNAs whose expression levels are overexpressed more than two times by exposure, these 26 kinds of microRNAs can be usefully used for monitoring and risk of benzokayfluoranthene using biomarkers. It can be seen that it can be used as a tool to identify the mechanism of toxic action caused by lanten.

Description

Micro RNA for identification of exposure to benzokayfluoranthene and a method using the same {microRNAs for identification of exposure to benzo [k] fluoranthene and the method of identification using approximately}

본 발명은 벤조케이플루오란텐(benzo[k]fluoranthene) 노출 여부 확인용 마이크로 RNA 및 이를 이용한 확인 방법에 관한 것으로, 더욱 상세하게는 두 가지 농도로 처리된 벤조케이플루오란텐에 의해 공통적으로 발현이 변화하는 마이크로 RNA 및 이를 이용한 벤조케이플루오란텐에 대한 노출 여부를 확인하는 방법에 관한 것이다.
The present invention relates to micro RNA for confirming exposure of benzo [k] fluoranthene and a method of identifying the same, and more particularly, commonly expressed by benzokayfluoranthene treated at two concentrations. The present invention relates to a method for confirming exposure to the changing micro RNA and the benzokayfluoranthene using the same.

최근 수년 동안, 폭넓은 생물학적 과정들에 대해 깊은 영향을 주는 조절성 RNA 의 중요한 부류로서 마이크로 RNA (miR, miRNA) 가 대두되었다. 이들 소형 (전형적으로 18-24 개 뉴클레오티드 길이) 비(非)암호화 RNA 분자는 RNA 분해 촉진, mRNA 번역 저해, 및 또한 유전자 전사에의 영향을 통해 단백질 발현 패턴을 조절할 수 있다. 마이크로 RNA 는 발달 및 분화, 세포 증식 제어, 스트레스 반응 및 대사작용 등의 다양한 과정에서 중심적 역할을 한다. 현재 약 1000여 개의 인간 마이크로 RNA 가 알려져 있다. In recent years, micro RNA (miR, miRNA) has emerged as an important class of regulatory RNA that has a profound effect on a wide range of biological processes. These small (typically 18-24 nucleotide long) non-coding RNA molecules can regulate protein expression patterns through promoting RNA degradation, inhibiting mRNA translation, and also affecting gene transcription. MicroRNAs play a central role in a variety of processes, including development and differentiation, cell proliferation control, stress response and metabolism. Currently, about 1,000 human microRNAs are known.

마이크로 RNA는 RNA 폴리머라제 Ⅱ(pol Ⅱ) 또는 RNA 폴리머라제 Ⅲ(pol Ⅲ; Qi, P. et al. Cell . Mol . Immunol . 3, 411-419, 2006 참조)에 의해 전사되고 개개의 마이크로 RNA 유전자, 단백질 암호화 유전자의 인트론 또는 여러 개인, 밀접하게 관련된 마이크로 RNA 를 주로 암호화하는 폴리-시스트론 전사물로부터 유도될 수 있다. RNA pol Ⅱ 또는 pol Ⅲ에 의한 miRNA 유전자들의 전사는 일반적으로 수천 염기 길이인 프라이머리 miRNA 전사물(pri-miRNAs)로 불리는, 최초 전사물을 생산한다. 핵에서, pri-miRNAs는 RNAse, 드로샤(Drosha)에 의해 가공되어, 70- 내지 100-뉴클레오티드 헤어핀-모양 전구체(pre-miRNAs)를 생산한다. 세포질로 운반된 후, 헤어핀 pre-miRNA는 이중-가닥 miRNA를 생산하기 위해 다이서에 의해 추가로 가공된다. 성숙한 miRNA 가닥은 RNA-유도 침묵 복합체(RISC) 속에 혼합되어, 여기서 성숙한 miRNA는 염기쌍 상보성에 의해 이의 표적 mRNAs와 결합한다. miRNA 염기쌍들이 mRNA 표적과 완벽하게 일치하는 비교적으로 드문 경우, 이것이 mRNA 분해를 촉진한다. 더욱 일반적으로, miRNAs는 표적 mRNAs와 불완전한 이형이중가닥을 형성하여 mRNA 번역에 영향을 준다. Micro RNA is transcribed by RNA polymerase II (pol II) or RNA polymerase III (pol III; Qi, P. et al. Cell . Mol . Immunol . 3, 411-419, 2006) and individual microRNA It can be derived from a poly-cistron transcript, which mainly encodes a gene, an intron of a protein coding gene or several individuals, a closely related micro RNA. Transcription of miRNA genes by RNA pol II or pol III produces initial transcripts, called primary miRNA transcripts (pri-miRNAs), which are typically thousands of bases in length. In the nucleus, pri-miRNAs are processed by RNAse, Drosha, producing 70- to 100-nucleotide hairpin-shaped precursors (pre-miRNAs). After being transported into the cytoplasm, the hairpin pre-miRNA is further processed by Dicer to produce double-stranded miRNAs. Mature miRNA strands are mixed into RNA-induced silencing complexes (RISCs), where mature miRNA binds to its target mRNAs by base pair complementarity. In relatively rare cases where miRNA base pairs perfectly match the mRNA target, this promotes mRNA degradation. More generally, miRNAs form incomplete heterologous strands with target mRNAs, thus affecting mRNA translation.

마이크로 RNA 메커니즘은 암 발병, 세포 노화, 장기의 성장 등에 중요한 영향을 미치고 있으며, 이에 따라 마이크로 RNA 관련 연구는 암 발생, 노화 등의 생명현상 인과 관계 규명에 중추적 역할을 할 뿐 만 아니라, 향후 발생 및 분화나 줄기세포를 이용한 세포치료제 개발 등의 연구에도 적용시킬 수 있는 우리나라 바이오 연구의 핵심 분야로 자리 잡을 수 있을 것으로 예상된다. 따라서, 마이크로 RNA 마커의 발굴은 암을 포함하여 질병의 조기 진단 가능성을 예측하는 데에 많은 도움을 줄 것이라는 점에서 의의가 있다. Micro RNA mechanisms have important effects on cancer development, cellular aging, and organ growth. Accordingly, micro RNA-related research not only plays a pivotal role in identifying the causal relationship between life occurrences such as cancer development and aging, It is expected to be established as a core field of biotechnology research in Korea that can be applied to research such as differentiation and development of cell therapy using stem cells. Therefore, the discovery of microRNA markers is meaningful in that it will be very helpful in predicting the possibility of early diagnosis of diseases including cancer.

뿐만 아니라 마이크로 RNA 마커는 특정 환경유해물질의 노출 예측에도 유용하게 쓰일 수 있을 것으로 생각되고 있다. 지금까지는 환경유해물질의 노출에 따른 유전자 (mRNA)의 변화 양상과 그에 따른 질병과의 연관성에 관련된 연구가 주로 진행되었으나 최근 마이크로 RNA와의 연관성에 대한 관심이 증가함에 따라 몇몇 연구에서 벤젠(benzene), 비소(arsenic) 또는 RDX와 같은 유해물질의 노출에 따른 마이크로 RNA의 발현 변화를 관찰하였으며 특이적으로 발현이 변화하는 마이크로 RNA와 그 표적 유전자를 유해물질에 대한 마커로 제시하였다(Baccarelli, A. & Bollati, V. Curr . Opin . Prediatr . 21, 243-251, 2009 참조). 또한 발굴된 마이크로 RNA는 노출 예측을 위한 마커로서 뿐만 아니라 표적 유전자의 발현을 조절하는 조절자로서 환경유해물질에 의한 독성 기작 예측을 위한 마커로서도 유용하게 쓰일 수 있다. 이렇듯 마이크로 RNA 마커의 환경유해물질 노출 및 독성기작 예측에서의 역할이 매우 중요하다고 할 수 있음에도 불구하고 현재 마이크로 RNA 관련 연구는 주로 질병 진단용 마커 발굴에 국한되어 있으며 다양한 환경 중에 노출 가능성이 매우 큰 다환방향족 탄화수소류와 같은 유해물질 노출에 의한 마이크로 RNA의 발현 변화에 대한 연구는 부족하다. 또한, 후성유전학적 변화는 유전자의 발현과 같은 유전학적 변화의 다양성에 비해 그 정도가 심하지 않게 때문에 다수의 마커가 필요한 유전자 발현 프로파일링에 비해서 단 하나의 마이크로 RNA나 DNA 메틸레이션과 같은 유전자 외적(epigenetic) 마커로도 질병이나 유해물질 노출을 초기에 진단할 수 있다는 장점뿐만 아니라 비침습적 방법으로 진단할 수 있다는 이점이 있다. 각 마이크로 RNA가 다양한 표적 유전자들을 조절하고 고등진핵생물에서는 천여 개의 마이크로 RNA가 존재하기 때문에 마이크로 RNA에 의해 조절될 수 있는 잠재적인 회로가 막대할 것이라고 예상하고 있다.
In addition, microRNA markers are expected to be useful in predicting the exposure of certain environmentally harmful substances. Until now, research on the changes in genes (mRNA) and their association with diseases has been conducted mainly due to exposure of environmentally harmful substances. Changes in the expression of microRNAs following exposure to harmful substances such as arsenic or RDX were observed, and microRNAs with specific expression changes and their target genes were presented as markers for harmful substances (Baccarelli, A. & Bollati, V. Curr . Opin . Prediatr . 21, 243-251, 2009). In addition, the excavated micro RNA may be useful as a marker for predicting the exposure mechanism as well as a marker for predicting exposure as well as a regulator for controlling expression of a target gene. Despite the fact that the role of microRNA markers in the exposure of environmentally harmful substances and the prediction of toxic mechanisms are very important, the current research on microRNAs is mainly limited to the discovery of markers for diagnosis of diseases, and polycyclic aromatics with a high possibility of exposure in various environments. There is a lack of research on changes in the expression of microRNAs due to exposure to harmful substances such as hydrocarbons. Also, epigenetic changes are not so severe compared to the diversity of genetic changes, such as gene expression, so compared to gene expression profiling, which requires multiple markers, extraneous genes such as microRNA or DNA methylation ( Epigenetic markers have the advantage of being able to diagnose disease or exposure to harmful substances early, as well as noninvasive methods. It is expected that potential microRNA-controlled circuits will be enormous because each microRNA controls a variety of target genes and there are a thousand microRNAs in higher eukaryotes.

다환 방향족 탄화수소류 중에서 벤조케이플루오란텐은 화재로부터 불완전 연소에 의해 자연적으로 발생하거나, 가솔린, 담배연기 또는 자동차 배기가스 등에서 발생한다. 벤조케이플루오란텐은 상업적으로 생산되는 물질은 아니지만 주로 연구목적으로 생산되어진다. Among polycyclic aromatic hydrocarbons, benzokayfluoranthene is naturally generated by incomplete combustion from a fire, or is generated from gasoline, tobacco smoke or automobile exhaust gas. Benzokeifluoranthene is not a commercially produced material but is mainly produced for research purposes.

벤조케이플루오란텐은 휘발성이 없어서 토양 중 이동성이 아주 미미하며, 토양중 반감기는 65일에서 1400일 정도이다. 물 표면에서의 휘발성도 거의 없어서, 주로 저질과 부유물질에 흡착되고, 수중에서의 가수분해반응은 일어나지 않으며 수생생물 중 생물농축이 매우 높은 것으로 알려져 있다. 대기 중에서는 입자 상태로만 존재하여 주로 물리적인 방법으로 제거될 수 있다. 또한 태양광에 강하게 흡착하여 환경 중에서 직접적인 광분해반응이 일어난다. 국내 식품 중 다환방향족 탄화수소류의 오염도 조사연구에서 전국 9개 도시에서 유통되는 육류, 육류 가공품 및 유지류의 벤조케이플루오란텐의 함량을 조사한 결과 훈연제품, 가금류 식품, 육류에서 0.041~0.221 ㎍/㎏으로 검출되었고(김명철 등, 2001), 식용유지에서 평균 0.16 ㎍/㎏으로 조사되었다(이종옥 등, 2002). Benzokeifluoranthene has no volatility, so mobility in soil is very small, and half-life in soil is 65 to 1400 days. There is also little volatility on the surface of water, so it is mainly adsorbed to low quality and suspended solids, hydrolysis reaction does not occur in water and it is known that bioaccumulation is very high in aquatic organisms. It exists only in particulate form in the atmosphere and can be removed primarily by physical means. It is also strongly adsorbed by sunlight, causing a direct photolysis reaction in the environment. Contamination degree of polycyclic aromatic hydrocarbons in Korean foods was examined in the content of benzokayfluoranthene in meats, processed meats and fats and oils distributed in nine cities nationwide. (Kim, Myung-chul et al., 2001), and the average value of 0.16 μg / kg in edible oil and fat was investigated (Lee Jong-ok et al., 2002).

동물실험에서 벤조케이플루오란텐은 위 장관 및 폐에서 빠르게 흡수되고, 지질에 잘 녹으며 표피 막을 통과할 수 있다. 장기에서의 부산물은 오랫동안 잔류하며 장기간 노출로 인하여 축적된다는 보고가 있다(Ericson G et al, 1999). 벤조케이플루오란텐은 강한 AHH(acryl hydrocarbon hydroxylase) 유도인자이다. 벤조케이플루오란텐은 쥐에서 8,9-다이하이드로-8,9-다이하이드록시 벤조케이플루오란텐으로 대사되어 궁극적으로 유전독성 및 발암성을 일으키는 것으로 보고되고 있다(HSDB). In animal experiments, benzokayfluoranthene is rapidly absorbed in the gastrointestinal tract and lungs, soluble in lipids and able to cross the epidermal membrane. Long-term by-products have long been reported and accumulate from prolonged exposure (Ericson G et al, 1999). Benzokeifluoranthene is a strong AHH (acryl hydrocarbon hydroxylase) inducer. Benzokeifluoranthene is reported to be metabolized to 8,9-dihydro-8,9-dihydroxy benzokefluoranthene in mice and ultimately to genotoxicity and carcinogenicity (HSDB).

또한, 벤조케이플루오란텐은 세계보건기구(WHO) 산하의 국제암연구기관(IARC)에서 '인체 발암 가능성 물질'인 2B등급으로 분류하고 있으며(IARC, IARC Monogr. Eval . Carcinog . Risks Hum . 82, 367-435, 2002), 미국 환경부의 발암성 분류 등급에서는 '잠재적인 인체 발암물질'로 발암성 C등급으로 구분하고 있다(IRIS, U.S. Environ . Protect . Agency http://www.epa.gov/iris/, 2003).
Benzokeifluoranthene is also classified by the International Cancer Research Organization (IARC) under the World Health Organization (IARC) as a class 2B, which is a potential human carcinogen (IARC, IARC Monogr. Eval . Carcinog . Risks) . Hum . 82, 367-435, 2002), the U.S. Department of Environment's carcinogenicity classification class is classified as 'potential human carcinogen' as carcinogenic C class (IRIS, US Environ . Protect . Agency http: //www.epa. gov / iris /, 2003).

다환방향족 탄화수소류의 발암성 정도와 유전자 발현 변화에 대한 연구는 일부 보고되고 있지만, 대표적인 다환방향족 탄화수소류로 알려진 벤조에이파이렌(Benzo[a]pyrene)에 대한 연구에 거의 국한되어 있다. 앞서 설명한 바와 같이 벤조케이플루오란텐의 노출은 인간에 발암 가능성 뿐 아니라 다양한 질병에 대한 가능성을 나타내고 있음에도 불구하고 인체에서의 위해도 평가 데이터가 충분하지 않고, 마이크로 RNA와 같은 후성유전체적 영향에 대한 연구는 거의 전무하다. Although some studies on the degree of carcinogenicity and gene expression of polyaromatic hydrocarbons have been reported, they are almost limited to the study of Benzo [a] pyrene, which is known as a representative polycyclic aromatic hydrocarbons. As described above, although exposure to benzokefluoranthene has not only carcinogenic potential to humans but also potential for various diseases, there is not enough risk assessment data in humans, and it has been found that epigenetic effects such as microRNAs may not be sufficient. There is almost no research.

근래에 들어 마이크로어레이 칩이 보편화되어 질병 진단을 위한 다양한 실험에 사용됨에도 불구하고 환경유해물질 노출에 대한 검색은 여전히 GC-MS(Gas Chromatography-Mass Spectrometer) 또는 HPLC(High Performance Liquid Chromatography) 등의 고전적인 방법을 사용하여 이루어지고 있다. GC-MS 또는 HPLC 방법 등을 이용하면 정량은 가능하나 분석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 보다 빠르고 간편한 스크리닝(screening) 방법, 예를 들면 마이크로어레이 칩 또는 프라이머(primer)를 이용하는 실시간(real-time) PCR(Real-time reverse transcript polymerase chain reaction) 등으로 신속한 위해성 평가를 통해 인체에서의 독성작용, 특히 암을 비롯한 다양한 질병 유발에 관여하는 마이크로 RNA 발현 변화 여부 등을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 벤조케이플루오란텐의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다.
Although microarray chips have been widely used in various experiments for diagnosis of diseases, the search for exposure to environmentally harmful substances is still performed by GC-MS (Gas Chromatography-Mass Spectrometer) or HPLC (High Performance Liquid Chromatography) And the like. Quantification is possible using GC-MS or HPLC methods, but appropriate conditions for analysis are required and expensive equipment is required. Therefore, faster and easier screening methods, such as real-time reverse transcript polymerase chain reaction (PCR) using microarray chips or primers, allow for rapid risk assessment in humans. It is important to identify and utilize molecular indicators that can detect toxic effects, in particular the changes in microRNA expression involved in various diseases, including cancer, and to take appropriate measures and control against exposure of benzokayfluoranthene. It's a task.

1997년 처음으로 마이크로 RNA가 밝혀진 이래 포유류, 미생물 등 여러 종의 마이크로 RNA가 급속도로 밝혀져 Sanger miRBASE 데이터베이스(database)에 보고되었다(http://www.mirbase.org/index.shtml). 이렇게 밝혀진 마이크로 RNA 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 한 번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 마이크로어레이(microarray) 분석을 수행한다(Schena, M, et al. Proc . Natl . Acad . Sci . USA 93, 10614-10619, 1996). Since the first microRNAs were discovered in 1997, several species of microRNAs, including mammals and microorganisms, have been rapidly identified and reported in the Sanger miRBASE database (http://www.mirbase.org/index.shtml). Genome-wide expression studies are being conducted to study the function of genes based on the microRNA data. Microarray analysis is performed to analyze the expression of thousands of genes in one experiment (Schena, M, et al. Proc . Natl . Acad . Sci . USA) . 93, 10614-10619,1996).

마이크로어레이는 cDNA(complementary DNA)나 20 - 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 Agilent, Genomic Solutions 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화 하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(Sellheyer K. et. al. J. Am . Acad . Dermatol . 51, 681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 Affymetrix사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어 지고 있으며, Agillent사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(Sellheyer, K. et. al. J. Am . Acad . Dermatol . 51, 681-692, 2004).A microarray is a collection of cDNA (complementary DNA) or a set of oligonucleotides of 20-25 base pairs in length on glass. cDNA microarrays are produced either by in-house laboratories or by companies such as Agilent, Genomic Solutions, etc., by mechanically immobilizing cDNA collections onto chips or by using ink jetting (Sellheyer K. et al., J. Am . acad. Dermatol. 51, 681-692, 2004). Oligonucleotide microarrays are made by Affymetrix's method of direct synthesis on a chip using photolithography, and Agillent's, etc., are produced by immobilizing synthesized oligonucleotides (Sellheyer, K.). et al. J. Am . Acad . Dermatol . 51, 681-692, 2004).

유전자의 발현을 분석을 위해서는 조직 등 시료에서 마이크로 RNA를 얻어 마이크로어레이에 있는 올리고뉴클레오티드와 교잡반응을 수행한다. 얻어진 마이크로 RNA는 형광이나 동위원소로 표지화 한다. To analyze gene expression, microRNAs are obtained from samples such as tissues and hybridized with oligonucleotides in microarrays. The obtained microRNA is labeled with fluorescence or isotope.

마이크로어레이를 통해 유전자 발현을 측정하는 방법으로는 크게 두 개의 염료(two-dye) 방식과 한 개의 염료(one-dye) 방식이 있다. 상보결합 반응을 측정할 때, 대조군 샘플과 실험군 샘플에 각각 두 개의 다른 형광(예: Cye3 및 Cye5)으로 표지한 후 마이크로어레이에서 반응시켜 측정하는 방식을 두 개의 염료 마이크로어레이(two-dye microarray) 라고 하고, 두 샘플에 동일한 형광을 입힌 후 두 개의 서로 다른 마이크로어레이에서 반응시켜 측정하는 방식을 한 개의 염료 마이크로어레이(one-dye microarray) 라고 한다(Vivian, G. et al. Nature 21, 15-19, 1999).As a method of measuring gene expression through microarray, there are largely two dyes (two-dye) method and one dye (one-dye) method. When measuring the complementary binding reaction, two different dye microarrays were measured by labeling the control sample and the experimental sample with two different fluorescences (for example, Cye3 and Cye5) and then reacting them in a microarray. The same fluorescence is applied to two samples and then reacted in two different microarrays to be measured as one-dye microarray (Vivian, G. et al. Nature 21, 15- 19, 1999).

최근 DNA 마크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신의약 후보물질은 물론 대표적인 환경오염물질을 비롯해 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 마이크로 RNA들의 발현 패턴의 분석, 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 마이크로 RNA의 발현 빈도를 분석함으로써 약물의 부작용 및 환경오염물질의 유해작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 환경오염물질의 유해작용과 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색 및 확인이 가능하게 될 것이다.
In combination with recent research on toxic genomics (Toxicogenomics), an advanced technique using DNA macroarray technology, high-throughput expression in specific tissues or cell lines by all chemicals, including pharmaceuticals and new drug candidates, as well as representative environmental pollutants Analysis and quantitative analysis of expression patterns of microRNAs are now possible. Accordingly, by analyzing the frequency of expression of specific microRNAs in specific cells, it is possible to discover genes related to the adverse effects of drugs and the harmful effects of environmental pollutants. Molecular mechanisms will be understood, and further, the detection and identification of substances that cause toxicity and side effects will be possible.

이에 본 발명자들은 인간 마이크로 RNA 887개가 집적된 올리고마이크로어레이를 이용하여 세포독성을 나타내지 않는 농도인 1μM 또는 80%의 세포생존율을 보이는 농도인 22.56μM로 처리한 벤조케이플루오란텐의 마이크로 RNA 발현 프로파일을 인간 간암 세포인 HepG2 세포주에서 관찰 및 분석한 결과, 두 가지 농도의 벤조케이플루오란텐에 의해 발현이 변화되는 마이크로 RNA를 발굴함으로써, 상기 마이크로 RNA를 이용하여 두 가지 농도의 벤조케이플루오란텐 노출 여부를 확인할 수 있는 방법을 확립함으로써 본 발명을 완성하였다.
Accordingly, the present inventors have used micro oligomicroarrays in which 887 human microRNAs are integrated, and the microRNA expression profile of benzokayfluoranthene treated with 22.56 μM of 1 μM or 80% of cell viability. Was observed and analyzed in HepG2 cell line, which is a human liver cancer cell, and as a result, the microRNAs whose expression was changed by two concentrations of benzokayfluoranthene were identified. The present invention has been completed by establishing a method of confirming exposure.

본 발명의 목적은 인체에 다양한 질병을 유발하는 등 독성작용을 갖는 벤조케이플루오란텐(benzo[k]fluoranthene)의 노출 여부 확인용 마이크로 RNA를 제공하는 것이다.An object of the present invention is to provide a micro RNA for confirming the exposure of benzo k fluoranthene (benzo [k] fluoranthene) having a toxic effect such as causing various diseases in the human body.

본 발명의 또 다른 목적은 상기 본 발명에 따른 마이크로 RNA를 이용하여 벤조케이플루오란텐의 노출 여부 확인 방법을 제공하는 것이다.
Still another object of the present invention is to provide a method for confirming exposure of benzokayfluoranthene using the microRNA according to the present invention.

상기 목적을 달성하기 위하여, 하기의 군으로부터 선택되는 어느 하나 이상의 마이크로 RNA 또는 그의 상보가닥 분자가 집적된, 벤조케이플루오란텐(benzo[k]fluoranthene) 노출 여부 확인용 마이크로어레이 칩을 제공한다: In order to achieve the above object, there is provided a microarray chip for checking whether benzo [k] fluoranthene is exposed, in which any one or more microRNAs or complementary strand molecules thereof are selected from the following group:

마이크로 RNA 등록번호 (miRbase) MIMAT0000063 (hsa-let-7b, Homo sapiens let-7b);Micro RNA Registry No. (miRbase) MIMAT0000063 (hsa-let-7b, Homo sapiens let-7b);

마이크로 RNA 등록번호 (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);Micro RNA accession number (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);

마이크로 RNA 등록번호 (miRbase) MIMAT0004587 (hsa-miR-23b*, Homo sapiens miR-23b*);Micro RNA accession number (miRbase) MIMAT0004587 (hsa-miR-23b *, Homo sapiens miR-23b *);

마이크로 RNA 등록번호 (miRbase) MIMAT0000086 (hsa-miR-29a, Homo sapiens miR-29a);Micro RNA accession number (miRbase) MIMAT0000086 (hsa-miR-29a, Homo sapiens miR-29a);

마이크로 RNA 등록번호 (miRbase) MIMAT0004514 (hsa-miR-29b-1*, Homo sapiens miR-29b-1*);Micro RNA Registry No. (miRbase) MIMAT0004514 (hsa-miR-29b-1 *, Homo sapiens miR-29b-1 *);

마이크로 RNA 등록번호 (miRbase) MIMAT0000256 (hsa-miR-181a, Homo sapiens miR-181a);Micro RNA Registry No. (miRbase) MIMAT0000256 (hsa-miR-181a, Homo sapiens miR-181a);

마이크로 RNA 등록번호 (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b);Micro RNA Registry No. (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b);

마이크로 RNA 등록번호 (miRbase) MIMAT0002821 (hsa-mir-181d, Homo sapiens miR-181d);Micro RNA Registry No. (miRbase) MIMAT0002821 (hsa-mir-181d, Homo sapiens miR-181d);

마이크로 RNA 등록번호 (miRbase) MIMAT0004560 (hsa-miR-183*, Homo sapiens miR-183*);Micro RNA accession number (miRbase) MIMAT0004560 (hsa-miR-183 *, Homo sapiens miR-183 *);

마이크로 RNA 등록번호 (miRbase) MIMAT0000228 (hsa-miR-198, Homo sapiens miR-198);Micro RNA Registry No. (miRbase) MIMAT0000228 (hsa-miR-198, Homo sapiens miR-198);

마이크로 RNA 등록번호 (miRbase) MIMAT0000617 (hsa-miR-200c, Homo sapiens miR-200c);Micro RNA accession number (miRbase) MIMAT0000617 (hsa-miR-200c, Homo sapiens miR-200c);

마이크로 RNA 등록번호 (miRbase) MIMAT0004568 (hsa-miR-221* Homo sapiens miR-221*);Micro RNA accession number (miRbase) MIMAT0004568 (hsa-miR-221 * Homo sapiens miR-221 *);

마이크로 RNA 등록번호 (miRbase) MIMAT0000764 (hsa-miR-339-5p, Homo sapiens miR-339-5p);Micro RNA accession number (miRbase) MIMAT0000764 (hsa-miR-339-5p, Homo sapiens miR-339-5p);

마이크로 RNA 등록번호 (miRbase) MIMAT0000710 (hsa-miR-365, Homo sapiens miR-365);Micro RNA accession number (miRbase) MIMAT0000710 (hsa-miR-365, Homo sapiens miR-365);

마이크로 RNA 등록번호 (miRbase) MIMAT0003884 (hsa-miR-454*, Homo sapiens miR-454*);Micro RNA accession number (miRbase) MIMAT0003884 (hsa-miR-454 *, Homo sapiens miR-454 *);

마이크로 RNA 등록번호 (miRbase) MIMAT0004800 (hsa-miR-550, Homo sapiens miR-550);Micro RNA accession number (miRbase) MIMAT0004800 (hsa-miR-550, Homo sapiens miR-550);

마이크로 RNA 등록번호 (miRbase) MIMAT0003228 (hsa-miR-564, Homo sapiens miR-564);Micro RNA accession number (miRbase) MIMAT0003228 (hsa-miR-564, Homo sapiens miR-564);

마이크로 RNA 등록번호 (miRbase) MIMAT0004795 (hsa-miR-574-5p, Homo sapiens miR-574-5p);Micro RNA Registry No. (miRbase) MIMAT0004795 (hsa-miR-574-5p, Homo sapiens miR-574-5p);

마이크로 RNA 등록번호 (miRbase) MIMAT0003249 (hsa-miR-584, Homo sapiens miR-584);Micro RNA Registry No. (miRbase) MIMAT0003249 (hsa-miR-584, Homo sapiens miR-584);

마이크로 RNA 등록번호 (miRbase) MIMAT0003296 (hsa-miR-627, Homo sapiens miR-627);Micro RNA Registry No. (miRbase) MIMAT0003296 (hsa-miR-627, Homo sapiens miR-627);

마이크로 RNA 등록번호 (miRbase) MIMAT0004809 (hsa-miR-628-5p, Homo sapiens miR-628-5p);Micro RNA Registry No. (miRbase) MIMAT0004809 (hsa-miR-628-5p, Homo sapiens miR-628-5p);

마이크로 RNA 등록번호 (miRbase) MIMAT0004810 (hsa-miR-629, Homo sapiens miR-629);Micro RNA Registry No. (miRbase) MIMAT0004810 (hsa-miR-629, Homo sapiens miR-629);

마이크로 RNA 등록번호 (miRbase) MIMAT0004957 (hsa-miR-760, Homo sapiens miR-760);Micro RNA Registry No. (miRbase) MIMAT0004957 (hsa-miR-760, Homo sapiens miR-760);

마이크로 RNA 등록번호 (miRbase) MIMAT0004949 (hsa-miR-877, Homo sapiens miR-877);Micro RNA accession number (miRbase) MIMAT0004949 (hsa-miR-877, Homo sapiens miR-877);

마이크로 RNA 등록번호 (miRbase) MIMAT0005825 (hsa-miR-1180, Homo sapiens miR-1180); 및Micro RNA accession number (miRbase) MIMAT0005825 (hsa-miR-1180, Homo sapiens miR-1180); And

마이크로 RNA 등록번호 (miRbase) MIMAT0011775 (hsa-miR-2276, Homo sapiens miR-2276).Micro RNA Registry No. (miRbase) MIMAT0011775 (hsa-miR-2276, Homo sapiens miR-2276).

또한, 본 발명은 상기 마이크로어레이 칩을 포함하는 벤조케이플루오란텐 노출 여부 확인용 키트를 제공한다.In addition, the present invention provides a kit for confirming exposure of benzokayfluoranthene including the microarray chip.

또한, 하기의 군으로부터 선택되는 어느 하나의 마이크로 RNA에 상보적이고, 상기 마이크로 RNA를 증폭할 수 있는 프라이머쌍을 포함하는 벤조케이플루오란텐 노출 여부 확인용 키트를 제공한다:The present invention also provides a kit for confirming exposure of benzokayfluoranthene, comprising a primer pair complementary to any one of the following microRNAs selected from the group below and capable of amplifying the microRNAs:

또한, 본 발명은In addition,

1) 실험군인 피검개체로부터 분리된 체세포 및 대조군인 정상개체로부터 분리된 체세포에서 각각의 RNA를 분리하는 단계;1) isolating respective RNAs from somatic cells isolated from the test subject in the experimental group and somatic cells isolated from the normal individuals as the control group;

2) 단계 1)의 실험군 및 대조군의 RNA를 각각 다른 형광물질로 표지하는 단계;2) labeling the RNA of the experimental group and the control group of step 1) with different fluorescent materials;

3) 단계 2)의 형광물질로 표지된 RNA를 상기 마이크로어레이 칩과 혼성화시키는 단계;3) hybridizing the RNA labeled with the fluorescent material of step 2) with the microarray chip;

4) 단계 3)의 반응한 마이크로어레이 칩을 분석하는 단계; 및4) analyzing the reacted microarray chip of step 3); And

5) 단계 4)의 분석한 데이터에서 실험군의 상기 마이크로어레이 칩에 집적된 마이크로 RNA의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 벤조케이플루오란텐에 대한 마이크로 RNA 발현 여부 확인 방법을 제공한다.5) provides a method of confirming the expression of micro RNA for benzoke fluoranthene comprising the step of confirming the expression level of the micro RNA integrated in the microarray chip of the experimental group in the analyzed data of step 4) compared to the control group do.

아울러, 본 발명은In addition,

2) 단계 1)의 실험군 및 대조군의 RNA를 각각 cDNA로 합성하는 단계;2) synthesizing RNA of the experimental group and the control group of step 1) into cDNA, respectively;

3) 단계 2)의 실험군 및 대조군의 cDNA를 각각 상기 마이크로어레이 칩에 집적된 마이크로 RNA를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및3) performing real-time reverse transcript polymerase chain reaction (RT-PCR) using primers capable of amplifying the microRNAs integrated in the microarray chip into the cDNA of the experimental group and the control group of step 2), respectively; And

4) 단계 3)의 실험군의 증폭산물의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 벤조케이플루오란텐에 대한 마이크로 RNA 발현 여부 확인 방법을 제공한다.
4) It provides a method of confirming the expression of micro RNA for benzoke fluoranthene comprising the step of confirming the expression level of the amplification product of the experimental group of step 3) compared to the control group.

본 발명은 벤조케이플루오란텐(benzo[k]fluoranthene) 노출에 의해 2배 이상 과발현되는 26종의 마이크로 RNA를 선별함으로써, 이들 26종의 마이크로 RNA를 바이오마커로 이용하여 벤조케이플루오란텐의 모니터링 및 위해성을 판정하는데 유용하게 사용할 수 있으며, 벤조케이플루오란텐에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있다.
The present invention selects 26 microRNAs that are overexpressed two or more times by benzo [k] fluoranthene exposure, thereby using the 26 microRNAs as biomarkers. It can be usefully used for monitoring and determining risk, and can be used as a tool for identifying mechanisms of toxic effects caused by benzokefluoranthene.

도 1은 벤조케이플루오란텐(benzo[k]fluoranthene)의 인간 간암 세포주에서의 세포 독성을 나타내는 그림이다.
도 2는 마이크로 RNA 마이크로어레이 칩을 이용한 벤조케이플루오란텐을 처리한 인간 간암 세포주의 마이크로 RNA 발현 양상을 분석한 결과를 나타내는 그림이다.
도 3은 벤조케이플루오란텐에서 공통적으로 발현이 변화한 6종의 마이크로 RNA의 올리고마이크로어레이 칩과 실시간 RT-PCR(real-time reverse transcript polymerase chain reaction)에서의 발현 양상을 비교한 결과를 나타내는 그림이다. 1 is a diagram showing the cytotoxicity of benzo [k] fluoranthene in human liver cancer cell line.
Figure 2 is a diagram showing the results of analyzing the microRNA expression of human liver cancer cell lines treated with benzokayfluoranthene using a microRNA microarray chip.
Figure 3 shows the results of comparing the expression pattern in the real-time reverse transcript polymerase chain reaction (RT-PCR) of the oligomicroarray chip of the six kinds of microRNAs in which the expression is commonly changed in benzokayfluoranthene Picture.

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 벤조케이플루오란텐(benzo[k]fluoranthene)의 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 벤조케이플루오란텐 노출 여부 확인용 바이오마커를 제공한다.The present invention provides a biomarker for confirming whether or not benzokayfluoranthene is exposed by causing the expression change by exposure to benzokayfluoranthene (benzo [k] fluoranthene).

상기 바이오마커는 두 가지 농도의 벤조케이플루오란텐 노출에 의해 공통적으로 2배 이상 발현이 증가한 마이크로 RNA로 구성되어 있다.The biomarker is composed of microRNAs that have more than twofold increased expression in common by exposure to two concentrations of benzokayfluoranthene.

상기 두 가지 농도는 구체적으로 1μM 또는 22.56μM이나 이에 한정되지 않는다. The two concentrations are specifically 1 μM or 22.56 μM, but are not limited thereto.

상기 바이오마커는 하기와 같이 구성된 군에서 선택되는 것이나 이에 한정되지 않는다:The biomarker is selected from the group consisting of but not limited to:

마이크로 RNA 등록번호 (miRbase) MIMAT0011775 (hsa-miR-2276, Homo sapiens miR-2276).
Micro RNA Registry No. (miRbase) MIMAT0011775 (hsa-miR-2276, Homo sapiens miR-2276).

본 발명자들은 벤조케이플루오란텐에 대한 마이크로 RNA 발현 여부 확인용 바이오마커를 발굴하기 위하여, 벤조케이플루오란텐을 인간 간암 세포주(HepG2)에 처리하여 세포독성을 확인하였다. 그 결과, 상기 벤조케이플루오란텐은 인간 간암 세포주에 독성이 있음이 확인되었고(도 1 참조), 상기 실험을 바탕으로 벤조케이플루오란텐의 농도(세포독성을 나타내지 않는 농도:NT, 세포 생존율 80%인 농도:IC₂₀)를 결정하였다. 이후 상기 결정된 두 가지 농도로 벤조케이플루오란텐을 인간 간암 세포주에 처리하고, 상기 물질을 처리한 세포주에서 마이크로 RNA를 포함하는 총 RNA를 분리하여 형광물질(Cy3)로 표지하였다. 상기 형광표지된 마이크로 RNA를 Agilent Human miRNA array v14.0(Agilent, USA)와 혼성화하였고, 형광 이미지를 스캔하여 유전자 발현 양상의 차이를 분석하였다. 분석시 실험군/대조군의 신호 강도(signal intensity) 비율이 2.0배 이상인 경우 발현 증가한 유전자로 분류하였고, 0.5배 이하인 경우 발현 감소한 유전자로 분류하였다. 그 결과, NT 농도로 벤조케이플루오란텐을 처리한 샘플에서 발현 증가한 마이크로 RNA는 5.07%(887개의 마이크로 RNA 중 45개)이고 발현이 감소한 마이크로 RNA는 없음을 확인하였고 IC₂₀ 농도로 벤조케이플루오란텐을 처리한 샘플에서 발현이 증가한 마이크로 RNA는 7.78%(887개의 마이크로 RNA 중 69개), 발현이 감소한 마이크로 RNA는 0.11%(887개의 마이크로 RNA 중 1개)임을 확인하였다(도 2 참조). 이때, NT과 IC₂₀의 벤조케이플루오란텐 모두에 의해 공통적으로 발현이 2배 이상 과발현, 저발현되는 마이크로 RNA가 26종 (과발현 26종, 저발현 0종) 이었으며 (표 1 참조) 이들 마이크로 RNA들은 본 발명에서 사용한 벤조케이플루오란텐을 처리했을 때, 인간 간암 세포에서 독성과 관련이 있다는 보고는 없다.
The present inventors, in order to find a biomarker for confirming the expression of micro RNA for benzokay fluoranthene, was treated with benzokay fluoranthene in human liver cancer cell line (HepG2) to confirm the cytotoxicity. As a result, it was confirmed that the benzokayfluoranthene is toxic to human liver cancer cell line (see FIG. 1), and based on the experiment, the concentration of benzokayfluoranthene (concentration not showing cytotoxicity: NT, cell viability) A concentration of 80%: IC ₂₀ ) was determined. Thereafter, benzokayfluoranthene was treated to human liver cancer cell lines at the two concentrations determined above, and total RNA including microRNAs was isolated from the cell line treated with the substance and labeled with fluorescent material (Cy3). The fluorescently labeled microRNAs were hybridized with Agilent Human miRNA array v14.0 (Agilent, USA), and the fluorescence images were scanned to analyze differences in gene expression patterns. In the analysis, when the signal intensity ratio of the experimental group / control group was 2.0 times or more, it was classified as an increased expression gene, and when it was 0.5 times or less, it was classified as an expression reduced gene. As a result, NT concentration of benzo K fluoran micro RNA increased expression in samples treated with X is benzo K-fluoro (45 out of 887 Micro RNA) 5.07%, and micro RNA expression was decreased was confirmed not to IC ₂₀ concentration The increased expression in the lanten treated samples was 7.78% (69 out of 887 microRNAs) and 0.11% (1 out of 887 microRNAs) with reduced expression (see FIG. 2). . At this time, 26 species of microRNAs overexpressed and underexpressed more than 2 times in common by both benzokayfluoranthenes of NT and IC ₂₀ (26 overexpressions, 0 low expression species) (see Table 1). RNAs have not been reported to be toxic in human liver cancer cells when treated with benzokefluoranthene used in the present invention.

본 발명자들은 상기 유전자 중 과발현된 유전자 6종을 분리하여, 실시간 RT-PCR(real-time reverse transcript polymerase chain reaction) 방법으로 발현 양상을 조사하였다. 그 결과, 6종의 과발현 유전자들의 발현 양상이 올리고마이크로어레이 칩 결과와 유사하게 나타남을 확인하였다(도 3, 표 5 참조). 이들 유전자들은 마이크로 RNA 등록번호 (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);The present inventors isolated the six overexpressed genes, and examined the expression pattern by real-time reverse transcript polymerase chain reaction (RT-PCR) method. As a result, it was confirmed that the expression patterns of the six over-expression genes appear similar to the oligomicroarray chip results (see FIG. 3, Table 5). These genes include micro RNA Accession Number (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);

마이크로 RNA 등록번호 (miRbase) MIMAT0004568 (hsa-miR-221*, Homo sapiens miR-221*);Micro RNA accession number (miRbase) MIMAT0004568 (hsa-miR-221 *, Homo sapiens miR-221 *);

마이크로 RNA 등록번호 (miRbase) MIMAT0002821 (hsa-mir-181d, Homo sapiens miR-181d); 및Micro RNA Registry No. (miRbase) MIMAT0002821 (hsa-mir-181d, Homo sapiens miR-181d); And

마이크로 RNA 등록번호 (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b) 등이다.Micro RNA accession number (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b) and the like.

또한, 본 발명은 상기 바이오마커 마이크로 RNA 서열의 전부 또는 일부를 포함하는 올리고뉴클레오티드 또는 그의 상보 가닥 분자가 합성/집적된 벤조케이플루오란텐에 대한 노출 여부 확인용 마이크로 RNA 마이크로어레이 칩을 제공한다.The present invention also provides a microRNA microarray chip for confirming whether or not an oligonucleotide including all or a part of the biomarker microRNA sequence or its complementary strand molecule is exposed to benzokayfluoranthene synthesized / integrated.

상기 올리고 뉴클레오티드 또는 이의 상보가닥 분자는 상기 바이오마커 마이크로 RNA의 15 내지 20개의 핵산을 포함한다. The oligonucleotide or complementary strand molecule thereof comprises 15 to 20 nucleic acids of the biomarker microRNA.

본 발명의 벤조케이플루오란텐 검색용 마이크로 RNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 구체적으로 상기 탐색된 바이오마커를 탐침 마이크로 RNA 분자로 이용하여 칩의 기판상에 고정화시키기 위해 잉크젯(inkjet) 방식 등을 사용하는 것이나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 SurePrint 잉크젯 마이크로 드롭핑 마이크로어레이(inkjet micro dropping microarray)를 이용하였다. 상기 DNA 마이크로어레이 칩의 기판은 구체적으로 에폭시(epoxy), 아미노-실란(amino-silane), 폴리-엘-리신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이나 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나 이에 제한되는 것은 아니며, 본 발명의 바람직한 실시예에서는 에폭시가 코팅된 슬라이드 글래스를 이용하였다.
The microRNA microarray chip for benzokayfluoranthene retrieval of the present invention can be produced by methods known to those skilled in the art. A method of fabricating the microarray chip is as follows. Specifically, an inkjet method or the like is used to immobilize the searched biomarker as a probe microRNA molecule on a chip substrate, but is not limited thereto. In a preferred embodiment of the present invention, a SurePrint inkjet micro drop is used. An inkjet micro dropping microarray was used. The substrate of the DNA microarray chip is specifically formed of one active group selected from the group consisting of epoxy, amino-silane, poly-L-lysine and aldehyde But is not limited thereto. The substrate may be selected from the group consisting of a slide glass, a plastic, a metal, a silicon, a nylon film, and a nitrocellulose membrane. However, the substrate is not limited thereto. In a preferred embodiment of the present invention, Slide glass was used.

또한, 본 발명은 상기 바이오마커를 이용한 벤조케이플루오란텐에 대한 마이크로 RNA 발현 여부를 확인하는 방법을 제공한다.In addition, the present invention provides a method for confirming the expression of micro RNA for benzokayfluoranthene using the biomarker.

구체적으로, 상기 방법은 하기와 같이 수행할 수 있다.Specifically, the method may be performed as follows.

3) 단계 2)의 형광물질로 표지된 RNA를 본 발명에 따른 마이크로어레이 칩과 혼성화시키는 단계;3) hybridizing the fluorescently labeled RNA of step 2) with a microarray chip according to the present invention;

5) 단계 4)의 분석한 데이터에서 실험군의 본 발명에 따른 마이크로어레이 칩에 집적된 마이크로 RNA의 발현 정도를 대조군과 비교하여 확인하는 단계.5) Identifying the degree of expression of the microRNA integrated in the microarray chip according to the present invention of the test group by comparison with the control group in the analyzed data of step 4).

상기 방법에 있어서, 단계 1)의 체세포는 구체적으로 인간의 간 세포 또는 인간 간암 세포인 것이나 이에 한정되지 않고, 조직에서 유래한 세포라면 모두 사용 가능하다.In the above method, the somatic cells of step 1) are specifically human liver cells or human liver cancer cells, but are not limited thereto, and any somatic cells may be used.

상기 방법에 있어서, 인간 간암 세포는 구체적으로 HepG2이나 이에 한정되지 않는다.In the above method, human liver cancer cells are specifically HepG2 but not limited thereto.

상기 방법에 있어서, 단계 2)의 형광물질은 구체적으로 Cy3, Cy5, 폴리 엘-리신-플루오레세인 이소티오시안산염(poly L-lysine-fluorescein isothiocyanate, FITC), 로다민-비-이소티오시안산염(rhodamine-B-isothiocyanate, RITC) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되는 것이나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다.In the above method, the fluorescent material of step 2) is specifically selected from the group consisting of Cy3, Cy5, polyL-lysine-fluorescein isothiocyanate (FITC), rhodamine-non-isothiocyanate Rhodamine-B-isothiocyanate (RITC) and rhodamine, but any fluorescent material known to those skilled in the art can be used.

상기 방법에 있어서, 단계 4)의 마이크로 RNA 마이크로어레이 칩은 구체적으로 Agilent Human miRNA array v14.0(Agilent, USA)등을 사용하는 것이나 이에 한정되는 것은 아니며, 인간 마이크로 RNA 중 본 발명에서 상기 공통적으로 발현이 변화된 마이크로 RNA(표 1 참조)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, 가장 구체적인 것은 상기 본 발명자가 제작한 마이크로 RNA 마이크로어레이 칩을 사용하는 것이다. In the above method, the microRNA microarray chip of step 4) specifically uses Agilent Human miRNA array v14.0 (Agilent, USA) and the like, but is not limited thereto. Any microarray chip equipped with a microRNA (see Table 1) having a changed expression can be used, and most specifically, a microRNA microarray chip manufactured by the present inventors is used.

상기 방법에 있어서, 단계 4)의 분석 방법은 구체적으로 GeneSpring GX 11 소프트웨어(Agilent, USA)를 사용하는 것이나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.
In the above method, the analysis method of step 4) specifically uses GeneSpring GX 11 software (Agilent, USA), but is not limited thereto, and may use analysis software known to those skilled in the art.

또한, 본 발명은In addition,

3) 단계 2)의 실험군 및 대조군의 cDNA를 각각 본 발명에 따른 마이크로어레이 칩에 집적된 마이크로 RNA를 증폭할 수 있는 프라이머를 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및Real-time reverse transcriptase polymerase chain reaction (RT-PCR) was performed using primers capable of amplifying the microRNAs integrated in the microarray chip according to the present invention. ; And

4) 단계 3)의 실험군의 증폭산물의 발현 정도를 대조군과 비교하여 확인하는 단계를 포함하는 벤조케이플루오란텐에 대한 마이크로 RNA 발현 여부 확인 방법을 제공한다.4) It provides a method of confirming the expression of micro RNA for benzoke fluoranthene comprising the step of confirming the expression level of the amplification product of the experimental group of step 3) compared to the control group.

상기 방법에 있어서, 단계 3)의 프라이머는 본 발명에서 탐색된 바이오마커 마이크로 RNA를 증폭할 수 있는 프라이머라면 모두 사용가능하다.
In the above method, the primer of step 3) may be any primer capable of amplifying the biomarker microRNA of the present invention.

또한, 본 발명은 본 발명에 따른 마이크로어레이 칩을 포함하는 벤조케이플루오란텐 노출 여부 확인용 키트를 제공한다.In addition, the present invention provides a kit for confirming exposure of benzokayfluoranthene comprising a microarray chip according to the present invention.

상기 벤조케이플루오란텐에 대한 마이크로 RNA 발현 여부 확인용 키트는 추가적으로 인간 간 세포 또는 인간 간암 세포를 포함하는 것이나 이에 한정되지 않는다.The kit for confirming the expression of the micro RNA for the benzokayfluoranthene additionally includes, but is not limited to, human liver cells or human liver cancer cells.

상기 인간 간암 세포는 구체적으로 HepG2를 사용하는 것이나 이에 한정되는 것은 아니며, 인간의 간 세포 또는 인간 간암의 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다. Specifically, the human liver cancer cells may be used as HepG2, but are not limited thereto. Any human liver cancer cells may be used as long as they are derived from human liver cells or cells and tissues of human liver cancer.

상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 구체적으로 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이나 이에 한정되는 것은 아니며, 본 발명의 바람직한 실시예에서는 Cy3를 사용하였다. The kit may further include a fluorescent substance, and the fluorescent substance may be a strepavidin-like phosphatease conjugate, a chemiluminescent substance, and a chemiluminescent substance. But the present invention is not limited thereto. In the preferred embodiment of the present invention, Cy3 is used.

상기 키트에 추가적으로 반응 시약을 포함시킬 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 마이크로 RNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함시킬 수 있다.
In addition to the kit, the reaction reagent may include a buffer solution used for hybridization, a labeling reagent such as a chemical inducer of a fluorescent dye, a washing buffer solution, and the like, but is not limited thereto. Any reaction reagent necessary for the hybridization reaction of the microRNA microarray chip can be included.

아울러, 본 발명은 하기의 군으로부터 선택되는 어느 하나의 마이크로 RNA에 상보적이고, 상기 마이크로 RNA를 증폭할 수 있는 프라이머쌍을 포함하는 벤조케이플루오란텐 노출 여부 확인용 키트를 제공한다:In addition, the present invention provides a kit for confirming exposure of benzokayfluoranthene, comprising a primer pair complementary to any one of the microRNAs selected from the following group and capable of amplifying the microRNAs:

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

<< 실시예Example 1> 1> 벤조케이플루오란텐의Of benzokefluoranthene 세포독성 확인 Cytotoxicity check

<1-1> 세포배양<1-1> Cell culture

인간 간암 세포주인 HepG2 세포(한국 세포주 은행)를 10% FBS가 첨가된 DMEM 배지(Gibro-BRL, USA)를 이용하여 100 ㎜ 디쉬(dish)에서 80% 정도 자랄 때까지 배양하였다. 본 발명자들은 기존의 연구와 보고를 통해 다환방향족 탄화수소류의 하나로서 발암성을 가지고 있는 물질인 벤조케이플루오란텐을 선정하였으며, DMSO에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.
HepG2 cells (Korea Cell Line Bank), which is a human liver cancer cell line, were cultured in DMEM medium (Gibro-BRL, USA) to which 10% FBS was added until 80% growth in 100 mm dish. The present inventors have selected benzokayfluoranthene, a substance having carcinogenicity, as one of the polycyclic aromatic hydrocarbons through existing studies and reports, and dissolved it in DMSO. The vehicle concentration was less than 0.1% in all experiments.

<1-2> 세포 독성 실험(<1-2> Cytotoxicity Test MTTMTT assayassay ) 및 화학 물질 처리를 통한 ) And through chemical treatment 벤조케이플루오Benzokayfluor 란텐이 미치는 세포독성 여부 확인Determine the cytotoxicity of lanten

Mossman 등(J. Immunol . Methods, 65, 55-63, 1983)의 방법으로 HepG2 세포주를 이용한 MTT 실험을 수행하였다. 세포는 24-웰 플레이트에 4× 10⁵/웰 세포수로 DMEM 배지(Gibro-BRL, USA)에서 DMSO에 용해된 벤조케이플루오란텐을 처리하고 48시간 후에 MTT(3-4,5-dimethylthiazol-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3 시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해하였다. 96-웰 플레이트로 옮겨 분주(aliquot)하고 흡광도 540 nm에서 O.D.값을 측정하였다. MTT experiment using HepG2 cell line was performed by the method of Mossman et al . ( J. Immunol . Methods , 65, 55-63, 1983). Cells were treated with benzokefluoranthene dissolved in DMSO in DMEM medium (Gibro-BRL, USA) at 4 × 10 ⁵ / well cell counts in 24-well plates, and after 48 hours, MTT (3-4,5-dimethylthiazol). 5 mg / ml of -2,5-diphenyltetra zolium bromide) was added to the tube and incubated at 37 ° C. for 3 hours. The medium was then removed and the formazan crystal formed was dissolved in 500 μl of DMSO. Transfer to a 96-well plate was aliquoted and the OD value was measured at absorbance 540 nm.

그 결과, 도 1에서 보는 바와 같이 HepG2 세포주에서 벤조케이플루오란텐의 세포독성을 나타내지 않는 농도(NT)는 1 μM이고 80% 생존율을 보이는 농도(IC₂₀)는 22.56 μM 임을 확인하였다(도 1).
As a result, as shown in FIG. 1, it was confirmed that the concentration (NT) showing no cytotoxicity of benzokayfluoranthene in the HepG2 cell line (1 μM) and the concentration (IC ₂₀ ) showing 80% survival rate were 22.56 μM (FIG. 1). ).

<< 실시예Example 2> 2> 마이크로어레이Microarray 실험을 통한 Through experiment 벤조케이플루오란텐에Benzokefluoranthene 의한 마이크로 By micro RNARNA 발현 양상 확인 Expression pattern confirmation

<2-1> 표적 마이크로 <2-1> target micro RNARNA 의 분리Separation of

6 × 10⁶cell/㎖ 농도로 100 mm 디쉬에 HepG2 세포를 분주한 후, 상기 실시예 <1-2>에서 결정된 벤조케이플루오란텐의 농도들을 48 시간 동안 처리하였다. 이후, 상기 처리한 세포에서 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase 세트(set)(Qiagen, USA)를 사용하여 제거하였다. 각 전체 RNA 시료의 농도는 분광광도계인 NanoDrop ND 1000 분광광도계(spectrophotometer)(NanoDrop Technologies Inc., USA)를 이용하여 측정하였으며 순도는 아가로스 젤 전기영동으로 확인하였다.
After dispensing HepG2 cells in a 100 mm dish at a concentration of 6 × 10 ⁶ cells / ml, the concentrations of benzokayfluoranthene determined in Example <1-2> were treated for 48 hours. Subsequently, total RNA was isolated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method. Genomic DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The concentration of each total RNA sample was measured using a spectrophotometer NanoDrop ND 1000 spectrophotometer (NanoDrop Technologies Inc., USA) and purity was confirmed by agarose gel electrophoresis.

<2-2> <2-2> 표지된Labeled 마이크로 Micro RNARNA 제조 및 형광물질 표지 Manufacture and fluorescent labeling

올리고 마이크로어레이 분석을 위하여 상기 실시예 <2-1>에서 수득한 벤조케이플루오란텐 처리군의 전체 RNA에 형광 물질을 표지하였다. 형광 표지는 Agilent사의 miRNA 완전한 라벨링 및 혼성화 키트(complete labeling and Hybridization kit)를 사용하여 제조사의 방법대로 수행하였다. 상기 수득한 전체 RNA 2μl(100 ng)에 0.4 ul의 10X CIP 완충용액, 1.1 ul의 핵산분해효소 자유수(nuclease-free water), 0.5 ul의 Calf Intestinal Phosphatase를 넣고 37℃에서 30분간 반응시킨 후 2.8 ul의 100% DMSO를 첨가하여 100%에서 5 내지 10분간 반응시키고 즉시 얼음으로 옮겼다. 염료(dye)를 붙여주기 위해 1 ul의 10X T4 RNA 리가아제(Ligase) 완충용액, 3 ul의 Cyanine3-pCp, 0.5 ul의 T4 RNA 리가아제를 넣고 16℃에서 2시간 동안 반응시켰다. 상기 라벨링(labeling)된 시료를 Micro Bio-Spin 6 컬럼(column)을 사용하여 정제하였다. 정제된 RNA를 55℃의 진공 농축기(vacuum concentrator)에서 완전히 말려 18 ul의 핵산분해효소 자유수로 녹인 후 4. 5 ul의 10X GE 차단 에이전트(Blocking Agent)를 넣고 22.5 ul의 2X Hi-RPM 혼성화 완충용액(Hybridization buffer)을 넣어주었으며 준비된 시료를 100℃에서 5분간 반응시키고 즉시 얼음으로 옮겨 5분간 반응시킨 다음 혼성화 반응에 사용하였다.For oligo microarray analysis, fluorescent material was labeled on total RNA of the benzokayfluoranthene treatment group obtained in Example <2-1>. Fluorescent labeling was performed according to the manufacturer's method using Agilent's miRNA complete labeling and hybridization kit. 2 μl (100 ng) of the obtained RNA was added 0.4 ul of 10X CIP buffer, 1.1 ul of nuclease-free water, 0.5 ul of Calf Intestinal Phosphatase and reacted at 37 ° C. for 30 minutes. 2.8 ul of 100% DMSO was added to react at 100% for 5 to 10 minutes and immediately transferred to ice. To attach a dye, 1 ul of 10X T4 RNA ligase (Ligase) buffer solution, 3 ul of Cyanine3-pCp, 0.5 ul of T4 RNA ligase was added and reacted at 16 ° C. for 2 hours. The labeled samples were purified using a Micro Bio-Spin 6 column. The purified RNA was completely dried in a vacuum concentrator at 55 ° C and dissolved in 18 ul of nuclease free water, followed by 4 ul of 10X GE Blocking Agent and 22.5 ul of 2X Hi-RPM hybridization. A buffer solution was added and the prepared sample was reacted at 100 ° C. for 5 minutes, immediately transferred to ice, and then reacted for 5 minutes, and used for hybridization.

<2-3> <2-3> 혼성화Hybridization 반응 reaction

혼성화 및 세척 과정은 지노첵(주)의 지시방법에 따라 수행하였다. 혼성화를 20시간 동안 55℃ 오븐에서 수행하였다. DNA 마이크로어레이 칩으로는 8×60 k 인간 miRNA 어레이(array) v14.0(Agilent, USA)를 이용하였다.
Hybridization and washing process was carried out according to the instructions of Genochet Co., Ltd .. Hybridization was carried out in a 55 [deg.] C oven for 20 hours. 8 x 60 k human miRNA array (array) v14.0 (Agilent, USA) was used as the DNA microarray chip.

<2-4> 형광 이미지 획득을 통한 마이크로 <2-4> Micro fluorescence image acquisition RNARNA 발현 양상 확인 Expression pattern confirmation

슬라이드 상의 혼성화 이미지는 Agilent C scanner(Agilent technologies, USA)로 스캔하였으며 추출된 데이터는 Agilent GeneSpring GX 11(Agilent technologies)를 이용하여 정상화(normalization)를 거쳐 각 유전자의 발현양상을 분석하였다.Hybridization images on the slides were scanned with an Agilent C scanner (Agilent technologies, USA) and the extracted data were normalized using Agilent GeneSpring GX 11 (Agilent technologies) to analyze the expression patterns of each gene.

그 결과, 도 2, 표 1에서 보는 바와 같이 올리고 칩 상에 존재하는 대략 887 개의 마이크로 RNA 중에서 NT의 벤조케이플루오란텐에 의해 실험군/대조군의 비율이 2.0배 이상으로 유전자 발현 증가를 보이는 마이크로 RNA는 5.07%(887개의 마이크로 RNA 중 45개)이고 발현 감소를 보이는 마이크로 RNA는 없음을 확인하였다. 또한, IC₂₀의 벤조케이플루오란텐에 의해 실험군/대조군의 비율이 2.0배 이상으로 유전자 발현 증가를 보이는 마이크로 RNA는 7.78%(887개의 마이크로 RNA 중 69개), 발현 감소를 보이는 마이크로 RNA는 0.11%(887개의 마이크로 RNA 중 1개)임을 확인하였다. 이때, NT과 IC₂₀의 벤조케이플루오란텐 모두에 의해 공통적으로 발현이 2배 이상 과발현, 저발현되는 마이크로 RNA가 26종 (과발현 26종, 저발현 0종) 인 것을 확인하였다(도 2, 표 1). As a result, as shown in FIG. 2 and Table 1, micro RNA showing an increase in gene expression by 2.0 times or more by the benzokayfluoranthene of NT out of approximately 887 micro RNAs present on the oligo chip. Was 5.07% (45 of 887 microRNAs) and no microRNAs showed reduced expression. In addition, by the benzokei fluoranthene of IC ₂₀ , the ratio of the experimental group / control group was 2.0 times higher than that of the micro RNA showing an increase in gene expression by 7.78% (69 out of 887 micro RNAs), and the micro RNA showing a decrease in expression was 0.11. % (1 of 887 microRNAs). At this time, it was confirmed that 26 kinds of microRNAs (26 overexpressions and 0 low expressions) were overexpressed and overexpressed at least two times in common by both benzokayfluoranthenes of NT and IC ₂₀ (FIG. 2, Table 1).

<< 실시예Example 3> 실시간 3> Real time RTRT -PCR(-PCR ( RealReal -- timetime reversereverse transcriptasetranscriptase polymerase중합체 chainchain reaction)을 통한 과발현된 마이크로 overexpressed via reaction RNARNA 의 발현 변화 확인Changes in expression

두 가지 농도의 벤조케이플루오란텐 노출에 의해 공통으로 과발현 유도된 상기 실시예 2의 마이크로 RNA 6종을 선별하였다. 이들 마이크로 RNA들은 마이크로 RNA 등록번호 (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);Six microRNAs of Example 2 were selected that were commonly overexpressed by exposure to two concentrations of benzokayfluoranthene. These micro RNAs include micro RNA accession number (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);

마이크로 RNA 등록번호 (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b) 등이다.
Micro RNA accession number (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b) and the like.

상기 마이크로 RNA들의 발현변화 정도를 조사 및 정량하기 위해 상기 마이크로 RNA를 특이적으로 발현할 수 있는 프라이머를 제작하여(표 2), My IQ 실시간 PCR(My IQ Real-time PCR)(Bio-rad, USA)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다. In order to investigate and quantify the expression change of the microRNAs, a primer capable of specifically expressing the microRNAs was prepared (Table 2), and the My IQ Real-time PCR (Bio-rad, USA) to perform quantitative real-time RT-PCR.

등록번호Registration Number 유전자명Gene name MatureMature 마이크로 Micro RNARNA 프라이머primer 서열 order (5'->3')(5 '-> 3') MIMAT0000067MIMAT0000067 hsa-let-7fhsa-let-7f 5'UGAGGUAGUAGAUUGUAUAGUU (서열번호 1)5'UGAGGUAGUAGAUUGUAUAGUU (SEQ ID NO: 1) MIMAT0004587MIMAT0004587 hsa-miR-23b*hsa-miR-23b * 5'UGGGUUCCUGGCAUGCUGAUUU (서열번호 2)5'UGGGUUCCUGGCAUGCUGAUUU (SEQ ID NO: 2) MIMAT0004568MIMAT0004568 hsa-miR-221*hsa-miR-221 * 5'ACCUGGCAUACAAUGUAGAUUU (서열번호 3)5'ACCUGGCAUACAAUGUAGAUUU (SEQ ID NO: 3) MIMAT0000063MIMAT0000063 hsa-let-7bhsa-let-7b 5'UGAGGUAGUAGGUUGUGUGGUU (서열번호 4) 5'UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 4) MIMAT0002821MIMAT0002821 hsa-miR-181dhsa-miR-181d 5'AACAUUCAUUGUUGUCGGUGGGU (서열번호 5) 5'AACAUUCAUUGUUGUCGGUGGGU (SEQ ID NO: 5) MIMAT0000257MIMAT0000257 hsa-miR-181bhsa-miR-181b 5'AACAUUCAUUGCUGUCGGUGGGU (서열번호 6)5'AACAUUCAUUGCUGUCGGUGGGU (SEQ ID NO: 6)

<3-1> <3-1> cDNAcDNA 제조 Produce

올리고 마이크로어레이 분석을 위하여 상기 실시예 <2-1>에서 수득한 벤조케이플루오란텐 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. For oligo microarray analysis, cDNA was prepared using total RNA of the benzokayfluoranthene treatment group obtained in Example <2-1>.

cDNA 제조는 Qiagen사의 miScript RT 키트를 사용하여 제조사의 방법대로 수행하였다. 상기 수득한 전체 RNA 1 ㎍을 하기 <표 3>과 같이 시약을 혼합한 후 37℃에서 60분간 반응시킨 후 95℃에서 5분간 반응시켜 역전사 효소(Reverse Transcriptase)를 불활성화시켰다. cDNA preparation was performed according to the manufacturer's method using a miScript RT kit from Qiagen. 1 μg of the obtained total RNA was mixed with reagents as shown in Table 3, followed by reaction at 37 ° C. for 60 minutes, followed by reaction at 95 ° C. for 5 minutes to inactivate reverse transcriptase.

구성Configuration 부피(㎕)Volume ([mu] l) RT 완충용액(buffer)RT buffer 44 RNase-자유수(free water)RNase-free water 잔량(variable)Variable 역전사 효소 믹스(Reverse Trascriptase Mix)`Reverse Trascriptase Mix 1One 주형(Template)Template 1㎍ 까지Up to 1µg 총 부피Total volume 2020

<3-2> <3-2> PCRPCR 산물 정량을 통한 마이크로 Micro by Product Quantification RNARNA 발현 변화 확인 Confirmation of expression change

PCR 산물을 정량하기 위하여 사이버그린(SYBR Green) I 염색(Bio-rad, USA)으로 염색하였다. 사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, PCR 과정 동안 이중나선 DNA가 생성될수록 형광강도(fluroscense intensity)가 증가하게 된다. 먼저 <표 4>와 같이 PCR에 이용한 표적 마이크로 RNA와 Universal 프라이머, 그리고 내재성(endogenous) 대조군(RNU6B2)에 대한 프라이머를 사이버그린 마스터 믹스(Master mix)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 합성된 cDNA 시료와 각각의 프라이머(표 2)를 혼합하고, 사이버그린 마스터 믹스를 첨가한 후 PCR를 수행하였고, 정량 소프트웨어(software)를 사용하여 분석하였다. To quantify the PCR products were stained with SYBR Green I stain (Bio-rad, USA). Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, as shown in Table 4, PCR was performed by adding the target microRNA, the universal primer used for PCR, and the primer for the endogenous control (RNU6B2) to the Cyberin master mix, and then performing appropriate PCR. Primer optimization was performed to select. Synthesized cDNA samples and each primer (Table 2) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software.

구성Configuration 부피(㎕)Volume ([mu] l) 사이버그린 마스터 믹스(SYBR Green Master Mix)SYBR Green Master Mix 55 Universal 프라이머(Primer)Universal Primer 1One 프라이머(primer) Primer 1One RNase-자유수(free water)RNase-free water 3.83.8 주형(Template) cDNATemplate cDNA 0.20.2

그 결과, 도 3, 표 5에서 나타난 바와 같이 6종의 공통 과발현 마이크로 RNA의 발현 양상이 벤조케이플루오란텐에 의한 마이크로 RNA 발현을 조사한 올리고 마이크로어레이 결과와 매우 유사하게 나타남을 확인하였다(도 3, 표 5).
As a result, as shown in FIG. 3, Table 5, it was confirmed that the expression patterns of the six common overexpressed microRNAs were very similar to the oligo microarray results of microRNA expression by benzokayfluoranthene (FIG. 3). , Table 5).

상기에서 보는 바와 같이, 본 발명은 인체에 다양한 질병을 유발하는 등 독성작용을 갖는 벤조케이플루오란텐의 모니터링 및 위해성을 판정하는데 유용하게 사용할 수 있으며, 벤조케이플루오란텐에 의해 야기되는 독성 작용 기작을 규명하는 도구로 이용할 수 있다.As can be seen from the above, the present invention can be usefully used to determine the risk and monitoring of benzoke fluoranthene having toxic effects such as causing various diseases in the human body, the toxic action caused by benzokay fluoranthene It can be used as a tool to identify mechanisms.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims

A microarray chip for detecting exposure to benzokefluoranthene, in which any one or more microRNAs or complementary strand molecules thereof are selected from the following group:
Micro RNA Registry No. (miRbase) MIMAT0000063 (hsa-let-7b, Homo sapiens let-7b);
Micro RNA accession number (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);
Micro RNA accession number (miRbase) MIMAT0004587 (hsa-miR-23b *, Homo sapiens miR-23b *);
Micro RNA accession number (miRbase) MIMAT0000086 (hsa-miR-29a, Homo sapiens miR-29a);
Micro RNA Registry No. (miRbase) MIMAT0004514 (hsa-miR-29b-1 *, Homo sapiens miR-29b-1 *);
MicroRNA registration number (miRbase) MIMAT0000256 (hsa-miR-181a, Homo sapiens miR-181a);
Micro RNA Registry No. (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b);
Micro RNA Registry No. (miRbase) MIMAT0002821 (hsa-mir-181d, Homo sapiens miR-181d);
Micro RNA accession number (miRbase) MIMAT0004560 (hsa-miR-183 *, Homo sapiens miR-183 *);
Micro RNA Registry No. (miRbase) MIMAT0000228 (hsa-miR-198, Homo sapiens miR-198);
Micro RNA accession number (miRbase) MIMAT0000617 (hsa-miR-200c, Homo sapiens miR-200c);
Micro RNA accession number (miRbase) MIMAT0004568 (hsa-miR-221 * Homo sapiens miR-221 *);
Micro RNA accession number (miRbase) MIMAT0000764 (hsa-miR-339-5p, Homo sapiens miR-339-5p);
Micro RNA accession number (miRbase) MIMAT0000710 (hsa-miR-365, Homo sapiens miR-365);
Micro RNA accession number (miRbase) MIMAT0003884 (hsa-miR-454 *, Homo sapiens miR-454 *);
Micro RNA accession number (miRbase) MIMAT0004800 (hsa-miR-550, Homo sapiens miR-550);
Micro RNA accession number (miRbase) MIMAT0003228 (hsa-miR-564, Homo sapiens miR-564);
Micro RNA Registry No. (miRbase) MIMAT0004795 (hsa-miR-574-5p, Homo sapiens miR-574-5p);
Micro RNA Registry No. (miRbase) MIMAT0003249 (hsa-miR-584, Homo sapiens miR-584);
Micro RNA Registry No. (miRbase) MIMAT0003296 (hsa-miR-627, Homo sapiens miR-627);
Micro RNA Registry No. (miRbase) MIMAT0004809 (hsa-miR-628-5p, Homo sapiens miR-628-5p);
Micro RNA Registry No. (miRbase) MIMAT0004810 (hsa-miR-629, Homo sapiens miR-629);
Micro RNA Registry No. (miRbase) MIMAT0004957 (hsa-miR-760, Homo sapiens miR-760);
Micro RNA accession number (miRbase) MIMAT0004949 (hsa-miR-877, Homo sapiens miR-877);
Micro RNA accession number (miRbase) MIMAT0005825 (hsa-miR-1180, Homo sapiens miR-1180); And
Micro RNA Registry No. (miRbase) MIMAT0011775 (hsa-miR-2276, Homo sapiens miR-2276).

Claim 1 kit for verifying exposure of benzokei fluoranthene comprising the microarray chip.

[Claim 3] The kit according to claim 2, further comprising human liver cells or liver cancer cells.

Kit for confirming the exposure of benzoke fluoranthene comprising a primer pair that is complementary to any one of the microRNAs selected from the group below and capable of amplifying the microRNAs:
Micro RNA Registry No. (miRbase) MIMAT0000063 (hsa-let-7b, Homo sapiens let-7b);
Micro RNA accession number (miRbase) MIMAT0000067 (hsa-let-7f, Homo sapiens let-7f);
Micro RNA accession number (miRbase) MIMAT0004587 (hsa-miR-23b *, Homo sapiens miR-23b *);
Micro RNA accession number (miRbase) MIMAT0000086 (hsa-miR-29a, Homo sapiens miR-29a);
Micro RNA Registry No. (miRbase) MIMAT0004514 (hsa-miR-29b-1 *, Homo sapiens miR-29b-1 *);
MicroRNA registration number (miRbase) MIMAT0000256 (hsa-miR-181a, Homo sapiens miR-181a);
Micro RNA Registry No. (miRbase) MIMAT0000257 (hsa-miR-181b, Homo sapiens miR-181b);
Micro RNA Registry No. (miRbase) MIMAT0002821 (hsa-mir-181d, Homo sapiens miR-181d);
Micro RNA accession number (miRbase) MIMAT0004560 (hsa-miR-183 *, Homo sapiens miR-183 *);
Micro RNA Registry No. (miRbase) MIMAT0000228 (hsa-miR-198, Homo sapiens miR-198);
Micro RNA accession number (miRbase) MIMAT0000617 (hsa-miR-200c, Homo sapiens miR-200c);
Micro RNA accession number (miRbase) MIMAT0004568 (hsa-miR-221 * Homo sapiens miR-221 *);
Micro RNA accession number (miRbase) MIMAT0000764 (hsa-miR-339-5p, Homo sapiens miR-339-5p);
Micro RNA accession number (miRbase) MIMAT0000710 (hsa-miR-365, Homo sapiens miR-365);
Micro RNA accession number (miRbase) MIMAT0003884 (hsa-miR-454 *, Homo sapiens miR-454 *);
Micro RNA accession number (miRbase) MIMAT0004800 (hsa-miR-550, Homo sapiens miR-550);
Micro RNA accession number (miRbase) MIMAT0003228 (hsa-miR-564, Homo sapiens miR-564);
Micro RNA Registry No. (miRbase) MIMAT0004795 (hsa-miR-574-5p, Homo sapiens miR-574-5p);
Micro RNA Registry No. (miRbase) MIMAT0003249 (hsa-miR-584, Homo sapiens miR-584);
Micro RNA Registry No. (miRbase) MIMAT0003296 (hsa-miR-627, Homo sapiens miR-627);
Micro RNA Registry No. (miRbase) MIMAT0004809 (hsa-miR-628-5p, Homo sapiens miR-628-5p);
Micro RNA Registry No. (miRbase) MIMAT0004810 (hsa-miR-629, Homo sapiens miR-629);
Micro RNA Registry No. (miRbase) MIMAT0004957 (hsa-miR-760, Homo sapiens miR-760);
Micro RNA accession number (miRbase) MIMAT0004949 (hsa-miR-877, Homo sapiens miR-877);
Micro RNA accession number (miRbase) MIMAT0005825 (hsa-miR-1180, Homo sapiens miR-1180); And
Micro RNA Registry No. (miRbase) MIMAT0011775 (hsa-miR-2276, Homo sapiens miR-2276).

1) isolating respective RNAs from somatic cells isolated from the test subject in the experimental group and somatic cells isolated from the normal individuals as the control group;
2) labeling the RNA of the experimental group and the control group of step 1) with different fluorescent materials;
3) hybridizing the RNA labeled with the fluorescent material of step 2) with the microarray chip of claim 1;
4) analyzing the reacted microarray chip of step 3); And
5) a method of confirming the expression of micro RNA for benzoke fluoranthene comprising the step of confirming the expression level of the micro RNA integrated in the microarray chip of claim 1 of the experimental group in the analyzed data of step 4) compared with the control group .

The method according to claim 5, wherein the somatic cells of step 1) are human liver cells or human liver cancer cells.

The method according to claim 6, wherein the human liver cancer cells are HepG2.

The method of claim 5, wherein the fluorescent material of step 2) is Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-non-isothiocyanate (rhodamine-B-isothiocyanate, RITC) and rhodamine (rhodamine) is selected from the group consisting of micro-RNA expression for benzoke fluoranthene, characterized in that it is used.

1) isolating respective RNAs from somatic cells isolated from the test subject in the experimental group and somatic cells isolated from the normal individuals as the control group;
2) synthesizing RNA of the experimental group and the control group of step 1) into cDNA, respectively;
3) Real-time reverse transcript polymerase chain reaction (RT-PCR) is carried out using primers capable of amplifying the microRNAs integrated in the microarray chip of claim 1 in the cDNA of the experimental group and the control group of step 2, respectively. step; And
4) A method of confirming the expression of micro RNA for benzokayfluoranthene comprising the step of confirming the expression level of the amplification product of the experimental group of step 3) compared to the control group.

10. The method according to claim 9, wherein the somatic cells of step 1) are human liver cells or human liver cancer cells.

The method according to claim 10, wherein the human liver cancer cells are HepG2.