KR101018788B1 - Biomarker for identification of exposure to chlordane and the method of identification using thereof - Google Patents

Biomarker for identification of exposure to chlordane and the method of identification using thereof Download PDF

Info

Publication number
KR101018788B1
KR101018788B1 KR1020090016326A KR20090016326A KR101018788B1 KR 101018788 B1 KR101018788 B1 KR 101018788B1 KR 1020090016326 A KR1020090016326 A KR 1020090016326A KR 20090016326 A KR20090016326 A KR 20090016326A KR 101018788 B1 KR101018788 B1 KR 101018788B1
Authority
KR
South Korea
Prior art keywords
genebank
protein
registration number
gene registration
gene
Prior art date
Application number
KR1020090016326A
Other languages
Korean (ko)
Other versions
KR20100097405A (en
Inventor
류재천
김연정
최한샘
Original Assignee
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국과학기술연구원 filed Critical 한국과학기술연구원
Priority to KR1020090016326A priority Critical patent/KR101018788B1/en
Publication of KR20100097405A publication Critical patent/KR20100097405A/en
Application granted granted Critical
Publication of KR101018788B1 publication Critical patent/KR101018788B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113—PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay

Abstract

본 발명은 클로르덴(Chlordane)에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것으로, 구체적으로 잔류성 유기 오염물 중 하나인 클로르덴에 의해 대조군에 비해 특이적으로 유전자 발현이 증가 또는 감소하는 바이오마커 및 이를 이용한 클로르덴에 대한 노출 여부를 확인하는 방법에 관한 것이다. 본 발명의 바이오마커가 집적된 DNA 마이크로어레이 칩은 인간 간에 대한 클로르덴 노출을 판정하는데 유용하게 사용될 수 있으며, 클로르덴에 의해 유발되는 독성 작용 기작을 규명하는 도구로 이용될 수 있다.The present invention relates to a biomarker for confirming exposure to chlorden (Chlordane) and a method of identifying the same, and specifically to increase or decrease gene expression compared to the control group by chlorden, one of the residual organic contaminants. It relates to a biomarker and a method for confirming exposure to chlorden using the same. The DNA microarray chip incorporating the biomarker of the present invention can be usefully used to determine chlorden exposure to human liver, and can be used as a tool for identifying the mechanism of toxic action caused by chlorden.

클로르덴, 잔류성 유기 오염물, 살충제, 바이오마커, DNA 마이크로어레이 칩 Chlordenes, persistent organic contaminants, pesticides, biomarkers, DNA microarray chips

Description

클로르덴 노출 여부 확인용 바이오마커 및 이를 이용한 확인방법{Biomarker for identification of exposure to chlordane and the method of identification using thereof}Biomarker for identification of chlorden exposure and identification method using the same {Biomarker for identification of exposure to chlordane and the method of identification using descriptor

본 발명은 클로르덴(Chlordane)에 대한 노출 여부 확인용 바이오마커 및 이를 이용한 확인 방법에 관한 것이다.The present invention relates to a biomarker for confirming exposure to chlorden (Chlordane) and a verification method using the same.

잔류성 유기오염물의 하나인 클로르덴(Chlordane)은 주로 살충제로 사용되고 오염된 음식물섭취나 공기흡입, 토양접촉을 통해 노출된다. 잔류성 유기오염물은 수천 마일의 이동성과 먹이 사슬에 따라 생체에 축적되고, 환경에 지속적으로 존재하여 식물, 동물 및 인간에 위해를 유발하는 화학물질이다(James CY et al ., Ecotoxicol. environ . saf, 72:162-172, 2009). 클로르덴은 살충제로서 좋은 효과를 나타내지만 반감기가 20년 이상이 되고 지용성 물질로, 환경 중의 여러 경로로 식물, 동물 등의 먹이 사슬을 통해 각 조직에 축적되어 신경계 손상, 암 유발, 내분비계 장애 및 인체의 전체적인 기관계에 독성을 나타내는 것으로 보고된 바 있 다(ASTDR 1995). 이에 각국에서는 클로르덴의 사용을 금지하였으며 일본에서도 1986년 사용이 금지되었다. 그러나 각국의 환경 시료 중에는 아직도 검출되고 있는 것으로 보고되고 있다(Barber et al., 2006; hageman et al., 2006; Tagoet al., 2006). 우리나라에서는 1969년에 농약관리법에 의하여 클로르덴을 농약으로의 사용을 금지하였으나, 유효성분으로 약 3톤이 사용된 것으로 보고되었고, 대기, 토양, 퇴적물 및 수계 등 환경매체 상에서 상당량 검출되고 있다고 보고된다(NIER, 2003; 정예표 등, 2001; 최민규 등, 2002).Chlordane, one of the persistent organic pollutants, is mainly used as a pesticide and is exposed through contaminated food intake, air intake, and soil contact. Persistent organic contaminants are chemicals that accumulate in living organisms along thousands of miles of mobility and food chains, and are present continuously in the environment causing harm to plants, animals and humans (James CY et. al . , Ecotoxicol. environ . saf , 72: 162-172, 2009). Chlorden has a good effect as a pesticide, but has a half-life of more than 20 years and is a fat-soluble substance that accumulates in each tissue through the food chain of plants, animals, etc. in various ways in the environment, causing nervous system damage, cancer, endocrine disorders, It has been reported to be toxic to the entire organ system of the human body (ASTDR 1995). Therefore, the use of chlorden was prohibited in each country, and in 1986, it was also banned in Japan. However, it is reported that it is still detected in the environmental samples of each country (Barber et al., 2006; hageman et al., 2006; Tago et al., 2006). In Korea, chlorine was banned as a pesticide under the Pesticide Control Act in 1969, but about 3 tons of active ingredient was reported, and it is reported that it is detected in environmental media such as air, soil, sediment and water system. (NIER, 2003; Elite Table, et al., 2001; Min Kyu et al., 2002).

마우스와 렛 등의 In vivo 실험에서 클로르덴에 의해 간암이 유발되는 것이 보고된 바 있고(IPSC, 1995), 클로르덴에 노출되면 세포 내의 상호작용을 제어하게 되어 암 발생 및 증식한다고 보고되었으나, 유전 독성은 확인된 바 없다고 보고되었다(Telang et al ., Carcinogenesis, 3: 1175-1178, 1982). 그러나 클로르덴은 주로 인체의 유방암 세포 및 조직과 생체 시료의 모니터링에 관련된 연구에 거의 국한되어 있다. 그리고 상기에서 언급한 것과 같이 클로르덴의 인간 간에 대해 장애를 일으킬 가능성에도 인체에서의 위해도 평가 데이터가 충분하지 않고, 노출에 대한 검색 방법 역시 기체크로마토그래피(Gas Chromatography-Mass Spectrometer: GC-MS) 또는 고성능액체크로마토그래피(High Performance Liquid Chromatography: HPLC) 등의 고전적인 방법에 국한되어 있다. 상기 GC-MS 또는 HPLC 방법 등을 이용할 경우 정량적 분석이 가능하나 분석을 위한 적정 조건을 설정하여야 하며 고가의 장비 등이 필요하다. 그러므로 더욱 빠르고 간편한 스크리닝(screening) 방법, 예를 들면 프라이머(primer)를 이용하는 실시간(real-time) RT-PCR(reverse transcription polymerase chain reaction) 또는 DNA 마이크로어레이 칩 등을 이용하여 신속한 위해성 평가를 통해 인체에서의 독성작용을 탐색할 수 있는 분자적 지표를 발굴하고 활용하여 클로르덴의 노출에 대한 적절한 대책 및 관리를 수행하는 것이 중요한 과제라 하겠다. In and mouse and let In vivo experiments have reported that liver cancer is caused by chlorden (IPSC, 1995), and exposure to chlorden has been reported to control intracellular interactions, resulting in cancer development and proliferation, but no genetic toxicity has been identified. (Telang et al . , Carcinogenesis , 3: 1175-1178, 1982). However, chlorden is mostly confined to research involving the monitoring of human breast cancer cells and tissues and biological samples. As mentioned above, there is not enough risk assessment data in humans for the possibility of chlorine's disorder in human liver, and the detection method for exposure is also Gas Chromatography-Mass Spectrometer (GC-MS). Or classical methods such as High Performance Liquid Chromatography (HPLC). When using the GC-MS or HPLC method, quantitative analysis is possible, but appropriate conditions for analysis must be set, and expensive equipment is required. Therefore, faster and easier screening methods, such as real-time reverse transcription polymerase chain reaction (RT-PCR) or DNA microarray chips using primers, can be used to quickly assess the human body. It is an important task to identify and utilize molecular indicators to explore the toxic effects of chlorine, and to take appropriate measures and control against chlorden exposure.

포유류 6종, 미생물 292종 등 여러 종의 게놈(genome) 염기서열 프로젝트가 완성되어 NCBI(National Center for Biotechnology Information)에 보고되었다. 이렇게 얻어진 막대한 양의 데이터를 기본으로 유전자의 기능을 연구하기 위하여 게놈-와이드 익스프레션(genome-wide expression) 연구가 이루어지고 있다. 즉, 한 번의 실험으로 수천 개의 유전자의 발현을 분석하기 위하여 DNA 마이크로어레이(microarray) 분석을 수행했다(Schena M et al ., Proc . Natl . Acad . Sci . USA 93:10614-10619, 1996). 마이크로어레이는 cDNA(complementary DNA)나 20 - 25 염기쌍(base pair) 길이의 올리고뉴클레오티드(oligonucleotide)들의 세트를 유리에 집적화한 것이다. cDNA 마이크로어레이는 학교 내의 연구실 또는 Agilent, Genomic Solutions 등의 회사에서 칩 위에 cDNA 수집물을 기계적으로 고정화하거나 잉크젯(ink jetting) 방법을 이용하여 생산하고 있다(Sellheyer K et al ., J. Am . Acad. Dermatol. 51:681-692, 2004). 올리고뉴클레오티드 마이크로어레이는 Affymetrix사에서 사진 식각 공정(photolithography)을 이용하여 칩 위에서 직접 합성하는 방법에 의해 만들어지고 있으며, Agillent사 등에는 합성된 올리고뉴클레오티드를 고정화하는 방법으로 생산하고 있다(Sellheyer K et al ., J. Am . Acad . Dermatol. 51:681-692, 2004).Several genome sequencing projects, including six mammals and 292 microbes, have been completed and reported to the National Center for Biotechnology Information (NCBI). Genome-wide expression studies are being conducted to study the function of genes based on the vast amount of data obtained. In other words, DNA microarray analysis was performed to analyze the expression of thousands of genes in one experiment (Schena M). et al ., Proc . Natl . Acad . Sci . USA 93: 10614-10619, 1996). Microarrays integrate a set of oligonucleotides of cDNA (complementary DNA) or 20-25 base pairs in length on glass. cDNA microarrays are produced by labs in schools or by companies such as Agilent and Genomic Solutions, either mechanically immobilizing the cDNA collection on a chip or by using ink jetting (Sellheyer K). et al ., J. Am . Acad. Dermatol . 51: 681-692, 2004). Oligonucleotide microarrays are made by Affymetrix by direct synthesis on a chip using photolithography, and Agillent et al. Are produced by immobilizing synthesized oligonucleotides (Sellheyer K). et al ., J. Am . Acad . Dermatol . 51: 681-692, 2004).

유전자 발현의 분석을 위해서는 조직 등 시료에서 RNA를 수득하여 형광이나 동위원소로 표지화하며 cDNA로 전환시킨 후, DNA 마이크로어레이에 있는 올리고뉴클레오티드와 혼성화 반응을 수행한다. 올리고마이크로어레이는 주로 두 개의 다른 형광(예: Cy3 및 Cy5)으로 대조군과 실험군을 각각 표지화하여 같은 칩 상에서 동시에 혼성화 반응을 수행한 후 광학적으로 이미지를 스캔하여 형광의 세기를 얻고 그 결과를 분석한다. 두 개의 형광 세기의 비율에 따라 유전자의 발현 여부를 결정한다(Somasundaram K et al ., Genomics Proteomics I:1-10, 2002). 최근 DNA 마크로어레이 기술을 이용한 첨단 기법인 독성 유전체학(Toxicogenomics) 연구 등과 접목하여 대량(high throughput)으로 의약품 및 신의약 후보물질은 물론 대표적인 환경오염물질을 비롯한 모든 화학물질에 의한 특정 조직이나 세포주에서 발현되는 유전자들의 발현 패턴의 분석 및 양적 분석이 가능해졌다. 이에 따라 특정 세포 내에서 특정 유전자의 발현 빈도를 분석함으로써 약물의 부작용 및 환경오염물질의 유해작용과 관련된 유전자의 발굴이 가능하며, 이를 통하여 환경오염물질의 유해작용과 약물의 작용 및 부작용에 따른 분자적 메커니즘을 이해하게 될 것이며 나아가 독성 및 부작용을 유발하는 물질의 검색이 가능하게 될 것이다.For analysis of gene expression, RNA is obtained from a sample such as tissue, labeled with fluorescence or isotope, converted to cDNA, and hybridized with oligonucleotides in a DNA microarray. Oligomicroarrays mainly label the control and experimental groups with two different fluorescences (eg Cy3 and Cy5), perform hybridization on the same chip at the same time, and then optically scan the image to obtain fluorescence intensity and analyze the results. . Gene expression is determined by the ratio of the two fluorescence intensities (Somasundaram K et al ., Genomics Proteomics I: 1-10, 2002). In combination with the recent research on toxic genomics (Toxicogenomics), which is an advanced technique using DNA macroarray technology, high-throughput expression in specific tissues or cell lines by all chemicals including drug and new drug candidates, as well as representative environmental pollutants Analysis and quantitative analysis of the expression patterns of genes are now possible. Accordingly, by analyzing the frequency of expression of specific genes in specific cells, it is possible to discover genes related to adverse effects of drugs and harmful effects of environmental pollutants, and through this, molecules according to the harmful effects of environmental pollutants, drugs, and side effects. It will be possible to understand the mechanisms and further to search for substances that cause toxicity and side effects.

이에, 본 발명자들은 인간 유전자 45,220개의 단편이 집적된 올리고마이크로어레이를 이용하여 클로르덴에 노출된 인간 간암 세포인 HepG2 세포주에서의 유전자 발현 프로파일을 관찰 및 분석함으로써, 클로르덴에 의해 대조군에 비해 특이적으로 유전자 발현이 증가 또는 감소하는 유전자를 발굴하여, 클로르덴 노출 여부를 확인할 수 있는 바이오마커 및 이를 이용한 노출 여부를 확인하는 방법을 확립하여 본 발명을 완성하였다.Accordingly, the present inventors observed and analyzed a gene expression profile in the HepG2 cell line, which is human liver cancer cells exposed to chlorden using oligomicroarrays in which 45,220 fragments of human genes were accumulated. By discovering genes with increased or decreased gene expression, a biomarker capable of confirming chlorden exposure and establishing a method for confirming exposure using the same have been completed.

본 발명의 목적은 클로르덴(Chlordane)에 대한 노출 여부 확인용 바이오마커를 제공하는 것이다.An object of the present invention is to provide a biomarker for confirming the exposure to chlorden (Chlordane).

본 발명의 다른 목적은 상기 바이오마커가 집적된, 클로르덴에 대한 노출 여부 확인용 마이크로어레이 칩을 제공하는 것이다.Another object of the present invention is to provide a microarray chip for confirming exposure to chlorden, in which the biomarker is integrated.

본 발명의 다른 목적은 클로르덴에 대한 노출 여부 확인을 위한 상기 바이오마커의 검출 방법을 제공하는 것이다.Another object of the present invention is to provide a method of detecting the biomarker for confirming the exposure to chlorden.

본 발명의 다른 목적은 상기 바이오마커를 이용한, 클로르덴에 대한 노출 여부 확인용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for confirming exposure to chlorden using the biomarker.

상기 목적을 달성하기 위하여, 본 발명은 잔류성 유기 오염질인 클로르덴(Chlordane) 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 클로르덴에 대한 노출 여부 확인용 바이오마커를 제공한다.In order to achieve the above object, the present invention provides a biomarker for confirming the exposure to chlorden, characterized in that the expression change is caused by exposure to chlorden (Chlordane), a persistent organic contaminant.

또한, 본 발명은 상기 바이오마커로부터 선택된, 어느 하나 이상의 유전자의 핵산서열의 전부; 또는 상기 유전자의 단편인 올리고뉴클레오티드; 또는 그의 상보가닥 분자가 집적된, 클로르덴에 대한 노출 여부 확인용 마이크로어레이 칩을 제공한다.In addition, the present invention, the nucleic acid sequence of any one or more genes selected from the biomarker; Or an oligonucleotide that is a fragment of the gene; Or it provides a microarray chip for confirming the exposure to chlorden, its complementary strand molecules are integrated.

또한, 본 발명은 클로르덴에 대한 노출 여부 확인을 위한 상기 마커의 검출 방법을 제공한다.In addition, the present invention provides a method for detecting the marker for confirming the exposure to chlorden.

아울러, 본 발명은 상기 바이오마커를 이용한, 클로르덴에 대한 노출 여부 확인용 키트를 제공한다.In addition, the present invention provides a kit for confirming exposure to chlorden using the biomarker.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 잔류성 유기 오염질인 클로르덴(Chlordane) 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 클로르덴에 대한 노출 여부 확인용 바이오마커를 제공한다.The present invention provides a biomarker for confirming exposure to chlorden, which is characterized by a change in expression by exposure to chlorden, a persistent organic pollutant.

상기 바이오마커는 클로르덴의 세포생존 80%의 농도 처리군에서 발현이 변화된 유전자들로 p-value가 0.001 이하에 해당하고, 5배 이상 발현이 증가 또는 0.2배 이하로 발현이 감소한 유전자로써, 유전자의 생물학적 방법(biological process)별 분류시 이에 해당하는 유전자의 기능은 생물학적 발달조절(regulation of biological process), 세포 요소 조직과 발생(cellular component organization and biogenesis), 스트레스 반응(response to stress), 세포증식(cell proliferation), 세포 사멸(cell death), 세포 자살(apoptosis), 세포 주기(cell cycle), 카르복실산 대사 과정(carboxylic acid metabolic process), 세포 골격 조직과 발생(cytoskeleton organization and biogenesis), 성장(growth), 상처 치료(wound healing)와 관련된 유전자로 구성되어 있다.The biomarker is a gene whose expression is changed in the concentration treatment group of 80% of cell survival of chlorden, and the p-value corresponds to 0.001 or less, and the expression is increased by 5 times or more or decreased by 0.2 times or less. The functions of genes in the classification of biological processes are: regulation of biological process, cellular component organization and biogenesis, response to stress, and cell proliferation. cell proliferation, cell death, apoptosis, cell cycle, carboxylic acid metabolic process, cytoskeleton organization and biogenesis, growth It is composed of genes related to growth and wound healing.

본 발명은 하기와 같이 구성된 군에서 선택되는 것을 특징으로 하는 바이오마커를 제공한다:The present invention provides a biomarker, characterized in that selected from the group consisting of:

유전자등록번호(Genebank) AB040974(Start codon is not identified.; Homo sapiens mRNA for KIAA1541 protein, partial cds.), 유전자등록번호(Genebank) AF011794(cell cycle progression 1), 유전자등록번호(Genebank) AF147412(Full length insert cDNA clone YP59C02), 유전자등록번호(Genebank) AF165191(dystonin), 유전자등록번호(Genebank) AK026078[ELK3, ETS-domain protein (SRF accessory protein 2)], 유전자등록번호(Genebank) AK055600[Iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) AK075342(Chromosome 12 open reading frame 39), 유전자등록번호(Genebank) AK124869(SH2 domain containing 5), 유전자등록번호(Genebank) AY665468[Ras association (RalGDS/AF-6) domain family 8], 유전자등록번호(Genebank) BC005130(hypothetical protein MGC11082), 유전자등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자등록번호(Genebank) BC031618(chromosome 10 open reading frame 30), 유전자등록번호(Genebank) BC033000(tetratricopeptide repeat domain 17), 유전자등록번호(Genebank) BC033829[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) BC036699(hypothetical LOC654433), 유전자등록번호(Genebank) BC047030(uridine phosphorylase 1), 유전자등록번호(Genebank) BC066644(KIAA1949), 유전자등록번호(Genebank) BC070200(hypothetical LOC541471), 유전자등록번호(Genebank) BF210146(Similar to asparagine synthetase), 유전자등록번호(Genebank) BG001037(Thioredoxin reductase 1), 유전자등록번호(Genebank) BG188151(Transcribed locus), 유전자등록번호(Genebank) CR595522[3'UTR of hypothetical protein (ORF1)], 유전자등록번호(Genebank) CR625648(metallothionein 2A), 유전자등록번호(Genebank) M90656(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_000167(glycerol kinase), 유전자등록번호(Genebank) NM_000202[iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) NM_000214[jagged 1 (Alagille syndrome)], 유전자등록번호(Genebank) NM_000433[neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], 유전자등록번호(Genebank) NM_000565(interleukin 6 receptor), 유전자등록번호(Genebank) NM_000574[CD55 molecule, decay accelerating factor for complement (Cromer blood group)], 유전자등록번호(Genebank) NM_000582[secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자등록번호(Genebank) NM_000584(interleukin 8), 유전자등록번호(Genebank) NM_000596(insulin-like growth factor binding protein 1), 유전자등록번호(Genebank) NM_000602[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1], 유전자등록번호(Genebank) NM_000660(transforming growth factor, beta 1), 유전자등록번호(Genebank) NM_001001555(growth factor receptor-bound protein 10), 유전자등록번 호(Genebank) NM_001007245(interferon-related developmental regulator 1), 유전자등록번호(Genebank) NM_001007271(dual specificity phosphatase 13), 유전자등록번호(Genebank) NM_001008211(optineurin), 유전자등록번호(Genebank) NM_001031716(oligonucleotide/oligosaccharide-binding fold containing 2A), 유전자등록번호(Genebank) NM_001105(activin A receptor, type I), 유전자등록번호(Genebank) NM_001172(arginase, type II), 유전자등록번호(Genebank) NM_001173(Rho GTPase activating protein 5), 유전자등록번호(Genebank) NM_001300(Kruppel-like factor 6), 유전자등록번호(Genebank) NM_001353[aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)], 유전자등록번호(Genebank) NM_001425(epithelial membrane protein 3), 유전자등록번호(Genebank) NM_001498(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_001554(cysteine-rich, angiogenic inducer, 61), 유전자등록번호(Genebank) NM_001614(actin, gamma 1), 유전자등록번호(Genebank) NM_001657[amphiregulin (schwannoma-derived growth factor)], 유전자등록번호(Genebank) NM_001723(dystonin), 유전자등록번호(Genebank) NM_001730[Kruppel-like factor 5 (intestinal)], 유전자등록번호(Genebank) NM_001748[calpain 2, (m/II) large subunit], 유전자등록번호(Genebank) NM_001769(CD9 molecule), 유전자등록번호(Genebank) NM_001780(CD63 molecule), 유전자등록번호(Genebank) NM_001785(cytidine deaminase), 유전자등록번호(Genebank) NM_001964(early growth response 1), 유전자등록번호(Genebank) NM_002061(glutamate-cysteine ligase, modifier subunit), 유전자등록번호(Genebank) NM_002064[glutaredoxin (thioltransferase)], 유전자등록번호(Genebank) NM_002115[hexokinase 3 (white cell)], 유전자등록번호(Genebank) NM_002143(hippocalcin), 유전자등록번호(Genebank) NM_002203[integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], 유전자등록번호(Genebank) NM_002224(inositol 1,4,5-triphosphate receptor, type 3), 유전자등록번호(Genebank) NM_002276(keratin 19), 유전자등록번호(Genebank) NM_002288(leukocyte-associated immunoglobulin-like receptor 2), 유전자등록번호(Genebank) NM_002305[lectin, galactoside-binding, soluble, 1 (galectin 1)], 유전자등록번호(Genebank) NM_002306(lectin, galactoside-binding, soluble, 3), 유전자등록번호(Genebank) NM_002309[leukemia inhibitory factor (cholinergic differentiation factor)], 유전자등록번호(Genebank) NM_002394[solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2], 유전자등록번호(Genebank) NM_002571[progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], 유전자등록번호(Genebank) NM_002576[p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)], 유전자등록번호(Genebank) NM_002607(platelet-derived growth factor alpha polypeptide), 유전자등록번호(Genebank) NM_002648(pim-1 oncogene), 유전자등록번호(Genebank) NM_002867(RAB3B, member RAS oncogene family), 유전자등록번호(Genebank) NM_002899(retinol binding protein 1, cellular), 유전자등록번호(Genebank) NM_002960(S100 calcium binding protein A3), 유전자등록번호(Genebank) NM_002970(spermidine/spermine N1-acetyltransferase 1), 유전자등록번호(Genebank) NM_003107[SRY (sex determining region Y)-box 4], 유전자등록번호(Genebank) NM_003122(serine peptidase inhibitor, Kazal type 1), 유전자등록번호(Genebank) NM_003225(trefoil factor 1), 유전자등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자등록번호(Genebank) NM_003311(pleckstrin homology-like domain, family A, member 2), 유전자등록번호(Genebank) NM_003330(thioredoxin reductase 1), 유전자등록번호(Genebank) NM_003407[zinc finger protein 36, C3H type, homolog (mouse)], 유전자등록번호(Genebank) NM_003739[aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], 유전자등록번호(Genebank) NM_003887(development and differentiation enhancing factor 2), 유전자등록번호(Genebank) NM_003897(immediate early response 3), 유전자등록번호(Genebank) NM_003900(sequestosome 1), 유전자등록번호(Genebank) NM_003937[kynureninase (L-kynurenine hydrolase)], 유전자등록번호(Genebank) NM_003979(G protein-coupled receptor, family C, group 5, member A), 유전자등록번호(Genebank) NM_004024(activating transcription factor 3), 유전자등록번호(Genebank) NM_004073[polo-like kinase 3 (Drosophila)], 유전자등록번호(Genebank) NM_004083(DNA-damage-inducible transcript 3), 유전자등록번호(Genebank) NM_004177(syntaxin 3), 유전자등록번호(Genebank) NM_004417(dual specificity phosphatase 1), 유전자등록번호(Genebank) NM_004418(dual specificity phosphatase 2), 유전자등록번호(Genebank) NM_004723[rho/rac guanine nucleotide exchange factor (GEF) 2], 유전자등록번호(Genebank) NM_004748(cell cycle progression 1), 유전자등록번호(Genebank) NM_004751[glucosaminyl (N-acetyl) transferase 3, mucin type], 유전자등록번호(Genebank) NM_004760(serine/threonine kinase 17a), 유전자등록번호(Genebank) NM_004864(growth differentiation factor 15), 유전자등록번호(Genebank) NM_004907(immediate early response 2), 유전자등록번호(Genebank) NM_004925[aquaporin 3 (Gill blood group)], 유전자등록번호(Genebank) NM_004926(zinc finger protein 36, C3H type-like 1), 유전자등록번호(Genebank) NM_005139(annexin A3), 유전자등록번호(Genebank) NM_005228{epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, 유전자등록번호(Genebank) NM_005242[coagulation factor II (thrombin) receptor-like 1], 유전자등록번호(Genebank) NM_005261(GTP binding protein overexpressed in skeletal muscle), 유전자등록번호(Genebank) NM_005415[solute carrier family 20 (phosphate transporter), member 1], 유전자등록번호(Genebank) NM_005438(FOS-like antigen 1), 유전자등록번호(Genebank) NM_005451[PDZ and LIM domain 7 (enigma)], 유전자등록번호(Genebank) NM_005469(acyl-CoA thioesterase 8), 유전자등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자등록번호(Genebank) NM_005772(RNA terminal phosphate cyclase-like 1), 유전자등록번호(Genebank) NM_005953(metallothionein 2A), 유전자등록번호(Genebank) NM_005980(S100 calcium binding protein P), 유전자등록번호(Genebank) NM_006091(coronin, actin binding protein, 2B), 유전자등록번호(Genebank) NM_006208(ectonucleotide pyrophosphatase/phosphodiesterase 1), 유전자등록번호(Genebank) NM_006216[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], 유전자등록번호(Genebank) NM_006572[guanine nucleotide binding protein (G protein), alpha 13], 유전자등록번호(Genebank) NM_006617(nestin), 유전자등록번호(Genebank) NM_007039(protein tyrosine phosphatase, non-receptor type 21), 유전자등록번호(Genebank) NM_007333(killer cell lectin-like receptor subfamily C, member 3), 유전자등록번호(Genebank) NM_012250[related RAS viral (r-ras) oncogene homolog 2], 유전자등록번호(Genebank) NM_012258(hairy/enhancer-of-split related with YRPW motif 1), 유전자등록번호(Genebank) NM_013246(cardiotrophin-like cytokine factor 1), 유전자등록번호(Genebank) NM_013259(transgelin 3), 유전자등록번호(Genebank) NM_014045(low density lipoprotein receptor-related protein 10), 유전자등록번호(Genebank) NM_014059(chromosome 13 open reading frame 15), 유전자등록번호(Genebank) NM_014256(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3), 유전자등록번호(Genebank) NM_014331[solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유전자등록번호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자등록번호(Genebank) NM_014798[pleckstrin homology domain containing, family M (with RUN domain) member 1], 유전자등록번호(Genebank) NM_015187(KIAA0746 protein), 유전자등록번호(Genebank) NM_016009(SH3-domain GRB2-like endophilin B1), 유전자등록번호(Genebank) NM_016081(palladin, cytoskeletal associated protein), 유전자등록번호(Genebank) NM_016113(transient receptor potential cation channel, subfamily V, member 2), 유전자등록번호(Genebank) NM_016548(golgi phosphoprotein 2), 유전자등록번호(Genebank) NM_016639(tumor necrosis factor receptor superfamily, member 12A), 유전자등록번호(Genebank) NM_017705(progestin and adipoQ receptor family member V), 유전자등록번호(Genebank) NM_018357(La ribonucleoprotein domain family, member 6), 유전자등록번호(Genebank) NM_018590(chondroitin sulfate GalNAcT-2), 유전자등록번호(Genebank) NM_018639(WD repeat and SOCS box-containing 2), 유전자등록번호(Genebank) NM_018689(KIAA1199), 유전자등록번호(Genebank) NM_018842(BAI1-associated protein 2-like 1), 유전자등록번호(Genebank) NM_018948(ERBB receptor feedback inhibitor 1), 유전자등록번호(Genebank) NM_019096(GTP binding protein 2), 유전자등록번호(Genebank) NM_020148[spire homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_020546[adenylate cyclase 2 (brain)], 유전자등록번호(Genebank) NM_020870(SH3 domain containing ring finger 1), 유전자등록번호(Genebank) NM_020962(neighbor of Punc E11), 유전자등록번호(Genebank) NM_021103(thymosin, beta 10), 유전자등록번호(Genebank) NM_021158[tribbles homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자등록번호(Genebank) NM_022153(chromosome 10 open reading frame 54), 유전자등록번호(Genebank) NM_022818(microtubule-associated protein 1 light chain 3 beta), 유전자등록번호(Genebank) NM_024847(transmembrane channel-like 7), 유전자등록번호(Genebank) NM_025099(chromosome 17 open reading frame 68), 유전자등록번호(Genebank) NM_025106(splA/ryanodine receptor domain and SOCS box containing 1), 유전자등록번호(Genebank) NM_025130(hexokinase domain containing 1), 유전자등록번호(Genebank) NM_025195[tribbles homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_030627(cytoplasmic polyadenylation element binding protein 4), 유전자등록번호(Genebank) NM_030674(solute carrier family 38, member 1), 유전자등록번호(Genebank) NM_031286(SH3 domain binding glutamic acid-rich protein like 3), 유전자등록번호(Genebank) NM_032466(aspartate beta-hydroxylase), 유전자등록번호(Genebank) NM_032525(tubulin, beta 6), 유전자등록번호(Genebank) NM_032717(lung cancer metastasis-associated protein), 유전자등록번호(Genebank) NM_032892(FERM domain containing 5), 유전자등록번호(Genebank) NM_033160(zinc finger protein 658), 유전자등록번호(Genebank) NM_033260(forkhead box Q1), 유전자등록번호(Genebank) NM_052871(hypothetical protein MGC4677), 유전자등록번호(Genebank) NM_078487[cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], 유전자등록번호(Genebank) NM_080655(chromosome 9 open reading frame 30), 유전자등록번호(Genebank) NM_080725[sulfiredoxin 1 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_080927(discoidin, CUB and LCCL domain containing 2), 유전자등록번호(Genebank) NM_134421(hippocalcin-like 1), 유전자등록번호(Genebank) NM_138961(endothelial cell adhesion molecule), 유전자등록번호(Genebank) NM_144497[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) NM_144652(leucine zipper-EF-hand containing transmembrane protein 2), 유전자등록번호(Genebank) NM_144778[muscleblind-like 2 (Drosophila)], 유전자등록번호(Genebank) NM_145904(high mobility group AT-hook 1), 유전자등록번호(Genebank) NM_147780(cathepsin B), 유전자등록번호(Genebank) NM_153006(N-acetylglutamate synthase), 유전자등록번호(Genebank) NM_153020(RNA binding motif protein 24), 유전자등록번호(Genebank) NM_153229(transmembrane protein 92), 유전자등록번호(Genebank) NM_153608(zinc finger protein 114), 유전자등록번호(Genebank) NM_170692(RAS protein activator like 2), 유전자등록번호(Genebank) NM_172210[colony stimulating factor 1 (macrophage)], 유전자등록번호(Genebank) NM_172364(calcium channel, voltage-dependent, alpha 2/delta subunit 4), 유전자등록번호(Genebank) NM_175839(spermine oxidase), 유전자등록번호(Genebank) NM_178234(tumor suppressor candidate 3), 유전자등록번 호(Genebank) NM_178275(eEF1A2 binding protein), 유전자등록번호(Genebank) NM_178859(organic solute transporter beta), 유전자등록번호(Genebank) NM_181985[leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], 유전자등록번호(Genebank) NM_182485(cytoplasmic polyadenylation element binding protein 2), 유전자등록번호(Genebank) NM_183373(chromosome 6 open reading frame 145), 유전자등록번호(Genebank) NM_198447[golgi transport 1 homolog A (S. cerevisiae)], 유전자등록번호(Genebank) NM_198833[serpin peptidase inhibitor, clade B (ovalbumin), member 8], 유전자등록번호(Genebank) NM_199330[homer homolog 2 (Drosophila)], 유전자등록번호(Genebank) NM_201555(four and a half LIM domains 2), 유전자등록번호(Genebank) NM_203380(acyl-CoA synthetase long-chain family member 5), 유전자등록번호(Genebank) NM_203391(glycerol kinase), 유전자등록번호(Genebank) NM_203403(chromosome 9 open reading frame 150), 유전자등록번호(Genebank) NR_002205(ferritin, heavy polypeptide-like 12), 유전자등록번호(Genebank) NR_002802(trophoblast-derived noncoding RNA), 유전자등록번호(Genebank) NR_002823(aquaporin 7 pseudogene 2), 유전자등록번호(Genebank) NR_002834(dual specificity phosphatase 5 pseudogene), 유전자등록번호(Genebank) XM_373277(similar to microtubule-associated proteins 1A/1B light chain 3), 유전자등록번호(Genebank) XM_932993[Homo sapiens cDNA FLJ32255 fis, clone PROST1000226. (AK056817)], 유전자등록번호(Genebank) XR_000951[Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC:15504 IMAGE:2990071), complete cds. (BC007251)], 유전자등록번호(Genebank) AF007149(hypothetical protein LOC257407), 유전자등록번호(Genebank) AF118092(predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), 유전자등록번호(Genebank) AF334184(Rac GTPase activating protein 1 pseudogene), 유전자등록번호(Genebank) AL832208(hypothetical protein FLJ32312), 유전자등록번호(Genebank) BC006267(asparaginase like 1), 유전자등록번호(Genebank) BC050292(MGC44478), 유전자등록번호(Genebank) BF591978[Apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) BX405503(Alpha-fetoprotein), 유전자등록번호(Genebank) CD608671(Fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000029[angiotensinogen (serpin peptidase inhibitor, clade A, member 8)], 유전자등록번호(Genebank) NM_000040(apolipoprotein C-III), 유전자등록번호(Genebank) NM_000042[apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) NM_000156(guanidinoacetate N-methyltransferase), 유전자등록번호(Genebank) NM_000166(gap junction protein, beta 1, 32kDa), 유전자등록번호(Genebank) NM_000204(complement factor I), 유전자등록번호(Genebank) NM_000253(microsomal triglyceride transfer protein), 유전자등록번호(Genebank) NM_000354[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], 유전자등록번호(Genebank) NM_000508(fibrinogen alpha chain), 유전자등록번 호(Genebank) NM_000509(fibrinogen gamma chain), 유전자등록번호(Genebank) NM_000607(orosomucoid 1), 유전자등록번호(Genebank) NM_000608(orosomucoid 2), 유전자등록번호(Genebank) NM_000670[alcohol dehydrogenase 4 (class II), pi polypeptide], 유전자등록번호(Genebank) NM_000671[alcohol dehydrogenase 5 (class III), chi polypeptide], 유전자등록번호(Genebank) NM_000672[alcohol dehydrogenase 6 (class V)], 유전자등록번호(Genebank) NM_000790[dopa decarboxylase (aromatic L-amino acid decarboxylase)], 유전자등록번호(Genebank) NM_000792(deiodinase, iodothyronine, type I), 유전자등록번호(Genebank) NM_000846(glutathione S-transferase A2), 유전자등록번호(Genebank) NM_000851(glutathione S-transferase M5), 유전자등록번호(Genebank) NM_000934[serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], 유전자등록번호(Genebank) NM_001005414[Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA (NM_001005414)], 유전자등록번호(Genebank) NM_001010845(hypothetical protein LOC123876), 유전자등록번호(Genebank) NM_001011554[solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], 유전자등록번호(Genebank) NM_001012271[baculoviral IAP repeat-containing 5 (survivin)], 유전자등록번호(Genebank) NM_001012716(chromosome 18 open reading frame 56), 유전자등록번호(Genebank) NM_001040152(paternally expressed 10), 유전자등록번호(Genebank) NM_001067[topoisomerase (DNA) II alpha 170kDa], 유전자등록번호(Genebank) NM_001071(thymidylate synthetase), 유전자등록번호(Genebank) NM_001134(alpha-fetoprotein), 유전자등록번호(Genebank) NM_001182(aldehyde dehydrogenase 7 family, member A1), 유전자등록번호(Genebank) NM_001237(cyclin A2), 유전자등록번호(Genebank) NM_001311[cysteine-rich protein 1 (intestinal)], 유전자등록번호(Genebank) NM_001443(fatty acid binding protein 1, liver), 유전자등록번호(Genebank) NM_001739(carbonic anhydrase VA, mitochondrial), 유전자등록번호(Genebank) NM_001756[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], 유전자등록번호(Genebank) NM_001786(cell division cycle 2, G1 to S and G2 to M), 유전자등록번호(Genebank) NM_001789[cell division cycle 25 homolog A (S. pombe)], 유전자등록번호(Genebank) NM_001823(creatine kinase, brain), 유전자등록번호(Genebank) NM_001844[collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], 유전자등록번호(Genebank) NM_001872[carboxypeptidase B2 (plasma)], 유전자등록번호(Genebank) NM_001948(dUTP pyrophosphatase), 유전자등록번호(Genebank) NM_002129(high-mobility group box 2), 유전자등록번호(Genebank) NM_002388(minichromosome maintenance complex component 3), 유전자등록번호(Genebank) NM_002497[NIMA (never in mitosis gene a)-related kinase 2], 유전자등록번호(Genebank) NM_002592(proliferating cell nuclear antigen), 유전자등록번호(Genebank) NM_002614(PDZ domain containing 1), 유전자등록번호(Genebank) NM_002630[progastricsin (pepsinogen C)], 유전자등록번호(Genebank) NM_002729(hematopoietically expressed homeobox), 유전자등록번호(Genebank) NM_002758(mitogen-activated protein kinase kinase 6), 유전자등록번호(Genebank) NM_003258(thymidine kinase 1, soluble), 유전자등록번호(Genebank) NM_003542(histone cluster 1, H4c), 유전자등록번호(Genebank) NM_003579[RAD54-like (S. cerevisiae)], 유전자등록번호(Genebank) NM_003882(WNT1 inducible signaling pathway protein 1), 유전자등록번호(Genebank) NM_003944(selenium binding protein 1), 유전자등록번호(Genebank) NM_003981(protein regulator of cytokinesis 1), 유전자등록번호(Genebank) NM_004111(flap structure-specific endonuclease 1), 유전자등록번호(Genebank) NM_004169[serine hydroxymethyltransferase 1 (soluble)], 유전자등록번호(Genebank) NM_004265(fatty acid desaturase 2), 유전자등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자등록번호(Genebank) NM_004701(cyclin B2), 유전자등록번호(Genebank) NM_004772(chromosome 5 open reading frame 13), 유전자등록번호(Genebank) NM_004845(phosphate cytidylyltransferase 1, choline, beta), 유전자등록번호(Genebank) NM_005030[polo-like kinase 1 (Drosophila)], 유전자등록번호(Genebank) NM_005063[stearoyl-CoA desaturase (delta-9-desaturase)], 유전자등록번호(Genebank) NM_005123(nuclear receptor subfamily 1, group H, member 4), 유전자등록번호(Genebank) NM_005165(aldolase C, fructose-bisphosphate), 유전자등록번호(Genebank) NM_005327(hydroxyacyl-Coenzyme A dehydrogenase), 유전자등록번호(Genebank) NM_005502[ATP-binding cassette, sub-family A (ABC1), member 1], 유전자등록번호(Genebank) NM_005573(lamin B1), 유전자등록번호(Genebank) NM_005631[smoothened homolog (Drosophila)], 유전자등록번호(Genebank) NM_005733(kinesin family member 20A), 유전자등록번호(Genebank) NM_005915(minichromosome maintenance complex component 6), 유전자등록번호(Genebank) NM_005940[matrix metallopeptidase 11 (stromelysin 3)], 유전자등록번호(Genebank) NM_005989[aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)], 유전자등록번호(Genebank) NM_006101[NDC80 homolog, kinetochore complex component (S. cerevisiae)], 유전자등록번호(Genebank) NM_006113(vav 3 oncogene), 유전자등록번호(Genebank) NM_006215[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], 유전자등록번호(Genebank) NM_006398(ubiquitin D), 유전자등록번호(Genebank) NM_006444(structural maintenance of chromosomes 2), 유전자등록번호(Genebank) NM_006461(sperm associated antigen 5), 유전자등록번호(Genebank) NM_006472(thioredoxin interacting protein), 유전자등록번호(Genebank) NM_006498(lectin, galactoside-binding, soluble, 2), 유전자등록번호(Genebank) NM_006757[troponin T type 3 (skeletal, fast)], 유전자등록번호(Genebank) NM_006845(kinesin family member 2C), 유전자등록번호(Genebank) NM_006876(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1), 유전자등록번호(Genebank) NM_007111(transcription factor Dp-1), 유전자등록번호(Genebank) NM_007317(kinesin family member 22), 유전자등록번호(Genebank) NM_012068(activating transcription factor 5), 유전자등록번호(Genebank) NM_012484[hyaluronan-mediated motility receptor (RHAMM)], 유전자등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자등록번호(Genebank) NM_014176[ubiquitin-conjugating enzyme E2T (putative)], 유전자등록번호(Genebank) NM_014264[polo-like kinase 4 (Drosophila)], 유전자등록번호(Genebank) NM_014333(cell adhesion molecule 1), 유전자등록번호(Genebank) NM_014736(KIAA0101), 유전자등록번호(Genebank) NM_014762(24-dehydrocholesterol reductase), 유전자등록번호(Genebank) NM_014791(maternal embryonic leucine zipper kinase), 유전자등록번호(Genebank) NM_014858(transmembrane and coiled-coil domain family 2), 유전자등록번호(Genebank) NM_015533[dihydroxyacetone kinase 2 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_016359(nucleolar and spindle associated protein 1), 유전자등록번호(Genebank) NM_016521(transcription factor Dp family, member 3), 유전자등록번호(Genebank) NM_017855(odontogenic, ameloblast asssociated), 유전자등록번호(Genebank) NM_018136[asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자등록번호(Genebank) NM_018154[ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], 유전자등록번호(Genebank) NM_018193(Fanconi anemia, complementation group I), 유전자등록번호(Genebank) NM_018410(hypothetical protein DKFZp762E1312), 유전자등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자등록번호(Genebank) NM_018974[unc-93 homolog A (C. elegans)], 유전자등록번호(Genebank) NM_020062(SLC2A4 regulator), 유전자등록번호(Genebank) NM_020530(oncostatin M), 유전자등록번호(Genebank) NM_020918(glycerol-3-phosphate acyltransferase, mitochondrial), 유전자등록번호(Genebank) NM_020995(haptoglobin-related protein), 유전자등록번호(Genebank) NM_021069(sorbin and SH3 domain containing 2), 유전자등록번호(Genebank) NM_022346(non-SMC condensin I complex, subunit G), 유전자등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자등록번호(Genebank) NM_025149(hypothetical protein FLJ20920), 유전자등록번호(Genebank) NM_025225(patatin-like phospholipase domain containing 3), 유전자등록번호(Genebank) NM_030771(coiled-coil domain containing 34), 유전자등록번호(Genebank) NM_030932[diaphanous homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_031299(cell division cycle associated 3), 유전자등록번호(Genebank) NM_031942(cell division cycle associated 7), 유전자등록번호(Genebank) NM_031966(cyclin B1), 유전자등록번호(Genebank) NM_032023[Ras association (RalGDS/AF-6) domain family 4], 유전자등록번호(Genebank) NM_032564[diacylglycerol O-acyltransferase homolog 2 (mouse)], 유전자등록번호(Genebank) NM_032638(GATA binding protein 2), 유전자등록번호(Genebank) NM_032828(zinc finger protein 587), 유전자등록번호(Genebank) NM_052968(apolipoprotein A-V), 유전자등록번호(Genebank) NM_054113(calcium and integrin binding family member 3), 유전자등록번호(Genebank) NM_058186(family with sequence similarity 3, member B), 유전자등록번호(Genebank) NM_145740(glutathione S-transferase A1), 유전자등록번호(Genebank) NM_148957(tumor necrosis factor receptor superfamily, member 19), 유전자등록번호(Genebank) NM_152308(chromosome 16 open reading frame 75), 유전자등록번호(Genebank) NM_152722(hepatocyte cell adhesion molecule), 유전자등록번호(Genebank) NM_153699(glutathione S-transferase A5), 유전자등록번호(Genebank) NM_172164[nuclear autoantigenic sperm protein (histone-binding)], 유전자등록번호(Genebank) NM_174936(proprotein convertase subtilisin/kexin type 9), 유전자등록번호(Genebank) NM_177550[solute carrier family 13 (sodium-dependent citrate transporter), member 5], 유전자등록번호(Genebank) NM_180991(solute carrier organic anion transporter family, member 4C1), 유전자등록번호(Genebank) NM_181712(ankyrin repeat domain 38), 유전자등록번호(Genebank) NM_182617(acyl-CoA synthetase medium-chain family member 2), 유전자등록번호(Genebank) NM_182908[dehydrogenase/reductase (SDR family) member 2], 유전자등록번호(Genebank) NM_198433(aurora kinase A), 유전자등록번호(Genebank) NM_201523(kinesin light chain 4), 유전자등록번호(Genebank) NM_203401(stathmin 1/oncoprotein 18), 유전자등록번호(Genebank) NM_207418(family with sequence similarity 72, member A), 유전자등록번호(Genebank) NR_002932(glutathione S-transferase M1 pseudogene), 유전자등록번호(Genebank) XM_940101[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] 및 유전자등록번호(Genebank) XM_944838(hypothetical protein LOC285733).Genebank AB040974 (Start codon is not identified .; Homo sapiens mRNA for KIAA1541 protein, partial cds.), Genebank AF011794 (cell cycle progression 1), Genebank AF147412 (Full) length insert cDNA clone YP59C02), Genebank (Genebank) AF165191 (dystonin), Genebank (Genebank) AK026078 [ELK3, ETS-domain protein (SRF accessory protein 2)], Genebank AK055600 [Iduronate 2 -sulfatase (Hunter syndrome)], Genebank AK075342 (Chromosome 12 open reading frame 39), Genebank AK124869 (SH2 domain containing 5), Genebank AY665468 [Ras association (RalGDS) / AF-6) domain family 8], Genebank BC005130 (hypothetical protein MGC11082), Genebank BC015987 (Kruppel-like factor 6), Genebank BC031618 (chromosome 10 open reading) frame 30), Genebank BC033000 (t etratricopeptide repeat domain 17), Genebank BC033829 [A kinase (PRKA) anchor protein (gravin) 12], Genebank (Genebank) BC036699 (hypothetical LOC654433), Genebank BC047030 (uridine phosphorylase 1 ), Genebank BC066644 (KIAA1949), Genebank (Genebank) BC070200 (hypothetical LOC541471), Genebank BG210146 (Similar to asparagine synthetase), Genebank BG001037 (Thioredoxin reductase 1 ), Genebank BG188151 (Transcribed locus), Genebank CR595522 [3'UTR of hypothetical protein (ORF1)], Genebank CR625648 (metallothionein 2A), Genebank (Genebank) ) M90656 (glutamate-cysteine ligase, catalytic subunit), Genebank NM_000167 (glycerol kinase), Genebank NM_000202 [iduronate 2-sulfatase (Hunter syndrome)], Genebank NM_000214 [ jagged 1 (Alagille syndrome)], Genebank NM_000433 [neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], Genebank NM_000565 (interleukin 6 receptor), Genebank NM_000574 [CD55 molecule, decay accelerating factor for complement (Cromer blood group)], Genebank NM_000582 [secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], Genebank NM_000584 (interleukin 8), Genebank NM_000596 (insulin-like growth factor binding protein 1), Genebank NM_000602 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1] , Genebank NM_000660 (transforming growth factor, beta 1), Genebank NM_001001555 (growth factor receptor-bound protein 10), Genebank NM_001007245 (interferon-related developme ntal regulator 1), gene registration number (Genebank) NM_001007271 (dual specificity phosphatase 13), gene registration number (Genebank) NM_001008211 (optineurin), gene registration number (Genebank) NM_001031716 (oligonucleotide / oligosaccharide-binding fold containing 2A), gene registration Genebank NM_001105 (activin A receptor, type I), Genebank NM_001172 (arginase, type II), Genebank NM_001173 (Rho GTPase activating protein 5), Genebank NM_001300 (Kruppel-like factor 6), Genebank NM_001353 [aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)], Genebank NM_001425 (epithelial membrane protein 3), Genebank NM_001498 (glutamate-cysteine ligase, catalytic subunit), Gene accession number (Genebank) ) NM_001554 (cysteine-rich, angiogenic inducer, 61), Genebank (Genebank) NM_001614 (actin, gamma 1), Genebank (Genebank) NM_001657 [amphiregulin (schwannoma-derived growth factor)], Genebank (Genebank) ) NM_001723 (dystonin), Genebank NM_001730 [Kruppel-like factor 5 (intestinal)], Genebank NM_001748 [calpain 2, (m / II) large subunit], Gene Registration Number (Genebank) NM_001769 (CD9 molecule), Gene Registration Number (Genebank) NM_001780 (CD63 molecule), Gene Registration Number (Genebank) NM_001785 (cytidine deaminase), Gene Registration Number (Genebank) NM_001964 (early growth response 1), Gene Registration Number (Genebank) NM_002061 (glutamate-cysteine ligase, modifier subunit), gene Genebank NM_002064 [glutaredoxin (thioltransferase)], Gene Registration Number (Genebank) NM_002115 [hexokinase 3 (white cell)], Gene Registration Number (Genebank) NM_002143 (hippocalcin), Gene Registration Number (Genebank) NM_002203 [integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], Genebank NM_002224 (inositol 1,4,5-triphosphate receptor, type 3), Genebank NM_002276 (keratin 19), Genebank NM_002288 (leukocyte-associated immunoglobulin-like receptor 2), Genebank NM_002305 [lectin, galactoside-binding, soluble, 1 (galectin 1)], Genebank NM_002306 (lectin , galactoside-binding, soluble, 3), Genebank NM_002309 [leukemia inhibitory factor (cholinergic differentiation factor)], Genebank NM_002394 [solute carrier family 3 (activators of dibasic and neutral amino acid transport) , member 2], Genebank NM_0025 71 [progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], Genebank NM_002576 [p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) )], Genebank NM_002607 (platelet-derived growth factor alpha polypeptide), Genebank (Genebank) NM_002648 (pim-1 oncogene), Genebank NM_002867 (RAB3B, member RAS oncogene family), Genebank (Genebank) NM_002899 (retinol binding protein 1, cellular), Genebank (Genebank) NM_002960 (S100 calcium binding protein A3), Genebank (Genebank) NM_002970 (spermidine / spermine N1-acetyltransferase 1), Gene registration Number (Genebank) NM_003107 [SRY (sex determining region Y) -box 4], Genebank NM_003122 (serine peptidase inhibitor, Kazal type 1), Genebank NM_003225 (trefoil factor 1), Gene registration Number (Genebank) NM_003254 (TIMP metall opeptidase inhibitor 1), Genebank NM_003255 (TIMP metallopeptidase inhibitor 2), Genebank NM_003311 (pleckstrin homology-like domain, family A, member 2), Genebank NM_003330 (thioredoxin reductase 1), Genebank NM_003407 [zinc finger protein 36, C3H type, homolog (mouse)], Genebank NM_003739 [aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], Genebank NM_003887 (development and differentiation enhancing factor 2), Genebank NM_003897 (immediate early response 3), Genebank NM_003900 (sequestosome 1), Gene registry number ( Genebank) NM_003937 [kynureninase (L-kynurenine hydrolase)], Genebank NM_003979 (G protein-coupled receptor, family C, group 5, member A), Genebank NM_004024 (activating transcription factor 3) , Gene registration number ( Genebank) NM_004073 [polo-like kinase 3 (Drosophila)], Genebank NM_004083 (DNA-damage-inducible transcript 3), Genebank NM_004177 (syntaxin 3), Genebank NM_004417 (dual specificity phosphatase 1), genebank NM_004418 (dual specificity phosphatase 2), genebank NM_004723 [rho / rac guanine nucleotide exchange factor (GEF) 2], genebank NM_004748 (Genebank) cell cycle progression 1), Genebank NM_004751 [glucosaminyl (N-acetyl) transferase 3, mucin type], Genebank NM_004760 (serine / threonine kinase 17a), Genebank NM_004864 ( growth differentiation factor 15), Genebank NM_004907 (immediate early response 2), Genebank NM_004925 [aquaporin 3 (Gill blood group)], Genebank NM_004926 (zinc finger protein 36, C3H type-like 1), gene registration number (Gen ebank) NM_005139 (annexin A3), Genebank NM_005228 {epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, Genebank NM_005242 [coagulation factor II ( thrombin) receptor-like 1], Genebank NM_005261 (GTP binding protein overexpressed in skeletal muscle), Genebank NM_005415 [solute carrier family 20 (phosphate transporter), member 1], gene registration number ( Genebank) NM_005438 (FOS-like antigen 1), Genebank NM_005451 [PDZ and LIM domain 7 (enigma)], Genebank NM_005469 (acyl-CoA thioesterase 8), Genebank (Genebank) NM_005620 (S100 calcium binding protein A11), Genebank (Genebank) NM_005772 (RNA terminal phosphate cyclase-like 1), Gene accession number (Genebank) NM_005953 (metallothionein 2A), Gene registration number (Genebank) NM_005980 (S100 calcium binding protein P), Genebank NM_006091 (coronin, actin binding protein, 2B), genebank (Genebank) NM_006208 (ectonucleotide pyrophosphatase / phosphodiesterase 1), genebank (Genebank) NM_006216 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], Genebank NM_006572 [guanine nucleotide binding protein (G protein), alpha 13], Genebank (Genebank) NM_006617 (nestin), Gene accession number (Genebank) NM_007039 (protein tyrosine phosphatase, non- receptor type 21), genebank NM_007333 (killer cell lectin-like receptor subfamily C, member 3), genebank NM_012250 [related RAS viral (r-ras) oncogene homolog 2], gene registry number Genebank NM_012258 (hairy / enhancer-of-split related with YRPW motif 1), Genebank NM_013246 (cardiotrophin-like cytokine factor 1), Genebank NM_013259 (transgelin 3), Gene registration number (Genebank) NM_014045 (low densit y lipoprotein receptor-related protein 10), Genebank NM_014059 (chromosome 13 open reading frame 15), Genebank NM_014256 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 3), Genebank No. NM_014331 [solute carrier family 7, (cationic amino acid transporter, y + system) member 11], Genebank No. NM_014624 (S100 calcium binding protein A6), Genebank No. NM_014798 [pleckstrin homology domain containing, family M (with RUN domain) member 1], Genebank NM_015187 (KIAA0746 protein), Genebank NM_016009 (SH3-domain GRB2-like endophilin B1), Genebank ID (Genebank) ) NM_016081 (palladin, cytoskeletal associated protein), Genebank NM_016113 (transient receptor potential cation channel, subfamily V, member 2), Genebank NM_016548 (golgi phosphoprotein 2), Gene accession number (Genebank) NM_016639 (tumo r necrosis factor receptor superfamily, member 12A), genebank NM_017705 (progestin and adipoQ receptor family member V), genebank NM_018357 (La ribonucleoprotein domain family, member 6), genebank (Genebank) NM_018590 (chondroitin sulfate GalNAcT-2), Genebank (Genebank) NM_018639 (WD repeat and SOCS box-containing 2), Genebank (Genebank) NM_018689 (KIAA1199), Genebank (Genebank) NM_018842 (BAI1-associated protein 2-like 1), Genebank NM_018948 (ERBB receptor feedback inhibitor 1), Genebank NM_019096 (GTP binding protein 2), Genebank NM_020148 [spire homolog 1 (Drosophila)] , Gene Registration Number (Genebank) NM_020546 [adenylate cyclase 2 (brain)], Gene Registration Number (Genebank) NM_020870 (SH3 domain containing ring finger 1), Gene Registration Number (Genebank) NM_020962 (neighbor of Punc E11), Gene Registration Number (Genebank) NM_021103 (thymos in, beta 10), Genebank NM_021158 [tribbles homolog 3 (Drosophila)], Genebank NM_021913 (AXL receptor tyrosine kinase), Genebank NM_022153 (chromosome 10 open reading frame 54 ), Genebank NM_022818 (microtubule-associated protein 1 light chain 3 beta), Genebank NM_024847 (transmembrane channel-like 7), Genebank NM_025099 (chromosome 17 open reading frame 68 ), Genebank NM_025106 (splA / ryanodine receptor domain and SOCS box containing 1), Genebank NM_025130 (hexokinase domain containing 1), Genebank NM_025195 (tribbles homolog 1 (Drosophila) ], Genebank NM_030627 (cytoplasmic polyadenylation element binding protein 4), Genebank N (Genebank) NM_030674 (solute carrier family 38, member 1), Genebank NM_031286 (SH3 domain binding glutamic acid-rich) protein like 3), genebank (Genebank) NM_032466 (aspartate beta-hydroxylase), genebank (Genebank) NM_032525 (tubulin, beta 6), genebank (Genebank) NM_032717 (lung cancer metastasis-associated protein), gene Genebank NM_032892 (FERM domain containing 5), Genebank NM_033160 (zinc finger protein 658), Genebank NM_033260 (forkhead box Q1), Genebank NM_052871 (hypothetical protein MGC4677), Genebank NM_078487 [cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], Genebank NM_080655 (chromosome 9 open reading frame 30), Genebank NM_080725 [sulfiredoxin 1 homolog (S. cerevisiae)], Genebank NM_080927 (discoidin, CUB and LCCL domain containing 2), Genebank NM_134421 (hippocalcin-like 1), Genebank NM_138961 (endothelial cell adhesion molecules), Genebank NM_144497 [A kinase (PRKA) anchor protein (gravin) 12], Genebank number (Genebank) NM_144652 (leucine zipper-EF-hand containing transmembrane protein 2), Genebank number NM_144778 [muscleblind -like 2 (Drosophila)], Genebank NM_145904 (high mobility group AT-hook 1), Genebank NM_147780 (cathepsin B), Genebank NM_153006 (N-acetylglutamate synthase) , Genebank NM_153020 (RNA binding motif protein 24), Genebank NM_153229 (transmembrane protein 92), Genebank NM_153608 (zinc finger protein 114), Genebank NM_170692 (RAS protein activator like 2), heredity Genebank NM_172210 [colony stimulating factor 1 (macrophage)], Genebank number (Genebank) NM_172364 (calcium channel, voltage-dependent, alpha 2 / delta subunit 4), Genebank number NM_175839 (spermine oxidase) , Genebank NM_178234 (tumor suppressor candidate 3), Genebank NM_178275 (eEF1A2 binding protein), Genebank NM_178859 (organic solute transporter beta), Genebank NM_181985 [leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], Genebank NM_182485 (cytoplasmic polyadenylation element binding protein 2), Genebank NM_183373 (chromosome 6 open reading frame 145) , Genebank NM_198447 [golgi transport 1 homolog A (S. cerevisiae)], Genebank NM_198833 [serpin peptidase inhibitor, clade B (ovalbumin), member 8], Genebank NM_199330 [homer homolog 2 (Drosophila)], Genebank NM_201555 ( four and a half LIM domains 2), Genebank NM_203380 (acyl-CoA synthetase long-chain family member 5), Genebank NM_203391 (glycerol kinase), Genebank NM_203403 (chromosome 9 open reading frame 150), Genebank NR_002205 (ferritin, heavy polypeptide-like 12), Genebank NR_002802 (trophoblast-derived noncoding RNA), Genebank NR_002823 (aquaporin 7 pseudogene 2), Genebank NR_002834 (dual specificity phosphatase 5 pseudogene), Genebank XM_373277 (similar to microtubule-associated proteins 1A / 1B light chain 3), Genebank XM_932993 [Homo sapiens cDNA FLJ32255 fis, clone PROST1 000226. (AK056817)], Genebank XR_000951 [Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC: 15504 IMAGE: 2990071), complete cds. (BC007251)], Genebank AF007149 (hypothetical protein LOC257407), Genebank AF118092 (predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), Genebank AF334184 (Rac GTPase activating protein 1 pseudogene, Genebank AL832208 (hypothetical protein FLJ32312), Genebank (Genebank) BC006267 (asparaginase like 1), Genebank (BCenebank) BC050292 (MGC44478), Genebank (Genebank) BF591978 [Apolipoprotein H (beta-2-glycoprotein I)], Genebank BX405503 (Alpha-fetoprotein), Genebank (Genebank) CD608671 (Fibrinogen alpha chain), Genebank (Genebank) NM_000029 [angiotensinogen ( serpin peptidase inhibitor, clade A, member 8)], Genebank NM_000040 (apolipoprotein C-III), Genebank NM_000042 [apolipoprotein H (beta-2-glycoprotein I)], Gene registration number ( Genebank) NM_000156 (guanidinoacetat e N-methyltransferase, Genebank NM_000166 (gap junction protein, beta 1, 32kDa), Genebank NM_000204 (complement factor I), Genebank NM_000253 (microsomal triglyceride transfer protein) , Genebank NM_000354 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], Genebank NM_000508 (fibrinogen alpha chain), Genebank NM_000509 ( fibrinogen gamma chain), gene registration number (Genebank) NM_000607 (orosomucoid 1), gene registration number (Genebank) NM_000608 (orosomucoid 2), gene registration number (Genebank) NM_000670 [alcohol dehydrogenase 4 (class II), pi polypeptide], gene Genebank NM_000671 [alcohol dehydrogenase 5 (class III), chi polypeptide], Genebank NM_000672 [alcohol dehydrogenase 6 (class V)], Genebank NM_000790 [dopa decarboxylase (aromatic L- amino acid decarboxylase) ], Gene Registration Number (Genebank) NM_000792 (deiodinase, iodothyronine, type I), Gene Registration Number (Genebank) NM_000846 (glutathione S-transferase A2), Gene Registration Number (Genebank) NM_000851 (glutathione S-transferase M5), Gene Registration Genebank NM_000934 [serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], Genebank NM_001005414 [Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA ( NM_001005414), Genebank NM_001010845 (hypothetical protein LOC123876), Genebank NM_001011554 [solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], Genebank NM_001012271 [baculoviral IAP repeat-containing 5 (survivin)], Genebank NM_001012716 (chromosome 18 open reading frame 56), Genebank NM_001040152 (paternally expressed 10), Genebank NM_001067 [top oisomerase (DNA) II alpha 170kDa], Genebank NM_001071 (thymidylate synthetase), Genebank NM_001134 (alpha-fetoprotein), Genebank NM_001182 (aldehyde dehydrogenase 7 family, member A1) Gene registration number (Genebank) NM_001237 (cyclin A2), gene registration number (Genebank) NM_001311 [cysteine-rich protein 1 (intestinal)], gene registration number (Genebank) NM_001443 (fatty acid binding protein 1, liver), gene registration Number (Genebank) NM_001739 (carbonic anhydrase VA, mitochondrial), Gene Registration Number (Genebank) NM_001756 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], Genebank NM_001786 (cell division cycle 2, G1 to S and G2 to M), Genebank NM_001789 [cell division cycle 25 homolog A (S. pombe), Genebank NM_001823 (creatine kinase, brain), Genebank NM_001844 [collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], Genebank (Genebank) NM_001872 [carboxypeptidase B2 (plasma)], genebank (Genebank) NM_001948 (dUTP pyrophosphatase), genebank (Genebank) NM_002129 (high-mobility group box 2), genebank (Genebank) NM_002388 (minichromosome maintenance complex component 3 ), Genebank NM_002497 [NIMA (never in mitosis gene a) -related kinase 2], Genebank NM_002592 (proliferating cell nuclear antigen), Genebank NM_002614 (PDZ domain containing 1 ), Genebank NM_002630 [progastricsin (pepsinogen C)], Genebank NM_002729 (hematopoietically expressed homeobox), Genebank NM_002758 (mitogen-activated protein kinase kinase 6), heredity Genebank Number NM_003258 (thymidine kinase 1, soluble), Genebank Number NM_003542 (histone cluster 1, H4c), Genebank Number NM_003579 [RAD54-like (S. cerevisiae)], Gene Registration Number (Genebank) NM_003882 (WNT1 inducible signaling pathway protein 1), Genebank NM_003944 (selenium binding protein 1), Genebank NM_003981 (protein regulator of cytokinesis 1), Genebank NM_004111 ( flap structure-specific endonuclease 1), Genebank NM_004169 [serine hydroxymethyltransferase 1 (soluble)], Genebank NM_004265 (fatty acid desaturase 2), Genebank NM_004336 [BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], Genebank NM_004701 (cyclin B2), Genebank NM_004772 (chromosome 5 open reading frame 13), Genebank NM_004845 (phosphate cytidylyltransferase 1, choline , beta), Genebank NM_005030 [polo-like kinase 1 (Drosophila)], Genebank NM_005063 [stearoyl-CoA desaturase (delta-9-desaturase)], Genebank NM_005123 (nuclear receptor subfamily 1, group H, member 4), genebank (Genebank) NM_005165 (aldolase C, fructose-bisphosphate), genebank (Genebank) NM_005327 (hydroxyacyl-Coenzyme A dehydrogenase), genebank (Genebank) NM_005502 [ATP-binding cassette, sub-family A (ABC1), member 1], gene registration number (Genebank) NM_005573 (lamin B1), gene registration number (Genebank) NM_005631 [smoothened homolog (Drosophila)], gene registration number ( Genebank) NM_005733 (kinesin family member 20A), Genebank NM_005915 (minichromosome maintenance complex component 6), Genebank NM_005940 [matrix metallopeptidase 11 (stromelysin 3)], Genebank NM_005989 [ aldo-keto reductase family 1, member D1 (delta 4-3-ketoster oid-5-beta-reductase)], Genebank NM_006101 [NDC80 homolog, kinetochore complex component (S. cerevisiae)], Genebank NM_006113 (vav 3 oncogene), Genebank Number (Genebank) NM_006215 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], Genebank (Genebank) NM_006398 (ubiquitin D), Genebank NM_006444 (structural maintenance of chromosomes 2), Genebank NM_006461 (sperm associated antigen 5), Genebank NM_006472 (thioredoxin interacting protein), Gene registration (Genebank) NM_006498 (lectin, galactoside-binding, soluble, 2), Genebank NM_006757 [troponin T type 3 (skeletal, fast)], Genebank NM_006845 (kinesin family member 2C), Genebank NM_006876 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 1), Genebank NM_007111 (transcription factor Dp-1), Genebank NM_007317 (kinesin family member 22), Genebank NM _012068 (activating transcription factor 5), Genebank NM_012484 [hyaluronan-mediated motility receptor (RHAMM)], Genebank NM_013277 (Rac GTPase activating protein 1), Genebank NM_014176 [ubiquitin -conjugating enzyme E2T (putative)], Genebank NM_014264 [polo-like kinase 4 (Drosophila)], Genebank NM_014333 (cell adhesion molecule 1), Genebank NM_014736 (KIAA0101 ), Genebank NM_014762 (24-dehydrocholesterol reductase), Genebank NM_014791 (maternal embryonic leucine zipper kinase), Genebank NM_014858 (transmembrane and coiled-coil domain family 2), Gene Genebank NM_015533 [dihydroxyacetone kinase 2 homolog (S. cerevisiae)], Genebank NM_016359 (nucleolar and spindle associated protein 1), Genebank NM_016521 (transcription factor Dp family, member 3), Genebank NM_017855 (odontogenic, ameloblast associated) , Genebank NM_018136 [asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], Genebank NM_018154 [ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], gene registration number ( Genebank) NM_018193 (Fanconi anemia, complementation group I), Genebank NM_018410 (hypothetical protein DKFZp762E1312), Genebank NM_018492 (PDZ binding kinase), Genebank NM_018974 [unc-93 homolog A (C. elegans)], Genebank NM_020062 (SLC2A4 regulator), Genebank Number (Genebank) NM_020530 (oncostatin M), Genebank Number (Genebank) NM_020918 (glycerol-3-phosphate acyltransferase, mitochondrial), U Genebank NM_020995 (haptoglobin-related protein), Genebank NM_021069 (sorbin and SH3 domain containing 2), Genebank NM_022346 (non-SMC condensin I complex, subunit G), gene Genebank NM_024629 (MLF1 interacting protein), Genebank NM_025149 (hypothetical protein FLJ20920), Genebank NM_025225 (patatin-like phospholipase domain containing 3), Genebank NM_030771 ( coiled-coil domain containing 34), Genebank NM_030932 (diaphanous homolog 3 (Drosophila)], Genebank NM_031299 (cell division cycle associated 3), Genebank NM_031942 (cell division cycle associated 7), Genebank NM_031966 (cyclin B1), Genebank NM_032023 [Ras association (RalGDS / AF-6) domain family 4], Genebank NM_032564 [diacylglycerol O-acyltransferase homolog 2 (mouse)], Genebank NM_032638 (GATA binding protein 2), Genebank NM_032828 (zinc finger protein 587), Genebank NM_052968 (apolipoprotein AV), Genebank (Genebank) NM_054113 (calcium and integrin binding family member 3), Genebank NM_058186 (family with sequence similarity 3, member B), Genebank NM_145740 (glutathione S-transferase A1), Gene accession number (Genebank) ) NM_148957 (tumor necrosis factor receptor superfamily, member 19), Genebank NM_152308 (chromosome 16 open reading frame 75), Genebank NM_152722 (hepatocyte cell adhesion molecule), Genebank NM_153699 (glutathione S-transferase A5), Genebank NM_172164 [nuclear autoantigenic sperm protein (histone-binding)], Genebank NM_174936 (proprotein convertase subtilisin / kexin type 9), Gene registration number (G enebank) NM_177550 [solute carrier family 13 (sodium-dependent citrate transporter), member 5], gene registration number (Genebank) NM_180991 (solute carrier organic anion transporter family, member 4C1), gene registration number (Genebank) NM_181712 (ankyrin repeat domain 38), gene registration number (Genebank) NM_182617 (acyl-CoA synthetase medium-chain family member 2), gene registration number (Genebank) NM_182908 [dehydrogenase / reductase (SDR family) member 2], gene registration number (Genebank) NM_198433 ( aurora kinase A), Genebank NM_201523 (kinesin light chain 4), Genebank NM_203401 (stathmin 1 / oncoprotein 18), Genebank NM_207418 (family with sequence similarity 72, member A ), Genebank NR_002932 (glutathione S-transferase M1 pseudogene), Genebank (Genebank) XM_940101 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] and Genebank (Genebank) ) XM_944838 (hypot hetical protein LOC285733).

1) 상기 바이오마커 중에서 클로르덴의 노출에 의해 발현이 증가하는 바이오마커 유전자는 하기와 같다:1) Biomarker genes whose expression is increased by exposure of chlorden in the biomarkers are as follows:

유전자등록번호(Genebank) AB040974(Start codon is not identified.; Homo sapiens mRNA for KIAA1541 protein, partial cds.), 유전자등록번호(Genebank) AF011794(cell cycle progression 1), 유전자등록번호(Genebank) AF147412(Full length insert cDNA clone YP59C02), 유전자등록번호(Genebank) AF165191(dystonin), 유전자등록번호(Genebank) AK026078[ELK3, ETS-domain protein (SRF accessory protein 2)], 유전자등록번호(Genebank) AK055600[Iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) AK075342(Chromosome 12 open reading frame 39), 유전자등록번호(Genebank) AK124869(SH2 domain containing 5), 유전자등록번호(Genebank) AY665468[Ras association (RalGDS/AF-6) domain family 8], 유전자등록번호(Genebank) BC005130(hypothetical protein MGC11082), 유전자등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자등록번호(Genebank) BC031618(chromosome 10 open reading frame 30), 유전자등록번호(Genebank) BC033000(tetratricopeptide repeat domain 17), 유전자등록번호(Genebank) BC033829[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) BC036699(hypothetical LOC654433), 유전자등록번호(Genebank) BC047030(uridine phosphorylase 1), 유전자등록번호(Genebank) BC066644(KIAA1949), 유전자등록번호(Genebank) BC070200(hypothetical LOC541471), 유전자등록번호(Genebank) BF210146(Similar to asparagine synthetase), 유전자등록번호(Genebank) BG001037(Thioredoxin reductase 1), 유전자등록번호(Genebank) BG188151(Transcribed locus), 유전자등록번호(Genebank) CR595522[3'UTR of hypothetical protein (ORF1)], 유전자등록번호(Genebank) CR625648(metallothionein 2A), 유전자등록번호(Genebank) M90656(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_000167(glycerol kinase), 유전자등록번호(Genebank) NM_000202[iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) NM_000214[jagged 1 (Alagille syndrome)], 유전자등록번호(Genebank) NM_000433[neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], 유전자등록번호(Genebank) NM_000565(interleukin 6 receptor), 유전자등록번호(Genebank) NM_000574[CD55 molecule, decay accelerating factor for complement (Cromer blood group)], 유전자등록번호(Genebank) NM_000582[secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자 등록번호(Genebank) NM_000584(interleukin 8), 유전자등록번호(Genebank) NM_000596(insulin-like growth factor binding protein 1), 유전자등록번호(Genebank) NM_000602[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1], 유전자등록번호(Genebank) NM_000660(transforming growth factor, beta 1), 유전자등록번호(Genebank) NM_001001555(growth factor receptor-bound protein 10), 유전자등록번호(Genebank) NM_001007245(interferon-related developmental regulator 1), 유전자등록번호(Genebank) NM_001007271(dual specificity phosphatase 13), 유전자등록번호(Genebank) NM_001008211(optineurin), 유전자등록번호(Genebank) NM_001031716(oligonucleotide/oligosaccharide-binding fold containing 2A), 유전자등록번호(Genebank) NM_001105(activin A receptor, type I), 유전자등록번호(Genebank) NM_001172(arginase, type II), 유전자등록번호(Genebank) NM_001173(Rho GTPase activating protein 5), 유전자등록번호(Genebank) NM_001300(Kruppel-like factor 6), 유전자등록번호(Genebank) NM_001353[aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)], 유전자등록번호(Genebank) NM_001425(epithelial membrane protein 3), 유전자등록번호(Genebank) NM_001498(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_001554(cysteine-rich, angiogenic inducer, 61), 유전자등록번호(Genebank) NM_001614(actin, gamma 1), 유전자등록번호(Genebank) NM_001657[amphiregulin (schwannoma-derived growth factor)], 유전자등록번호(Genebank) NM_001723(dystonin), 유전자등록번호(Genebank) NM_001730[Kruppel-like factor 5 (intestinal)], 유전자등록번호(Genebank) NM_001748[calpain 2, (m/II) large subunit], 유전자등록번호(Genebank) NM_001769(CD9 molecule), 유전자등록번호(Genebank) NM_001780(CD63 molecule), 유전자등록번호(Genebank) NM_001785(cytidine deaminase), 유전자등록번호(Genebank) NM_001964(early growth response 1), 유전자등록번호(Genebank) NM_002061(glutamate-cysteine ligase, modifier subunit), 유전자등록번호(Genebank) NM_002064[glutaredoxin (thioltransferase)], 유전자등록번호(Genebank) NM_002115[hexokinase 3 (white cell)], 유전자등록번호(Genebank) NM_002143(hippocalcin), 유전자등록번호(Genebank) NM_002203[integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], 유전자등록번호(Genebank) NM_002224(inositol 1,4,5-triphosphate receptor, type 3), 유전자등록번호(Genebank) NM_002276(keratin 19), 유전자등록번호(Genebank) NM_002288(leukocyte-associated immunoglobulin-like receptor 2), 유전자등록번호(Genebank) NM_002305[lectin, galactoside-binding, soluble, 1 (galectin 1)], 유전자등록번호(Genebank) NM_002306(lectin, galactoside-binding, soluble, 3), 유전자등록번호(Genebank) NM_002309[leukemia inhibitory factor (cholinergic differentiation factor)], 유전자등록번호(Genebank) NM_002394[solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2], 유전자등록번호(Genebank) NM_002571[progestagen- associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], 유전자등록번호(Genebank) NM_002576[p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)], 유전자등록번호(Genebank) NM_002607(platelet-derived growth factor alpha polypeptide), 유전자등록번호(Genebank) NM_002648(pim-1 oncogene), 유전자등록번호(Genebank) NM_002867(RAB3B, member RAS oncogene family), 유전자등록번호(Genebank) NM_002899(retinol binding protein 1, cellular), 유전자등록번호(Genebank) NM_002960(S100 calcium binding protein A3), 유전자등록번호(Genebank) NM_002970(spermidine/spermine N1-acetyltransferase 1), 유전자등록번호(Genebank) NM_003107[SRY (sex determining region Y)-box 4], 유전자등록번호(Genebank) NM_003122(serine peptidase inhibitor, Kazal type 1), 유전자등록번호(Genebank) NM_003225(trefoil factor 1), 유전자등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자등록번호(Genebank) NM_003311(pleckstrin homology-like domain, family A, member 2), 유전자등록번호(Genebank) NM_003330(thioredoxin reductase 1), 유전자등록번호(Genebank) NM_003407[zinc finger protein 36, C3H type, homolog (mouse)], 유전자등록번호(Genebank) NM_003739[aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], 유전자등록번호(Genebank) NM_003887(development and differentiation enhancing factor 2), 유전자등록번 호(Genebank) NM_003897(immediate early response 3), 유전자등록번호(Genebank) NM_003900(sequestosome 1), 유전자등록번호(Genebank) NM_003937[kynureninase (L-kynurenine hydrolase)], 유전자등록번호(Genebank) NM_003979(G protein-coupled receptor, family C, group 5, member A), 유전자등록번호(Genebank) NM_004024(activating transcription factor 3), 유전자등록번호(Genebank) NM_004073[polo-like kinase 3 (Drosophila)], 유전자등록번호(Genebank) NM_004083(DNA-damage-inducible transcript 3), 유전자등록번호(Genebank) NM_004177(syntaxin 3), 유전자등록번호(Genebank) NM_004417(dual specificity phosphatase 1), 유전자등록번호(Genebank) NM_004418(dual specificity phosphatase 2), 유전자등록번호(Genebank) NM_004723[rho/rac guanine nucleotide exchange factor (GEF) 2], 유전자등록번호(Genebank) NM_004748(cell cycle progression 1), 유전자등록번호(Genebank) NM_004751[glucosaminyl (N-acetyl) transferase 3, mucin type], 유전자등록번호(Genebank) NM_004760(serine/threonine kinase 17a), 유전자등록번호(Genebank) NM_004864(growth differentiation factor 15), 유전자등록번호(Genebank) NM_004907(immediate early response 2), 유전자등록번호(Genebank) NM_004925[aquaporin 3 (Gill blood group)], 유전자등록번호(Genebank) NM_004926(zinc finger protein 36, C3H type-like 1), 유전자등록번호(Genebank) NM_005139(annexin A3), 유전자등록번호(Genebank) NM_005228{epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, 유전자등록번호(Genebank) NM_005242[coagulation factor II (thrombin) receptor-like 1], 유전자등록번호(Genebank) NM_005261(GTP binding protein overexpressed in skeletal muscle), 유전자등록번호(Genebank) NM_005415[solute carrier family 20 (phosphate transporter), member 1], 유전자등록번호(Genebank) NM_005438(FOS-like antigen 1), 유전자등록번호(Genebank) NM_005451[PDZ and LIM domain 7 (enigma)], 유전자등록번호(Genebank) NM_005469(acyl-CoA thioesterase 8), 유전자등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자등록번호(Genebank) NM_005772(RNA terminal phosphate cyclase-like 1), 유전자등록번호(Genebank) NM_005953(metallothionein 2A), 유전자등록번호(Genebank) NM_005980(S100 calcium binding protein P), 유전자등록번호(Genebank) NM_006091(coronin, actin binding protein, 2B), 유전자등록번호(Genebank) NM_006208(ectonucleotide pyrophosphatase/phosphodiesterase 1), 유전자등록번호(Genebank) NM_006216[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], 유전자등록번호(Genebank) NM_006572[guanine nucleotide binding protein (G protein), alpha 13], 유전자등록번호(Genebank) NM_006617(nestin), 유전자등록번호(Genebank) NM_007039(protein tyrosine phosphatase, non-receptor type 21), 유전자등록번호(Genebank) NM_007333(killer cell lectin-like receptor subfamily C, member 3), 유전자등록번호(Genebank) NM_012250[related RAS viral (r-ras) oncogene homolog 2], 유전자등록번호(Genebank) NM_012258(hairy/enhancer-of-split related with YRPW motif 1), 유전자등록번호(Genebank) NM_013246(cardiotrophin-like cytokine factor 1), 유전자등록번호(Genebank) NM_013259(transgelin 3), 유전자등록번호(Genebank) NM_014045(low density lipoprotein receptor-related protein 10), 유전자등록번호(Genebank) NM_014059(chromosome 13 open reading frame 15), 유전자등록번호(Genebank) NM_014256(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3), 유전자등록번호(Genebank) NM_014331[solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유전자등록번호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자등록번호(Genebank) NM_014798[pleckstrin homology domain containing, family M (with RUN domain) member 1], 유전자등록번호(Genebank) NM_015187(KIAA0746 protein), 유전자등록번호(Genebank) NM_016009(SH3-domain GRB2-like endophilin B1), 유전자등록번호(Genebank) NM_016081(palladin, cytoskeletal associated protein), 유전자등록번호(Genebank) NM_016113(transient receptor potential cation channel, subfamily V, member 2), 유전자등록번호(Genebank) NM_016548(golgi phosphoprotein 2), 유전자등록번호(Genebank) NM_016639(tumor necrosis factor receptor superfamily, member 12A), 유전자등록번호(Genebank) NM_017705(progestin and adipoQ receptor family member V), 유전자등록번호(Genebank) NM_018357(La ribonucleoprotein domain family, member 6), 유전자등록번호(Genebank) NM_018590(chondroitin sulfate GalNAcT-2), 유전자등록번호(Genebank) NM_018639(WD repeat and SOCS box-containing 2), 유전자등록번 호(Genebank) NM_018689(KIAA1199), 유전자등록번호(Genebank) NM_018842(BAI1-associated protein 2-like 1), 유전자등록번호(Genebank) NM_018948(ERBB receptor feedback inhibitor 1), 유전자등록번호(Genebank) NM_019096(GTP binding protein 2), 유전자등록번호(Genebank) NM_020148[spire homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_020546[adenylate cyclase 2 (brain)], 유전자등록번호(Genebank) NM_020870(SH3 domain containing ring finger 1), 유전자등록번호(Genebank) NM_020962(neighbor of Punc E11), 유전자등록번호(Genebank) NM_021103(thymosin, beta 10), 유전자등록번호(Genebank) NM_021158[tribbles homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자등록번호(Genebank) NM_022153(chromosome 10 open reading frame 54), 유전자등록번호(Genebank) NM_022818(microtubule-associated protein 1 light chain 3 beta), 유전자등록번호(Genebank) NM_024847(transmembrane channel-like 7), 유전자등록번호(Genebank) NM_025099(chromosome 17 open reading frame 68), 유전자등록번호(Genebank) NM_025106(splA/ryanodine receptor domain and SOCS box containing 1), 유전자등록번호(Genebank) NM_025130(hexokinase domain containing 1), 유전자등록번호(Genebank) NM_025195[tribbles homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_030627(cytoplasmic polyadenylation element binding protein 4), 유전자등록번호(Genebank) NM_030674(solute carrier family 38, member 1), 유전자등록번호(Genebank) NM_031286(SH3 domain binding glutamic acid-rich protein like 3), 유전자등록번호(Genebank) NM_032466(aspartate beta-hydroxylase), 유전자등록번호(Genebank) NM_032525(tubulin, beta 6), 유전자등록번호(Genebank) NM_032717(lung cancer metastasis-associated protein), 유전자등록번호(Genebank) NM_032892(FERM domain containing 5), 유전자등록번호(Genebank) NM_033160(zinc finger protein 658), 유전자등록번호(Genebank) NM_033260(forkhead box Q1), 유전자등록번호(Genebank) NM_052871(hypothetical protein MGC4677), 유전자등록번호(Genebank) NM_078487[cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], 유전자등록번호(Genebank) NM_080655(chromosome 9 open reading frame 30), 유전자등록번호(Genebank) NM_080725[sulfiredoxin 1 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_080927(discoidin, CUB and LCCL domain containing 2), 유전자등록번호(Genebank) NM_134421(hippocalcin-like 1), 유전자등록번호(Genebank) NM_138961(endothelial cell adhesion molecule), 유전자등록번호(Genebank) NM_144497[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) NM_144652(leucine zipper-EF-hand containing transmembrane protein 2), 유전자등록번호(Genebank) NM_144778[muscleblind-like 2 (Drosophila)], 유전자등록번호(Genebank) NM_145904(high mobility group AT-hook 1), 유전자등록번호(Genebank) NM_147780(cathepsin B), 유전자등록번호(Genebank) NM_153006(N-acetylglutamate synthase), 유전자등록번호(Genebank) NM_153020(RNA binding motif protein 24), 유전자등록번호(Genebank) NM_153229(transmembrane protein 92), 유전자등록번호(Genebank) NM_153608(zinc finger protein 114), 유전자등록번호(Genebank) NM_170692(RAS protein activator like 2), 유전자등록번호(Genebank) NM_172210[colony stimulating factor 1 (macrophage)], 유전자등록번호(Genebank) NM_172364(calcium channel, voltage-dependent, alpha 2/delta subunit 4), 유전자등록번호(Genebank) NM_175839(spermine oxidase), 유전자등록번호(Genebank) NM_178234(tumor suppressor candidate 3), 유전자등록번호(Genebank) NM_178275(eEF1A2 binding protein), 유전자등록번호(Genebank) NM_178859(organic solute transporter beta), 유전자등록번호(Genebank) NM_181985[leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], 유전자등록번호(Genebank) NM_182485(cytoplasmic polyadenylation element binding protein 2), 유전자등록번호(Genebank) NM_183373(chromosome 6 open reading frame 145), 유전자등록번호(Genebank) NM_198447[golgi transport 1 homolog A (S. cerevisiae)], 유전자등록번호(Genebank) NM_198833[serpin peptidase inhibitor, clade B (ovalbumin), member 8], 유전자등록번호(Genebank) NM_199330[homer homolog 2 (Drosophila)], 유전자등록번호(Genebank) NM_201555(four and a half LIM domains 2), 유전자등록번호(Genebank) NM_203380(acyl-CoA synthetase long-chain family member 5), 유전자등록번호(Genebank) NM_203391(glycerol kinase), 유전자등록번호(Genebank) NM_203403(chromosome 9 open reading frame 150), 유전자등록번호(Genebank) NR_002205(ferritin, heavy polypeptide-like 12), 유전자등록번호(Genebank) NR_002802(trophoblast-derived noncoding RNA), 유전자등록번호(Genebank) NR_002823(aquaporin 7 pseudogene 2), 유전자등록번호(Genebank) NR_002834(dual specificity phosphatase 5 pseudogene), 유전자등록번호(Genebank) XM_373277(similar to microtubule-associated proteins 1A/1B light chain 3), 유전자등록번호(Genebank) XM_932993[Homo sapiens cDNA FLJ32255 fis, clone PROST1000226. (AK056817)] 및 유전자등록번호(Genebank) XR_000951[Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC:15504 IMAGE:2990071), complete cds. (BC007251)].Genebank AB040974 (Start codon is not identified .; Homo sapiens mRNA for KIAA1541 protein, partial cds.), Genebank AF011794 (cell cycle progression 1), Genebank AF147412 (Full) length insert cDNA clone YP59C02), Genebank (Genebank) AF165191 (dystonin), Genebank (Genebank) AK026078 [ELK3, ETS-domain protein (SRF accessory protein 2)], Genebank AK055600 [Iduronate 2 -sulfatase (Hunter syndrome)], Genebank AK075342 (Chromosome 12 open reading frame 39), Genebank AK124869 (SH2 domain containing 5), Genebank AY665468 [Ras association (RalGDS) / AF-6) domain family 8], Genebank BC005130 (hypothetical protein MGC11082), Genebank BC015987 (Kruppel-like factor 6), Genebank BC031618 (chromosome 10 open reading) frame 30), Genebank BC033000 ( tetratricopeptide repeat domain 17), Genebank BC033829 [A kinase (PRKA) anchor protein (gravin) 12], Genebank (Genebank) BC036699 (hypothetical LOC654433), Genebank BC047030 (uridine phosphorylase 1 ), Genebank BC066644 (KIAA1949), Genebank (Genebank) BC070200 (hypothetical LOC541471), Genebank BG210146 (Similar to asparagine synthetase), Genebank BG001037 (Thioredoxin reductase 1 ), Genebank BG188151 (Transcribed locus), Genebank CR595522 [3'UTR of hypothetical protein (ORF1)], Genebank CR625648 (metallothionein 2A), Genebank (Genebank) ) M90656 (glutamate-cysteine ligase, catalytic subunit), Genebank NM_000167 (glycerol kinase), Genebank NM_000202 [iduronate 2-sulfatase (Hunter syndrome)], Genebank NM_000214 [ jagged 1 (Alagille syndrome)], Genebank NM_000433 [neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], Genebank NM_000565 (interleukin 6 receptor), Genebank NM_000574 [CD55 molecule, decay accelerating factor for complement (Cromer blood group)], Genebank NM_000582 [secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], gene registration number (Genebank) NM_000584 (interleukin 8), Genebank NM_000596 (insulin-like growth factor binding protein 1), Genebank NM_000602 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1] , Genebank NM_000660 (transforming growth factor, beta 1), Genebank NM_001001555 (growth factor receptor-bound protein 10), Genebank NM_001007245 (interferon-related developme ntal regulator 1), gene registration number (Genebank) NM_001007271 (dual specificity phosphatase 13), gene registration number (Genebank) NM_001008211 (optineurin), gene registration number (Genebank) NM_001031716 (oligonucleotide / oligosaccharide-binding fold containing 2A), gene registration Genebank NM_001105 (activin A receptor, type I), Genebank NM_001172 (arginase, type II), Genebank NM_001173 (Rho GTPase activating protein 5), Genebank NM_001300 (Kruppel-like factor 6), Genebank NM_001353 [aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)], Genebank NM_001425 (epithelial membrane protein 3), Genebank NM_001498 (glutamate-cysteine ligase, catalytic subunit), Gene accession number (Genebank) ) NM_001554 (cysteine-rich, angiogenic inducer, 61), Genebank (Genebank) NM_001614 (actin, gamma 1), Genebank (Genebank) NM_001657 [amphiregulin (schwannoma-derived growth factor)], Genebank (Genebank) ) NM_001723 (dystonin), Genebank NM_001730 [Kruppel-like factor 5 (intestinal)], Genebank NM_001748 [calpain 2, (m / II) large subunit], Gene Registration Number (Genebank) NM_001769 (CD9 molecule), Gene Registration Number (Genebank) NM_001780 (CD63 molecule), Gene Registration Number (Genebank) NM_001785 (cytidine deaminase), Gene Registration Number (Genebank) NM_001964 (early growth response 1), Gene Registration Number (Genebank) NM_002061 (glutamate-cysteine ligase, modifier subunit), gene Genebank NM_002064 [glutaredoxin (thioltransferase)], Gene Registration Number (Genebank) NM_002115 [hexokinase 3 (white cell)], Gene Registration Number (Genebank) NM_002143 (hippocalcin), Gene Registration Number (Genebank) NM_002203 [integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], Genebank NM_002224 (inositol 1,4,5-triphosphate receptor, type 3), Genebank NM_002276 (keratin 19), Genebank NM_002288 (leukocyte-associated immunoglobulin-like receptor 2), Genebank NM_002305 [lectin, galactoside-binding, soluble, 1 (galectin 1)], Genebank NM_002306 (lectin , galactoside-binding, soluble, 3), Genebank NM_002309 [leukemia inhibitory factor (cholinergic differentiation factor)], Genebank NM_002394 [solute carrier family 3 (activators of dibasic and neutral amino acid transport) , member 2], Genebank NM_0025 71 [progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], Genebank NM_002576 [p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) )], Genebank NM_002607 (platelet-derived growth factor alpha polypeptide), Genebank (Genebank) NM_002648 (pim-1 oncogene), Genebank NM_002867 (RAB3B, member RAS oncogene family), Genebank (Genebank) NM_002899 (retinol binding protein 1, cellular), Genebank (Genebank) NM_002960 (S100 calcium binding protein A3), Genebank (Genebank) NM_002970 (spermidine / spermine N1-acetyltransferase 1), Gene registration Number (Genebank) NM_003107 [SRY (sex determining region Y) -box 4], Genebank NM_003122 (serine peptidase inhibitor, Kazal type 1), Genebank NM_003225 (trefoil factor 1), Gene registration Number (Genebank) NM_003254 (TIMP metall opeptidase inhibitor 1), Genebank NM_003255 (TIMP metallopeptidase inhibitor 2), Genebank NM_003311 (pleckstrin homology-like domain, family A, member 2), Genebank NM_003330 (thioredoxin reductase 1), Genebank NM_003407 [zinc finger protein 36, C3H type, homolog (mouse)], Genebank NM_003739 [aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], Genebank NM_003887 (development and differentiation enhancing factor 2), Genebank NM_003897 (immediate early response 3), Genebank NM_003900 (sequestosome 1), Gene registration number (Genebank) NM_003937 [kynureninase (L-kynurenine hydrolase)], Genebank NM_003979 (G protein-coupled receptor, family C, group 5, member A), Genebank NM_004024 (activating transcription factor 3 ), Gene registration number (Genebank) NM_004073 [polo-like kinase 3 (Drosophila)], gene registration number (Genebank) NM_004083 (DNA-damage-inducible transcript 3), gene registration number (Genebank) NM_004177 (syntaxin 3), gene registration number (Genebank) NM_004417 (dual specificity phosphatase 1), Genebank NM_004418 (dual specificity phosphatase 2), Genebank NM_004723 [rho / rac guanine nucleotide exchange factor (GEF) 2], Genebank (Menebank) NM_004748 (cell cycle progression 1), Genebank NM_004751 [glucosaminyl (N-acetyl) transferase 3, mucin type], Genebank NM_004760 (serine / threonine kinase 17a), Genebank NM_004864 (growth differentiation factor 15), Genebank NM_004907 (immediate early response 2), Genebank NM_004925 [aquaporin 3 (Gill blood group)], Genebank NM_004926 (zinc finger protein 36 , C3H type-like 1), Gene Registration Number (Gen ebank) NM_005139 (annexin A3), Genebank NM_005228 {epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, Genebank NM_005242 [coagulation factor II ( thrombin) receptor-like 1], Genebank NM_005261 (GTP binding protein overexpressed in skeletal muscle), Genebank NM_005415 [solute carrier family 20 (phosphate transporter), member 1], gene registration number ( Genebank) NM_005438 (FOS-like antigen 1), Genebank NM_005451 [PDZ and LIM domain 7 (enigma)], Genebank NM_005469 (acyl-CoA thioesterase 8), Genebank (Genebank) NM_005620 (S100 calcium binding protein A11), Genebank (Genebank) NM_005772 (RNA terminal phosphate cyclase-like 1), Gene accession number (Genebank) NM_005953 (metallothionein 2A), Gene registration number (Genebank) NM_005980 (S100 calcium binding protein P), Genebank NM_006091 (coronin, actin binding protein, 2B), genebank (Genebank) NM_006208 (ectonucleotide pyrophosphatase / phosphodiesterase 1), genebank (Genebank) NM_006216 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], Genebank NM_006572 [guanine nucleotide binding protein (G protein), alpha 13], Genebank (Genebank) NM_006617 (nestin), Gene accession number (Genebank) NM_007039 (protein tyrosine phosphatase, non- receptor type 21), genebank NM_007333 (killer cell lectin-like receptor subfamily C, member 3), genebank NM_012250 [related RAS viral (r-ras) oncogene homolog 2], gene registry number Genebank NM_012258 (hairy / enhancer-of-split related with YRPW motif 1), Genebank NM_013246 (cardiotrophin-like cytokine factor 1), Genebank NM_013259 (transgelin 3), Gene registration number (Genebank) NM_014045 (low densi ty lipoprotein receptor-related protein 10), Genebank NM_014059 (chromosome 13 open reading frame 15), Genebank NM_014256 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 3), Genebank No. NM_014331 [solute carrier family 7, (cationic amino acid transporter, y + system) member 11], Genebank No. NM_014624 (S100 calcium binding protein A6), Genebank No. NM_014798 [pleckstrin homology domain containing, family M (with RUN domain) member 1], Genebank NM_015187 (KIAA0746 protein), Genebank NM_016009 (SH3-domain GRB2-like endophilin B1), Genebank ID (Genebank) ) NM_016081 (palladin, cytoskeletal associated protein), Genebank NM_016113 (transient receptor potential cation channel, subfamily V, member 2), Genebank NM_016548 (golgi phosphoprotein 2), Gene accession number (Genebank) NM_016639 (tumo r necrosis factor receptor superfamily, member 12A), genebank NM_017705 (progestin and adipoQ receptor family member V), genebank NM_018357 (La ribonucleoprotein domain family, member 6), genebank (Genebank) NM_018590 (chondroitin sulfate GalNAcT-2), Genebank NM_018639 (WD repeat and SOCS box-containing 2), Genebank NM_018689 (KIAA1199), Genebank NM_018842 (BAI1-associated protein 2-like 1), Genebank NM_018948 (ERBB receptor feedback inhibitor 1), Genebank NM_019096 (GTP binding protein 2), Genebank NM_020148 (spire homolog 1 (Drosophila) ], Genebank No. NM_020546 [adenylate cyclase 2 (brain)], Genebank No. (Genebank) NM_020870 (SH3 domain containing ring finger 1), Genebank No. NM_020962 (neighbor of Punc E11), Gene Registration Number (Genebank) NM_021103 (thymos in, beta 10), Genebank NM_021158 [tribbles homolog 3 (Drosophila)], Genebank NM_021913 (AXL receptor tyrosine kinase), Genebank NM_022153 (chromosome 10 open reading frame 54 ), Genebank NM_022818 (microtubule-associated protein 1 light chain 3 beta), Genebank NM_024847 (transmembrane channel-like 7), Genebank NM_025099 (chromosome 17 open reading frame 68 ), Genebank NM_025106 (splA / ryanodine receptor domain and SOCS box containing 1), Genebank NM_025130 (hexokinase domain containing 1), Genebank NM_025195 (tribbles homolog 1 (Drosophila) ], Genebank NM_030627 (cytoplasmic polyadenylation element binding protein 4), Genebank N (Genebank) NM_030674 (solute carrier family 38, member 1), Genebank NM_031286 (SH3 domain binding glutamic acid-rich) protein like 3), genebank (Genebank) NM_032466 (aspartate beta-hydroxylase), genebank (Genebank) NM_032525 (tubulin, beta 6), genebank (Genebank) NM_032717 (lung cancer metastasis-associated protein), gene Genebank NM_032892 (FERM domain containing 5), Genebank NM_033160 (zinc finger protein 658), Genebank NM_033260 (forkhead box Q1), Genebank NM_052871 (hypothetical protein MGC4677), Genebank NM_078487 [cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], Genebank NM_080655 (chromosome 9 open reading frame 30), Genebank NM_080725 [sulfiredoxin 1 homolog (S. cerevisiae)], Genebank NM_080927 (discoidin, CUB and LCCL domain containing 2), Genebank NM_134421 (hippocalcin-like 1), Genebank NM_138961 (endothelial cell adhesion molecules), Genebank NM_144497 [A kinase (PRKA) anchor protein (gravin) 12], Genebank number (Genebank) NM_144652 (leucine zipper-EF-hand containing transmembrane protein 2), Genebank number NM_144778 [muscleblind -like 2 (Drosophila)], Genebank NM_145904 (high mobility group AT-hook 1), Genebank NM_147780 (cathepsin B), Genebank NM_153006 (N-acetylglutamate synthase) , Genebank NM_153020 (RNA binding motif protein 24), Genebank NM_153229 (transmembrane protein 92), Genebank NM_153608 (zinc finger protein 114), Genebank NM_170692 (RAS protein activator like 2), heredity Genebank NM_172210 [colony stimulating factor 1 (macrophage)], Genebank number (Genebank) NM_172364 (calcium channel, voltage-dependent, alpha 2 / delta subunit 4), Genebank number NM_175839 (spermine oxidase ), Genebank NM_178234 (tumor suppressor candidate 3), Genebank NM_178275 (eEF1A2 binding protein), Genebank NM_178859 (organic solute transporter beta), Genebank NM_181985 [leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], Genebank NM_182485 (cytoplasmic polyadenylation element binding protein 2), Genebank NM_183373 (chromosome 6 open reading frame 145) , Genebank NM_198447 [golgi transport 1 homolog A (S. cerevisiae)], Genebank NM_198833 [serpin peptidase inhibitor, clade B (ovalbumin), member 8], Genebank NM_199330 [homer homolog 2 (Drosophila)], Genebank NM_201555 ( four and a half LIM domains 2), Genebank NM_203380 (acyl-CoA synthetase long-chain family member 5), Genebank NM_203391 (glycerol kinase), Genebank NM_203403 (chromosome 9 open reading frame 150), Genebank NR_002205 (ferritin, heavy polypeptide-like 12), Genebank NR_002802 (trophoblast-derived noncoding RNA), Genebank NR_002823 (aquaporin 7 pseudogene 2), Genebank NR_002834 (dual specificity phosphatase 5 pseudogene), Genebank XM_373277 (similar to microtubule-associated proteins 1A / 1B light chain 3), Genebank XM_932993 [Homo sapiens cDNA FLJ32255 fis, clone PROST 1000226. (AK056817)] and Genebank XR_000951 [Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC: 15504 IMAGE: 2990071), complete cds. (BC007251)].

2) 상기 바이오마커 중에서, 클로르덴의 노출에 의해 발현이 감소하는 바이오마커 유전자는 하기와 같다:2) Among the biomarkers, biomarker genes whose expression is reduced by the exposure of chlorden are as follows:

유전자등록번호(Genebank) AF007149(hypothetical protein LOC257407), 유전자등록번호(Genebank) AF118092(predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), 유전자등록번호(Genebank) AF334184(Rac GTPase activating protein 1 pseudogene), 유전자등록번호(Genebank) AL832208(hypothetical protein FLJ32312), 유전자등록번호(Genebank) BC006267(asparaginase like 1), 유전자등록번호(Genebank) BC050292(MGC44478), 유전자등록번호(Genebank) BF591978[Apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) BX405503(Alpha-fetoprotein), 유전자등록번호(Genebank) CD608671(Fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000029[angiotensinogen (serpin peptidase inhibitor, clade A, member 8)], 유전자등록번호(Genebank) NM_000040(apolipoprotein C-III), 유전자등록번호(Genebank) NM_000042[apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) NM_000156(guanidinoacetate N-methyltransferase), 유전자등록번호(Genebank) NM_000166(gap junction protein, beta 1, 32kDa), 유전자등록번호(Genebank) NM_000204(complement factor I), 유전자등록번호(Genebank) NM_000253(microsomal triglyceride transfer protein), 유전자등록번호(Genebank) NM_000354[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], 유전자등록번호(Genebank) NM_000508(fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000509(fibrinogen gamma chain), 유전자등록번호(Genebank) NM_000607(orosomucoid 1), 유전자등록번호(Genebank) NM_000608(orosomucoid 2), 유전자등록번호(Genebank) NM_000670[alcohol dehydrogenase 4 (class II), pi polypeptide], 유전자등록번호(Genebank) NM_000671[alcohol dehydrogenase 5 (class III), chi polypeptide], 유전자등록번호(Genebank) NM_000672[alcohol dehydrogenase 6 (class V)], 유전자등록번호(Genebank) NM_000790[dopa decarboxylase (aromatic L-amino acid decarboxylase)], 유전자등록번호(Genebank) NM_000792(deiodinase, iodothyronine, type I), 유전자등록번호(Genebank) NM_000846(glutathione S-transferase A2), 유전자등록번호(Genebank) NM_000851(glutathione S-transferase M5), 유전자등록번호(Genebank) NM_000934[serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], 유전자등록번호(Genebank) NM_001005414[Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA (NM_001005414)], 유전자등록번호(Genebank) NM_001010845(hypothetical protein LOC123876), 유전자등록번호(Genebank) NM_001011554[solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], 유전자등록번호(Genebank) NM_001012271[baculoviral IAP repeat-containing 5 (survivin)], 유전자등록번호(Genebank) NM_001012716(chromosome 18 open reading frame 56), 유전자등록번호(Genebank) NM_001040152(paternally expressed 10), 유전자등록번호(Genebank) NM_001067[topoisomerase (DNA) II alpha 170kDa], 유전자등록번호(Genebank) NM_001071(thymidylate synthetase), 유전자등록번호(Genebank) NM_001134(alpha-fetoprotein), 유전자등록번호(Genebank) NM_001182(aldehyde dehydrogenase 7 family, member A1), 유전자등록번호(Genebank) NM_001237(cyclin A2), 유전자등록번호(Genebank) NM_001311[cysteine-rich protein 1 (intestinal)], 유전자등록번호(Genebank) NM_001443(fatty acid binding protein 1, liver), 유전자등록번호(Genebank) NM_001739(carbonic anhydrase VA, mitochondrial), 유전자등록번호(Genebank) NM_001756[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], 유전자등록번호(Genebank) NM_001786(cell division cycle 2, G1 to S and G2 to M), 유전자등록번호(Genebank) NM_001789[cell division cycle 25 homolog A (S. pombe)], 유전자등 록번호(Genebank) NM_001823(creatine kinase, brain), 유전자등록번호(Genebank) NM_001844[collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], 유전자등록번호(Genebank) NM_001872[carboxypeptidase B2 (plasma)], 유전자등록번호(Genebank) NM_001948(dUTP pyrophosphatase), 유전자등록번호(Genebank) NM_002129(high-mobility group box 2), 유전자등록번호(Genebank) NM_002388(minichromosome maintenance complex component 3), 유전자등록번호(Genebank) NM_002497[NIMA (never in mitosis gene a)-related kinase 2], 유전자등록번호(Genebank) NM_002592(proliferating cell nuclear antigen), 유전자등록번호(Genebank) NM_002614(PDZ domain containing 1), 유전자등록번호(Genebank) NM_002630[progastricsin (pepsinogen C)], 유전자등록번호(Genebank) NM_002729(hematopoietically expressed homeobox), 유전자등록번호(Genebank) NM_002758(mitogen-activated protein kinase kinase 6), 유전자등록번호(Genebank) NM_003258(thymidine kinase 1, soluble), 유전자등록번호(Genebank) NM_003542(histone cluster 1, H4c), 유전자등록번호(Genebank) NM_003579[RAD54-like (S. cerevisiae)], 유전자등록번호(Genebank) NM_003882(WNT1 inducible signaling pathway protein 1), 유전자등록번호(Genebank) NM_003944(selenium binding protein 1), 유전자등록번호(Genebank) NM_003981(protein regulator of cytokinesis 1), 유전자등록번호(Genebank) NM_004111(flap structure-specific endonuclease 1), 유전자등록번호(Genebank) NM_004169[serine hydroxymethyltransferase 1 (soluble)], 유전자등록번호(Genebank) NM_004265(fatty acid desaturase 2), 유전자등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자등록번호(Genebank) NM_004701(cyclin B2), 유전자등록번호(Genebank) NM_004772(chromosome 5 open reading frame 13), 유전자등록번호(Genebank) NM_004845(phosphate cytidylyltransferase 1, choline, beta), 유전자등록번호(Genebank) NM_005030[polo-like kinase 1 (Drosophila)], 유전자등록번호(Genebank) NM_005063[stearoyl-CoA desaturase (delta-9-desaturase)], 유전자등록번호(Genebank) NM_005123(nuclear receptor subfamily 1, group H, member 4), 유전자등록번호(Genebank) NM_005165(aldolase C, fructose-bisphosphate), 유전자등록번호(Genebank) NM_005327(hydroxyacyl-Coenzyme A dehydrogenase), 유전자등록번호(Genebank) NM_005502[ATP-binding cassette, sub-family A (ABC1), member 1], 유전자등록번호(Genebank) NM_005573(lamin B1), 유전자등록번호(Genebank) NM_005631[smoothened homolog (Drosophila)], 유전자등록번호(Genebank) NM_005733(kinesin family member 20A), 유전자등록번호(Genebank) NM_005915(minichromosome maintenance complex component 6), 유전자등록번호(Genebank) NM_005940[matrix metallopeptidase 11 (stromelysin 3)], 유전자등록번호(Genebank) NM_005989[aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)], 유전자등록번호(Genebank) NM_006101[NDC80 homolog, kinetochore complex component (S. cerevisiae)], 유전자등록번호(Genebank) NM_006113(vav 3 oncogene), 유전자등록번호(Genebank) NM_006215[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], 유전자등록번호(Genebank) NM_006398(ubiquitin D), 유전자등록번호(Genebank) NM_006444(structural maintenance of chromosomes 2), 유전자등록번호(Genebank) NM_006461(sperm associated antigen 5), 유전자등록번호(Genebank) NM_006472(thioredoxin interacting protein), 유전자등록번호(Genebank) NM_006498(lectin, galactoside-binding, soluble, 2), 유전자등록번호(Genebank) NM_006757[troponin T type 3 (skeletal, fast)], 유전자등록번호(Genebank) NM_006845(kinesin family member 2C), 유전자등록번호(Genebank) NM_006876(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1), 유전자등록번호(Genebank) NM_007111(transcription factor Dp-1), 유전자등록번호(Genebank) NM_007317(kinesin family member 22), 유전자등록번호(Genebank) NM_012068(activating transcription factor 5), 유전자등록번호(Genebank) NM_012484[hyaluronan-mediated motility receptor (RHAMM)], 유전자등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자등록번호(Genebank) NM_014176[ubiquitin-conjugating enzyme E2T (putative)], 유전자등록번호(Genebank) NM_014264[polo-like kinase 4 (Drosophila)], 유전자등록번호(Genebank) NM_014333(cell adhesion molecule 1), 유전자등록번호(Genebank) NM_014736(KIAA0101), 유전자등록번호(Genebank) NM_014762(24-dehydrocholesterol reductase), 유전자등록번호(Genebank) NM_014791(maternal embryonic leucine zipper kinase), 유전자등록번호(Genebank) NM_014858(transmembrane and coiled-coil domain family 2), 유전자등록번호(Genebank) NM_015533[dihydroxyacetone kinase 2 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_016359(nucleolar and spindle associated protein 1), 유전자등록번호(Genebank) NM_016521(transcription factor Dp family, member 3), 유전자등록번호(Genebank) NM_017855(odontogenic, ameloblast asssociated), 유전자등록번호(Genebank) NM_018136[asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자등록번호(Genebank) NM_018154[ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], 유전자등록번호(Genebank) NM_018193(Fanconi anemia, complementation group I), 유전자등록번호(Genebank) NM_018410(hypothetical protein DKFZp762E1312), 유전자등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자등록번호(Genebank) NM_018974[unc-93 homolog A (C. elegans)], 유전자등록번호(Genebank) NM_020062(SLC2A4 regulator), 유전자등록번호(Genebank) NM_020530(oncostatin M), 유전자등록번호(Genebank) NM_020918(glycerol-3-phosphate acyltransferase, mitochondrial), 유전자등록번호(Genebank) NM_020995(haptoglobin-related protein), 유전자등록번호(Genebank) NM_021069(sorbin and SH3 domain containing 2), 유전자등록번호(Genebank) NM_022346(non-SMC condensin I complex, subunit G), 유전자등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자등록번호(Genebank) NM_025149(hypothetical protein FLJ20920), 유전자등록번호(Genebank) NM_025225(patatin-like phospholipase domain containing 3), 유전자등록번호(Genebank) NM_030771(coiled-coil domain containing 34), 유전자등록번호(Genebank) NM_030932[diaphanous homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_031299(cell division cycle associated 3), 유전자등록번호(Genebank) NM_031942(cell division cycle associated 7), 유전자등록번호(Genebank) NM_031966(cyclin B1), 유전자등록번호(Genebank) NM_032023[Ras association (RalGDS/AF-6) domain family 4], 유전자등록번호(Genebank) NM_032564[diacylglycerol O-acyltransferase homolog 2 (mouse)], 유전자등록번호(Genebank) NM_032638(GATA binding protein 2), 유전자등록번호(Genebank) NM_032828(zinc finger protein 587), 유전자등록번호(Genebank) NM_052968(apolipoprotein A-V), 유전자등록번호(Genebank) NM_054113(calcium and integrin binding family member 3), 유전자등록번호(Genebank) NM_058186(family with sequence similarity 3, member B), 유전자등록번호(Genebank) NM_145740(glutathione S-transferase A1), 유전자등록번호(Genebank) NM_148957(tumor necrosis factor receptor superfamily, member 19), 유전자등록번호(Genebank) NM_152308(chromosome 16 open reading frame 75), 유전자등록번호(Genebank) NM_152722(hepatocyte cell adhesion molecule), 유전자등록번호(Genebank) NM_153699(glutathione S-transferase A5), 유전자등록번호(Genebank) NM_172164[nuclear autoantigenic sperm protein (histone- binding)], 유전자등록번호(Genebank) NM_174936(proprotein convertase subtilisin/kexin type 9), 유전자등록번호(Genebank) NM_177550[solute carrier family 13 (sodium-dependent citrate transporter), member 5], 유전자등록번호(Genebank) NM_180991(solute carrier organic anion transporter family, member 4C1), 유전자등록번호(Genebank) NM_181712(ankyrin repeat domain 38), 유전자등록번호(Genebank) NM_182617(acyl-CoA synthetase medium-chain family member 2), 유전자등록번호(Genebank) NM_182908[dehydrogenase/reductase (SDR family) member 2], 유전자등록번호(Genebank) NM_198433(aurora kinase A), 유전자등록번호(Genebank) NM_201523(kinesin light chain 4), 유전자등록번호(Genebank) NM_203401(stathmin 1/oncoprotein 18), 유전자등록번호(Genebank) NM_207418(family with sequence similarity 72, member A), 유전자등록번호(Genebank) NR_002932(glutathione S-transferase M1 pseudogene), 유전자등록번호(Genebank) XM_940101[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] 및 유전자등록번호(Genebank) XM_944838(hypothetical protein LOC285733).Genebank AF007149 (hypothetical protein LOC257407), Genebank AF118092 (predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), Genebank AF334184 (Rac GTPase activating protein 1 pseudogene ), Genebank AL832208 (hypothetical protein FLJ32312), Genebank (Genebank) BC006267 (asparaginase like 1), Genebank (Genebank) BC050292 (MGC44478), Genebank (Genebank) BF591978 [Apolipoprotein H ( beta-2-glycoprotein I)], genebank (Genebank) BX405503 (alpha-fetoprotein), genebank (Genebank) CD608671 (Fibrinogen alpha chain), genebank (Genebank) NM_000029 [angiotensinogen (serpin peptidase inhibitor, clade) A, member 8)], Genebank NM_000040 (apolipoprotein C-III), Genebank NM_000042 [apolipoprotein H (beta-2-glycoprotein I)], Genebank NM_000156 (guanidinoacetate N-methyltr ansferase), Genebank NM_000166 (gap junction protein, beta 1, 32kDa), Genebank (Genebank) NM_000204 (complement factor I), Genebank NM_000253 (microsomal triglyceride transfer protein), Gene registration Number (Genebank) NM_000354 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], gene registration number (Genebank) NM_000508 (fibrinogen alpha chain), gene registration number (Genebank) NM_000509 (fibrinogen gamma chain) , Gene Registration Number (Genebank) NM_000607 (orosomucoid 1), Gene Registration Number (Genebank) NM_000608 (orosomucoid 2), Gene Registration Number (Genebank) NM_000670 [alcohol dehydrogenase 4 (class II), pi polypeptide], Gene Registration Number (Genebank) ) NM_000671 [alcohol dehydrogenase 5 (class III), chi polypeptide], Genebank NM_000672 [alcohol dehydrogenase 6 (class V)], Genebank NM_000790 [dopa decarboxylase (aromatic L-amino acid decarboxylase) ], gene Lock number (Genebank) NM_000792 (deiodinase, iodothyronine, type I), gene registration number (Genebank) NM_000846 (glutathione S-transferase A2), gene registration number (Genebank) NM_000851 (glutathione S-transferase M5), gene registration number (Genebank) ) NM_000934 [serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], Genebank NM_001005414 [Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA (NM_001005414)] , Genebank NM_001010845 (hypothetical protein LOC123876), Genebank NM_001011554 [solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], Genebank NM_001012271 [baculoviral IAP repeat- containing 5 (survivin)], Genebank NM_001012716 (chromosome 18 open reading frame 56), Genebank NM_001040152 (paternally expressed 10), Genebank NM_001067 [topoisomerase (D NA) II alpha 170kDa], Genebank NM_001071 (thymidylate synthetase), Genebank NM_001134 (alpha-fetoprotein), Genebank NM_001182 (aldehyde dehydrogenase 7 family, member A1), Gene Genebank NM_001237 (cyclin A2), Genebank NM_001311 [cysteine-rich protein 1 (intestinal)], Genebank NM_001443 (fatty acid binding protein 1, liver), gene registration number ( Genebank) NM_001739 (carbonic anhydrase VA, mitochondrial), Genebank NM_001756 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], Genebank NM_001786 (cell division cycle 2 , G1 to S and G2 to M), Genebank NM_001789 [cell division cycle 25 homolog A (S. pombe), Genebank NM_001823 (creatine kinase, brain), Genebank NM_001844 [collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], Genebank (Genebank) NM_001872 [carboxypeptidase B2 (plasma)], Genebank NM_001948 (dUTP pyrophosphatase), Genebank NM_002129 (high-mobility group box 2), Genebank NM_002388 (minichromosome maintenance complex component) 3), Genebank NM_002497 [never in mitosis gene a-related kinase 2], Genebank NM_002592 (proliferating cell nuclear antigen), Genebank NM_002614 (PDZ domain containing) 1), Genebank NM_002630 [progastricsin (pepsinogen C)], Genebank NM_002729 (hematopoietically expressed homeobox), Genebank NM_002758 (mitogen-activated protein kinase kinase 6), heredity Genebank Number NM_003258 (thymidine kinase 1, soluble), Genebank Number NM_003542 (histone cluster 1, H4c), Genebank Number NM_003579 [RAD54-like (S. cerevisiae)], Gene Registration Number (Genebank) NM_003882 (WNT1 inducible signaling pathway protein 1), Genebank NM_003944 (selenium binding protein 1), Genebank NM_003981 (protein regulator of cytokinesis 1), Genebank NM_004111 ( flap structure-specific endonuclease 1), Genebank NM_004169 [serine hydroxymethyltransferase 1 (soluble)], Genebank NM_004265 (fatty acid desaturase 2), Genebank NM_004336 [BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], Genebank NM_004701 (cyclin B2), Genebank NM_004772 (chromosome 5 open reading frame 13), Genebank NM_004845 (phosphate cytidylyltransferase 1, cholin e, beta) Genebank NM_005030 [polo-like kinase 1 (Drosophila)], Genebank NM_005063 [stearoyl-CoA desaturase (delta-9-desaturase)], Genebank (Genebank) NM_005123 (nuclear receptor subfamily 1, group H, member 4), Genebank (Genebank) NM_005165 (aldolase C, fructose-bisphosphate), Genebank (Genebank) NM_005327 (hydroxyacyl-Coenzyme A dehydrogenase), Genebank ) NM_005502 [ATP-binding cassette, sub-family A (ABC1), member 1], gene registration number (Genebank) NM_005573 (lamin B1), gene registration number (Genebank) NM_005631 [smoothened homolog (Drosophila)], gene registration number (Genebank) NM_005733 (kinesin family member 20A), Genebank NM_005915 (minichromosome maintenance complex component 6), Gene registration number (Genebank) NM_005940 [matrix metallopeptidase 11 (stromelysin 3)], Gene registration number (Genebank) NM_005989 [aldo-keto reductase family 1, member D1 (delta 4-3-ketoster oid-5-beta-reductase)], Genebank NM_006101 [NDC80 homolog, kinetochore complex component (S. cerevisiae)], Genebank NM_006113 (vav 3 oncogene), Genebank Number (Genebank) NM_006215 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], Genebank (Genebank) NM_006398 (ubiquitin D), Genebank NM_006444 (structural maintenance of chromosomes 2), Genebank NM_006461 (sperm associated antigen 5), Genebank NM_006472 (thioredoxin interacting protein), Gene registration (Genebank) NM_006498 (lectin, galactoside-binding, soluble, 2), Genebank NM_006757 [troponin T type 3 (skeletal, fast)], Genebank NM_006845 (kinesin family member 2C), Genebank NM_006876 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 1), Genebank NM_007111 (transcription factor Dp-1), Genebank NM_007317 (kinesin family member 22), Genebank NM_ 012068 (activating transcription factor 5), Genebank NM_012484 (hyaluronan-mediated motility receptor (RHAMM)], Genebank NM_013277 (Rac GTPase activating protein 1), Genebank NM_014176 [ubiquitin -conjugating enzyme E2T (putative)], Genebank NM_014264 [polo-like kinase 4 (Drosophila)], Genebank NM_014333 (cell adhesion molecule 1), Genebank NM_014736 (KIAA0101 ), Genebank NM_014762 (24-dehydrocholesterol reductase), Genebank NM_014791 (maternal embryonic leucine zipper kinase), Genebank NM_014858 (transmembrane and coiled-coil domain family 2), Gene Genebank NM_015533 [dihydroxyacetone kinase 2 homolog (S. cerevisiae)], Genebank NM_016359 (nucleolar and spindle associated protein 1), Genebank NM_016521 (transcription factor Dp family, member 3), Genebank NM_017855 (odontogenic, ameloblast associated) , Genebank NM_018136 [asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], Genebank NM_018154 [ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], gene registration number ( Genebank) NM_018193 (Fanconi anemia, complementation group I), Genebank NM_018410 (hypothetical protein DKFZp762E1312), Genebank NM_018492 (PDZ binding kinase), Genebank NM_018974 [unc-93 homolog A (C. elegans)], Genebank NM_020062 (SLC2A4 regulator), Genebank Number (Genebank) NM_020530 (oncostatin M), Genebank Number (Genebank) NM_020918 (glycerol-3-phosphate acyltransferase, mitochondrial), heredity Genebank NM_020995 (haptoglobin-related protein), Genebank NM_021069 (sorbin and SH3 domain containing 2), Genebank NM_022346 (non-SMC condensin I complex, subunit G), gene Genebank NM_024629 (MLF1 interacting protein), Genebank NM_025149 (hypothetical protein FLJ20920), Genebank NM_025225 (patatin-like phospholipase domain containing 3), Genebank NM_030771 ( coiled-coil domain containing 34), Genebank NM_030932 (diaphanous homolog 3 (Drosophila)], Genebank NM_031299 (cell division cycle associated 3), Genebank NM_031942 (cell division cycle associated 7), Genebank NM_031966 (cyclin B1), Genebank NM_032023 [Ras association (RalGDS / AF-6) domain family 4], Genebank NM_032564 [diacylglycerol O-acyltransferase homolog 2 (mouse)], Genebank NM_032638 (GATA binding protein 2), Genebank NM_032828 (zinc finger protein 587), Genebank NM_052968 (apolipoprotein AV), Genebank (Genebank) NM_054113 (calcium and integrin binding family member 3), Genebank NM_058186 (family with sequence similarity 3, member B), Genebank NM_145740 (glutathione S-transferase A1), Gene accession number (Genebank) ) NM_148957 (tumor necrosis factor receptor superfamily, member 19), Genebank NM_152308 (chromosome 16 open reading frame 75), Genebank NM_152722 (hepatocyte cell adhesion molecule), Genebank NM_153699 (glutathione S-transferase A5), Genebank NM_172164 [nuclear autoantigenic sperm protein (histone-binding)], Genebank NM_174936 (proprotein convertase subtilisin / kexin type 9), Gene registry number (G enebank) NM_177550 [solute carrier family 13 (sodium-dependent citrate transporter), member 5], gene registration number (Genebank) NM_180991 (solute carrier organic anion transporter family, member 4C1), gene registration number (Genebank) NM_181712 (ankyrin repeat domain 38), gene registration number (Genebank) NM_182617 (acyl-CoA synthetase medium-chain family member 2), gene registration number (Genebank) NM_182908 [dehydrogenase / reductase (SDR family) member 2], gene registration number (Genebank) NM_198433 ( aurora kinase A), Genebank NM_201523 (kinesin light chain 4), Genebank NM_203401 (stathmin 1 / oncoprotein 18), Genebank NM_207418 (family with sequence similarity 72, member A ), Genebank NR_002932 (glutathione S-transferase M1 pseudogene), Genebank (Genebank) XM_940101 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] and Genebank (Genebank) ) XM_944838 (hypoth etical protein LOC285733).

본 발명자들은 클로르덴에 대한 노출 여부 확인용 바이오마커를 발굴하기 위하여, 클로르덴을 인간 간암 세포주(HepG2)에 처리하여 80% 생존 농도(IC20 dose)의 클로르덴(도 1 참조)을 인간 간암 세포주에 처리한 후, mRNA를 분리하여 4×44 k 올리고마이크로어레이 칩 Human whole genome microarray(Agilent, USA)를 이용 하여 유전자 발현양상을 분석하였다(도 2 참조). 분석시 p-value가 0.001 이하이고, Cy5/Cy3 비율이 5배 이상인 경우 발현이 증가한 유전자로 분류하였고, 0.2배 이하인 경우 발현 감소한 유전자로 분류하였다. 분석 결과, 발현이 증가한 유전자는 0.466%(45,220개의 유전자 중 211개), 발현이 감소한 유전자는 0.345%(45,220개의 유전자 중 156개)임을 확인하였다. 상기 유전자들 중 기능이 알려진 유전자들을 생물학적 방법(biological process)에 따라 분류한 결과, 유전자의 생물학적 방법(biological process)별 분류시 이에 해당하는 유전자의 기능은 생물학적 발달조절(regulation of biological process), 세포 요소 조직과 발생(cellular component organization and biogenesis), 스트레스 반응(response to stress), 세포증식(cell proliferation), 세포 사멸(cell death), 세포 자살(apoptosis), 세포 주기(cell cycle), 카르복실산 대사 과정(carboxylic acid metabolic process), 세포 골격 조직과 발생(cytoskeleton organization and biogenesis), 성장(growth), 상처 치료(wound healing)와 관련된 유전자로 분류되었다(표 2 및 표 3 참조). 상기 유전자들은 본 발명에서 사용한 클로르덴을 처리했을 때, 인간 간암 세포주에서 독성과 관련이 있다는 보고는 없다.The present inventors treated chlorden with a human liver cancer cell line (HepG2) to find a biomarker for confirming the exposure to chlorden, and then treated with 80% viable concentration (IC20 dose) of chlordene (see FIG. 1). After treatment, mRNA was isolated and analyzed for gene expression using 4 × 44 k oligomicroarray chip Human whole genome microarray (Agilent, USA) (see FIG. 2). When the p-value was less than 0.001 and the Cy5 / Cy3 ratio was 5 times or more, the gene was classified as an increased expression, and when it was 0.2 or less, the gene was classified as a reduced gene. As a result, it was confirmed that 0.466% (211 out of 45,220) genes with increased expression and 0.345% (156 out of 45,220 genes) with reduced expression. As a result of classifying the known genes among the genes according to the biological process, the functions of the corresponding genes are classified according to the biological process of the genes. Cellular component organization and biogenesis, stress to stress, cell proliferation, cell death, apoptosis, cell cycle, carboxylic acid It was classified as a gene involved in the carboxylic acid metabolic process, cytoskeleton organization and biogenesis, growth, and wound healing (see Table 2 and Table 3). The genes have not been reported to be associated with toxicity in human liver cancer cell lines when treated with chlordene used in the present invention.

또한, 본 발명은 상기 바이오마커로부터 선택된, 어느 하나 이상의 유전자의 핵산서열의 전부; 또는 상기 유전자의 단편인 올리고뉴클레오티드; 또는 그의 상보가닥 분자가 집적된, 클로르덴에 대한 노출 여부 확인용 마이크로어레이 칩을 제공한다.In addition, the present invention, the nucleic acid sequence of any one or more genes selected from the biomarker; Or an oligonucleotide that is a fragment of the gene; Or it provides a microarray chip for confirming the exposure to chlorden, its complementary strand molecules are integrated.

상기 올리고뉴클레오티드 또는 이의 상보가닥 분자는 상기 바이오마커 유전자의 15 내지 50개, 바람직하게는 15 내지 30개, 더욱 바람직하게는 18 내지 25개의 핵산을 포함한다.The oligonucleotide or complementary strand molecule thereof comprises 15 to 50, preferably 15 to 30, more preferably 18 to 25 nucleic acids of the biomarker gene.

본 발명의 DNA 마이크로어레이 칩은 당업자에게 알려진 방법으로 제작할 수 있다. 상기 마이크로어레이 칩을 제작하는 방법은 하기와 같다. 상기 탐색된 바이오마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판상에 고정화시키기 위해 파이조일렉트릭(piezoelectric) 방식을 이용한 마이크로파이펫팅(micropipetting)법 또는 핀(pin) 형태의 스폿터(spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 한정되는 것은 아니다. 상기 DNA 마이크로어레이 칩의 기판은 아미노-실란(amino-silane), 폴리-L-라이신(poly-L-lysine) 및 알데히드(aldehyde)로 이루어진 군에서 선택되는 하나의 활성기가 코팅된 것이 바람직하나 이에 한정되는 것은 아니다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막, 및 니트로셀룰로스 막(nitrocellulose membrane)으로 이루어진 군에서 선택될 수 있으나 이에 제한되는 것은 아니다. The DNA microarray chip of the present invention can be produced by methods known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method using a piezoelectric method or a pin type spotter is used. It is preferable to use a method and the like, but is not limited thereto. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde. It is not limited. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto.

또한, 본 발명은 클로르덴에 대한 노출 여부 확인을 위한 상기 마커의 검출 방법을 제공한다.In addition, the present invention provides a method for detecting the marker for confirming the exposure to chlorden.

본 발명은The present invention

클로르덴에 대한 노출이 의심되는 개체(실험군) 및 대조군의 체세포로부터 분리된 RNA 시료로부터From RNA samples isolated from somatic cells of subjects (experimental group) and control groups suspected of exposure to chlordene

1) cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;1) labeling the experimental and control groups with different fluorescent materials while synthesizing with cDNA;

2) 단계 1)의 각기 다른 형광물질로 표지된 cDNA를 본 발명의 DNA 마이크로어레이 칩과 혼성화시키는 단계;2) hybridizing cDNA labeled with different fluorescent materials of step 1) with the DNA microarray chip of the present invention;

3) 단계 2)의 반응한 DNA 마이크로어레이 칩을 분석하는 단계; 및3) analyzing the reacted DNA microarray chip of step 2); And

4) 단계 3)의 분석한 데이터에서 상기 DNA 마이크로어레이 칩 상의 유전자의 발현 정도를 대조군과 비교하는 단계를 포함하는, 클로르덴에 대한 노출 여부를 확인하기 위해 상기 바이오마커를 검출하는 방법을 제공한다.4) provides a method for detecting the biomarker to confirm the exposure to chlorden, comprising comparing the expression level of the gene on the DNA microarray chip with the control in the analyzed data of step 3) .

상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포를 사용하는 것이 바람직하나 이에 한정되는 것은 아니다. 이때, 대조군은 건강한 개체일 것이다.The somatic cell is preferably used, but is not limited to cells derived from liver or liver cancer cells and tissues. At this time, the control group will be a healthy individual.

또한, 단계 2)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 형광물질은 모두 사용 가능하다. 또한, 단계 2)의 혼성화는 40 내지 50℃에서 10 내지 20시간 동안 수행하는 것이 바람직하나 이에 한정되는 것은 아니다.In addition, the fluorescent material of step 2) is preferably selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). Not all phosphors known to those skilled in the art can be used. In addition, the hybridization of step 2) is preferably performed at 40 to 50 ° C. for 10 to 20 hours, but is not limited thereto.

또한, 단계 2)의 DNA 마이크로어레이 칩은 인간 게놈 중 본 발명에서 상기 과발현 또는 저발현 유전자(표 2 및 표 3 참조)가 탑재된 마이크로어레이 칩이라면 사용 가능하고, Whole Human Genome Oligo Microarray(Agilent, USA) 등을 사용하 는 것이 바람직하나 이에 한정되는 것은 아니며, 상기 본 발명자가 제작한 DNA 마이크로어레이 칩을 사용하는 것이 가장 바람직하다.In addition, the DNA microarray chip of step 2) can be used as long as the microarray chip is loaded with the over- or low-expression gene (see Table 2 and Table 3) in the human genome of the present invention, and Whole Human Genome Oligo Microarray (Agilent, USA) is preferably used, but is not limited thereto. It is most preferable to use a DNA microarray chip manufactured by the present inventors.

아울러, 단계 3)의 분석은 혼성화된 마이크로어레이 칩을 세척 및 염색한 후 스캔하여 이미지 프로세싱을 수행한 다음 통계적 분석을 수행하는 것이 바람직하다. 상기 염색 및 세척은 uidics Station 450을 이용하고, 스캔은 GeneChip scanner　 3000을 이용하며, 이미지 프로세싱은 Affymetrix GeneChip　 Operating System(GCOS)을 이용하며, 모든 절차는 Affymetrix사의 프로토콜에 따라 수행하는 것이 바람직하나 이에 한정되지 않는다. 상기 통계학적 분석은 GenPlex software version 2.3을 이용하여 수행하는 것이 바람직하나 이에 한정되는 것은 아니며, 당업자에게 알려진 분석 소프트웨어를 사용하여도 무방하다.In addition, in the analysis of step 3), it is preferable that the hybridized microarray chip is washed, stained, scanned, subjected to image processing, and then statistical analysis. The staining and washing using uidics Station 450, the scan is GeneChip scanner 　 3000, and the image processing is Affymetrix GeneChip 　 Operating System (GCOS), and all procedures are preferably performed according to the protocol of Affymetrix, but is not limited thereto. The statistical analysis is preferably performed using GenPlex software version 2.3, but is not limited thereto. Analysis software known to those skilled in the art may be used.

또한, 본 발명은In addition,

클로르덴에 대한 노출이 의심되는 개체(실험군) 및 대조군의 체세포로부터 분리된 RNA 시료로부터From RNA samples isolated from somatic cells of subjects (experimental group) and control groups suspected of exposure to chlordene

1) 상기 RNA를 대상으로, 본 발명의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머 쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및1) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) on the RNA using a primer pair complementary to the biomarker gene of the present invention and capable of amplifying the biomarker gene; And

2) 단계 1)의 유전자 산물의 양을 대조군과 비교하는 단계를 포함하는, 클로르덴에 대한 노출 여부를 확인하기 위해 상기 바이오마커를 검출하는 방법을 제공 한다.2) comparing the amount of the gene product of step 1) with the control group, to provide a method for detecting the biomarker to determine the exposure to chlorden.

상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포를 사용하는 것이 바람직하나 이에 한정되는 것은 아니다. 이때, 대조군은 건강한 개체일 것이다.The somatic cell is preferably used, but is not limited to cells derived from liver or liver cancer cells and tissues. At this time, the control group will be a healthy individual.

단계 1)의 프라이머 쌍은 바이오마커 유전자의 증폭 산물이 100 내지 300 bp가 되도록 설계된 15 내지 50머 길이, 바람직하게는 15 내지 30머의 길의, 더욱 바람직하게는 18 내지 25머의 길이의 정방향 및 역방향 프라이머 쌍은 모두 사용 가능하다.The primer pair of step 1) is in the forward direction of 15 to 50mers long, preferably 15 to 30mers long, more preferably 18 to 25mers, designed so that the amplification product of the biomarker gene is 100 to 300 bp. And reverse primer pairs are both available.

또한, 본 발명은 상기 마이크로어레이 칩을 포함하는, 클로르덴에 대한 노출 여부 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing exposure to chlorden, including the microarray chip.

상기 확인용 키트에 추가적으로 인간 체세포를 포함하는 클로르덴에 대한 노출 여부 진단용 키트를 제공한다. 상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다. 상기 간암 세포는 HepG2를 사용하는 것이 바람직하나 이에 한정되는 것은 아니다.In addition to the identification kit, a kit for diagnosing exposure to chlorden including human somatic cells is provided. The somatic cells can be used if the cells derived from the liver or liver cancer cells and tissues. The liver cancer cells preferably use HepG2, but are not limited thereto.

또한, 상기 키트에 추가적으로 형광물질을 포함할 수 있으며, 상기 형광물질은 스트렙아비딘-알칼리 탈인화효소 접합물질(strepavidin-like phosphatease conjugate), 화학형광물질(chemiflurorensce) 및 화학발광물질(chemiluminescent)로 이루어진 군으로부터 선택되는 것이 바람직하나 이에 한정되는 것은 아니다.In addition, the kit may further include a fluorescent material, and the fluorescent material may be composed of a strepavidin-like phosphatease conjugate, a chemical fluorescence (chemiflurorensce), and a chemiluminescent material (chemiluminescent). It is preferably selected from the group but is not limited thereto.

아울러, 상기 키트에 추가적으로 반응 시약을 포함할 수 있으며, 상기 반응 시약은 혼성화에 사용되는 완충용액, RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 DNA 마이크로어레이 칩의 혼성화 반응에 필요한 반응 시약은 모두 포함할 수 있다.In addition, the kit may further include a reaction reagent, the reaction reagent used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), fluorescent staining agent It may be composed of a labeling reagent such as a chemical inducing agent, a washing buffer, and the like, but is not limited thereto. The reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art may be included.

아울러, 본 발명은 상기 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머 쌍을 포함하는, 클로르덴에 대한 노출 여부 진단용 키트를 제공한다.In addition, the present invention provides a kit for diagnosing exposure to chlorden, comprising a primer pair complementary to the biomarker gene and capable of amplifying the biomarker gene.

상기 확인용 키트의 프라이머 쌍은 프라이머 쌍 1 내지 16으로 구성된 군으로부터 선택되어 사용하는 것이 바람직하나 이에 한정되는 것은 아니며, 상기 바이오마커 유전자의 증폭 산물이 100 내지 300 bp가 되도록 설계된 15 내지 50머 길이, 바람직하게는 15 내지 30머의 길의, 더욱 바람직하게는 18 내지 25머의 길이의 정방향 및 역방향 프라이머 쌍은 모두 사용 가능하다.The primer pair of the identification kit is preferably selected from the group consisting of primer pairs 1 to 16, but is not limited thereto. The 15 to 50mer length is designed so that the amplification product of the biomarker gene is 100 to 300 bp. Both forward and reverse primer pairs, preferably 15-30 mer long, more preferably 18-25 mer long, can be used.

프라이머 쌍 1: 서열번호 1로 기재되는 정방향 프라이머 및 서열번호 2로 기재되는 역방향 프라이머;Primer pair 1: forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2;

프라이머 쌍 2: 서열번호 3으로 기재되는 정방향 프라이머 및 서열번호 4로 기재되는 역방향 프라이머;Primer pair 2: forward primer set forth in SEQ ID NO: 3 and reverse primer set forth in SEQ ID NO: 4;

프라이머 쌍 3: 서열번호 5로 기재되는 정방향 프라이머 및 서열번호 6으로 기재되는 역방향 프라이머;Primer pair 3: forward primer set forth in SEQ ID NO: 5 and reverse primer set forth in SEQ ID NO: 6;

프라이머 쌍 4: 서열번호 7로 기재되는 정방향 프라이머 및 서열번호 8로 기재되는 역방향 프라이머;Primer pair 4: forward primer set forth in SEQ ID NO: 7 and reverse primer set forth in SEQ ID NO: 8;

프라이머 쌍 5: 서열번호 9로 기재되는 정방향 프라이머 및 서열번호 10으로 기재되는 역방향 프라이머;Primer pair 5: forward primer set forth in SEQ ID NO: 9 and reverse primer set forth in SEQ ID NO: 10;

프라이머 쌍 6: 서열번호 11로 기재되는 정방향 프라이머 및 서열번호 12로 기재되는 역방향 프라이머;Primer pair 6: forward primer set forth in SEQ ID NO: 11 and reverse primer set forth in SEQ ID NO: 12;

프라이머 쌍 7: 서열번호 13으로 기재되는 정방향 프라이머 및 서열번호 14로 기재되는 역방향 프라이머;Primer pair 7: forward primer set forth in SEQ ID NO: 13 and reverse primer set forth in SEQ ID NO: 14;

프라이머 쌍 8: 서열번호 15로 기재되는 정방향 프라이머 및 서열번호 16으로 기재되는 역방향 프라이머;Primer pair 8: forward primer set forth in SEQ ID NO: 15 and reverse primer set forth in SEQ ID NO: 16;

프라이머 쌍 9: 서열번호 17로 기재되는 정방향 프라이머 및 서열번호 18로 기재되는 역방향 프라이머;Primer pair 9: forward primer set forth in SEQ ID NO: 17 and reverse primer set forth in SEQ ID NO: 18;

프라이머 쌍 10: 서열번호 19로 기재되는 정방향 프라이머 및 서열번호 20으로 기재되는 역방향 프라이머;Primer pair 10: forward primer set forth in SEQ ID NO: 19 and reverse primer set forth in SEQ ID NO: 20;

프라이머 쌍 11: 서열번호 21로 기재되는 정방향 프라이머 및 서열번호 22로 기재되는 역방향 프라이머;Primer pair 11: forward primer as depicted in SEQ ID NO: 21 and reverse primer as depicted in SEQ ID NO: 22;

프라이머 쌍 12: 서열번호 23으로 기재되는 정방향 프라이머 및 서열번호 24로 기재되는 역방향 프라이머;Primer pair 12: forward primer set forth in SEQ ID NO: 23 and reverse primer set forth in SEQ ID NO: 24;

프라이머 쌍 13: 서열번호 25로 기재되는 정방향 프라이머 및 서열번호 26으로 기재되는 역방향 프라이머;Primer pair 13: forward primer set forth in SEQ ID NO: 25 and reverse primer set forth in SEQ ID NO: 26;

프라이머 쌍 14: 서열번호 27로 기재되는 정방향 프라이머 및 서열번호 28로 기재되는 역방향 프라이머;Primer pair 14: forward primer set forth in SEQ ID NO: 27 and reverse primer set forth in SEQ ID NO: 28;

프라이머 쌍 15: 서열번호 29로 기재되는 정방향 프라이머 및 서열번호 30으로 기재되는 역방향 프라이머; 및,Primer pair 15: forward primer set forth in SEQ ID NO: 29 and reverse primer set forth in SEQ ID NO: 30; And,

프라이머 쌍 16: 서열번호 31로 기재되는 정방향 프라이머 및 서열번호 32로 기재되는 역방향 프라이머.Primer pair 16: Forward primer set forth in SEQ ID NO: 31 and reverse primer set forth in SEQ ID NO: 32.

상기 확인용 키트에 추가적으로 인간 체세포를 포함하는 클로르덴에 대한 노출 여부 진단용 키트를 제공한다. 상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포라면 모두 사용 가능하다. 상기 간암 세포는 HepG2를 사용하는 것이 바람직하나 이에 한정되는 것은 아니다.In addition to the identification kit, a kit for diagnosing exposure to chlorden including human somatic cells is provided. The somatic cells can be used if the cells derived from the liver or liver cancer cells and tissues. The liver cancer cells preferably use HepG2, but are not limited thereto.

아울러, 상기 키트에 추가적으로 반응 시약을 포함할 수 있으며, 상기 반응 시약은 RNA로부터 cDNA를 합성하기 위한 역전사효소, cNTPs 및 rNTP(사전 혼합형 또는 분리 공급형), 형광 염색제의 화학적 유도제와 같은 표식시약, 세척 완충용액 등으로 구성될 수 있으나 이에 한정된 것은 아니며, 당업자에게 알려진 RT-PCR 반응에 필요한 반응 시약은 모두 포함할 수 있다.In addition, the kit may further include a reaction reagent, the reagent for labeling such as reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), chemical inducer of fluorescent dye, It may be composed of a washing buffer and the like, but is not limited thereto, and may include all reaction reagents required for RT-PCR reaction known to those skilled in the art.

본 발명의 바이오마커가 집적된 DNA 마이크로어레이 칩은 인간 간에 대한 클로르덴 노출을 판정하는데 유용하게 사용될 수 있으며, 클로르덴에 의해 유발되는 독성 작용 기작을 규명하는 도구로 이용될 수 있다.The DNA microarray chip incorporating the biomarker of the present invention can be usefully used to determine chlorden exposure to human liver, and can be used as a tool for identifying the mechanism of toxic action caused by chlorden.

이하, 본 발명을 실시예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by way of examples.

단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

<< 실시예Example 1> 세포 배양 및 화학물질 처리 1> Cell Culture and Chemical Treatment

<1-1> 세포배양<1-1> Cell Culture

인간 간암 세포주인 HepG2 세포(Human hepatocellular liver carcinoma cell line)를 5% FBS가 첨가된 DMEM 배지(Gibro-BRL, USA)를 이용하여 100 ㎜ 디쉬(dish)에서 80% 정도 자랄 때까지 배양하였다. 본 발명자들은 기존의 연구와 보고를 통해 잔류성 유기 오염물질 중 하나인 클로르덴을 선정하였으며, 이를 DMSO에 용해시켰다. 매질(vehicle) 농도는 모든 실험에서 0.1% 이하였다.Human liver cancer cell line HepG2 cells (Human hepatocellular liver carcinoma cell line) were incubated in DMEM medium (Gibro-BRL, USA) to which 5% FBS was added until 80% growth in 100 mm dish. The inventors have selected chlorden, one of the persistent organic pollutants, through existing studies and reports, and dissolved it in DMSO. Vehicle concentration was less than 0.1% in all experiments.

<1-2> 세포 독성 실험(<1-2> cytotoxicity test ( MTTMTT assayassay ) 및 화학 물질 처리) And chemical processing

Mossman 등(J. Immunol . Methods, 65:55-63, 1983)의 방법으로 HepG2 세포주를 이용한 MTT 실험을 수행하였다. 24-웰 플레이트의 DMEM 배지에 80 × 104/웰 세포수로 분주하여 DMSO에 용해된 클로르덴을 처리하였고, 48시간 후에 MTT(3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetra zolium bromide) 5 ㎎/㎖을 혼합하여 튜브에 가하여 37℃에서 3 시간 동안 배양하였다. 이 후 배지를 제거하고 형성된 포 르마잔 크리스탈(formazan crystal)을 DMSO 500 ㎕에 용해하였다. 96-웰 플레이트로 옮겨 분주(aliquot)하였고 흡광도 540 nm에서 O.D.값을 측정하였다. HepG2 세포주에서 클로르덴의 세포독성을 살펴본 결과, 세포가 80% 생존 농도(IC20 dose)는 158 μM 이었으며(도 1 참조), 상기 농도로 결정하여 마이크로어레이 실험을 수행하였다.MTT experiment using HepG2 cell line was performed by the method of Mossman et al . ( J. Immunol . Methods , 65: 55-63, 1983). DMEM medium in 24-well plates was treated with 80 × 10 4 / well cell number and treated with chlorine dissolved in DMSO, and after 48 hours, MTT (3- [4,5-dimethylthiazol-2-yl] -2, 5 mg / mL of 5-diphenyltetra zolium bromide) was mixed and added to the tube and incubated at 37 ° C. for 3 hours. Thereafter, the medium was removed, and the formed formazan crystal was dissolved in 500 µl of DMSO. Transfer to a 96-well plate was aliquoted and the OD value was measured at absorbance 540 nm. As a result of examining the cytotoxicity of chlorden in the HepG2 cell line, the 80% viable concentration (IC 20 dose) of the cells was 158 μM (see FIG. 1), and the microarray experiment was performed by determining the concentration.

<< 실시예Example 2>  2> 마이크로어레이Microarray 실험 Experiment

<2-1> <2-1> RNARNA 의 분리 및 형광 물질 표지Isolation and Labeling of Fluorescent Materials

6 × 106 세포/㎖ 농도로 100 ㎜ 디쉬에 HepG2 세포를 분주한 후, 실시예 1-2에서 결정한 농도의 클로르덴을 48시간 동안 처리하였다. 이후, 상기 처리한 세포로부터 트리졸(trizol) 시약(Invitrogen life technologies, USA)을 사용하여 제조사의 방법대로 전체 RNA를 분리하였고, RNeasy mini kit(Qiagen, USA)를 사용하여 정제하였다. 게놈 DNA는 RNA 정제 동안 RNase-free DNase set(Qiagen, USA)를 사용하여 제거하였다. 각 전체 RNA 시료의 양은 분광광도계로 측정하였고, 농도는 Experion(Automated Electrophoresis station, Bio-Rad, USA)으로 확인하였다.After dispensing HepG2 cells in a 100 mm dish at a concentration of 6 × 10 6 cells / ml, chlordene at the concentration determined in Example 1-2 was treated for 48 hours. Thereafter, total RNA was isolated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using an RNeasy mini kit (Qiagen, USA). Genomic DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The amount of each total RNA sample was measured by spectrophotometer, the concentration was confirmed by Experion (Automated Electrophoresis station, Bio-Rad, USA).

<2-2> <2-2> 표지된Labeled cDNAcDNA 제조  Produce

올리고 마이크로어레이 분석을 위하여 실시예 2-1에서 수득한 클로르덴 처리군의 전체 RNA를 사용하여 cDNA를 제조하였다. 구체적으로, 상기 수득한 전체 RNA 30 ㎍과 올리고(dT) 프라이머 2 ㎍(1 ㎍/㎕)를 혼합하고 65℃에서 10분간 반응시킨 후 바로 얼음에 넣어 어닐링(annealing)시켰다. 상기 어닐링된 RNA의 역전사(Reverse Transcript) 반응을 위해 표 1과 같이 시약을 혼합하였다.CDNA was prepared using the total RNA of the chlordene treated group obtained in Example 2-1 for oligo microarray analysis. Specifically, 30 μg of the obtained RNA and 2 μg (1 μg / μl) of oligo (dT) primer were mixed and reacted at 65 ° C. for 10 minutes, and then annealed in ice immediately. Reagents were mixed as shown in Table 1 for Reverse Transcript reaction of the annealed RNA.

구성Configuration 부피(㎕)Volume (μl) 5X first strand buffer5X first strand buffer 66 dNTPsdNTPs 0.60.6 0.1 M DDT0.1 M DDT 33 SuperScript II enzymeSuperScript II enzyme 33 Cy-3 or Cy-5 dUTPCy-3 or Cy-5 dUTP 22

대조군인 HepG2 세포주에서 분리한 전체 RNA는 Cy3-dUTP(녹색)로 표지화하였고, 클로르덴을 처리한 HepG2 세포주로부터 분리한 RNA는 Cy5-dUTP(적색)로 표지화하였다. 이때 두 시료는 Microcon YM-30 컬럼(Millipore, USA)을 사용하여 혼합, 정제되었다.Total RNA isolated from control HepG2 cell line was labeled with Cy3-dUTP (green), RNA isolated from chlorden treated HepG2 cell line was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

<2-3> <2-3> 혼성화Hybridization 반응 reaction

혼성화 및 세척 과정은 지노첵(주)(한국)의 지시방법에 따라 수행되었다. 혼성화는 12시간 동안 62℃ 오븐에서 수행되었다. DNA 마이크로어레이 칩으로는 4X44 k Whole Human Genome Oligo Microarray(Agilent, USA)를 이용하였다. 세척 과정(2분간 2× SSC/0.1% SDS, 3분간 1× SSC 및 2분간 0.2× SSC에 세척)을 거친 후 슬라이드는 3분간 800 rpm으로 원심분리하여 건조하였다.Hybridization and washing process was carried out according to the instructions of Gino Chek Co., Ltd. (Korea). Hybridization was performed in a 62 ° C. oven for 12 hours. As a DNA microarray chip, 4 × 44 k Whole Human Genome Oligo Microarray (Agilent, USA) was used. After the washing process (washing in 2 × SSC / 0.1% SDS for 2 minutes, 1 × SSC for 3 minutes and 0.2 × SSC for 2 minutes), the slides were dried by centrifugation at 800 rpm for 3 minutes.

<2-4> 형광 이미지 획득<2-4> Fluorescence Image Acquisition

슬라이드 상의 혼성화 이미지는 Genepix 4000B(Axon Instruments, USA)로 스캔하였다. 결합하지 않은 유전자를 세척한 칩은 레이저 광 스캐너(laser fluorescence scanner)를 사용하여 형광 이미지를 획득하였다. 이때 녹색 형광 이미지는 대조군에서, 적색 형광 이미지는 실험군에서만 특이하게 발현되는 유전자의 활성정도를 나타내게 되며, 노란색 형광 이미지는 녹색과 적색의 보색으로 두 군의 발현이 큰 차이가 없음을 의미하였다. 스캔한 이미지들은 유전자 발현 비율을 얻기 위하여 GenePix 4.1 소프트웨어(Axon Instruments, USA)로 분석하였다. 상기 방법에 의해 수득한 데이터로부터, Cy5/Cy3 비율이 5배 이상인 경우 발현이 증가한 유전자로 분류하였고, 0.2배 이하인 경우 발현 감소한 유전자로 분류함으로써 클로르덴에 대한 마커 유전자를 선별하였다. 이때, p-value는 0.001 이하이다. 본 실시예에서 5배 이상의 유전자를 선별한 것은 기존의 방법대로 1.5나 2배의 유전자를 선별하였을 경우 유전자의 수가 너무 많게 되어 클로르덴에 대한 특이 유전자라는 신뢰도가 감소될 수 있어 좀 더 신뢰도를 높이고자 5배 이상의 발현 유전자를 선별하게 되었고 P-value 역시 같은 이유이다.Hybridization images on the slides were scanned with the Genepix 4000B (Axon Instruments, USA). Chips washed with unbound genes were obtained with a fluorescence image using a laser fluorescence scanner. In this case, the green fluorescence image in the control group, the red fluorescence image represents the activity level of the gene specifically expressed in the experimental group, and the yellow fluorescence image means that the expression of the two groups does not have a large difference in complementary colors of green and red. Scanned images were analyzed with GenePix 4.1 software (Axon Instruments, USA) to obtain gene expression rates. From the data obtained by the above method, marker genes for chlorden were selected by classifying genes with increased expression when the Cy5 / Cy3 ratio was 5 times or more and by genes with reduced expression when 0.2 or less. At this time, p-value is 0.001 or less. In the present example, the selection of five or more genes in the present embodiment results in a too large number of genes when 1.5 or 2 times the genes are selected according to the conventional method, thereby reducing the reliability of the specific gene for chlorden, thereby increasing the reliability. Now, more than five times the expression genes were selected and P-value is the same reason.

그 결과, 발현이 증가한 유전자는 0.466%(45,220개의 유전자 중 211개), 발현이 감소한 유전자는 0.345%(45,220개의 유전자 중 156개)임을 확인하였다.As a result, it was confirmed that the gene with increased expression was 0.466% (211 out of 45,220 genes), and the 0.3% with reduced expression gene (156 out of 45,220 genes).

상기 선별된 유전자들의 기능을 생물학적 방법(biological process)에 따라 분류한 결과, 표 2 및 표 3에서 나타난 바와 같이, 상기 유전자들 중 일부는 생물학적 발달조절(regulation of biological process), 세포 요소 조직과 발생(cellular component organization and biogenesis), 스트레스 반응(response to stress), 세포증식(cell proliferation), 세포 사멸(cell death), 세포 자살(apoptosis), 세포 주기(cell cycle), 카르복실산 대사 과정(carboxylic acid metabolic process), 세포 골격 조직과 발생(cytoskeleton organization and biogenesis), 성장(growth), 상처 치료(wound healing)와 관련된 유전자로 분류되었다.As a result of classifying the functions of the selected genes according to a biological process, as shown in Tables 2 and 3, some of the genes were regulated by biological regulation, cell element organization and development. (cellular component organization and biogenesis), response to stress, cell proliferation, cell death, apoptosis, cell cycle, carboxylic acid metabolism The genes have been classified as related to acid metabolic processes, cytoskeleton organization and biogenesis, growth, and wound healing.

클로르덴에 의해 발현이 증가하는 유전자Gene whose expression is increased by chlorden 등록번호Registration Number
(Genebank)(Genebank) 유전자명Gene name 유전자gene
약어Abbreviation 중간값비Median ratio 1.regulation of biological process (생물학적 발달조절)1.regulation of biological process AF147412AF147412 Full length insert cDNA clone YP59C02Full length insert cDNA clone YP59C02 　 7.93 7.93 AF165191AF165191 dystonindystonin DSTDST 9.38 9.38 AK026078AK026078 ELK3, ETS-domain protein (SRF accessory protein 2)ELK3, ETS-domain protein (SRF accessory protein 2) 　 5.76 5.76 BC015987BC015987 Kruppel-like factor 6Kruppel-like factor 6 　 8.53 8.53 CR595522CR595522 3'UTR of hypothetical protein (ORF1)3'UTR of hypothetical protein (ORF1) 　 16.09 16.09 M90656M90656 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.24 11.24 NM_000214NM_000214 jagged 1 (Alagille syndrome)jagged 1 (Alagille syndrome) JAG1JAG1 17.22 17.22 NM_000574NM_000574 CD55 molecule, decay accelerating factor for complement (Cromer blood group)CD55 molecule, decay accelerating factor for complement (Cromer blood group) CD55CD55 12.96 12.96 NM_000582NM_000582 secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1) SPP1SPP1 7.03 7.03 NM_000584NM_000584 interleukin 8interleukin 8 IL8IL8 9.58 9.58 NM_000596NM_000596 insulin-like growth factor binding protein 1insulin-like growth factor binding protein 1 IGFBP1IGFBP1 42.28 42.28 NM_000602NM_000602 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 SERPINE1SERPINE1 21.08 21.08 NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_001105NM_001105 activin A receptor, type Iactivin A receptor, type I ACVR1ACVR1 5.27 5.27 NM_001172NM_001172 arginase, type IIarginase, type II ARG2ARG2 5.81 5.81 NM_001300NM_001300 Kruppel-like factor 6Kruppel-like factor 6 KLF6KLF6 6.42 6.42 NM_001425NM_001425 epithelial membrane protein 3epithelial membrane protein 3 EMP3EMP3 9.33 9.33 NM_001498NM_001498 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.07 11.07 NM_001554NM_001554 cysteine-rich, angiogenic inducer, 61cysteine-rich, angiogenic inducer, 61 CYR61CYR61 11.97 11.97 NM_001723NM_001723 dystonindystonin DSTDST 172.25 172.25 NM_001730NM_001730 Kruppel-like factor 5 (intestinal)Kruppel-like factor 5 (intestinal) KLF5KLF5 8.37 8.37 NM_001780NM_001780 CD63 moleculeCD63 molecule CD63CD63 5.17 5.17 NM_001785NM_001785 cytidine deaminasecytidine deaminase CDACDA 5.64 5.64 NM_001964NM_001964 early growth response 1early growth response 1 EGR1EGR1 23.76 23.76 NM_002061NM_002061 glutamate-cysteine ligase, modifier subunitglutamate-cysteine ligase, modifier subunit GCLMGCLM 7.11 7.11 NM_002305NM_002305 lectin, galactoside-binding, soluble, 1 (galectin 1)lectin, galactoside-binding, soluble, 1 (galectin 1) LGALS1LGALS1 13.18 13.18 NM_002309NM_002309 leukemia inhibitory factor (cholinergic differentiation factor)leukemia inhibitory factor (cholinergic differentiation factor) LIFLIF 16.29 16.29 NM_002607NM_002607 platelet-derived growth factor alpha polypeptideplatelet-derived growth factor alpha polypeptide PDGFAPDGFA 9.99 9.99 NM_002648NM_002648 pim-1 oncogenepim-1 oncogene PIM1PIM1 9.94 9.94 NM_002867NM_002867 RAB3B, member RAS oncogene familyRAB3B, member RAS oncogene family RAB3BRAB3B 6.35 6.35 NM_003107NM_003107 SRY (sex determining region Y)-box 4SRY (sex determining region Y) -box 4 SOX4SOX4 7.78 7.78 NM_003225NM_003225 trefoil factor 1trefoil factor 1 TFF1TFF1 6.19 6.19 NM_003254NM_003254 TIMP metallopeptidase inhibitor 1TIMP metallopeptidase inhibitor 1 TIMP1TIMP1 26.76 26.76 NM_003255NM_003255 TIMP metallopeptidase inhibitor 2TIMP metallopeptidase inhibitor 2 TIMP2TIMP2 6.47 6.47 NM_003311NM_003311 pleckstrin homology-like domain, family A, member 2pleckstrin homology-like domain, family A, member 2 PHLDA2PHLDA2 9.90 9.90 NM_003407NM_003407 zinc finger protein 36, C3H type, homolog (mouse)zinc finger protein 36, C3H type, homolog (mouse) ZFP36ZFP36 9.28 9.28 NM_003887NM_003887 development and differentiation enhancing factor 2development and differentiation enhancing factor 2 DDEF2DDEF2 8.71 8.71 NM_003897NM_003897 immediate early response 3immediate early response 3 IER3IER3 28.65 28.65 NM_003900NM_003900 sequestosome 1sequestosome 1 SQSTM1SQSTM1 12.64 12.64 NM_004024NM_004024 activating transcription factor 3activating transcription factor 3 ATF3ATF3 6.41 6.41 NM_004073NM_004073 polo-like kinase 3 (Drosophila)polo-like kinase 3 (Drosophila) PLK3PLK3 24.20 24.20 NM_004083NM_004083 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 DDIT3DDIT3 7.52 7.52 NM_004723NM_004723 rho/rac guanine nucleotide exchange factor (GEF) 2rho / rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2ARHGEF2 6.86 6.86 NM_004760NM_004760 serine/threonine kinase 17aserine / threonine kinase 17a STK17ASTK17A 5.12 5.12 NM_004926NM_004926 zinc finger protein 36, C3H type-like 1zinc finger protein 36, C3H type-like 1 ZFP36L1ZFP36L1 6.96 6.96 NM_005228NM_005228 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) EGFREGFR 9.97 9.97 NM_005415NM_005415 solute carrier family 20 (phosphate transporter), member 1solute carrier family 20 (phosphate transporter), member 1 SLC20A1SLC20A1 6.72 6.72 NM_005438NM_005438 FOS-like antigen 1FOS-like antigen 1 FOSL1FOSL1 7.27 7.27 NM_005620NM_005620 S100 calcium binding protein A11S100 calcium binding protein A11 S100A11S100A11 13.67 13.67 NM_006216NM_006216 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 SERPINE2SERPINE2 5.63 5.63 NM_006572NM_006572 guanine nucleotide binding protein (G protein), alpha 13guanine nucleotide binding protein (G protein), alpha 13 GNA13GNA13 5.62 5.62 NM_012250NM_012250 related RAS viral (r-ras) oncogene homolog 2related RAS viral (r-ras) oncogene homolog 2 RRAS2RRAS2 7.11 7.11 NM_012258NM_012258 hairy/enhancer-of-split related with YRPW motif 1hairy / enhancer-of-split related with YRPW motif 1 HEY1HEY1 9.61 9.61 NM_013246NM_013246 cardiotrophin-like cytokine factor 1cardiotrophin-like cytokine factor 1 CLCF1CLCF1 5.36 5.36 NM_014059NM_014059 chromosome 13 open reading frame 15chromosome 13 open reading frame 15 C13orf15C13orf15 17.80 17.80 NM_014624NM_014624 S100 calcium binding protein A6S100 calcium binding protein A6 S100A6S100A6 11.97 11.97 NM_016009NM_016009 SH3-domain GRB2-like endophilin B1SH3-domain GRB2-like endophilin B1 SH3GLB1SH3GLB1 6.69 6.69 NM_016639NM_016639 tumor necrosis factor receptor superfamily, member 12Atumor necrosis factor receptor superfamily, member 12A TNFRSF12ATNFRSF12A 10.74 10.74 NM_021158NM_021158 tribbles homolog 3 (Drosophila)tribbles homolog 3 (Drosophila) TRIB3TRIB3 8.93 8.93 NM_021913NM_021913 AXL receptor tyrosine kinaseAXL receptor tyrosine kinase AXLAXL 5.47 5.47 NM_033160NM_033160 zinc finger protein 658zinc finger protein 658 ZNF658ZNF658 6.71 6.71 NM_033260NM_033260 forkhead box Q1forkhead box Q1 FOXQ1FOXQ1 5.65 5.65 NM_078487NM_078487 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) CDKN2BCDKN2B 5.53 5.53 NM_080927NM_080927 discoidin, CUB and LCCL domain containing 2discoidin, CUB and LCCL domain containing 2 DCBLD2DCBLD2 5.96 5.96 NM_145904NM_145904 high mobility group AT-hook 1high mobility group AT-hook 1 HMGA1HMGA1 9.19 9.19 NM_147780NM_147780 cathepsin Bcathepsin B CTSBCTSB 15.88 15.88 NM_153608NM_153608 zinc finger protein 114zinc finger protein 114 ZNF114ZNF114 5.66 5.66 NM_170692NM_170692 RAS protein activator like 2RAS protein activator like 2 RASAL2RASAL2 9.94 9.94 NM_172210NM_172210 colony stimulating factor 1 (macrophage)colony stimulating factor 1 (macrophage) CSF1CSF1 9.15 9.15 NM_182485NM_182485 cytoplasmic polyadenylation element binding protein 2cytoplasmic polyadenylation element binding protein 2 CPEB2CPEB2 6.15 6.15 NM_201555NM_201555 four and a half LIM domains 2four and a half LIM domains 2 FHL2FHL2 18.17 18.17 2.2. cellularcellular componentcomponent organizationorganization andand biogenesisbiogenesis (세포 요소 조직과 발생)(Cell urea tissue and development) AF147412AF147412 Full length insert cDNA clone YP59C02Full length insert cDNA clone YP59C02 　 7.93 7.93 AF165191AF165191 dystonindystonin DSTDST 9.38 9.38 BC015987BC015987 Kruppel-like factor 6Kruppel-like factor 6 　 8.53 8.53 CR595522CR595522 3'UTR of hypothetical protein (ORF1)3'UTR of hypothetical protein (ORF1) 　 16.09 16.09 NM_000596NM_000596 insulin-like growth factor binding protein 1insulin-like growth factor binding protein 1 IGFBP1IGFBP1 42.28 42.28 NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_001300NM_001300 Kruppel-like factor 6Kruppel-like factor 6 KLF6KLF6 6.42 6.42 NM_001425NM_001425 epithelial membrane protein 3epithelial membrane protein 3 EMP3EMP3 9.33 9.33 NM_001554NM_001554 cysteine-rich, angiogenic inducer, 61cysteine-rich, angiogenic inducer, 61 CYR61CYR61 11.97 11.97 NM_001723NM_001723 dystonindystonin DSTDST 172.25 172.25 NM_001730NM_001730 Kruppel-like factor 5 (intestinal)Kruppel-like factor 5 (intestinal) KLF5KLF5 8.37 8.37 NM_001780NM_001780 CD63 moleculeCD63 molecule CD63CD63 5.17 5.17 NM_001785NM_001785 cytidine deaminasecytidine deaminase CDACDA 5.64 5.64 NM_002607NM_002607 platelet-derived growth factor alpha polypeptideplatelet-derived growth factor alpha polypeptide PDGFAPDGFA 9.99 9.99 NM_002867NM_002867 RAB3B, member RAS oncogene familyRAB3B, member RAS oncogene family RAB3BRAB3B 6.35 6.35 NM_003900NM_003900 sequestosome 1sequestosome 1 SQSTM1SQSTM1 12.64 12.64 NM_004723NM_004723 rho/rac guanine nucleotide exchange factor (GEF) 2rho / rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2ARHGEF2 6.86 6.86 NM_005228NM_005228 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) EGFREGFR 9.97 9.97 NM_006572NM_006572 guanine nucleotide binding protein (G protein), alpha 13guanine nucleotide binding protein (G protein), alpha 13 GNA13GNA13 5.62 5.62 NM_014624NM_014624 S100 calcium binding protein A6S100 calcium binding protein A6 S100A6S100A6 11.97 11.97 NM_016009NM_016009 SH3-domain GRB2-like endophilin B1SH3-domain GRB2-like endophilin B1 SH3GLB1SH3GLB1 6.69 6.69 NM_016639NM_016639 tumor necrosis factor receptor superfamily, member 12Atumor necrosis factor receptor superfamily, member 12A TNFRSF12ATNFRSF12A 10.74 10.74 NM_080927NM_080927 discoidin, CUB and LCCL domain containing 2discoidin, CUB and LCCL domain containing 2 DCBLD2DCBLD2 5.96 5.96 NM_145904NM_145904 high mobility group AT-hook 1high mobility group AT-hook 1 HMGA1HMGA1 9.19 9.19 BC033829BC033829 A kinase (PRKA) anchor protein (gravin) 12A kinase (PRKA) anchor protein (gravin) 12 　 7.75 7.75 NM_001008211NM_001008211 optineurinoptineurin OPTNOPTN 5.38 5.38 NM_001353NM_001353 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase) AKR1C1AKR1C1 5.34 5.34 NM_001614NM_001614 actin, gamma 1actin, gamma 1 ACTG1ACTG1 7.42 7.42 NM_001769NM_001769 CD9 moleculeCD9 molecule CD9CD9 7.27 7.27 NM_002276NM_002276 keratin 19keratin 19 KRT19KRT19 6.43 6.43 NM_002394NM_002394 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 SLC3A2SLC3A2 10.21 10.21 NM_002576NM_002576 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) PAK1PAK1 5.66 5.66 NM_004177NM_004177 syntaxin 3syntaxin 3 STX3STX3 6.06 6.06 NM_005451NM_005451 PDZ and LIM domain 7 (enigma)PDZ and LIM domain 7 (enigma) PDLIM7PDLIM7 9.21 9.21 NM_005469NM_005469 acyl-CoA thioesterase 8acyl-CoA thioesterase 8 ACOT8ACOT8 8.64 8.64 NM_006091NM_006091 coronin, actin binding protein, 2Bcoronin, actin binding protein, 2B CORO2BCORO2B 9.65 9.65 NM_014045NM_014045 low density lipoprotein receptor-related protein 10low density lipoprotein receptor-related protein 10 LRP10LRP10 7.42 7.42 NM_014331NM_014331 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11solute carrier family 7, (cationic amino acid transporter, y + system) member 11 SLC7A11SLC7A11 10.29 10.29 NM_016081NM_016081 palladin, cytoskeletal associated proteinpalladin, cytoskeletal associated protein PALLDPALLD 7.28 7.28 NM_018842NM_018842 BAI1-associated protein 2-like 1BAI1-associated protein 2-like 1 BAIAP2L1BAIAP2L1 7.60 7.60 NM_021103NM_021103 thymosin, beta 10thymosin, beta 10 TMSB10TMSB10 14.14 14.14 NM_032525NM_032525 tubulin, beta 6tubulin, beta 6 TUBB6TUBB6 6.97 6.97 NM_144497NM_144497 A kinase (PRKA) anchor protein (gravin) 12A kinase (PRKA) anchor protein (gravin) 12 AKAP12AKAP12 9.04 9.04 3.3. responseresponse toto stressstress (스트레스반응) (Stress reaction) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_003900NM_003900 sequestosome 1sequestosome 1 SQSTM1SQSTM1 12.64 12.64 NM_005228NM_005228 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) EGFREGFR 9.97 9.97 NM_006572NM_006572 guanine nucleotide binding protein (G protein), alpha 13guanine nucleotide binding protein (G protein), alpha 13 GNA13GNA13 5.62 5.62 NM_080927NM_080927 discoidin, CUB and LCCL domain containing 2discoidin, CUB and LCCL domain containing 2 DCBLD2DCBLD2 5.96 5.96 NM_001769NM_001769 CD9 moleculeCD9 molecule CD9CD9 7.27 7.27 AK026078AK026078 ELK3, ETS-domain protein (SRF accessory protein 2)ELK3, ETS-domain protein (SRF accessory protein 2) 　 5.76 5.76 M90656M90656 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.24 11.24 NM_000574NM_000574 CD55 molecule, decay accelerating factor for complement (Cromer blood group)CD55 molecule, decay accelerating factor for complement (Cromer blood group) CD55CD55 12.96 12.96 NM_000584NM_000584 interleukin 8interleukin 8 IL8IL8 9.58 9.58 NM_000602NM_000602 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 SERPINE1SERPINE1 21.08 21.08 NM_001105NM_001105 activin A receptor, type Iactivin A receptor, type I ACVR1ACVR1 5.27 5.27 NM_001498NM_001498 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.07 11.07 NM_002061NM_002061 glutamate-cysteine ligase, modifier subunitglutamate-cysteine ligase, modifier subunit GCLMGCLM 7.11 7.11 NM_003407NM_003407 zinc finger protein 36, C3H type, homolog (mouse)zinc finger protein 36, C3H type, homolog (mouse) ZFP36ZFP36 9.28 9.28 NM_004083NM_004083 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 DDIT3DDIT3 7.52 7.52 NM_021158NM_021158 tribbles homolog 3 (Drosophila)tribbles homolog 3 (Drosophila) TRIB3TRIB3 8.93 8.93 NM_147780NM_147780 cathepsin Bcathepsin B CTSBCTSB 15.88 15.88 BG001037BG001037 Thioredoxin reductase 1Thioredoxin reductase 1 　 6.31 6.31 NM_002203NM_002203 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) ITGA2ITGA2 14.04 14.04 NM_003330NM_003330 thioredoxin reductase 1thioredoxin reductase 1 TXNRD1TXNRD1 8.17 8.17 NM_004417NM_004417 dual specificity phosphatase 1dual specificity phosphatase 1 DUSP1DUSP1 16.69 16.69 NM_005242NM_005242 coagulation factor II (thrombin) receptor-like 1coagulation factor II (thrombin) receptor-like 1 F2RL1F2RL1 5.95 5.95 NM_018948NM_018948 ERBB receptor feedback inhibitor 1ERBB receptor feedback inhibitor 1 ERRFI1ERRFI1 7.34 7.34 NM_080725NM_080725 sulfiredoxin 1 homolog (S. cerevisiae)sulfiredoxin 1 homolog (S. cerevisiae) SRXN1SRXN1 15.41 15.41 NM_153020NM_153020 RNA binding motif protein 24RNA binding motif protein 24 RBM24RBM24 26.79 26.79 4.4. cellcell proliferationproliferation (세포 증식) (Cell proliferation) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_005228NM_005228 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) EGFREGFR 9.97 9.97 NM_000584NM_000584 interleukin 8interleukin 8 IL8IL8 9.58 9.58 BG001037BG001037 Thioredoxin reductase 1Thioredoxin reductase 1 　 6.31 6.31 NM_003330NM_003330 thioredoxin reductase 1thioredoxin reductase 1 TXNRD1TXNRD1 8.17 8.17 NM_001425NM_001425 epithelial membrane protein 3epithelial membrane protein 3 EMP3EMP3 9.33 9.33 NM_001554NM_001554 cysteine-rich, angiogenic inducer, 61cysteine-rich, angiogenic inducer, 61 CYR61CYR61 11.97 11.97 NM_001730NM_001730 Kruppel-like factor 5 (intestinal)Kruppel-like factor 5 (intestinal) KLF5KLF5 8.37 8.37 NM_002607NM_002607 platelet-derived growth factor alpha polypeptideplatelet-derived growth factor alpha polypeptide PDGFAPDGFA 9.99 9.99 NM_004723NM_004723 rho/rac guanine nucleotide exchange factor (GEF) 2rho / rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2ARHGEF2 6.86 6.86 NM_014624NM_014624 S100 calcium binding protein A6S100 calcium binding protein A6 S100A6S100A6 11.97 11.97 NM_000214NM_000214 jagged 1 (Alagille syndrome)jagged 1 (Alagille syndrome) JAG1JAG1 17.22 17.22 NM_002309NM_002309 leukemia inhibitory factor (cholinergic differentiation factor)leukemia inhibitory factor (cholinergic differentiation factor) LIFLIF 16.29 16.29 NM_002648NM_002648 pim-1 oncogenepim-1 oncogene PIM1PIM1 9.94 9.94 NM_003225NM_003225 trefoil factor 1trefoil factor 1 TFF1TFF1 6.19 6.19 NM_003254NM_003254 TIMP metallopeptidase inhibitor 1TIMP metallopeptidase inhibitor 1 TIMP1TIMP1 26.76 26.76 NM_003255NM_003255 TIMP metallopeptidase inhibitor 2TIMP metallopeptidase inhibitor 2 TIMP2TIMP2 6.47 6.47 NM_005438NM_005438 FOS-like antigen 1FOS-like antigen 1 FOSL1FOSL1 7.27 7.27 NM_005620NM_005620 S100 calcium binding protein A11S100 calcium binding protein A11 S100A11S100A11 13.67 13.67 NM_078487NM_078487 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) CDKN2BCDKN2B 5.53 5.53 NM_172210NM_172210 colony stimulating factor 1 (macrophage)colony stimulating factor 1 (macrophage) CSF1CSF1 9.15 9.15 NM_000565NM_000565 interleukin 6 receptorinterleukin 6 receptor IL6RIL6R 7.07 7.07 NM_001657NM_001657 amphiregulin (schwannoma-derived growth factor)amphiregulin (schwannoma-derived growth factor) AREGAREG 40.83 40.83 NM_025195NM_025195 tribbles homolog 1 (Drosophila)tribbles homolog 1 (Drosophila) TRIB1TRIB1 12.71 12.71 5.5. cellcell deathdeath (세포 사멸) (Cell death) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_001425NM_001425 epithelial membrane protein 3epithelial membrane protein 3 EMP3EMP3 9.33 9.33 NM_002648NM_002648 pim-1 oncogenepim-1 oncogene PIM1PIM1 9.94 9.94 NM_003900NM_003900 sequestosome 1sequestosome 1 SQSTM1SQSTM1 12.64 12.64 M90656M90656 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.24 11.24 NM_001105NM_001105 activin A receptor, type Iactivin A receptor, type I ACVR1ACVR1 5.27 5.27 NM_001498NM_001498 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.07 11.07 NM_002061NM_002061 glutamate-cysteine ligase, modifier subunitglutamate-cysteine ligase, modifier subunit GCLMGCLM 7.11 7.11 NM_004083NM_004083 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 DDIT3DDIT3 7.52 7.52 NM_021158NM_021158 tribbles homolog 3 (Drosophila)tribbles homolog 3 (Drosophila) TRIB3TRIB3 8.93 8.93 NM_147780NM_147780 cathepsin Bcathepsin B CTSBCTSB 15.88 15.88 NM_016009NM_016009 SH3-domain GRB2-like endophilin B1SH3-domain GRB2-like endophilin B1 SH3GLB1SH3GLB1 6.69 6.69 NM_016639NM_016639 tumor necrosis factor receptor superfamily, member 12Atumor necrosis factor receptor superfamily, member 12A TNFRSF12ATNFRSF12A 10.74 10.74 NM_001008211NM_001008211 optineurinoptineurin OPTNOPTN 5.38 5.38 NM_002576NM_002576 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) PAK1PAK1 5.66 5.66 NM_002305NM_002305 lectin, galactoside-binding, soluble, 1 (galectin 1)lectin, galactoside-binding, soluble, 1 (galectin 1) LGALS1LGALS1 13.18 13.18 NM_003311NM_003311 pleckstrin homology-like domain, family A, member 2pleckstrin homology-like domain, family A, member 2 PHLDA2PHLDA2 9.90 9.90 NM_003897NM_003897 immediate early response 3immediate early response 3 IER3IER3 28.65 28.65 NM_004760NM_004760 serine/threonine kinase 17aserine / threonine kinase 17a STK17ASTK17A 5.12 5.12 NM_013246NM_013246 cardiotrophin-like cytokine factor 1cardiotrophin-like cytokine factor 1 CLCF1CLCF1 5.36 5.36 6.6. apoptosisapoptosis (세포 자살) (Cell suicide) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_002648NM_002648 pim-1 oncogenepim-1 oncogene PIM1PIM1 9.94 9.94 NM_003900NM_003900 sequestosome 1sequestosome 1 SQSTM1SQSTM1 12.64 12.64 M90656M90656 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.24 11.24 NM_001105NM_001105 activin A receptor, type Iactivin A receptor, type I ACVR1ACVR1 5.27 5.27 NM_001498NM_001498 glutamate-cysteine ligase, catalytic subunitglutamate-cysteine ligase, catalytic subunit GCLCGCLC 11.07 11.07 NM_002061NM_002061 glutamate-cysteine ligase, modifier subunitglutamate-cysteine ligase, modifier subunit GCLMGCLM 7.11 7.11 NM_004083NM_004083 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 DDIT3DDIT3 7.52 7.52 NM_021158NM_021158 tribbles homolog 3 (Drosophila)tribbles homolog 3 (Drosophila) TRIB3TRIB3 8.93 8.93 NM_147780NM_147780 cathepsin Bcathepsin B CTSBCTSB 15.88 15.88 NM_016009NM_016009 SH3-domain GRB2-like endophilin B1SH3-domain GRB2-like endophilin B1 SH3GLB1SH3GLB1 6.69 6.69 NM_016639NM_016639 tumor necrosis factor receptor superfamily, member 12Atumor necrosis factor receptor superfamily, member 12A TNFRSF12ATNFRSF12A 10.74 10.74 NM_002576NM_002576 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) PAK1PAK1 5.66 5.66 NM_002305NM_002305 lectin, galactoside-binding, soluble, 1 (galectin 1)lectin, galactoside-binding, soluble, 1 (galectin 1) LGALS1LGALS1 13.18 13.18 NM_003311NM_003311 pleckstrin homology-like domain, family A, member 2pleckstrin homology-like domain, family A, member 2 PHLDA2PHLDA2 9.90 9.90 NM_003897NM_003897 immediate early response 3immediate early response 3 IER3IER3 28.65 28.65 NM_004760NM_004760 serine/threonine kinase 17aserine / threonine kinase 17a STK17ASTK17A 5.12 5.12 NM_013246NM_013246 cardiotrophin-like cytokine factor 1cardiotrophin-like cytokine factor 1 CLCF1CLCF1 5.36 5.36 7.7. cellcell cyclecycle (세포 주기) (Cell cycle) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_001105NM_001105 activin A receptor, type Iactivin A receptor, type I ACVR1ACVR1 5.27 5.27 NM_004083NM_004083 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 DDIT3DDIT3 7.52 7.52 NM_005228NM_005228 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) EGFREGFR 9.97 9.97 NM_000584NM_000584 interleukin 8interleukin 8 IL8IL8 9.58 9.58 NM_002607NM_002607 platelet-derived growth factor alpha polypeptideplatelet-derived growth factor alpha polypeptide PDGFAPDGFA 9.99 9.99 NM_014624NM_014624 S100 calcium binding protein A6S100 calcium binding protein A6 S100A6S100A6 11.97 11.97 NM_005438NM_005438 FOS-like antigen 1FOS-like antigen 1 FOSL1FOSL1 7.27 7.27 NM_078487NM_078487 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) CDKN2BCDKN2B 5.53 5.53 NM_004417NM_004417 dual specificity phosphatase 1dual specificity phosphatase 1 DUSP1DUSP1 16.69 16.69 AF165191AF165191 dystonindystonin DSTDST 9.38 9.38 NM_001723NM_001723 dystonindystonin DSTDST 172.25 172.25 NM_004073NM_004073 polo-like kinase 3 (Drosophila)polo-like kinase 3 (Drosophila) PLK3PLK3 24.20 24.20 NM_014059NM_014059 chromosome 13 open reading frame 15chromosome 13 open reading frame 15 C13orf15C13orf15 17.80 17.80 NM_021913NM_021913 AXL receptor tyrosine kinaseAXL receptor tyrosine kinase AXLAXL 5.47 5.47 AF011794AF011794 cell cycle progression 1cell cycle progression 1 CCPG1CCPG1 6.12 6.12 NM_001007271NM_001007271 dual specificity phosphatase 13dual specificity phosphatase 13 DUSP13DUSP13 10.02 10.02 NM_004748NM_004748 cell cycle progression 1cell cycle progression 1 CCPG1CCPG1 5.68 5.68 8.8. carboxyliccarboxylic acidacid metabolicmetabolic processprocess ( ( 카르복실산Carboxylic acid 대사 과정) Metabolic process) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_001105NM_001105 activin A receptor, type Iactivin A receptor, type I ACVR1ACVR1 5.27 5.27 NM_004083NM_004083 DNA-damage-inducible transcript 3DNA-damage-inducible transcript 3 DDIT3DDIT3 7.52 7.52 NM_005228NM_005228 epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) EGFREGFR 9.97 9.97 NM_000584NM_000584 interleukin 8interleukin 8 IL8IL8 9.58 9.58 NM_002607NM_002607 platelet-derived growth factor alpha polypeptideplatelet-derived growth factor alpha polypeptide PDGFAPDGFA 9.99 9.99 NM_014624NM_014624 S100 calcium binding protein A6S100 calcium binding protein A6 S100A6S100A6 11.97 11.97 NM_005438NM_005438 FOS-like antigen 1FOS-like antigen 1 FOSL1FOSL1 7.27 7.27 NM_078487NM_078487 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) CDKN2BCDKN2B 5.53 5.53 NM_004417NM_004417 dual specificity phosphatase 1dual specificity phosphatase 1 DUSP1DUSP1 16.69 16.69 AF165191AF165191 dystonindystonin DSTDST 9.38 9.38 NM_001723NM_001723 dystonindystonin DSTDST 172.25 172.25 AF011794AF011794 cell cycle progression 1cell cycle progression 1 CCPG1CCPG1 6.12 6.12 NM_001007271NM_001007271 dual specificity phosphatase 13dual specificity phosphatase 13 DUSP13DUSP13 10.02 10.02 NM_004748NM_004748 cell cycle progression 1cell cycle progression 1 CCPG1CCPG1 5.68 5.68 9.9. cytoskeletoncytoskeleton organizationorganization andand biogenesisbiogenesis (세포 골격 조직과 발생) (Cytoskeletal tissue and development) NM_002607NM_002607 platelet-derived growth factor alpha polypeptideplatelet-derived growth factor alpha polypeptide PDGFAPDGFA 9.99 9.99 AF165191AF165191 dystonindystonin DSTDST 9.38 9.38 NM_001723NM_001723 dystonindystonin DSTDST 172.25 172.25 NM_002576NM_002576 p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) PAK1PAK1 5.66 5.66 NM_004723NM_004723 rho/rac guanine nucleotide exchange factor (GEF) 2rho / rac guanine nucleotide exchange factor (GEF) 2 ARHGEF2ARHGEF2 6.86 6.86 CR595522CR595522 3'UTR of hypothetical protein (ORF1)3'UTR of hypothetical protein (ORF1) 　 16.09 16.09 NM_001614NM_001614 actin, gamma 1actin, gamma 1 ACTG1ACTG1 7.42 7.42 NM_002276NM_002276 keratin 19keratin 19 KRT19KRT19 6.43 6.43 NM_005451NM_005451 PDZ and LIM domain 7 (enigma)PDZ and LIM domain 7 (enigma) PDLIM7PDLIM7 9.21 9.21 NM_006091NM_006091 coronin, actin binding protein, 2Bcoronin, actin binding protein, 2B CORO2BCORO2B 9.65 9.65 NM_016081NM_016081 palladin, cytoskeletal associated proteinpalladin, cytoskeletal associated protein PALLDPALLD 7.28 7.28 NM_021103NM_021103 thymosin, beta 10thymosin, beta 10 TMSB10TMSB10 14.14 14.14 NM_032525NM_032525 tubulin, beta 6tubulin, beta 6 TUBB6TUBB6 6.97 6.97 10.10. growthgrowth (성장)(growth) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_001425NM_001425 epithelial membrane protein 3epithelial membrane protein 3 EMP3EMP3 9.33 9.33 NM_001554NM_001554 cysteine-rich, angiogenic inducer, 61cysteine-rich, angiogenic inducer, 61 CYR61CYR61 11.97 11.97 NM_172210NM_172210 colony stimulating factor 1 (macrophage)colony stimulating factor 1 (macrophage) CSF1CSF1 9.15 9.15 NM_080927NM_080927 discoidin, CUB and LCCL domain containing 2discoidin, CUB and LCCL domain containing 2 DCBLD2DCBLD2 5.96 5.96 BC015987BC015987 Kruppel-like factor 6Kruppel-like factor 6 　 8.53 8.53 NM_000596NM_000596 insulin-like growth factor binding protein 1insulin-like growth factor binding protein 1 IGFBP1IGFBP1 42.28 42.28 NM_001300NM_001300 Kruppel-like factor 6Kruppel-like factor 6 KLF6KLF6 6.42 6.42 NM_001785NM_001785 cytidine deaminasecytidine deaminase CDACDA 5.64 5.64 NM_002394NM_002394 solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 SLC3A2SLC3A2 10.21 10.21 11.11. woundwound healinghealing (상처 치료) (Wound healing) NM_000660NM_000660 transforming growth factor, beta 1transforming growth factor, beta 1 TGFB1TGFB1 7.85 7.85 NM_080927NM_080927 discoidin, CUB and LCCL domain containing 2discoidin, CUB and LCCL domain containing 2 DCBLD2DCBLD2 5.96 5.96 NM_006572NM_006572 guanine nucleotide binding protein (G protein), alpha 13guanine nucleotide binding protein (G protein), alpha 13 GNA13GNA13 5.62 5.62 NM_001769NM_001769 CD9 moleculeCD9 molecule CD9CD9 7.27 7.27 AK026078AK026078 ELK3, ETS-domain protein (SRF accessory protein 2)ELK3, ETS-domain protein (SRF accessory protein 2) 　 5.76 5.76 NM_000602NM_000602 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 SERPINE1SERPINE1 21.08 21.08 NM_002203NM_002203 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) ITGA2ITGA2 14.04 14.04 NM_005242NM_005242 coagulation factor II (thrombin) receptor-like 1coagulation factor II (thrombin) receptor-like 1 F2RL1F2RL1 5.95 5.95

클로르덴에 의해 발현이 감소하는 유전자Gene whose expression is reduced by chlorden 등록번호Registration Number
(Genebank)(Genebank) 유전자명Gene name 유전자gene
약어Abbreviation 중간값비Median ratio 1.regulation of biological process (생물학적 발달조절)1.regulation of biological process AF118092AF118092 predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds. 　 0.15 0.15 BF591978BF591978 Apolipoprotein H (beta-2-glycoprotein I)Apolipoprotein H (beta-2-glycoprotein I) 　 0.13 0.13 CD608671CD608671 Fibrinogen alpha chainFibrinogen alpha chain 　 0.17 0.17 NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_000042NM_000042 apolipoprotein H (beta-2-glycoprotein I)apolipoprotein H (beta-2-glycoprotein I) APOHAPOH 0.09 0.09 NM_000156NM_000156 guanidinoacetate N-methyltransferaseguanidinoacetate N-methyltransferase GAMTGAMT 0.17 0.17 NM_000204NM_000204 complement factor Icomplement factor I CFICFI 0.14 0.14 NM_000508NM_000508 fibrinogen alpha chainfibrinogen alpha chain FGAFGA 0.14 0.14 NM_000509NM_000509 fibrinogen gamma chainfibrinogen gamma chain FGGFGG 0.12 0.12 NM_001005414NM_001005414 Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414]Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414] 　 0.09 0.09 NM_001012271NM_001012271 baculoviral IAP repeat-containing 5 (survivin)baculoviral IAP repeat-containing 5 (survivin) BIRC5BIRC5 0.11 0.11 NM_001067NM_001067 topoisomerase (DNA) II alpha 170kDatopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.04 0.04 NM_001237NM_001237 cyclin A2cyclin A2 CCNA2CCNA2 0.13 0.13 NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M CDC2CDC2 0.09 0.09 NM_001789NM_001789 cell division cycle 25 homolog A (S. pombe)cell division cycle 25 homolog A (S. pombe) CDC25ACDC25A 0.14 0.14 NM_002129NM_002129 high-mobility group box 2high-mobility group box 2 HMGB2HMGB2 0.18 0.18 NM_002388NM_002388 minichromosome maintenance complex component 3minichromosome maintenance complex component 3 MCM3MCM3 0.17 0.17 NM_002497NM_002497 NIMA (never in mitosis gene a)-related kinase 2NIMA (never in mitosis gene a) -related kinase 2 NEK2NEK2 0.18 0.18 NM_002592NM_002592 proliferating cell nuclear antigenproliferating cell nuclear antigen PCNAPCNA 0.16 0.16 NM_002729NM_002729 hematopoietically expressed homeoboxhematopoietically expressed homeobox HHEXHHEX 0.18 0.18 NM_002758NM_002758 mitogen-activated protein kinase kinase 6mitogen-activated protein kinase kinase 6 MAP2K6MAP2K6 0.12 0.12 NM_003882NM_003882 WNT1 inducible signaling pathway protein 1WNT1 inducible signaling pathway protein 1 WISP1WISP1 0.19 0.19 NM_004336NM_004336 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1BUB1 0.06 0.06 NM_004701NM_004701 cyclin B2cyclin B2 CCNB2CCNB2 0.12 0.12 NM_004772NM_004772 chromosome 5 open reading frame 13chromosome 5 open reading frame 13 C5orf13C5orf13 0.13 0.13 NM_005030NM_005030 polo-like kinase 1 (Drosophila)polo-like kinase 1 (Drosophila) PLK1PLK1 0.11 0.11 NM_005123NM_005123 nuclear receptor subfamily 1, group H, member 4nuclear receptor subfamily 1, group H, member 4 NR1H4NR1H4 0.13 0.13 NM_005502NM_005502 ATP-binding cassette, sub-family A (ABC1), member 1ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1ABCA1 0.17 0.17 NM_005631NM_005631 smoothened homolog (Drosophila)smoothened homolog (Drosophila) SMOSMO 0.17 0.17 NM_005915NM_005915 minichromosome maintenance complex component 6minichromosome maintenance complex component 6 MCM6MCM6 0.17 0.17 NM_006113NM_006113 vav 3 oncogenevav 3 oncogene VAV3VAV3 0.19 0.19 NM_006472NM_006472 thioredoxin interacting proteinthioredoxin interacting protein TXNIPTXNIP 0.19 0.19 NM_006757NM_006757 troponin T type 3 (skeletal, fast)troponin T type 3 (skeletal, fast) TNNT3TNNT3 0.16 0.16 NM_007111NM_007111 transcription factor Dp-1transcription factor Dp-1 TFDP1TFDP1 0.16 0.16 NM_012068NM_012068 activating transcription factor 5activating transcription factor 5 ATF5ATF5 0.15 0.15 NM_014333NM_014333 cell adhesion molecule 1cell adhesion molecule 1 CADM1CADM1 0.12 0.12 NM_014762NM_014762 24-dehydrocholesterol reductase24-dehydrocholesterol reductase DHCR24DHCR24 0.19 0.19 NM_016359NM_016359 nucleolar and spindle associated protein 1nucleolar and spindle associated protein 1 NUSAP1NUSAP1 0.17 0.17 NM_016521NM_016521 transcription factor Dp family, member 3transcription factor Dp family, member 3 TFDP3TFDP3 0.18 0.18 NM_018154NM_018154 ASF1 anti-silencing function 1 homolog B (S. cerevisiae)ASF1 anti-silencing function 1 homolog B (S. cerevisiae) ASF1BASF1B 0.16 0.16 NM_020062NM_020062 SLC2A4 regulatorSLC2A4 regulator SLC2A4RGSLC2A4RG 0.20 0.20 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 NM_024629NM_024629 MLF1 interacting proteinMLF1 interacting protein MLF1IPMLF1IP 0.17 0.17 NM_031942NM_031942 cell division cycle associated 7cell division cycle associated 7 CDCA7CDCA7 0.13 0.13 NM_031966NM_031966 cyclin B1cyclin B1 CCNB1CCNB1 0.14 0.14 NM_032023NM_032023 Ras association (RalGDS/AF-6) domain family 4Ras association (RalGDS / AF-6) domain family 4 RASSF4RASSF4 0.18 0.18 NM_032638NM_032638 GATA binding protein 2GATA binding protein 2 GATA2GATA2 0.19 0.19 NM_032828NM_032828 zinc finger protein 587zinc finger protein 587 ZNF587ZNF587 0.17 0.17 NM_052968NM_052968 apolipoprotein A-Vapolipoprotein A-V APOA5APOA5 0.18 0.18 NM_148957NM_148957 tumor necrosis factor receptor superfamily, member 19tumor necrosis factor receptor superfamily, member 19 TNFRSF19TNFRSF19 0.11 0.11 NM_152722NM_152722 hepatocyte cell adhesion moleculehepatocyte cell adhesion molecule HEPACAMHEPACAM 0.12 0.12 NM_174936NM_174936 proprotein convertase subtilisin/kexin type 9proprotein convertase subtilisin / kexin type 9 PCSK9PCSK9 0.14 0.14 NM_182908NM_182908 dehydrogenase/reductase (SDR family) member 2dehydrogenase / reductase (SDR family) member 2 DHRS2DHRS2 0.13 0.13 2.2. cellcell cyclecycle (세포 주기) (Cell cycle) NM_001005414NM_001005414 Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414]Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414] 　 0.09 0.09 NM_001012271NM_001012271 baculoviral IAP repeat-containing 5 (survivin)baculoviral IAP repeat-containing 5 (survivin) BIRC5BIRC5 0.11 0.11 NM_001237NM_001237 cyclin A2cyclin A2 CCNA2CCNA2 0.13 0.13 NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M CDC2CDC2 0.09 0.09 NM_001789NM_001789 cell division cycle 25 homolog A (S. pombe)cell division cycle 25 homolog A (S. pombe) CDC25ACDC25A 0.14 0.14 NM_002388NM_002388 minichromosome maintenance complex component 3minichromosome maintenance complex component 3 MCM3MCM3 0.17 0.17 NM_002497NM_002497 NIMA (never in mitosis gene a)-related kinase 2NIMA (never in mitosis gene a) -related kinase 2 NEK2NEK2 0.18 0.18 NM_002592NM_002592 proliferating cell nuclear antigenproliferating cell nuclear antigen PCNAPCNA 0.16 0.16 NM_002758NM_002758 mitogen-activated protein kinase kinase 6mitogen-activated protein kinase kinase 6 MAP2K6MAP2K6 0.12 0.12 NM_004336NM_004336 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1BUB1 0.06 0.06 NM_004701NM_004701 cyclin B2cyclin B2 CCNB2CCNB2 0.12 0.12 NM_005030NM_005030 polo-like kinase 1 (Drosophila)polo-like kinase 1 (Drosophila) PLK1PLK1 0.11 0.11 NM_005915NM_005915 minichromosome maintenance complex component 6minichromosome maintenance complex component 6 MCM6MCM6 0.17 0.17 NM_006472NM_006472 thioredoxin interacting proteinthioredoxin interacting protein TXNIPTXNIP 0.19 0.19 NM_007111NM_007111 transcription factor Dp-1transcription factor Dp-1 TFDP1TFDP1 0.16 0.16 NM_012068NM_012068 activating transcription factor 5activating transcription factor 5 ATF5ATF5 0.15 0.15 NM_014333NM_014333 cell adhesion molecule 1cell adhesion molecule 1 CADM1CADM1 0.12 0.12 NM_014762NM_014762 24-dehydrocholesterol reductase24-dehydrocholesterol reductase DHCR24DHCR24 0.19 0.19 NM_016359NM_016359 nucleolar and spindle associated protein 1nucleolar and spindle associated protein 1 NUSAP1NUSAP1 0.17 0.17 NM_016521NM_016521 transcription factor Dp family, member 3transcription factor Dp family, member 3 TFDP3TFDP3 0.18 0.18 NM_031966NM_031966 cyclin B1cyclin B1 CCNB1CCNB1 0.14 0.14 NM_032023NM_032023 Ras association (RalGDS/AF-6) domain family 4Ras association (RalGDS / AF-6) domain family 4 RASSF4RASSF4 0.18 0.18 NM_152722NM_152722 hepatocyte cell adhesion moleculehepatocyte cell adhesion molecule HEPACAMHEPACAM 0.12 0.12 NM_182908NM_182908 dehydrogenase/reductase (SDR family) member 2dehydrogenase / reductase (SDR family) member 2 DHRS2DHRS2 0.13 0.13 NM_003579NM_003579 RAD54-like (S. cerevisiae)RAD54-like (S. cerevisiae) RAD54LRAD54L 0.15 0.15 NM_003981NM_003981 protein regulator of cytokinesis 1protein regulator of cytokinesis 1 PRC1PRC1 0.14 0.14 NM_006101NM_006101 NDC80 homolog, kinetochore complex component (S. cerevisiae)NDC80 homolog, kinetochore complex component (S. cerevisiae) NDC80NDC80 0.10 0.10 NM_006444NM_006444 structural maintenance of chromosomes 2structural maintenance of chromosomes 2 SMC2SMC2 0.18 0.18 NM_006461NM_006461 sperm associated antigen 5sperm associated antigen 5 SPAG5SPAG5 0.09 0.09 NM_006845NM_006845 kinesin family member 2Ckinesin family member 2C KIF2CKIF2C 0.15 0.15 NM_007317NM_007317 kinesin family member 22kinesin family member 22 KIF22KIF22 0.19 0.19 NM_013277NM_013277 Rac GTPase activating protein 1Rac GTPase activating protein 1 RACGAP1RACGAP1 0.19 0.19 NM_018136NM_018136 asp (abnormal spindle) homolog, microcephaly associated (Drosophila)asp (abnormal spindle) homolog, microcephaly associated (Drosophila) ASPMASPM 0.11 0.11 NM_018193NM_018193 Fanconi anemia, complementation group IFanconi anemia, complementation group I FANCIFANCI 0.13 0.13 NM_018492NM_018492 PDZ binding kinasePDZ binding kinase PBKPBK 0.20 0.20 NM_022346NM_022346 non-SMC condensin I complex, subunit Gnon-SMC condensin I complex, subunit G NCAPGNCAPG 0.16 0.16 NM_031299NM_031299 cell division cycle associated 3cell division cycle associated 3 CDCA3CDCA3 0.12 0.12 NM_172164NM_172164 nuclear autoantigenic sperm protein (histone-binding)nuclear autoantigenic sperm protein (histone-binding) NASPNASP 0.19 0.19 NM_198433NM_198433 aurora kinase Aaurora kinase A AURKAAURKA 0.15 0.15 NM_203401NM_203401 stathmin 1/oncoprotein 18stathmin 1 / oncoprotein 18 STMN1STMN1 0.11 0.11 3.3. cellularcellular componentcomponent organizationorganization andand biogenesisbiogenesis (세포 요소 조직과 발생) (Cell urea tissue and development) NM_001005414NM_001005414 Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414]Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414] 　 0.09 0.09 NM_001012271NM_001012271 baculoviral IAP repeat-containing 5 (survivin)baculoviral IAP repeat-containing 5 (survivin) BIRC5BIRC5 0.11 0.11 NM_002497NM_002497 NIMA (never in mitosis gene a)-related kinase 2NIMA (never in mitosis gene a) -related kinase 2 NEK2NEK2 0.18 0.18 NM_002592NM_002592 proliferating cell nuclear antigenproliferating cell nuclear antigen PCNAPCNA 0.16 0.16 NM_014333NM_014333 cell adhesion molecule 1cell adhesion molecule 1 CADM1CADM1 0.12 0.12 NM_014762NM_014762 24-dehydrocholesterol reductase24-dehydrocholesterol reductase DHCR24DHCR24 0.19 0.19 NM_016359NM_016359 nucleolar and spindle associated protein 1nucleolar and spindle associated protein 1 NUSAP1NUSAP1 0.17 0.17 NM_152722NM_152722 hepatocyte cell adhesion moleculehepatocyte cell adhesion molecule HEPACAMHEPACAM 0.12 0.12 NM_003981NM_003981 protein regulator of cytokinesis 1protein regulator of cytokinesis 1 PRC1PRC1 0.14 0.14 NM_006101NM_006101 NDC80 homolog, kinetochore complex component (S. cerevisiae)NDC80 homolog, kinetochore complex component (S. cerevisiae) NDC80NDC80 0.10 0.10 NM_006444NM_006444 structural maintenance of chromosomes 2structural maintenance of chromosomes 2 SMC2SMC2 0.18 0.18 NM_006461NM_006461 sperm associated antigen 5sperm associated antigen 5 SPAG5SPAG5 0.09 0.09 NM_006845NM_006845 kinesin family member 2Ckinesin family member 2C KIF2CKIF2C 0.15 0.15 NM_007317NM_007317 kinesin family member 22kinesin family member 22 KIF22KIF22 0.19 0.19 NM_013277NM_013277 Rac GTPase activating protein 1Rac GTPase activating protein 1 RACGAP1RACGAP1 0.19 0.19 NM_022346NM_022346 non-SMC condensin I complex, subunit Gnon-SMC condensin I complex, subunit G NCAPGNCAPG 0.16 0.16 NM_172164NM_172164 nuclear autoantigenic sperm protein (histone-binding)nuclear autoantigenic sperm protein (histone-binding) NASPNASP 0.19 0.19 NM_198433NM_198433 aurora kinase Aaurora kinase A AURKAAURKA 0.15 0.15 NM_203401NM_203401 stathmin 1/oncoprotein 18stathmin 1 / oncoprotein 18 STMN1STMN1 0.11 0.11 NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_001067NM_001067 topoisomerase (DNA) II alpha 170kDatopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.04 0.04 NM_002129NM_002129 high-mobility group box 2high-mobility group box 2 HMGB2HMGB2 0.18 0.18 NM_003882NM_003882 WNT1 inducible signaling pathway protein 1WNT1 inducible signaling pathway protein 1 WISP1WISP1 0.19 0.19 NM_005502NM_005502 ATP-binding cassette, sub-family A (ABC1), member 1ATP-binding cassette, sub-family A (ABC1), member 1 ABCA1ABCA1 0.17 0.17 NM_006113NM_006113 vav 3 oncogenevav 3 oncogene VAV3VAV3 0.19 0.19 NM_018154NM_018154 ASF1 anti-silencing function 1 homolog B (S. cerevisiae)ASF1 anti-silencing function 1 homolog B (S. cerevisiae) ASF1BASF1B 0.16 0.16 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 NM_032638NM_032638 GATA binding protein 2GATA binding protein 2 GATA2GATA2 0.19 0.19 NM_003542NM_003542 histone cluster 1, H4chistone cluster 1, H4c HIST1H4CHIST1H4C 0.12 0.12 NM_005733NM_005733 kinesin family member 20Akinesin family member 20A KIF20AKIF20A 0.10 0.10 NM_030932NM_030932 diaphanous homolog 3 (Drosophila)diaphanous homolog 3 (Drosophila) DIAPH3DIAPH3 0.17 0.17 4.4. responseresponse toto stressstress (스트레스 반응) (Stress reaction) NM_002592NM_002592 proliferating cell nuclear antigenproliferating cell nuclear antigen PCNAPCNA 0.16 0.16 NM_014762NM_014762 24-dehydrocholesterol reductase24-dehydrocholesterol reductase DHCR24DHCR24 0.19 0.19 NM_007317NM_007317 kinesin family member 22kinesin family member 22 KIF22KIF22 0.19 0.19 NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_001067NM_001067 topoisomerase (DNA) II alpha 170kDatopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.04 0.04 NM_002129NM_002129 high-mobility group box 2high-mobility group box 2 HMGB2HMGB2 0.18 0.18 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 NM_001237NM_001237 cyclin A2cyclin A2 CCNA2CCNA2 0.13 0.13 NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M CDC2CDC2 0.09 0.09 NM_002758NM_002758 mitogen-activated protein kinase kinase 6mitogen-activated protein kinase kinase 6 MAP2K6MAP2K6 0.12 0.12 NM_006472NM_006472 thioredoxin interacting proteinthioredoxin interacting protein TXNIPTXNIP 0.19 0.19 NM_003579NM_003579 RAD54-like (S. cerevisiae)RAD54-like (S. cerevisiae) RAD54LRAD54L 0.15 0.15 NM_018193NM_018193 Fanconi anemia, complementation group IFanconi anemia, complementation group I FANCIFANCI 0.13 0.13 AF118092AF118092 predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds. 　 0.15 0.15 BF591978BF591978 Apolipoprotein H (beta-2-glycoprotein I)Apolipoprotein H (beta-2-glycoprotein I) 　 0.13 0.13 CD608671CD608671 Fibrinogen alpha chainFibrinogen alpha chain 　 0.17 0.17 NM_000042NM_000042 apolipoprotein H (beta-2-glycoprotein I)apolipoprotein H (beta-2-glycoprotein I) APOHAPOH 0.09 0.09 NM_000204NM_000204 complement factor Icomplement factor I CFICFI 0.14 0.14 NM_000508NM_000508 fibrinogen alpha chainfibrinogen alpha chain FGAFGA 0.14 0.14 NM_000509NM_000509 fibrinogen gamma chainfibrinogen gamma chain FGGFGG 0.12 0.12 NM_052968NM_052968 apolipoprotein A-Vapolipoprotein A-V APOA5APOA5 0.18 0.18 NM_174936NM_174936 proprotein convertase subtilisin/kexin type 9proprotein convertase subtilisin / kexin type 9 PCSK9PCSK9 0.14 0.14 NM_000607NM_000607 orosomucoid 1orosomucoid 1 ORM1ORM1 0.14 0.14 NM_000608NM_000608 orosomucoid 2orosomucoid 2 ORM2ORM2 0.13 0.13 NM_000934NM_000934 serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2 SERPINF2SERPINF2 0.16 0.16 NM_001071NM_001071 thymidylate synthetasethymidylate synthetase TYMSTYMS 0.17 0.17 NM_004111NM_004111 flap structure-specific endonuclease 1flap structure-specific endonuclease 1 FEN1FEN1 0.19 0.19 5.5. cellcell proliferationproliferation (세포 증식) (Cell proliferation) NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 AF118092AF118092 predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds. 　 0.15 0.15 CD608671CD608671 Fibrinogen alpha chainFibrinogen alpha chain 　 0.17 0.17 NM_000508NM_000508 fibrinogen alpha chainfibrinogen alpha chain FGAFGA 0.14 0.14 NM_000509NM_000509 fibrinogen gamma chainfibrinogen gamma chain FGGFGG 0.12 0.12 NM_014333NM_014333 cell adhesion molecule 1cell adhesion molecule 1 CADM1CADM1 0.12 0.12 NM_006845NM_006845 kinesin family member 2Ckinesin family member 2C KIF2CKIF2C 0.15 0.15 NM_013277NM_013277 Rac GTPase activating protein 1Rac GTPase activating protein 1 RACGAP1RACGAP1 0.19 0.19 NM_172164NM_172164 nuclear autoantigenic sperm protein (histone-binding)nuclear autoantigenic sperm protein (histone-binding) NASPNASP 0.19 0.19 NM_001789NM_001789 cell division cycle 25 homolog A (S. pombe)cell division cycle 25 homolog A (S. pombe) CDC25ACDC25A 0.14 0.14 NM_004336NM_004336 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1BUB1 0.06 0.06 NM_005030NM_005030 polo-like kinase 1 (Drosophila)polo-like kinase 1 (Drosophila) PLK1PLK1 0.11 0.11 NM_007111NM_007111 transcription factor Dp-1transcription factor Dp-1 TFDP1TFDP1 0.16 0.16 NM_002729NM_002729 hematopoietically expressed homeoboxhematopoietically expressed homeobox HHEXHHEX 0.18 0.18 NM_005631NM_005631 smoothened homolog (Drosophila)smoothened homolog (Drosophila) SMOSMO 0.17 0.17 NM_031942NM_031942 cell division cycle associated 7cell division cycle associated 7 CDCA7CDCA7 0.13 0.13 NM_001311NM_001311 cysteine-rich protein 1 (intestinal)cysteine-rich protein 1 (intestinal) CRIP1CRIP1 0.09 0.09 NM_002614NM_002614 PDZ domain containing 1PDZ domain containing 1 PDZK1PDZK1 0.11 0.11 6.6. cytoskeletoncytoskeleton organizationorganization andand biogenesisbiogenesis (세포 골격 조직과 발생) (Cytoskeletal tissue and development) NM_006845NM_006845 kinesin family member 2Ckinesin family member 2C KIF2CKIF2C 0.15 0.15 NM_013277NM_013277 Rac GTPase activating protein 1Rac GTPase activating protein 1 RACGAP1RACGAP1 0.19 0.19 NM_007317NM_007317 kinesin family member 22kinesin family member 22 KIF22KIF22 0.19 0.19 NM_001005414NM_001005414 Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414]Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA [NM_001005414] 　 0.09 0.09 NM_016359NM_016359 nucleolar and spindle associated protein 1nucleolar and spindle associated protein 1 NUSAP1NUSAP1 0.17 0.17 NM_003981NM_003981 protein regulator of cytokinesis 1protein regulator of cytokinesis 1 PRC1PRC1 0.14 0.14 NM_006101NM_006101 NDC80 homolog, kinetochore complex component (S. cerevisiae)NDC80 homolog, kinetochore complex component (S. cerevisiae) NDC80NDC80 0.10 0.10 NM_006461NM_006461 sperm associated antigen 5sperm associated antigen 5 SPAG5SPAG5 0.09 0.09 NM_198433NM_198433 aurora kinase Aaurora kinase A AURKAAURKA 0.15 0.15 NM_203401NM_203401 stathmin 1/oncoprotein 18stathmin 1 / oncoprotein 18 STMN1STMN1 0.11 0.11 NM_005733NM_005733 kinesin family member 20Akinesin family member 20A KIF20AKIF20A 0.10 0.10 NM_030932NM_030932 diaphanous homolog 3 (Drosophila)diaphanous homolog 3 (Drosophila) DIAPH3DIAPH3 0.17 0.17 7.7. cellcell deathdeath (세포 사멸) (Cell death) NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 NM_014333NM_014333 cell adhesion molecule 1cell adhesion molecule 1 CADM1CADM1 0.12 0.12 NM_007111NM_007111 transcription factor Dp-1transcription factor Dp-1 TFDP1TFDP1 0.16 0.16 NM_005631NM_005631 smoothened homolog (Drosophila)smoothened homolog (Drosophila) SMOSMO 0.17 0.17 NM_014762NM_014762 24-dehydrocholesterol reductase24-dehydrocholesterol reductase DHCR24DHCR24 0.19 0.19 NM_001067NM_001067 topoisomerase (DNA) II alpha 170kDatopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.04 0.04 NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M CDC2CDC2 0.09 0.09 NM_174936NM_174936 proprotein convertase subtilisin/kexin type 9proprotein convertase subtilisin / kexin type 9 PCSK9PCSK9 0.14 0.14 NM_001012271NM_001012271 baculoviral IAP repeat-containing 5 (survivin)baculoviral IAP repeat-containing 5 (survivin) BIRC5BIRC5 0.11 0.11 NM_012068NM_012068 activating transcription factor 5activating transcription factor 5 ATF5ATF5 0.15 0.15 NM_148957NM_148957 tumor necrosis factor receptor superfamily, member 19tumor necrosis factor receptor superfamily, member 19 TNFRSF19TNFRSF19 0.11 0.11 8.8. carboxyliccarboxylic acidacid metabolicmetabolic processprocess ( ( 카르복실산Carboxylic acid 대사 과정) Metabolic process) NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_000156NM_000156 guanidinoacetate N-methyltransferaseguanidinoacetate N-methyltransferase GAMTGAMT 0.17 0.17 NM_005123NM_005123 nuclear receptor subfamily 1, group H, member 4nuclear receptor subfamily 1, group H, member 4 NR1H4NR1H4 0.13 0.13 BC006267BC006267 asparaginase like 1asparaginase like 1 ASRGL1ASRGL1 0.18 0.18 NM_000790NM_000790 dopa decarboxylase (aromatic L-amino acid decarboxylase)dopa decarboxylase (aromatic L-amino acid decarboxylase) DDCDDC 0.08 0.08 NM_001010845NM_001010845 hypothetical protein LOC123876hypothetical protein LOC123876 　 0.09 0.09 NM_001443NM_001443 fatty acid binding protein 1, liverfatty acid binding protein 1, liver FABP1FABP1 0.06 0.06 NM_004169NM_004169 serine hydroxymethyltransferase 1 (soluble)serine hydroxymethyltransferase 1 (soluble) SHMT1SHMT1 0.18 0.18 NM_004265NM_004265 fatty acid desaturase 2fatty acid desaturase 2 FADS2FADS2 0.15 0.15 NM_005063NM_005063 stearoyl-CoA desaturase (delta-9-desaturase)stearoyl-CoA desaturase (delta-9-desaturase) SCDSCD 0.16 0.16 NM_005327NM_005327 hydroxyacyl-Coenzyme A dehydrogenasehydroxyacyl-Coenzyme A dehydrogenase HADHHADH 0.18 0.18 NM_005989NM_005989 aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase) AKR1D1AKR1D1 0.15 0.15 NM_182617NM_182617 acyl-CoA synthetase medium-chain family member 2acyl-CoA synthetase medium-chain family member 2 ACSM2ACSM2 0.10 0.10 9.9. apoptosisapoptosis (세포 자살) (Cell suicide) NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 NM_014333NM_014333 cell adhesion molecule 1cell adhesion molecule 1 CADM1CADM1 0.12 0.12 NM_007111NM_007111 transcription factor Dp-1transcription factor Dp-1 TFDP1TFDP1 0.16 0.16 NM_005631NM_005631 smoothened homolog (Drosophila)smoothened homolog (Drosophila) SMOSMO 0.17 0.17 NM_014762NM_014762 24-dehydrocholesterol reductase24-dehydrocholesterol reductase DHCR24DHCR24 0.19 0.19 NM_001067NM_001067 topoisomerase (DNA) II alpha 170kDatopoisomerase (DNA) II alpha 170kDa TOP2ATOP2A 0.04 0.04 NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M CDC2CDC2 0.09 0.09 NM_174936NM_174936 proprotein convertase subtilisin/kexin type 9proprotein convertase subtilisin / kexin type 9 PCSK9PCSK9 0.14 0.14 NM_001012271NM_001012271 baculoviral IAP repeat-containing 5 (survivin)baculoviral IAP repeat-containing 5 (survivin) BIRC5BIRC5 0.11 0.11 NM_012068NM_012068 activating transcription factor 5activating transcription factor 5 ATF5ATF5 0.15 0.15 NM_148957NM_148957 tumor necrosis factor receptor superfamily, member 19tumor necrosis factor receptor superfamily, member 19 TNFRSF19TNFRSF19 0.11 0.11 10.10. growthgrowth (성장) (growth) NM_000029NM_000029 angiotensinogen (serpin peptidase inhibitor, clade A, member 8)angiotensinogen (serpin peptidase inhibitor, clade A, member 8) AGTAGT 0.11 0.11 NM_020530NM_020530 oncostatin Moncostatin M OSMOSM 0.20 0.20 NM_005631NM_005631 smoothened homolog (Drosophila)smoothened homolog (Drosophila) SMOSMO 0.17 0.17 NM_000156NM_000156 guanidinoacetate N-methyltransferaseguanidinoacetate N-methyltransferase GAMTGAMT 0.17 0.17 CD608671CD608671 Fibrinogen alpha chainFibrinogen alpha chain 　 0.17 0.17 NM_000508NM_000508 fibrinogen alpha chainfibrinogen alpha chain FGAFGA 0.14 0.14 NM_052968NM_052968 apolipoprotein A-Vapolipoprotein A-V APOA5APOA5 0.18 0.18 NM_152722NM_152722 hepatocyte cell adhesion moleculehepatocyte cell adhesion molecule HEPACAMHEPACAM 0.12 0.12 NM_003882NM_003882 WNT1 inducible signaling pathway protein 1WNT1 inducible signaling pathway protein 1 WISP1WISP1 0.19 0.19 11.11. woundwound healinghealing (상처 치료) (Wound healing) CD608671CD608671 Fibrinogen alpha chainFibrinogen alpha chain 　 0.17 0.17 NM_000508NM_000508 fibrinogen alpha chainfibrinogen alpha chain FGAFGA 0.14 0.14 NM_052968NM_052968 apolipoprotein A-Vapolipoprotein A-V APOA5APOA5 0.18 0.18 AF118092AF118092 predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds. 　 0.15 0.15 NM_000509NM_000509 fibrinogen gamma chainfibrinogen gamma chain FGGFGG 0.12 0.12 BF591978BF591978 Apolipoprotein H (beta-2-glycoprotein I)Apolipoprotein H (beta-2-glycoprotein I) 　 0.13 0.13 NM_000042NM_000042 apolipoprotein H (beta-2-glycoprotein I)apolipoprotein H (beta-2-glycoprotein I) APOHAPOH 0.09 0.09

<< 실시예Example 3> 실시간  3> Real time RTRT -- PCRPCR 정량 dose

실시예 2에서 선별된 클로르덴에 의해 과발현 및 저발현된 유전자 중 몇 종의 발현변화 정도를 실시간 RT-PCR 방법으로 확인하였다.The degree of expression change of several genes overexpressed and underexpressed by chlorden selected in Example 2 was confirmed by real-time RT-PCR method.

구체적으로, My IQ 실시간 PCR(My IQ Real-time PCR; Bio-rad, USA)을 이용하여 정량적인 실시간 RT-PCR을 실시하였다. 구체적으로, 올리고 dT 프라이머와 Superscript kit(Omniscipt™ kit, Qiagen, Co., USA)를 이용하여 역전사 반응을 수행하여 cDNA를 합성하였다. 먼저 PCR에 이용한 표적 유전자와 내재성(endogenous) 대조군(RPLP0)에 대한 프라이머를 사이버그린(SYBR Green) 마스터 믹스(Master mix; Bio-rad, USA)에 첨가하여 PCR을 실시한 후, 적절한 농도를 선택하는 프라이머 적합화(primer optimization) 과정을 수행하였다. 상기 cDNA 0.2 ㎕와 증류수 3.8 ㎕, 표 4의 센스 프라이머 0.5 ㎕, 안티센스 프라이머 0.5 ㎕, 사이버그린 I 염색 수퍼믹스(Bio-rad, USA) 5 ㎕를 혼합하여, PCR 튜브에 담아 단계 1: 95℃, 3분; 단계 2(45회 반복): 단계 2-1: 95℃, 10초; 단계 2-2: 55 내지 65℃ 45초; 단계 3: 95℃, 1분; 단계 4: 55℃, 1분; 단계 5(반복 80회): 55℃, 10초로 프로그램을 설계한 My IQ 실시간 PCR 기계에서 반응을 수행한 후, 정량 소프트웨어(software)를 사용하여 분석하였다.Specifically, quantitative real-time RT-PCR was performed using My IQ Real-time PCR (Bio-rad, USA). Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). First, the primers for the target gene and endogenous control (RPLP0) used for PCR were added to the SYBR Green Master mix (Bio-rad, USA), and then PCR was selected. Primer optimization was performed. 0.2 µl of the cDNA, 3.8 µl of distilled water, 0.5 µl of the sense primer of Table 4, 0.5 µl of the antisense primer, and 5 µl of the Cyberrin I staining supermix (Bio-rad, USA) were added to the PCR tube, Step 1: 95 ° C. , 3 minutes; Step 2 (repeat 45): Step 2-1: 95 ° C., 10 seconds; Step 2-2: 55 to 65 ° C. 45 seconds; Step 3: 95 ° C., 1 minute; Step 4: 55 ° C., 1 minute; Step 5 (80 repetitions): The reaction was performed on a My IQ real-time PCR machine designed for program at 55 ° C., 10 seconds, followed by analysis using quantification software.

사이버그린 I 염색은 이중나선 DNA에 결합하는 염색법으로서, 실시간 RT-PCR 과정 동안 이중나선 DNA가 생성될수록 형광강도(fluroscense intensity)가 증가함으로써, 실시간 RT-PCR 산물을 정량하기 위하여 사용된다.Cyberlin I staining is a staining method that binds to double-stranded DNA, which is used to quantify real-time RT-PCR products by increasing the fluorescence intensity as the double-stranded DNA is generated during the real-time RT-PCR process.

그 결과, 표 5에 나타난 바와 같이 7종의 과발현 유전자들과 9종의 저발현 유전자들의 유전자 발현 양상은 올리고 마이크로어레이 칩의 결과와 매우 유사하게 나타남을 확인하였다.As a result, as shown in Table 5, the gene expression patterns of the seven overexpression genes and the nine low expression genes were confirmed to be very similar to those of the oligo microarray chip.

프라이머 서열Primer sequence 등록번호Registration Number 유전자명Gene name PCR 프라이머 서열PCR primer sequence (5'->3')(5 '-> 3') NM_203403NM_203403 chromosome 9 open reading frame 150chromosome 9 open reading frame 150 센스sense TTACGTGGCAGCTACAACAGCCTATTACGTGGCAGCTACAACAGCCTA (서열번호 1)(SEQ ID NO 1) 안티센스Antisense TGAGGGAGCTGTCACTGAATTGGTTGAGGGAGCTGTCACTGAATTGGT (서열번호 2)(SEQ ID NO: 2) NM_000584NM_000584 interleukin 8interleukin 8 센스sense CCAGGAAGAAACCACCGGACCAGGAAGAAACCACCGGA (서열번호 3)(SEQ ID NO 3) 안티센스Antisense GAAATCAGGAAGGCTGCCAAGGAAATCAGGAAGGCTGCCAAG (서열번호 4)(SEQ ID NO: 4) NM_000214NM_000214 jagged 1 (Alagille syndrome)jagged 1 (Alagille syndrome) 센스sense TGAGATCAATGGCTACCGGTGTGT TGAGATCAATGGCTACCGGTGTGT (서열번호 5)(SEQ ID NO: 5) 안티센스Antisense TGCAAGGTCTCCCTGAAACTTCCT TGCAAGGTCTCCCTGAAACTTCCT (서열번호 6)(SEQ ID NO: 6) NM_004417NM_004417 dual specificity phosphatase 1dual specificity phosphatase 1 센스sense GGCCCCGAGAACAGACAAAGGCCCCGAGAACAGACAAA (서열번호 7)(SEQ ID NO: 7) 안티센스Antisense GTGCCCACTTCCATGACCAT GTGCCCACTTCCATGACCAT (서열번호 8)(SEQ ID NO: 8) NM_145904NM_145904 high mobility group AT-hook 1high mobility group AT-hook 1 센스sense GTCCTCCTGCTTTGGCATCGTCCTCCTGCTTTGGCATC (서열번호 9)(SEQ ID NO: 9) 안티센스Antisense AGCAGGTGGAAGAGTGATGG AGCAGGTGGAAGAGTGATGG (서열번호 10)(SEQ ID NO: 10) NM_002305NM_002305 lectin, galactoside-binding, soluble, 1 (galectin 1)lectin, galactoside-binding, soluble, 1 (galectin 1) 센스sense TCGCCAGCAACCTGAATCTCAAAC TCGCCAGCAACCTGAATCTCAAAC (서열번호 11)(SEQ ID NO: 11) 안티센스Antisense TTGTTGCTGTCTTTGCCCAGGTTC TTGTTGCTGTCTTTGCCCAGGTTC (서열번호 12)(SEQ ID NO: 12) NM_002309NM_002309 leukemia inhibitory factor (cholinergic differentiation factor)leukemia inhibitory factor (cholinergic differentiation factor) 센스sense TATCACCATCTGTGCCTTTGCTGCTATCACCATCTGTGCCTTTGCTGC (서열번호 13)(SEQ ID NO: 13) 안티센스Antisense TCTGCCAGATTGTTCCTATGCCCATCTGCCAGATTGTTCCTATGCCCA (서열번호 14)(SEQ ID NO: 14) NM_000670NM_000670 alcohol dehydrogenase 4 (class II), pi polypeptidealcohol dehydrogenase 4 (class II), pi polypeptide 센스sense TGAATTGACCAAGGGAGGTGTGGA TGAATTGACCAAGGGAGGTGTGGA (서열번호 15)(SEQ ID NO: 15) 안티센스Antisense TTGTACAGTCCAGGGCTGCTTTCATTGTACAGTCCAGGGCTGCTTTCA (서열번호 16)(SEQ ID NO: 16) NM_000042NM_000042 apolipoprotein H (beta-2-glycoprotein I)apolipoprotein H (beta-2-glycoprotein I) 센스sense AATGCCCATTCCCATCAAGACCAG AATGCCCATTCCCATCAAGACCAG (서열번호 17)(SEQ ID NO: 17) 안티센스Antisense TTTCTTCCGGGCCATCCAGAGAATTTTCTTCCGGGCCATCCAGAGAAT (서열번호 18)(SEQ ID NO: 18) NM_001872NM_001872 carboxypeptidase B2 (plasma)carboxypeptidase B2 (plasma) 센스sense TCAGCATGCATTCATACTCCCAGC TCAGCATGCATTCATACTCCCAGC (서열번호 19)(SEQ ID NO: 19) 안티센스Antisense TAGCACGAACTGCTTCACTGGCTATAGCACGAACTGCTTCACTGGCTA (서열번호 20)(SEQ ID NO: 20) NM_004701NM_004701 cyclin B2cyclin B2 센스sense AGACTCTGTACATGTGCGTTGGCAAGACTCTGTACATGTGCGTTGGCA (서열번호 21)(SEQ ID NO: 21) 안티센스Antisense TTGGAAGCCAAGAGCAGAGCAGTATTGGAAGCCAAGAGCAGAGCAGTA (서열번호 22)(SEQ ID NO: 22) NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M 센스sense CAGAGCTTTGGGCACTCCCAATAA CAGAGCTTTGGGCACTCCCAATAA (서열번호 23)(SEQ ID NO: 23) 안티센스Antisense ATGGGATGCTAGGCTTCCTGGTTT ATGGGATGCTAGGCTTCCTGGTTT (서열번호 24)(SEQ ID NO: 24) NM_145740NM_145740 glutathione S-transferase A1glutathione S-transferase A1 센스sense AGGAAGCCTCCCATGGATGAGAAAAGGAAGCCTCCCATGGATGAGAAA (서열번호 25)(SEQ ID NO: 25) 안티센스Antisense TTCTTGGCCTCCATGACTGCGTTA TTCTTGGCCTCCATGACTGCGTTA (서열번호 26)(SEQ ID NO 26) NM_174936NM_174936 proprotein convertase subtilisin/kexin type 9proprotein convertase subtilisin / kexin type 9 센스sense AGGAACTGAGCCAGAAACGCAGATAGGAACTGAGCCAGAAACGCAGAT (서열번호 27)(SEQ ID NO 27) 안티센스Antisense ATCAGGCCTGGGTGATAACGGAAAATCAGGCCTGGGTGATAACGGAAA (서열번호 28)(SEQ ID NO 28) NM_001011554NM_001011554 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 센스sense AGACAGCCCAGTGTCATCAACAGT AGACAGCCCAGTGTCATCAACAGT (서열번호 29)(SEQ ID NO 29) 안티센스Antisense TTGGAACATTGCAGCCCAGGAAAG TTGGAACATTGCAGCCCAGGAAAG (서열번호 30)(SEQ ID NO: 30) NM_148957NM_148957 tumor necrosis factor receptor superfamily, member 19tumor necrosis factor receptor superfamily, member 19 센스sense TGATGAAAGTAGGCAGGGCTGTGT TGATGAAAGTAGGCAGGGCTGTGT (서열번호 31)(SEQ ID NO 31) 안티센스Antisense TCTCCAGCCAGTGTTTGTCCTTGA TCTCCAGCCAGTGTTTGTCCTTGA (서열번호 32)(SEQ ID NO 32)

등록번호Registration Number 유전자명Gene name ChlordaneChlordane 실시간 PCR
(상대적 배율)Real time PCR
(Relative magnification) cDNA 마이크로어레이
(Cy3/Cy5 비율)cDNA Microarray
(Cy3 / Cy5 ratio) NM_203403NM_203403 chromosome 9 open reading frame 150chromosome 9 open reading frame 150 68.28 68.28 14.46 14.46 NM_000584NM_000584 interleukin 8interleukin 8 16.70 16.70 9.58 9.58 NM_000214NM_000214 jagged 1 (Alagille syndrome)jagged 1 (Alagille syndrome) 73.69 73.69 17.22 17.22 NM_004417NM_004417 dual specificity phosphatase 1dual specificity phosphatase 1 21.02 21.02 16.69 16.69 NM_145904NM_145904 high mobility group AT-hook 1high mobility group AT-hook 1 9.96 9.96 9.19 9.19 NM_002305NM_002305 lectin, galactoside-binding, soluble, 1 (galectin 1)lectin, galactoside-binding, soluble, 1 (galectin 1) 60.78 60.78 13.18 13.18 NM_002309NM_002309 leukemia inhibitory factor (cholinergic differentiation factor)leukemia inhibitory factor (cholinergic differentiation factor) 113.23 113.23 16.29 16.29 NM_000670NM_000670 alcohol dehydrogenase 4 (class II), pi polypeptidealcohol dehydrogenase 4 (class II), pi polypeptide 0.14 0.14 0.18 0.18 NM_000042NM_000042 apolipoprotein H (beta-2-glycoprotein I)apolipoprotein H (beta-2-glycoprotein I) 0.04 0.04 0.09 0.09 NM_001872NM_001872 carboxypeptidase B2 (plasma)carboxypeptidase B2 (plasma) 0.03 0.03 0.12 0.12 NM_004701NM_004701 cyclin B2cyclin B2 0.04 0.04 0.09 0.09 NM_001786NM_001786 cell division cycle 2, G1 to S and G2 to Mcell division cycle 2, G1 to S and G2 to M 0.03 0.03 0.06 0.06 NM_145740NM_145740 glutathione S-transferase A1glutathione S-transferase A1 0.01 0.01 0.04 0.04 NM_174936NM_174936 proprotein convertase subtilisin/kexin type 9proprotein convertase subtilisin / kexin type 9 0.01 0.01 0.14 0.14 NM_001011554NM_001011554 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 0.16 0.16 0.18 0.18 NM_148957NM_148957 tumor necrosis factor receptor superfamily, member 19tumor necrosis factor receptor superfamily, member 19 0.12 0.12 0.11 0.11

이에, 본 발명의 마이크로어레이 칩을 이용한 실험으로 선별된 유전자들은 클로르덴에 대한 노출 여부 확인에 유용하게 이용될 수 있다.Thus, the genes selected by experiments using the microarray chip of the present invention can be usefully used to confirm the exposure to chlorden.

도 1은 클로르덴(Chlordane)의 인간 간암 세포주에서의 세포 독성을 조사한 그래프이다.1 is a graph illustrating the cytotoxicity of chlorden (Chlordane) in human liver cancer cell line.

도 2는 클로르덴을 처리한 인간 간암 세포주에서의 유전자 발현 양상을 마이크로어레이 칩을 이용하여 분석한 결과를 나타내는 그림이다.Figure 2 is a diagram showing the results of analyzing the gene expression pattern in the human liver cancer cell line treated with chlorden using a microarray chip.

<110> Korea Instititue of Science and Technology <120> Biomarker for identification of exposure to chlordane and the method of identification using thereof <130> 9P-02-33 <160> 32 <170> KopatentIn 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_203403 sense primer <400> 1 ttacgtggca gctacaacag ccta 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_203403 antisense primer <400> 2 tgagggagct gtcactgaat tggt 24 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NM_000584 sense primer <400> 3 ccaggaagaa accaccgga 19 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NM_000584 antisense primer <400> 4 gaaatcagga aggctgccaa g 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000214 sense primer <400> 5 tgagatcaat ggctaccggt gtgt 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000214 antisense primer <400> 6 tgcaaggtct ccctgaaact tcct 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NM_004417 sense primer <400> 7 ggccccgaga acagacaaa 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NM_004417 antisense primer <400> 8 gtgcccactt ccatgaccat 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NM_145904 sense primer <400> 9 gtcctcctgc tttggcatc 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NM_145904 antisense primer <400> 10 agcaggtgga agagtgatgg 20 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002305 sense primer <400> 11 tcgccagcaa cctgaatctc aaac 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002305 antisense primer <400> 12 ttgttgctgt ctttgcccag gttc 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002309 sense primer <400> 13 tatcaccatc tgtgcctttg ctgc 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002309 antisense primer <400> 14 tctgccagat tgttcctatg ccca 24 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000670 sense primer <400> 15 tgaattgacc aagggaggtg tgga 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000670 antisense primer <400> 16 ttgtacagtc cagggctgct ttca 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000042 sense primer <400> 17 aatgcccatt cccatcaaga ccag 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000042 antisense primer <400> 18 tttcttccgg gccatccaga gaat 24 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001872 sense primer <400> 19 tcagcatgca ttcatactcc cagc 24 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001872 antisense primer <400> 20 tagcacgaac tgcttcactg gcta 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_004701 sense primer <400> 21 agactctgta catgtgcgtt ggca 24 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_004701 antisense primer <400> 22 ttggaagcca agagcagagc agta 24 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001786 sense primer <400> 23 cagagctttg ggcactccca ataa 24 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001786 antisense primer <400> 24 atgggatgct aggcttcctg gttt 24 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_145740 sense primer <400> 25 aggaagcctc ccatggatga gaaa 24 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_145740 antisense primer <400> 26 ttcttggcct ccatgactgc gtta 24 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_174936 sense primer <400> 27 aggaactgag ccagaaacgc agat 24 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_174936 antisense primer <400> 28 atcaggcctg ggtgataacg gaaa 24 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001011554 sense primer <400> 29 agacagccca gtgtcatcaa cagt 24 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001011554 antisense primer <400> 30 ttggaacatt gcagcccagg aaag 24 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_148957 sense primer <400> 31 tgatgaaagt aggcagggct gtgt 24 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_148957 antisense primer <400> 32 tctccagcca gtgtttgtcc ttga 24 <110> Korea Instititue of Science and Technology <120> Biomarker for identification of exposure to chlordane and the          method of identification using <130> 9P-02-33 <160> 32 <170> KopatentIn 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_203403 sense primer <400> 1 ttacgtggca gctacaacag ccta 24 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_203403 antisense primer <400> 2 tgagggagct gtcactgaat tggt 24 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NM_000584 sense primer <400> 3 ccaggaagaa accaccgga 19 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NM_000584 antisense primer <400> 4 gaaatcagga aggctgccaa g 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000214 sense primer <400> 5 tgagatcaat ggctaccggt gtgt 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000214 antisense primer <400> 6 tgcaaggtct ccctgaaact tcct 24 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NM_004417 sense primer <400> 7 ggccccgaga acagacaaa 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NM_004417 antisense primer <400> 8 gtgcccactt ccatgaccat 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NM_145904 sense primer <400> 9 gtcctcctgc tttggcatc 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NM_145904 antisense primer <400> 10 agcaggtgga agagtgatgg 20 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002305 sense primer <400> 11 tcgccagcaa cctgaatctc aaac 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002305 antisense primer <400> 12 ttgttgctgt ctttgcccag gttc 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002309 sense primer <400> 13 tatcaccatc tgtgcctttg ctgc 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_002309 antisense primer <400> 14 tctgccagat tgttcctatg ccca 24 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000670 sense primer <400> 15 tgaattgacc aagggaggtg tgga 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000670 antisense primer <400> 16 ttgtacagtc cagggctgct ttca 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000042 sense primer <400> 17 aatgcccatt cccatcaaga ccag 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_000042 antisense primer <400> 18 tttcttccgg gccatccaga gaat 24 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001872 sense primer <400> 19 tcagcatgca ttcatactcc cagc 24 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001872 antisense primer <400> 20 tagcacgaac tgcttcactg gcta 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_004701 sense primer <400> 21 agactctgta catgtgcgtt ggca 24 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_004701 antisense primer <400> 22 ttggaagcca agagcagagc agta 24 <210> 23 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001786 sense primer <400> 23 cagagctttg ggcactccca ataa 24 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001786 antisense primer <400> 24 atgggatgct aggcttcctg gttt 24 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_145740 sense primer <400> 25 aggaagcctc ccatggatga gaaa 24 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_145740 antisense primer <400> 26 ttcttggcct ccatgactgc gtta 24 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_174936 sense primer <400> 27 aggaactgag ccagaaacgc agat 24 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_174936 antisense primer <400> 28 atcaggcctg ggtgataacg gaaa 24 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001011554 sense primer <400> 29 agacagccca gtgtcatcaa cagt 24 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_001011554 antisense primer <400> 30 ttggaacatt gcagcccagg aaag 24 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_148957 sense primer <400> 31 tgatgaaagt aggcagggct gtgt 24 <210> 32 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> NM_148957 antisense primer <400> 32 tctccagcca gtgtttgtcc ttga 24  

Claims (24)

하기의 군으로부터 선택되는 어느 하나 이상의 유전자를 포함하는, 클로르덴(Chlordane) 노출에 의해 발현 변화를 일으키는 것을 특징으로 하는 클로르덴에 대한 노출 여부 확인용 바이오마커:Biomarker for confirming the exposure to chlorden, characterized in that the expression changes by Chlordane exposure, including any one or more genes selected from the group: 유전자등록번호(Genebank) AB040974(Start codon is not identified.; Homo sapiens mRNA for KIAA1541 protein, partial cds.), 유전자등록번호(Genebank) AF011794(cell cycle progression 1), 유전자등록번호(Genebank) AF147412(Full length insert cDNA clone YP59C02), 유전자등록번호(Genebank) AF165191(dystonin), 유전자등록번호(Genebank) AK026078[ELK3, ETS-domain protein (SRF accessory protein 2)], 유전자등록번호(Genebank) AK055600[Iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) AK075342(Chromosome 12 open reading frame 39), 유전자등록번호(Genebank) AK124869(SH2 domain containing 5), 유전자등록번호(Genebank) AY665468[Ras association (RalGDS/AF-6) domain family 8], 유전자등록번호(Genebank) BC005130(hypothetical protein MGC11082), 유전자등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자등록번호(Genebank) BC031618(chromosome 10 open reading frame 30), 유전자등록번호(Genebank) BC033000(tetratricopeptide repeat domain 17), 유전자등록번호(Genebank) BC033829[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번 호(Genebank) BC036699(hypothetical LOC654433), 유전자등록번호(Genebank) BC047030(uridine phosphorylase 1), 유전자등록번호(Genebank) BC066644(KIAA1949), 유전자등록번호(Genebank) BC070200(hypothetical LOC541471), 유전자등록번호(Genebank) BF210146(Similar to asparagine synthetase), 유전자등록번호(Genebank) BG001037(Thioredoxin reductase 1), 유전자등록번호(Genebank) BG188151(Transcribed locus), 유전자등록번호(Genebank) CR595522[3'UTR of hypothetical protein (ORF1)], 유전자등록번호(Genebank) CR625648(metallothionein 2A), 유전자등록번호(Genebank) M90656(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_000167(glycerol kinase), 유전자등록번호(Genebank) NM_000202[iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) NM_000214[jagged 1 (Alagille syndrome)], 유전자등록번호(Genebank) NM_000433[neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], 유전자등록번호(Genebank) NM_000565(interleukin 6 receptor), 유전자등록번호(Genebank) NM_000574[CD55 molecule, decay accelerating factor for complement (Cromer blood group)], 유전자등록번호(Genebank) NM_000582[secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자등록번호(Genebank) NM_000584(interleukin 8), 유전자등록번호(Genebank) NM_000596(insulin-like growth factor binding protein 1), 유전자등록번호(Genebank) NM_000602[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1], 유전자등록번호(Genebank) NM_000660(transforming growth factor, beta 1), 유전자등록번호(Genebank) NM_001001555(growth factor receptor-bound protein 10), 유전자등록번호(Genebank) NM_001007245(interferon-related developmental regulator 1), 유전자등록번호(Genebank) NM_001007271(dual specificity phosphatase 13), 유전자등록번호(Genebank) NM_001008211(optineurin), 유전자등록번호(Genebank) NM_001031716(oligonucleotide/oligosaccharide-binding fold containing 2A), 유전자등록번호(Genebank) NM_001105(activin A receptor, type I), 유전자등록번호(Genebank) NM_001172(arginase, type II), 유전자등록번호(Genebank) NM_001173(Rho GTPase activating protein 5), 유전자등록번호(Genebank) NM_001300(Kruppel-like factor 6), 유전자등록번호(Genebank) NM_001353[aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)], 유전자등록번호(Genebank) NM_001425(epithelial membrane protein 3), 유전자등록번호(Genebank) NM_001498(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_001554(cysteine-rich, angiogenic inducer, 61), 유전자등록번호(Genebank) NM_001614(actin, gamma 1), 유전자등록번호(Genebank) NM_001657[amphiregulin (schwannoma-derived growth factor)], 유전자등록번호(Genebank) NM_001723(dystonin), 유전자등록번호(Genebank) NM_001730[Kruppel-like factor 5 (intestinal)], 유전자등록번호(Genebank) NM_001748[calpain 2, (m/II) large subunit], 유전자등록번호(Genebank) NM_001769(CD9 molecule), 유전자등록번호(Genebank) NM_001780(CD63 molecule), 유전자등록번호(Genebank) NM_001785(cytidine deaminase), 유전자등록번호(Genebank) NM_001964(early growth response 1), 유전자등록번호(Genebank) NM_002061(glutamate-cysteine ligase, modifier subunit), 유전자등록번호(Genebank) NM_002064[glutaredoxin (thioltransferase)], 유전자등록번호(Genebank) NM_002115[hexokinase 3 (white cell)], 유전자등록번호(Genebank) NM_002143(hippocalcin), 유전자등록번호(Genebank) NM_002203[integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], 유전자등록번호(Genebank) NM_002224(inositol 1,4,5-triphosphate receptor, type 3), 유전자등록번호(Genebank) NM_002276(keratin 19), 유전자등록번호(Genebank) NM_002288(leukocyte-associated immunoglobulin-like receptor 2), 유전자등록번호(Genebank) NM_002305[lectin, galactoside-binding, soluble, 1 (galectin 1)], 유전자등록번호(Genebank) NM_002306(lectin, galactoside-binding, soluble, 3), 유전자등록번호(Genebank) NM_002309[leukemia inhibitory factor (cholinergic differentiation factor)], 유전자등록번호(Genebank) NM_002394[solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2], 유전자등록번호(Genebank) NM_002571[progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], 유전자등록번호(Genebank) NM_002576[p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)], 유전자등록번호(Genebank) NM_002607(platelet-derived growth factor alpha polypeptide), 유전자등록번호(Genebank) NM_002648(pim-1 oncogene), 유전자등록번호(Genebank) NM_002867(RAB3B, member RAS oncogene family), 유전자등록번호(Genebank) NM_002899(retinol binding protein 1, cellular), 유전자등록번호(Genebank) NM_002960(S100 calcium binding protein A3), 유전자등록번호(Genebank) NM_002970(spermidine/spermine N1-acetyltransferase 1), 유전자등록번호(Genebank) NM_003107[SRY (sex determining region Y)-box 4], 유전자등록번호(Genebank) NM_003122(serine peptidase inhibitor, Kazal type 1), 유전자등록번호(Genebank) NM_003225(trefoil factor 1), 유전자등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자등록번호(Genebank) NM_003311(pleckstrin homology-like domain, family A, member 2), 유전자등록번호(Genebank) NM_003330(thioredoxin reductase 1), 유전자등록번호(Genebank) NM_003407[zinc finger protein 36, C3H type, homolog (mouse)], 유전자등록번호(Genebank) NM_003739[aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], 유전자등록번호(Genebank) NM_003887(development and differentiation enhancing factor 2), 유전자등록번호(Genebank) NM_003897(immediate early response 3), 유전자등록번호(Genebank) NM_003900(sequestosome 1), 유전자등록번호(Genebank) NM_003937[kynureninase (L-kynurenine hydrolase)], 유전자등록번호(Genebank) NM_003979(G protein- coupled receptor, family C, group 5, member A), 유전자등록번호(Genebank) NM_004024(activating transcription factor 3), 유전자등록번호(Genebank) NM_004073[polo-like kinase 3 (Drosophila)], 유전자등록번호(Genebank) NM_004083(DNA-damage-inducible transcript 3), 유전자등록번호(Genebank) NM_004177(syntaxin 3), 유전자등록번호(Genebank) NM_004417(dual specificity phosphatase 1), 유전자등록번호(Genebank) NM_004418(dual specificity phosphatase 2), 유전자등록번호(Genebank) NM_004723[rho/rac guanine nucleotide exchange factor (GEF) 2], 유전자등록번호(Genebank) NM_004748(cell cycle progression 1), 유전자등록번호(Genebank) NM_004751[glucosaminyl (N-acetyl) transferase 3, mucin type], 유전자등록번호(Genebank) NM_004760(serine/threonine kinase 17a), 유전자등록번호(Genebank) NM_004864(growth differentiation factor 15), 유전자등록번호(Genebank) NM_004907(immediate early response 2), 유전자등록번호(Genebank) NM_004925[aquaporin 3 (Gill blood group)], 유전자등록번호(Genebank) NM_004926(zinc finger protein 36, C3H type-like 1), 유전자등록번호(Genebank) NM_005139(annexin A3), 유전자등록번호(Genebank) NM_005228{epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, 유전자등록번호(Genebank) NM_005242[coagulation factor II (thrombin) receptor-like 1], 유전자등록번호(Genebank) NM_005261(GTP binding protein overexpressed in skeletal muscle), 유전자등록번호(Genebank) NM_005415[solute carrier family 20 (phosphate transporter), member 1], 유전자등록번호(Genebank) NM_005438(FOS-like antigen 1), 유전자등록번호(Genebank) NM_005451[PDZ and LIM domain 7 (enigma)], 유전자등록번호(Genebank) NM_005469(acyl-CoA thioesterase 8), 유전자등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자등록번호(Genebank) NM_005772(RNA terminal phosphate cyclase-like 1), 유전자등록번호(Genebank) NM_005953(metallothionein 2A), 유전자등록번호(Genebank) NM_005980(S100 calcium binding protein P), 유전자등록번호(Genebank) NM_006091(coronin, actin binding protein, 2B), 유전자등록번호(Genebank) NM_006208(ectonucleotide pyrophosphatase/phosphodiesterase 1), 유전자등록번호(Genebank) NM_006216[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], 유전자등록번호(Genebank) NM_006572[guanine nucleotide binding protein (G protein), alpha 13], 유전자등록번호(Genebank) NM_006617(nestin), 유전자등록번호(Genebank) NM_007039(protein tyrosine phosphatase, non-receptor type 21), 유전자등록번호(Genebank) NM_007333(killer cell lectin-like receptor subfamily C, member 3), 유전자등록번호(Genebank) NM_012250[related RAS viral (r-ras) oncogene homolog 2], 유전자등록번호(Genebank) NM_012258(hairy/enhancer-of-split related with YRPW motif 1), 유전자등록번호(Genebank) NM_013246(cardiotrophin-like cytokine factor 1), 유전자등록번호(Genebank) NM_013259(transgelin 3), 유전자등록번호(Genebank) NM_014045(low density lipoprotein receptor-related protein 10), 유전자등록번호(Genebank) NM_014059(chromosome 13 open reading frame 15), 유전자등록번호(Genebank) NM_014256(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3), 유전자등록번호(Genebank) NM_014331[solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유전자등록번호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자등록번호(Genebank) NM_014798[pleckstrin homology domain containing, family M (with RUN domain) member 1], 유전자등록번호(Genebank) NM_015187(KIAA0746 protein), 유전자등록번호(Genebank) NM_016009(SH3-domain GRB2-like endophilin B1), 유전자등록번호(Genebank) NM_016081(palladin, cytoskeletal associated protein), 유전자등록번호(Genebank) NM_016113(transient receptor potential cation channel, subfamily V, member 2), 유전자등록번호(Genebank) NM_016548(golgi phosphoprotein 2), 유전자등록번호(Genebank) NM_016639(tumor necrosis factor receptor superfamily, member 12A), 유전자등록번호(Genebank) NM_017705(progestin and adipoQ receptor family member V), 유전자등록번호(Genebank) NM_018357(La ribonucleoprotein domain family, member 6), 유전자등록번호(Genebank) NM_018590(chondroitin sulfate GalNAcT-2), 유전자등록번호(Genebank) NM_018639(WD repeat and SOCS box-containing 2), 유전자등록번호(Genebank) NM_018689(KIAA1199), 유전자등록번호(Genebank) NM_018842(BAI1-associated protein 2-like 1), 유전자등록번호(Genebank) NM_018948(ERBB receptor feedback inhibitor 1), 유전자등록번호(Genebank) NM_019096(GTP binding protein 2), 유전자등록번호(Genebank) NM_020148[spire homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_020546[adenylate cyclase 2 (brain)], 유전자등록번호(Genebank) NM_020870(SH3 domain containing ring finger 1), 유전자등록번호(Genebank) NM_020962(neighbor of Punc E11), 유전자등록번호(Genebank) NM_021103(thymosin, beta 10), 유전자등록번호(Genebank) NM_021158[tribbles homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자등록번호(Genebank) NM_022153(chromosome 10 open reading frame 54), 유전자등록번호(Genebank) NM_022818(microtubule-associated protein 1 light chain 3 beta), 유전자등록번호(Genebank) NM_024847(transmembrane channel-like 7), 유전자등록번호(Genebank) NM_025099(chromosome 17 open reading frame 68), 유전자등록번호(Genebank) NM_025106(splA/ryanodine receptor domain and SOCS box containing 1), 유전자등록번호(Genebank) NM_025130(hexokinase domain containing 1), 유전자등록번호(Genebank) NM_025195[tribbles homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_030627(cytoplasmic polyadenylation element binding protein 4), 유전자등록번호(Genebank) NM_030674(solute carrier family 38, member 1), 유전자등록번호(Genebank) NM_031286(SH3 domain binding glutamic acid-rich protein like 3), 유전자등록번호(Genebank) NM_032466(aspartate beta-hydroxylase), 유전자등록번호(Genebank) NM_032525(tubulin, beta 6), 유전자등록번호(Genebank) NM_032717(lung cancer metastasis-associated protein), 유전자등 록번호(Genebank) NM_032892(FERM domain containing 5), 유전자등록번호(Genebank) NM_033160(zinc finger protein 658), 유전자등록번호(Genebank) NM_033260(forkhead box Q1), 유전자등록번호(Genebank) NM_052871(hypothetical protein MGC4677), 유전자등록번호(Genebank) NM_078487[cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], 유전자등록번호(Genebank) NM_080655(chromosome 9 open reading frame 30), 유전자등록번호(Genebank) NM_080725[sulfiredoxin 1 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_080927(discoidin, CUB and LCCL domain containing 2), 유전자등록번호(Genebank) NM_134421(hippocalcin-like 1), 유전자등록번호(Genebank) NM_138961(endothelial cell adhesion molecule), 유전자등록번호(Genebank) NM_144497[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) NM_144652(leucine zipper-EF-hand containing transmembrane protein 2), 유전자등록번호(Genebank) NM_144778[muscleblind-like 2 (Drosophila)], 유전자등록번호(Genebank) NM_145904(high mobility group AT-hook 1), 유전자등록번호(Genebank) NM_147780(cathepsin B), 유전자등록번호(Genebank) NM_153006(N-acetylglutamate synthase), 유전자등록번호(Genebank) NM_153020(RNA binding motif protein 24), 유전자등록번호(Genebank) NM_153229(transmembrane protein 92), 유전자등록번호(Genebank) NM_153608(zinc finger protein 114), 유전자등록번호(Genebank) NM_170692(RAS protein activator like 2), 유전자등록번호(Genebank) NM_172210[colony stimulating factor 1 (macrophage)], 유전자등록 번호(Genebank) NM_172364(calcium channel, voltage-dependent, alpha 2/delta subunit 4), 유전자등록번호(Genebank) NM_175839(spermine oxidase), 유전자등록번호(Genebank) NM_178234(tumor suppressor candidate 3), 유전자등록번호(Genebank) NM_178275(eEF1A2 binding protein), 유전자등록번호(Genebank) NM_178859(organic solute transporter beta), 유전자등록번호(Genebank) NM_181985[leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], 유전자등록번호(Genebank) NM_182485(cytoplasmic polyadenylation element binding protein 2), 유전자등록번호(Genebank) NM_183373(chromosome 6 open reading frame 145), 유전자등록번호(Genebank) NM_198447[golgi transport 1 homolog A (S. cerevisiae)], 유전자등록번호(Genebank) NM_198833[serpin peptidase inhibitor, clade B (ovalbumin), member 8], 유전자등록번호(Genebank) NM_199330[homer homolog 2 (Drosophila)], 유전자등록번호(Genebank) NM_201555(four and a half LIM domains 2), 유전자등록번호(Genebank) NM_203380(acyl-CoA synthetase long-chain family member 5), 유전자등록번호(Genebank) NM_203391(glycerol kinase), 유전자등록번호(Genebank) NM_203403(chromosome 9 open reading frame 150), 유전자등록번호(Genebank) NR_002205(ferritin, heavy polypeptide-like 12), 유전자등록번호(Genebank) NR_002802(trophoblast-derived noncoding RNA), 유전자등록번호(Genebank) NR_002823(aquaporin 7 pseudogene 2), 유전자등록번호(Genebank) NR_002834(dual specificity phosphatase 5 pseudogene), 유전자등록번호(Genebank) XM_373277(similar to microtubule-associated proteins 1A/1B light chain 3), 유전자등록번호(Genebank) XM_932993[Homo sapiens cDNA FLJ32255 fis, clone PROST1000226. (AK056817)], 유전자등록번호(Genebank) XR_000951[Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC:15504 IMAGE:2990071), complete cds. (BC007251)], 유전자등록번호(Genebank) AF007149(hypothetical protein LOC257407), 유전자등록번호(Genebank) AF118092(predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), 유전자등록번호(Genebank) AF334184(Rac GTPase activating protein 1 pseudogene), 유전자등록번호(Genebank) AL832208(hypothetical protein FLJ32312), 유전자등록번호(Genebank) BC006267(asparaginase like 1), 유전자등록번호(Genebank) BC050292(MGC44478), 유전자등록번호(Genebank) BF591978[Apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) BX405503(Alpha-fetoprotein), 유전자등록번호(Genebank) CD608671(Fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000029[angiotensinogen (serpin peptidase inhibitor, clade A, member 8)], 유전자등록번호(Genebank) NM_000040(apolipoprotein C-III), 유전자등록번호(Genebank) NM_000042[apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) NM_000156(guanidinoacetate N-methyltransferase), 유전자등록번호(Genebank) NM_000166(gap junction protein, beta 1, 32kDa), 유전자등록번호(Genebank) NM_000204(complement factor I), 유전자등록번호(Genebank) NM_000253(microsomal triglyceride transfer protein), 유전자등록번호(Genebank) NM_000354[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], 유전자등록번호(Genebank) NM_000508(fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000509(fibrinogen gamma chain), 유전자등록번호(Genebank) NM_000607(orosomucoid 1), 유전자등록번호(Genebank) NM_000608(orosomucoid 2), 유전자등록번호(Genebank) NM_000670[alcohol dehydrogenase 4 (class II), pi polypeptide], 유전자등록번호(Genebank) NM_000671[alcohol dehydrogenase 5 (class III), chi polypeptide], 유전자등록번호(Genebank) NM_000672[alcohol dehydrogenase 6 (class V)], 유전자등록번호(Genebank) NM_000790[dopa decarboxylase (aromatic L-amino acid decarboxylase)], 유전자등록번호(Genebank) NM_000792(deiodinase, iodothyronine, type I), 유전자등록번호(Genebank) NM_000846(glutathione S-transferase A2), 유전자등록번호(Genebank) NM_000851(glutathione S-transferase M5), 유전자등록번호(Genebank) NM_000934[serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], 유전자등록번호(Genebank) NM_001005414[Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA (NM_001005414)], 유전자등록번호(Genebank) NM_001010845(hypothetical protein LOC123876), 유전자등록번호(Genebank) NM_001011554[solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], 유전자등록번호(Genebank) NM_001012271[baculoviral IAP repeat-containing 5 (survivin)], 유전자등록번호(Genebank) NM_001012716(chromosome 18 open reading frame 56), 유전자등록번호(Genebank) NM_001040152(paternally expressed 10), 유전자등록번호(Genebank) NM_001067[topoisomerase (DNA) II alpha 170kDa], 유전자등록번호(Genebank) NM_001071(thymidylate synthetase), 유전자등록번호(Genebank) NM_001134(alpha-fetoprotein), 유전자등록번호(Genebank) NM_001182(aldehyde dehydrogenase 7 family, member A1), 유전자등록번호(Genebank) NM_001237(cyclin A2), 유전자등록번호(Genebank) NM_001311[cysteine-rich protein 1 (intestinal)], 유전자등록번호(Genebank) NM_001443(fatty acid binding protein 1, liver), 유전자등록번호(Genebank) NM_001739(carbonic anhydrase VA, mitochondrial), 유전자등록번호(Genebank) NM_001756[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], 유전자등록번호(Genebank) NM_001786(cell division cycle 2, G1 to S and G2 to M), 유전자등록번호(Genebank) NM_001789[cell division cycle 25 homolog A (S. pombe)], 유전자등록번호(Genebank) NM_001823(creatine kinase, brain), 유전자등록번호(Genebank) NM_001844[collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], 유전자등록번호(Genebank) NM_001872[carboxypeptidase B2 (plasma)], 유전자등록번호(Genebank) NM_001948(dUTP pyrophosphatase), 유전자등록번호(Genebank) NM_002129(high-mobility group box 2), 유전자등록번호(Genebank) NM_002388(minichromosome maintenance complex component 3), 유전자등록번호(Genebank) NM_002497[NIMA (never in mitosis gene a)-related kinase 2], 유전자등록번호(Genebank) NM_002592(proliferating cell nuclear antigen), 유전자등록번호(Genebank) NM_002614(PDZ domain containing 1), 유전자등록번호(Genebank) NM_002630[progastricsin (pepsinogen C)], 유전자등록번호(Genebank) NM_002729(hematopoietically expressed homeobox), 유전자등록번호(Genebank) NM_002758(mitogen-activated protein kinase kinase 6), 유전자등록번호(Genebank) NM_003258(thymidine kinase 1, soluble), 유전자등록번호(Genebank) NM_003542(histone cluster 1, H4c), 유전자등록번호(Genebank) NM_003579[RAD54-like (S. cerevisiae)], 유전자등록번호(Genebank) NM_003882(WNT1 inducible signaling pathway protein 1), 유전자등록번호(Genebank) NM_003944(selenium binding protein 1), 유전자등록번호(Genebank) NM_003981(protein regulator of cytokinesis 1), 유전자등록번호(Genebank) NM_004111(flap structure-specific endonuclease 1), 유전자등록번호(Genebank) NM_004169[serine hydroxymethyltransferase 1 (soluble)], 유전자등록번호(Genebank) NM_004265(fatty acid desaturase 2), 유전자등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자등록번호(Genebank) NM_004701(cyclin B2), 유전자등록번호(Genebank) NM_004772(chromosome 5 open reading frame 13), 유전자등록번호(Genebank) NM_004845(phosphate cytidylyltransferase 1, choline, beta), 유전자등록번 호(Genebank) NM_005030[polo-like kinase 1 (Drosophila)], 유전자등록번호(Genebank) NM_005063[stearoyl-CoA desaturase (delta-9-desaturase)], 유전자등록번호(Genebank) NM_005123(nuclear receptor subfamily 1, group H, member 4), 유전자등록번호(Genebank) NM_005165(aldolase C, fructose-bisphosphate), 유전자등록번호(Genebank) NM_005327(hydroxyacyl-Coenzyme A dehydrogenase), 유전자등록번호(Genebank) NM_005502[ATP-binding cassette, sub-family A (ABC1), member 1], 유전자등록번호(Genebank) NM_005573(lamin B1), 유전자등록번호(Genebank) NM_005631[smoothened homolog (Drosophila)], 유전자등록번호(Genebank) NM_005733(kinesin family member 20A), 유전자등록번호(Genebank) NM_005915(minichromosome maintenance complex component 6), 유전자등록번호(Genebank) NM_005940[matrix metallopeptidase 11 (stromelysin 3)], 유전자등록번호(Genebank) NM_005989[aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)], 유전자등록번호(Genebank) NM_006101[NDC80 homolog, kinetochore complex component (S. cerevisiae)], 유전자등록번호(Genebank) NM_006113(vav 3 oncogene), 유전자등록번호(Genebank) NM_006215[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], 유전자등록번호(Genebank) NM_006398(ubiquitin D), 유전자등록번호(Genebank) NM_006444(structural maintenance of chromosomes 2), 유전자등록번호(Genebank) NM_006461(sperm associated antigen 5), 유전자등록번호(Genebank) NM_006472(thioredoxin interacting protein), 유전자등록번 호(Genebank) NM_006498(lectin, galactoside-binding, soluble, 2), 유전자등록번호(Genebank) NM_006757[troponin T type 3 (skeletal, fast)], 유전자등록번호(Genebank) NM_006845(kinesin family member 2C), 유전자등록번호(Genebank) NM_006876(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1), 유전자등록번호(Genebank) NM_007111(transcription factor Dp-1), 유전자등록번호(Genebank) NM_007317(kinesin family member 22), 유전자등록번호(Genebank) NM_012068(activating transcription factor 5), 유전자등록번호(Genebank) NM_012484[hyaluronan-mediated motility receptor (RHAMM)], 유전자등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자등록번호(Genebank) NM_014176[ubiquitin-conjugating enzyme E2T (putative)], 유전자등록번호(Genebank) NM_014264[polo-like kinase 4 (Drosophila)], 유전자등록번호(Genebank) NM_014333(cell adhesion molecule 1), 유전자등록번호(Genebank) NM_014736(KIAA0101), 유전자등록번호(Genebank) NM_014762(24-dehydrocholesterol reductase), 유전자등록번호(Genebank) NM_014791(maternal embryonic leucine zipper kinase), 유전자등록번호(Genebank) NM_014858(transmembrane and coiled-coil domain family 2), 유전자등록번호(Genebank) NM_015533[dihydroxyacetone kinase 2 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_016359(nucleolar and spindle associated protein 1), 유전자등록번호(Genebank) NM_016521(transcription factor Dp family, member 3), 유전자등록번호(Genebank) NM_017855(odontogenic, ameloblast asssociated), 유전자등록번 호(Genebank) NM_018136[asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자등록번호(Genebank) NM_018154[ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], 유전자등록번호(Genebank) NM_018193(Fanconi anemia, complementation group I), 유전자등록번호(Genebank) NM_018410(hypothetical protein DKFZp762E1312), 유전자등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자등록번호(Genebank) NM_018974[unc-93 homolog A (C. elegans)], 유전자등록번호(Genebank) NM_020062(SLC2A4 regulator), 유전자등록번호(Genebank) NM_020530(oncostatin M), 유전자등록번호(Genebank) NM_020918(glycerol-3-phosphate acyltransferase, mitochondrial), 유전자등록번호(Genebank) NM_020995(haptoglobin-related protein), 유전자등록번호(Genebank) NM_021069(sorbin and SH3 domain containing 2), 유전자등록번호(Genebank) NM_022346(non-SMC condensin I complex, subunit G), 유전자등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자등록번호(Genebank) NM_025149(hypothetical protein FLJ20920), 유전자등록번호(Genebank) NM_025225(patatin-like phospholipase domain containing 3), 유전자등록번호(Genebank) NM_030771(coiled-coil domain containing 34), 유전자등록번호(Genebank) NM_030932[diaphanous homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_031299(cell division cycle associated 3), 유전자등록번호(Genebank) NM_031942(cell division cycle associated 7), 유전자등록번호(Genebank) NM_031966(cyclin B1), 유전자등록번호(Genebank) NM_032023[Ras association (RalGDS/AF-6) domain family 4], 유전자등록번호(Genebank) NM_032564[diacylglycerol O-acyltransferase homolog 2 (mouse)], 유전자등록번호(Genebank) NM_032638(GATA binding protein 2), 유전자등록번호(Genebank) NM_032828(zinc finger protein 587), 유전자등록번호(Genebank) NM_052968(apolipoprotein A-V), 유전자등록번호(Genebank) NM_054113(calcium and integrin binding family member 3), 유전자등록번호(Genebank) NM_058186(family with sequence similarity 3, member B), 유전자등록번호(Genebank) NM_145740(glutathione S-transferase A1), 유전자등록번호(Genebank) NM_148957(tumor necrosis factor receptor superfamily, member 19), 유전자등록번호(Genebank) NM_152308(chromosome 16 open reading frame 75), 유전자등록번호(Genebank) NM_152722(hepatocyte cell adhesion molecule), 유전자등록번호(Genebank) NM_153699(glutathione S-transferase A5), 유전자등록번호(Genebank) NM_172164[nuclear autoantigenic sperm protein (histone-binding)], 유전자등록번호(Genebank) NM_174936(proprotein convertase subtilisin/kexin type 9), 유전자등록번호(Genebank) NM_177550[solute carrier family 13 (sodium-dependent citrate transporter), member 5], 유전자등록번호(Genebank) NM_180991(solute carrier organic anion transporter family, member 4C1), 유전자등록번호(Genebank) NM_181712(ankyrin repeat domain 38), 유전자등록번호(Genebank) NM_182617(acyl-CoA synthetase medium-chain family member 2), 유전자등록번호(Genebank) NM_182908[dehydrogenase/reductase (SDR family) member 2], 유전자등록번호(Genebank) NM_198433(aurora kinase A), 유전자등록번호(Genebank) NM_201523(kinesin light chain 4), 유전자등록번호(Genebank) NM_203401(stathmin 1/oncoprotein 18), 유전자등록번호(Genebank) NM_207418(family with sequence similarity 72, member A), 유전자등록번호(Genebank) NR_002932(glutathione S-transferase M1 pseudogene), 유전자등록번호(Genebank) XM_940101[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] 및 유전자등록번호(Genebank) XM_944838(hypothetical protein LOC285733).Genebank AB040974 (Start codon is not identified .; Homo sapiens mRNA for KIAA1541 protein, partial cds.), Genebank AF011794 (cell cycle progression 1), Genebank AF147412 (Full) length insert cDNA clone YP59C02), Genebank (Genebank) AF165191 (dystonin), Genebank (Genebank) AK026078 [ELK3, ETS-domain protein (SRF accessory protein 2)], Genebank AK055600 [Iduronate 2 -sulfatase (Hunter syndrome)], Genebank AK075342 (Chromosome 12 open reading frame 39), Genebank AK124869 (SH2 domain containing 5), Genebank AY665468 [Ras association (RalGDS) / AF-6) domain family 8], Genebank BC005130 (hypothetical protein MGC11082), Genebank BC015987 (Kruppel-like factor 6), Genebank BC031618 (chromosome 10 open reading) frame 30), Genebank BC033000 (t etratricopeptide repeat domain 17), Genebank BC033829 [A kinase (PRKA) anchor protein (gravin) 12], Genebank BC036699 (hypothetical LOC654433), Genebank BC047030 (uridine phosphorylase 1) Genebank BC066644 (KIAA1949), Genebank BC070200 (hypothetical LOC541471), Genebank BF210146 (Similar to asparagine synthetase), Genebank BG001037 (Thioredoxin reductase) 1) Genebank BG188151 (Transcribed locus), Genebank CR595522 [3'UTR of hypothetical protein (ORF1)], Genebank CR625648 (metallothionein 2A), Gene registry number ( Genebank) M90656 (glutamate-cysteine ligase, catalytic subunit), Genebank NM_000167 (glycerol kinase), Genebank NM_000202 [iduronate 2-sulfatase (Hunter syndrome)], Genebank NM_000214 [jagged 1 (Alagille syndrome)], Genebank NM_000433 [neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], Genebank NM_000565 (interleukin 6 receptor), Genebank NM_000574 [CD55 molecule, decay accelerating factor for complement (Cromer blood group)], Genebank NM_000582 [secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], Genebank NM_000584 (interleukin 8), Genebank NM_000596 (insulin-like growth factor binding protein 1), Genebank NM_000602 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1] , Genebank NM_000660 (transforming growth factor, beta 1), Genebank NM_001001555 (growth factor receptor-bound protein 10), Genebank NM_001007245 (interferon-related developme ntal regulator 1), gene registration number (Genebank) NM_001007271 (dual specificity phosphatase 13), gene registration number (Genebank) NM_001008211 (optineurin), gene registration number (Genebank) NM_001031716 (oligonucleotide / oligosaccharide-binding fold containing 2A), gene registration Genebank NM_001105 (activin A receptor, type I), Genebank NM_001172 (arginase, type II), Genebank NM_001173 (Rho GTPase activating protein 5), Genebank NM_001300 (Kruppel-like factor 6), Genebank NM_001353 [aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)], Genebank NM_001425 (epithelial membrane protein 3), Genebank NM_001498 (glutamate-cysteine ligase, catalytic subunit), Gene accession number (Genebank) ) NM_001554 (cysteine-rich, angiogenic inducer, 61), Genebank (Genebank) NM_001614 (actin, gamma 1), Genebank (Genebank) NM_001657 [amphiregulin (schwannoma-derived growth factor)], Genebank (Genebank) ) NM_001723 (dystonin), Genebank NM_001730 [Kruppel-like factor 5 (intestinal)], Genebank NM_001748 [calpain 2, (m / II) large subunit], Gene Registration Number (Genebank) NM_001769 (CD9 molecule), Gene Registration Number (Genebank) NM_001780 (CD63 molecule), Gene Registration Number (Genebank) NM_001785 (cytidine deaminase), Gene Registration Number (Genebank) NM_001964 (early growth response 1), Gene Registration Number (Genebank) NM_002061 (glutamate-cysteine ligase, modifier subunit), gene Genebank NM_002064 [glutaredoxin (thioltransferase)], Gene Registration Number (Genebank) NM_002115 [hexokinase 3 (white cell)], Gene Registration Number (Genebank) NM_002143 (hippocalcin), Gene Registration Number (Genebank) NM_002203 [integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], Genebank NM_002224 (inositol 1,4,5-triphosphate receptor, type 3), Genebank NM_002276 (keratin 19), Genebank NM_002288 (leukocyte-associated immunoglobulin-like receptor 2), Genebank NM_002305 [lectin, galactoside-binding, soluble, 1 (galectin 1)], Genebank NM_002306 (lectin , galactoside-binding, soluble, 3), Genebank NM_002309 [leukemia inhibitory factor (cholinergic differentiation factor)], Genebank NM_002394 [solute carrier family 3 (activators of dibasic and neutral amino acid transport) , member 2], Genebank NM_0025 71 [progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], Genebank NM_002576 [p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) )], Genebank NM_002607 (platelet-derived growth factor alpha polypeptide), Genebank (Genebank) NM_002648 (pim-1 oncogene), Genebank NM_002867 (RAB3B, member RAS oncogene family), Genebank (Genebank) NM_002899 (retinol binding protein 1, cellular), Genebank (Genebank) NM_002960 (S100 calcium binding protein A3), Genebank (Genebank) NM_002970 (spermidine / spermine N1-acetyltransferase 1), Gene registration Number (Genebank) NM_003107 [SRY (sex determining region Y) -box 4], Genebank NM_003122 (serine peptidase inhibitor, Kazal type 1), Genebank NM_003225 (trefoil factor 1), Gene registration Number (Genebank) NM_003254 (TIMP metall opeptidase inhibitor 1), Genebank NM_003255 (TIMP metallopeptidase inhibitor 2), Genebank NM_003311 (pleckstrin homology-like domain, family A, member 2), Genebank NM_003330 (thioredoxin reductase 1), Genebank NM_003407 [zinc finger protein 36, C3H type, homolog (mouse)], Genebank NM_003739 [aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], Genebank NM_003887 (development and differentiation enhancing factor 2), Genebank NM_003897 (immediate early response 3), Genebank NM_003900 (sequestosome 1), Gene registry number ( Genebank) NM_003937 [kynureninase (L-kynurenine hydrolase)], Genebank NM_003979 (G protein-coupled receptor, family C, group 5, member A), Genebank NM_004024 (activating transcription factor 3) , Gene registration number (Genebank) NM_004073 [polo-like kinase 3 (Drosophila)], gene registration number (Genebank) NM_004083 (DNA-damage-inducible transcript 3), gene registration number (Genebank) NM_004177 (syntaxin 3), gene registration number (Genebank) NM_004417 (dual specificity phosphatase 1), Genebank NM_004418 (dual specificity phosphatase 2), Genebank NM_004723 [rho / rac guanine nucleotide exchange factor (GEF) 2], Genebank (Menebank) NM_004748 (cell cycle progression 1), Genebank NM_004751 [glucosaminyl (N-acetyl) transferase 3, mucin type], Genebank NM_004760 (serine / threonine kinase 17a), Genebank NM_004864 (growth differentiation factor 15), Genebank NM_004907 (immediate early response 2), Genebank NM_004925 [aquaporin 3 (Gill blood group)], Genebank NM_004926 (zinc finger protein 36 , C3H type-like 1), Gene Registration Number (Gen ebank) NM_005139 (annexin A3), Genebank NM_005228 {epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, Genebank NM_005242 [coagulation factor II ( thrombin) receptor-like 1], Genebank NM_005261 (GTP binding protein overexpressed in skeletal muscle), Genebank NM_005415 [solute carrier family 20 (phosphate transporter), member 1], gene registration number ( Genebank) NM_005438 (FOS-like antigen 1), Genebank NM_005451 [PDZ and LIM domain 7 (enigma)], Genebank NM_005469 (acyl-CoA thioesterase 8), Genebank (Genebank) NM_005620 (S100 calcium binding protein A11), Genebank (Genebank) NM_005772 (RNA terminal phosphate cyclase-like 1), Gene accession number (Genebank) NM_005953 (metallothionein 2A), Gene registration number (Genebank) NM_005980 (S100 calcium binding protein P), Genebank NM_006091 (coronin, actin binding protein, 2B), genebank (Genebank) NM_006208 (ectonucleotide pyrophosphatase / phosphodiesterase 1), genebank (Genebank) NM_006216 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], Genebank NM_006572 [guanine nucleotide binding protein (G protein), alpha 13], Genebank (Genebank) NM_006617 (nestin), Gene accession number (Genebank) NM_007039 (protein tyrosine phosphatase, non- receptor type 21), genebank NM_007333 (killer cell lectin-like receptor subfamily C, member 3), genebank NM_012250 [related RAS viral (r-ras) oncogene homolog 2], gene registry number Genebank NM_012258 (hairy / enhancer-of-split related with YRPW motif 1), Genebank NM_013246 (cardiotrophin-like cytokine factor 1), Genebank NM_013259 (transgelin 3), Gene registration number (Genebank) NM_014045 (low densit y lipoprotein receptor-related protein 10), Genebank NM_014059 (chromosome 13 open reading frame 15), Genebank NM_014256 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 3), Genebank No. NM_014331 [solute carrier family 7, (cationic amino acid transporter, y + system) member 11], Genebank No. NM_014624 (S100 calcium binding protein A6), Genebank No. NM_014798 [pleckstrin homology domain containing, family M (with RUN domain) member 1], Genebank NM_015187 (KIAA0746 protein), Genebank NM_016009 (SH3-domain GRB2-like endophilin B1), Genebank ID (Genebank) ) NM_016081 (palladin, cytoskeletal associated protein), Genebank NM_016113 (transient receptor potential cation channel, subfamily V, member 2), Genebank NM_016548 (golgi phosphoprotein 2), Gene accession number (Genebank) NM_016639 (tumo r necrosis factor receptor superfamily, member 12A), genebank NM_017705 (progestin and adipoQ receptor family member V), genebank NM_018357 (La ribonucleoprotein domain family, member 6), genebank (Genebank) NM_018590 (chondroitin sulfate GalNAcT-2), Genebank (Genebank) NM_018639 (WD repeat and SOCS box-containing 2), Genebank (Genebank) NM_018689 (KIAA1199), Genebank (Genebank) NM_018842 (BAI1-associated protein 2-like 1), Genebank NM_018948 (ERBB receptor feedback inhibitor 1), Genebank NM_019096 (GTP binding protein 2), Genebank NM_020148 [spire homolog 1 (Drosophila)] , Gene Registration Number (Genebank) NM_020546 [adenylate cyclase 2 (brain)], Gene Registration Number (Genebank) NM_020870 (SH3 domain containing ring finger 1), Gene Registration Number (Genebank) NM_020962 (neighbor of Punc E11), Gene Registration Number (Genebank) NM_021103 (thymos in, beta 10), Genebank NM_021158 [tribbles homolog 3 (Drosophila)], Genebank NM_021913 (AXL receptor tyrosine kinase), Genebank NM_022153 (chromosome 10 open reading frame 54 ), Genebank NM_022818 (microtubule-associated protein 1 light chain 3 beta), Genebank NM_024847 (transmembrane channel-like 7), Genebank NM_025099 (chromosome 17 open reading frame 68 ), Genebank NM_025106 (splA / ryanodine receptor domain and SOCS box containing 1), Genebank NM_025130 (hexokinase domain containing 1), Genebank NM_025195 (tribbles homolog 1 (Drosophila) ], Genebank NM_030627 (cytoplasmic polyadenylation element binding protein 4), Genebank N (Genebank) NM_030674 (solute carrier family 38, member 1), Genebank NM_031286 (SH3 domain binding glutamic acid-rich) protein like 3), genebank (Genebank) NM_032466 (aspartate beta-hydroxylase), genebank (Genebank) NM_032525 (tubulin, beta 6), genebank (Genebank) NM_032717 (lung cancer metastasis-associated protein), gene Registration Number (Genebank) NM_032892 (FERM domain containing 5), Gene Registration Number (Genebank) NM_033160 (zinc finger protein 658), Gene Registration Number (Genebank) NM_033260 (forkhead box Q1), Gene Registration Number (Genebank) NM_052871 (hypothetical protein MGC4677), genebank NM_078487 [cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], genebank NM_080655 (chromosome 9 open reading frame 30), genebank NM_080725 [ sulfiredoxin 1 homolog (S. cerevisiae)], Genebank NM_080927 (discoidin, CUB and LCCL domain containing 2), Genebank NM_134421 (hippocalcin-like 1), Genebank NM_138961 (endothelial cell adhesion molecules), Genebank NM_144497 [A kinase (PRKA) anchor protein (gravin) 12], Genebank number (Genebank) NM_144652 (leucine zipper-EF-hand containing transmembrane protein 2), Genebank number NM_144778 [muscleblind -like 2 (Drosophila)], Genebank NM_145904 (high mobility group AT-hook 1), Genebank NM_147780 (cathepsin B), Genebank NM_153006 (N-acetylglutamate synthase) , Genebank NM_153020 (RNA binding motif protein 24), Genebank NM_153229 (transmembrane protein 92), Genebank NM_153608 (zinc finger protein 114), Genebank NM_170692 (RAS protein activator like 2), heredity Genebank NM_172210 [colony stimulating factor 1 (macrophage)], Genebank number (Genebank) NM_172364 (calcium channel, voltage-dependent, alpha 2 / delta subunit 4), Genebank number NM_175839 (spermine oxidase) , Genebank NM_178234 (tumor suppressor candidate 3), Genebank NM_178275 (eEF1A2 binding protein), Genebank NM_178859 (organic solute transporter beta), Genebank NM_181985 [ leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], Genebank NM_182485 (cytoplasmic polyadenylation element binding protein 2), Genebank NM_183373 (chromosome 6 open reading frame 145), Genebank NM_198447 [golgi transport 1 homolog A (S. cerevisiae)], Genebank NM_198833 [serpin peptidase inhibitor, clade B (ovalbumin), member 8], Genebank NM_199330 [homer homolog 2 (Drosophila)], Genebank NM_201555 ( four and a half LIM domains 2), Genebank NM_203380 (acyl-CoA synthetase long-chain family member 5), Genebank NM_203391 (glycerol kinase), Genebank NM_203403 (chromosome 9 open reading frame 150), Genebank NR_002205 (ferritin, heavy polypeptide-like 12), Genebank NR_002802 (trophoblast-derived noncoding RNA), Genebank NR_002823 (aquaporin 7 pseudogene 2), Genebank NR_002834 (dual specificity phosphatase 5 pseudogene), Genebank XM_373277 (similar to microtubule-associated proteins 1A / 1B light chain 3), Genebank XM_932993 [Homo sapiens cDNA FLJ32255 fis, clone PROST 1000226. (AK056817)], Genebank XR_000951 [Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC: 15504 IMAGE: 2990071), complete cds. (BC007251)], Genebank AF007149 (hypothetical protein LOC257407), Genebank AF118092 (predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), Genebank AF334184 (Rac GTPase activating protein 1 pseudogene, Genebank AL832208 (hypothetical protein FLJ32312), Genebank (Genebank) BC006267 (asparaginase like 1), Genebank (BCenebank) BC050292 (MGC44478), Genebank (Genebank) BF591978 [Apolipoprotein H (beta-2-glycoprotein I)], Genebank BX405503 (Alpha-fetoprotein), Genebank (Genebank) CD608671 (Fibrinogen alpha chain), Genebank (Genebank) NM_000029 [angiotensinogen ( serpin peptidase inhibitor, clade A, member 8)], Genebank NM_000040 (apolipoprotein C-III), Genebank NM_000042 [apolipoprotein H (beta-2-glycoprotein I)], Gene registration number ( Genebank) NM_000156 (guanidinoacetat e N-methyltransferase, Genebank NM_000166 (gap junction protein, beta 1, 32kDa), Genebank NM_000204 (complement factor I), Genebank NM_000253 (microsomal triglyceride transfer protein) , Genebank NM_000354 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], Genebank NM_000508 (fibrinogen alpha chain), Genebank NM_000509 (fibrinogen gamma chain, Genebank NM_000607 (orosomucoid 1), Genebank NM_000608 (orosomucoid 2), Genebank NM_000670 [alcohol dehydrogenase 4 (class II), pi polypeptide], Gene registration Number (Genebank) NM_000671 [alcohol dehydrogenase 5 (class III), chi polypeptide], gene registration number (Genebank) NM_000672 [alcohol dehydrogenase 6 (class V)], gene accession number (Genebank) NM_000790 [dopa decarboxylase (aromatic L-amino acid decarboxylase) ], Gene Registration Number (Genebank) NM_000792 (deiodinase, iodothyronine, type I), Gene Registration Number (Genebank) NM_000846 (glutathione S-transferase A2), Gene Registration Number (Genebank) NM_000851 (glutathione S-transferase M5), Gene Registration Genebank NM_000934 [serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], Genebank NM_001005414 [Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA ( NM_001005414), Genebank NM_001010845 (hypothetical protein LOC123876), Genebank NM_001011554 [solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], Genebank NM_001012271 [baculoviral IAP repeat-containing 5 (survivin)], Genebank NM_001012716 (chromosome 18 open reading frame 56), Genebank NM_001040152 (paternally expressed 10), Genebank NM_001067 [top oisomerase (DNA) II alpha 170kDa], Genebank NM_001071 (thymidylate synthetase), Genebank NM_001134 (alpha-fetoprotein), Genebank NM_001182 (aldehyde dehydrogenase 7 family, member A1) Gene registration number (Genebank) NM_001237 (cyclin A2), gene registration number (Genebank) NM_001311 [cysteine-rich protein 1 (intestinal)], gene registration number (Genebank) NM_001443 (fatty acid binding protein 1, liver), gene registration Number (Genebank) NM_001739 (carbonic anhydrase VA, mitochondrial), Gene Registration Number (Genebank) NM_001756 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], Genebank NM_001786 (cell division cycle 2, G1 to S and G2 to M), Genebank NM_001789 [cell division cycle 25 homolog A (S. pombe), Genebank NM_001823 (creatine kinase, brain), Genebank NM_001844 [collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], Genebank (Genebank) NM_001872 [carboxypeptidase B2 (plasma)], genebank (Genebank) NM_001948 (dUTP pyrophosphatase), genebank (Genebank) NM_002129 (high-mobility group box 2), genebank (Genebank) NM_002388 (minichromosome maintenance complex component 3 ), Genebank NM_002497 [NIMA (never in mitosis gene a) -related kinase 2], Genebank NM_002592 (proliferating cell nuclear antigen), Genebank NM_002614 (PDZ domain containing 1 ), Genebank NM_002630 [progastricsin (pepsinogen C)], Genebank NM_002729 (hematopoietically expressed homeobox), Genebank NM_002758 (mitogen-activated protein kinase kinase 6), heredity Genebank Number NM_003258 (thymidine kinase 1, soluble), Genebank Number NM_003542 (histone cluster 1, H4c), Genebank Number NM_003579 [RAD54-like (S. cerevisiae)], Gene Registration Number (Genebank) NM_003882 (WNT1 inducible signaling pathway protein 1), Genebank NM_003944 (selenium binding protein 1), Genebank NM_003981 (protein regulator of cytokinesis 1), Genebank NM_004111 ( flap structure-specific endonuclease 1), Genebank NM_004169 [serine hydroxymethyltransferase 1 (soluble)], Genebank NM_004265 (fatty acid desaturase 2), Genebank NM_004336 [BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], Genebank NM_004701 (cyclin B2), Genebank NM_004772 (chromosome 5 open reading frame 13), Genebank NM_004845 (phosphate cytidylyltransferase 1, choline , beta), Genebank NM_005030 [polo-like kinase 1 (Drosophila)], Genebank NM_005063 [stearoyl-CoA desaturase (delta-9-desaturase)], Genebank (Genebank) NM_005123 (nuclear receptor subfamily 1, group H, member 4), Genebank (Genebank) NM_005165 (aldolase C, fructose-bisphosphate), Genebank (Genebank) NM_005327 (hydroxyacyl-Coenzyme A dehydrogenase), Genebank ) NM_005502 [ATP-binding cassette, sub-family A (ABC1), member 1], gene registration number (Genebank) NM_005573 (lamin B1), gene registration number (Genebank) NM_005631 [smoothened homolog (Drosophila)], gene registration number (Genebank) NM_005733 (kinesin family member 20A), Genebank NM_005915 (minichromosome maintenance complex component 6), Gene registration number (Genebank) NM_005940 [matrix metallopeptidase 11 (stromelysin 3)], Gene registration number (Genebank) NM_005989 [aldo-keto reductase family 1, member D1 (delta 4-3-ketoster oid-5-beta-reductase)], Genebank NM_006101 [NDC80 homolog, kinetochore complex component (S. cerevisiae)], Genebank NM_006113 (vav 3 oncogene), Genebank Number (Genebank) NM_006215 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], Genebank (Genebank) NM_006398 (ubiquitin D), Genebank NM_006444 (structural maintenance of chromosomes 2), Genebank NM_006461 (sperm associated antigen 5), Genebank NM_006472 (thioredoxin interacting protein), Gene registration Genebank NM_006498 (lectin, galactoside-binding, soluble, 2), Genebank NM_006757 [troponin T type 3 (skeletal, fast)], Genebank NM_006845 (kinesin family member 2C) , Genebank NM_006876 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 1), Genebank NM_007111 (transcription factor Dp-1), Genebank NM_007317 (kinesin family member 22), Genebank NM _012068 (activating transcription factor 5), Genebank NM_012484 [hyaluronan-mediated motility receptor (RHAMM)], Genebank NM_013277 (Rac GTPase activating protein 1), Genebank NM_014176 [ubiquitin -conjugating enzyme E2T (putative)], Genebank NM_014264 [polo-like kinase 4 (Drosophila)], Genebank NM_014333 (cell adhesion molecule 1), Genebank NM_014736 (KIAA0101 ), Genebank NM_014762 (24-dehydrocholesterol reductase), Genebank NM_014791 (maternal embryonic leucine zipper kinase), Genebank NM_014858 (transmembrane and coiled-coil domain family 2), Gene Genebank NM_015533 [dihydroxyacetone kinase 2 homolog (S. cerevisiae)], Genebank NM_016359 (nucleolar and spindle associated protein 1), Genebank NM_016521 (transcription factor Dp family, member 3), Genebank NM_017855 (odontogenic, ameloblast associated) , Genebank NM_018136 [asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], Genebank NM_018154 [ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], gene registration number (Genebank) NM_018193 (Fanconi anemia, complementation group I), Genebank NM_018410 (hypothetical protein DKFZp762E1312), Genebank NM_018492 (PDZ binding kinase), Gene accession number (Genebank) NM_018974 [unc-93 homolog A (C. elegans)], Genebank NM_020062 (SLC2A4 regulator), Genebank NM_020530 (oncostatin M), Genebank NM_020918 (glycerol-3-phosphate acyltransferase, mitochondrial) , U Genebank NM_020995 (haptoglobin-related protein), Genebank NM_021069 (sorbin and SH3 domain containing 2), Genebank NM_022346 (non-SMC condensin I complex, subunit G), gene Genebank NM_024629 (MLF1 interacting protein), Genebank NM_025149 (hypothetical protein FLJ20920), Genebank NM_025225 (patatin-like phospholipase domain containing 3), Genebank NM_030771 ( coiled-coil domain containing 34), Genebank NM_030932 (diaphanous homolog 3 (Drosophila)], Genebank NM_031299 (cell division cycle associated 3), Genebank NM_031942 (cell division cycle associated 7), Genebank NM_031966 (cyclin B1), Genebank NM_032023 [Ras association (RalGDS / AF-6) domain family 4], Genebank NM_032564 [diacylglycerol O-acyltransferase homolog 2 (mouse)], Genebank NM_032638 (GATA binding protein 2), Genebank NM_032828 (zinc finger protein 587), Genebank NM_052968 (apolipoprotein AV), Gene Registration Number ( Genebank) NM_054113 (calcium and integrin binding family member 3), Genebank NM_058186 (family with sequence similarity 3, member B), Genebank NM_145740 (glutathione S-transferase A1), gene registration number ( Genebank) NM_148957 (tumor necrosis factor receptor superfamily, member 19), Genebank NM_152308 (chromosome 16 open reading frame 75), Genebank NM_152722 (hepatocyte cell adhesion molecule), Genebank (Genebank) NM_153699 (glutathione S-transferase A5), Genebank NM_172164 [nuclear autoantigenic sperm protein (histone-binding)], Genebank NM_174936 (proprotein convertase subtilisin / kexin type 9), Gene registration number (G enebank) NM_177550 [solute carrier family 13 (sodium-dependent citrate transporter), member 5], gene registration number (Genebank) NM_180991 (solute carrier organic anion transporter family, member 4C1), gene registration number (Genebank) NM_181712 (ankyrin repeat domain 38), gene registration number (Genebank) NM_182617 (acyl-CoA synthetase medium-chain family member 2), gene registration number (Genebank) NM_182908 [dehydrogenase / reductase (SDR family) member 2], gene registration number (Genebank) NM_198433 ( aurora kinase A), Genebank NM_201523 (kinesin light chain 4), Genebank NM_203401 (stathmin 1 / oncoprotein 18), Genebank NM_207418 (family with sequence similarity 72, member A ), Genebank NR_002932 (glutathione S-transferase M1 pseudogene), Genebank (Genebank) XM_940101 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] and Genebank (Genebank) ) XM_944838 (hypot hetical protein LOC285733). 제 1항에 있어서, 하기 유전자가 클로르덴에 대한 노출에 의하여 발현이 증가하는 것을 특징으로 하는 바이오마커:The biomarker of claim 1, wherein the expression of the following genes is increased by exposure to chlordene: 유전자등록번호(Genebank) AB040974(Start codon is not identified.; Homo sapiens mRNA for KIAA1541 protein, partial cds.), 유전자등록번호(Genebank) AF011794(cell cycle progression 1), 유전자등록번호(Genebank) AF147412(Full length insert cDNA clone YP59C02), 유전자등록번호(Genebank) AF165191(dystonin), 유전자등록번호(Genebank) AK026078[ELK3, ETS-domain protein (SRF accessory protein 2)], 유전자등록번호(Genebank) AK055600[Iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) AK075342(Chromosome 12 open reading frame 39), 유전자등록번호(Genebank) AK124869(SH2 domain containing 5), 유전자등록번호(Genebank) AY665468[Ras association (RalGDS/AF-6) domain family 8], 유전자등록번호(Genebank) BC005130(hypothetical protein MGC11082), 유전자등록번호(Genebank) BC015987(Kruppel-like factor 6), 유전자등록번호(Genebank) BC031618(chromosome 10 open reading frame 30), 유전자등록번호(Genebank) BC033000(tetratricopeptide repeat domain 17), 유전자등록번호(Genebank) BC033829[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) BC036699(hypothetical LOC654433), 유전자등록번호(Genebank) BC047030(uridine phosphorylase 1), 유전자등록번호(Genebank) BC066644(KIAA1949), 유전자등록번호(Genebank) BC070200(hypothetical LOC541471), 유전자등록번호(Genebank) BF210146(Similar to asparagine synthetase), 유전자등록번호(Genebank) BG001037(Thioredoxin reductase 1), 유전자등록번호(Genebank) BG188151(Transcribed locus), 유전자등록번호(Genebank) CR595522[3'UTR of hypothetical protein (ORF1)], 유전자등록번호(Genebank) CR625648(metallothionein 2A), 유전자등록번호(Genebank) M90656(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_000167(glycerol kinase), 유전자등록번호(Genebank) NM_000202[iduronate 2-sulfatase (Hunter syndrome)], 유전자등록번호(Genebank) NM_000214[jagged 1 (Alagille syndrome)], 유전자등록번호(Genebank) NM_000433[neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], 유전자등록번 호(Genebank) NM_000565(interleukin 6 receptor), 유전자등록번호(Genebank) NM_000574[CD55 molecule, decay accelerating factor for complement (Cromer blood group)], 유전자등록번호(Genebank) NM_000582[secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], 유전자등록번호(Genebank) NM_000584(interleukin 8), 유전자등록번호(Genebank) NM_000596(insulin-like growth factor binding protein 1), 유전자등록번호(Genebank) NM_000602[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1], 유전자등록번호(Genebank) NM_000660(transforming growth factor, beta 1), 유전자등록번호(Genebank) NM_001001555(growth factor receptor-bound protein 10), 유전자등록번호(Genebank) NM_001007245(interferon-related developmental regulator 1), 유전자등록번호(Genebank) NM_001007271(dual specificity phosphatase 13), 유전자등록번호(Genebank) NM_001008211(optineurin), 유전자등록번호(Genebank) NM_001031716(oligonucleotide/oligosaccharide-binding fold containing 2A), 유전자등록번호(Genebank) NM_001105(activin A receptor, type I), 유전자등록번호(Genebank) NM_001172(arginase, type II), 유전자등록번호(Genebank) NM_001173(Rho GTPase activating protein 5), 유전자등록번호(Genebank) NM_001300(Kruppel-like factor 6), 유전자등록번호(Genebank) NM_001353[aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)], 유전자등록번호(Genebank) NM_001425(epithelial membrane protein 3), 유전자등록번호(Genebank) NM_001498(glutamate-cysteine ligase, catalytic subunit), 유전자등록번호(Genebank) NM_001554(cysteine-rich, angiogenic inducer, 61), 유전자등록번호(Genebank) NM_001614(actin, gamma 1), 유전자등록번호(Genebank) NM_001657[amphiregulin (schwannoma-derived growth factor)], 유전자등록번호(Genebank) NM_001723(dystonin), 유전자등록번호(Genebank) NM_001730[Kruppel-like factor 5 (intestinal)], 유전자등록번호(Genebank) NM_001748[calpain 2, (m/II) large subunit], 유전자등록번호(Genebank) NM_001769(CD9 molecule), 유전자등록번호(Genebank) NM_001780(CD63 molecule), 유전자등록번호(Genebank) NM_001785(cytidine deaminase), 유전자등록번호(Genebank) NM_001964(early growth response 1), 유전자등록번호(Genebank) NM_002061(glutamate-cysteine ligase, modifier subunit), 유전자등록번호(Genebank) NM_002064[glutaredoxin (thioltransferase)], 유전자등록번호(Genebank) NM_002115[hexokinase 3 (white cell)], 유전자등록번호(Genebank) NM_002143(hippocalcin), 유전자등록번호(Genebank) NM_002203[integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], 유전자등록번호(Genebank) NM_002224(inositol 1,4,5-triphosphate receptor, type 3), 유전자등록번호(Genebank) NM_002276(keratin 19), 유전자등록번호(Genebank) NM_002288(leukocyte-associated immunoglobulin-like receptor 2), 유전자등록번호(Genebank) NM_002305[lectin, galactoside-binding, soluble, 1 (galectin 1)], 유전자등록번호(Genebank) NM_002306(lectin, galactoside- binding, soluble, 3), 유전자등록번호(Genebank) NM_002309[leukemia inhibitory factor (cholinergic differentiation factor)], 유전자등록번호(Genebank) NM_002394[solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2], 유전자등록번호(Genebank) NM_002571[progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], 유전자등록번호(Genebank) NM_002576[p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)], 유전자등록번호(Genebank) NM_002607(platelet-derived growth factor alpha polypeptide), 유전자등록번호(Genebank) NM_002648(pim-1 oncogene), 유전자등록번호(Genebank) NM_002867(RAB3B, member RAS oncogene family), 유전자등록번호(Genebank) NM_002899(retinol binding protein 1, cellular), 유전자등록번호(Genebank) NM_002960(S100 calcium binding protein A3), 유전자등록번호(Genebank) NM_002970(spermidine/spermine N1-acetyltransferase 1), 유전자등록번호(Genebank) NM_003107[SRY (sex determining region Y)-box 4], 유전자등록번호(Genebank) NM_003122(serine peptidase inhibitor, Kazal type 1), 유전자등록번호(Genebank) NM_003225(trefoil factor 1), 유전자등록번호(Genebank) NM_003254(TIMP metallopeptidase inhibitor 1), 유전자등록번호(Genebank) NM_003255(TIMP metallopeptidase inhibitor 2), 유전자등록번호(Genebank) NM_003311(pleckstrin homology-like domain, family A, member 2), 유전자등록번호(Genebank) NM_003330(thioredoxin reductase 1), 유전자등록번 호(Genebank) NM_003407[zinc finger protein 36, C3H type, homolog (mouse)], 유전자등록번호(Genebank) NM_003739[aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], 유전자등록번호(Genebank) NM_003887(development and differentiation enhancing factor 2), 유전자등록번호(Genebank) NM_003897(immediate early response 3), 유전자등록번호(Genebank) NM_003900(sequestosome 1), 유전자등록번호(Genebank) NM_003937[kynureninase (L-kynurenine hydrolase)], 유전자등록번호(Genebank) NM_003979(G protein-coupled receptor, family C, group 5, member A), 유전자등록번호(Genebank) NM_004024(activating transcription factor 3), 유전자등록번호(Genebank) NM_004073[polo-like kinase 3 (Drosophila)], 유전자등록번호(Genebank) NM_004083(DNA-damage-inducible transcript 3), 유전자등록번호(Genebank) NM_004177(syntaxin 3), 유전자등록번호(Genebank) NM_004417(dual specificity phosphatase 1), 유전자등록번호(Genebank) NM_004418(dual specificity phosphatase 2), 유전자등록번호(Genebank) NM_004723[rho/rac guanine nucleotide exchange factor (GEF) 2], 유전자등록번호(Genebank) NM_004748(cell cycle progression 1), 유전자등록번호(Genebank) NM_004751[glucosaminyl (N-acetyl) transferase 3, mucin type], 유전자등록번호(Genebank) NM_004760(serine/threonine kinase 17a), 유전자등록번호(Genebank) NM_004864(growth differentiation factor 15), 유전자등록번호(Genebank) NM_004907(immediate early response 2), 유전자등록번호(Genebank) NM_004925[aquaporin 3 (Gill blood group)], 유전자등록번호(Genebank) NM_004926(zinc finger protein 36, C3H type-like 1), 유전자등록번호(Genebank) NM_005139(annexin A3), 유전자등록번호(Genebank) NM_005228{epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, 유전자등록번호(Genebank) NM_005242[coagulation factor II (thrombin) receptor-like 1], 유전자등록번호(Genebank) NM_005261(GTP binding protein overexpressed in skeletal muscle), 유전자등록번호(Genebank) NM_005415[solute carrier family 20 (phosphate transporter), member 1], 유전자등록번호(Genebank) NM_005438(FOS-like antigen 1), 유전자등록번호(Genebank) NM_005451[PDZ and LIM domain 7 (enigma)], 유전자등록번호(Genebank) NM_005469(acyl-CoA thioesterase 8), 유전자등록번호(Genebank) NM_005620(S100 calcium binding protein A11), 유전자등록번호(Genebank) NM_005772(RNA terminal phosphate cyclase-like 1), 유전자등록번호(Genebank) NM_005953(metallothionein 2A), 유전자등록번호(Genebank) NM_005980(S100 calcium binding protein P), 유전자등록번호(Genebank) NM_006091(coronin, actin binding protein, 2B), 유전자등록번호(Genebank) NM_006208(ectonucleotide pyrophosphatase/phosphodiesterase 1), 유전자등록번호(Genebank) NM_006216[serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], 유전자등록번호(Genebank) NM_006572[guanine nucleotide binding protein (G protein), alpha 13], 유전자등록번호(Genebank) NM_006617(nestin), 유전자등록번호(Genebank) NM_007039(protein tyrosine phosphatase, non-receptor type 21), 유전자등록번호(Genebank) NM_007333(killer cell lectin-like receptor subfamily C, member 3), 유전자등록번호(Genebank) NM_012250[related RAS viral (r-ras) oncogene homolog 2], 유전자등록번호(Genebank) NM_012258(hairy/enhancer-of-split related with YRPW motif 1), 유전자등록번호(Genebank) NM_013246(cardiotrophin-like cytokine factor 1), 유전자등록번호(Genebank) NM_013259(transgelin 3), 유전자등록번호(Genebank) NM_014045(low density lipoprotein receptor-related protein 10), 유전자등록번호(Genebank) NM_014059(chromosome 13 open reading frame 15), 유전자등록번호(Genebank) NM_014256(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3), 유전자등록번호(Genebank) NM_014331[solute carrier family 7, (cationic amino acid transporter, y+ system) member 11], 유전자등록번호(Genebank) NM_014624(S100 calcium binding protein A6), 유전자등록번호(Genebank) NM_014798[pleckstrin homology domain containing, family M (with RUN domain) member 1], 유전자등록번호(Genebank) NM_015187(KIAA0746 protein), 유전자등록번호(Genebank) NM_016009(SH3-domain GRB2-like endophilin B1), 유전자등록번호(Genebank) NM_016081(palladin, cytoskeletal associated protein), 유전자등록번호(Genebank) NM_016113(transient receptor potential cation channel, subfamily V, member 2), 유전자등록번호(Genebank) NM_016548(golgi phosphoprotein 2), 유전자등록번호(Genebank) NM_016639(tumor necrosis factor receptor superfamily, member 12A), 유전자등록번호(Genebank) NM_017705(progestin and adipoQ receptor family member V), 유전자등록번호(Genebank) NM_018357(La ribonucleoprotein domain family, member 6), 유전자등록번호(Genebank) NM_018590(chondroitin sulfate GalNAcT-2), 유전자등록번호(Genebank) NM_018639(WD repeat and SOCS box-containing 2), 유전자등록번호(Genebank) NM_018689(KIAA1199), 유전자등록번호(Genebank) NM_018842(BAI1-associated protein 2-like 1), 유전자등록번호(Genebank) NM_018948(ERBB receptor feedback inhibitor 1), 유전자등록번호(Genebank) NM_019096(GTP binding protein 2), 유전자등록번호(Genebank) NM_020148[spire homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_020546[adenylate cyclase 2 (brain)], 유전자등록번호(Genebank) NM_020870(SH3 domain containing ring finger 1), 유전자등록번호(Genebank) NM_020962(neighbor of Punc E11), 유전자등록번호(Genebank) NM_021103(thymosin, beta 10), 유전자등록번호(Genebank) NM_021158[tribbles homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_021913(AXL receptor tyrosine kinase), 유전자등록번호(Genebank) NM_022153(chromosome 10 open reading frame 54), 유전자등록번호(Genebank) NM_022818(microtubule-associated protein 1 light chain 3 beta), 유전자등록번호(Genebank) NM_024847(transmembrane channel-like 7), 유전자등록번호(Genebank) NM_025099(chromosome 17 open reading frame 68), 유전자등록번호(Genebank) NM_025106(splA/ryanodine receptor domain and SOCS box containing 1), 유전자등록번호(Genebank) NM_025130(hexokinase domain containing 1), 유전 자등록번호(Genebank) NM_025195[tribbles homolog 1 (Drosophila)], 유전자등록번호(Genebank) NM_030627(cytoplasmic polyadenylation element binding protein 4), 유전자등록번호(Genebank) NM_030674(solute carrier family 38, member 1), 유전자등록번호(Genebank) NM_031286(SH3 domain binding glutamic acid-rich protein like 3), 유전자등록번호(Genebank) NM_032466(aspartate beta-hydroxylase), 유전자등록번호(Genebank) NM_032525(tubulin, beta 6), 유전자등록번호(Genebank) NM_032717(lung cancer metastasis-associated protein), 유전자등록번호(Genebank) NM_032892(FERM domain containing 5), 유전자등록번호(Genebank) NM_033160(zinc finger protein 658), 유전자등록번호(Genebank) NM_033260(forkhead box Q1), 유전자등록번호(Genebank) NM_052871(hypothetical protein MGC4677), 유전자등록번호(Genebank) NM_078487[cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], 유전자등록번호(Genebank) NM_080655(chromosome 9 open reading frame 30), 유전자등록번호(Genebank) NM_080725[sulfiredoxin 1 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_080927(discoidin, CUB and LCCL domain containing 2), 유전자등록번호(Genebank) NM_134421(hippocalcin-like 1), 유전자등록번호(Genebank) NM_138961(endothelial cell adhesion molecule), 유전자등록번호(Genebank) NM_144497[A kinase (PRKA) anchor protein (gravin) 12], 유전자등록번호(Genebank) NM_144652(leucine zipper-EF-hand containing transmembrane protein 2), 유전자등록번호(Genebank) NM_144778[muscleblind-like 2 (Drosophila)], 유전자등록번호(Genebank) NM_145904(high mobility group AT-hook 1), 유전자등록번호(Genebank) NM_147780(cathepsin B), 유전자등록번호(Genebank) NM_153006(N-acetylglutamate synthase), 유전자등록번호(Genebank) NM_153020(RNA binding motif protein 24), 유전자등록번호(Genebank) NM_153229(transmembrane protein 92), 유전자등록번호(Genebank) NM_153608(zinc finger protein 114), 유전자등록번호(Genebank) NM_170692(RAS protein activator like 2), 유전자등록번호(Genebank) NM_172210[colony stimulating factor 1 (macrophage)], 유전자등록번호(Genebank) NM_172364(calcium channel, voltage-dependent, alpha 2/delta subunit 4), 유전자등록번호(Genebank) NM_175839(spermine oxidase), 유전자등록번호(Genebank) NM_178234(tumor suppressor candidate 3), 유전자등록번호(Genebank) NM_178275(eEF1A2 binding protein), 유전자등록번호(Genebank) NM_178859(organic solute transporter beta), 유전자등록번호(Genebank) NM_181985[leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], 유전자등록번호(Genebank) NM_182485(cytoplasmic polyadenylation element binding protein 2), 유전자등록번호(Genebank) NM_183373(chromosome 6 open reading frame 145), 유전자등록번호(Genebank) NM_198447[golgi transport 1 homolog A (S. cerevisiae)], 유전자등록번호(Genebank) NM_198833[serpin peptidase inhibitor, clade B (ovalbumin), member 8], 유전자등록번호(Genebank) NM_199330[homer homolog 2 (Drosophila)], 유전자등록번호(Genebank) NM_201555(four and a half LIM domains 2), 유전자등록 번호(Genebank) NM_203380(acyl-CoA synthetase long-chain family member 5), 유전자등록번호(Genebank) NM_203391(glycerol kinase), 유전자등록번호(Genebank) NM_203403(chromosome 9 open reading frame 150), 유전자등록번호(Genebank) NR_002205(ferritin, heavy polypeptide-like 12), 유전자등록번호(Genebank) NR_002802(trophoblast-derived noncoding RNA), 유전자등록번호(Genebank) NR_002823(aquaporin 7 pseudogene 2), 유전자등록번호(Genebank) NR_002834(dual specificity phosphatase 5 pseudogene), 유전자등록번호(Genebank) XM_373277(similar to microtubule-associated proteins 1A/1B light chain 3), 유전자등록번호(Genebank) XM_932993[Homo sapiens cDNA FLJ32255 fis, clone PROST1000226. (AK056817)] 및 유전자등록번호(Genebank) XR_000951[Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC:15504 IMAGE:2990071), complete cds. (BC007251)].Genebank AB040974 (Start codon is not identified .; Homo sapiens mRNA for KIAA1541 protein, partial cds.), Genebank AF011794 (cell cycle progression 1), Genebank AF147412 (Full) length insert cDNA clone YP59C02), Genebank (Genebank) AF165191 (dystonin), Genebank (Genebank) AK026078 [ELK3, ETS-domain protein (SRF accessory protein 2)], Genebank AK055600 [Iduronate 2 -sulfatase (Hunter syndrome)], Genebank AK075342 (Chromosome 12 open reading frame 39), Genebank AK124869 (SH2 domain containing 5), Genebank AY665468 [Ras association (RalGDS) / AF-6) domain family 8], Genebank BC005130 (hypothetical protein MGC11082), Genebank BC015987 (Kruppel-like factor 6), Genebank BC031618 (chromosome 10 open reading) frame 30), Genebank BC033000 ( tetratricopeptide repeat domain 17), Genebank BC033829 [A kinase (PRKA) anchor protein (gravin) 12], Genebank (Genebank) BC036699 (hypothetical LOC654433), Genebank BC047030 (uridine phosphorylase 1 ), Genebank BC066644 (KIAA1949), Genebank (Genebank) BC070200 (hypothetical LOC541471), Genebank BG210146 (Similar to asparagine synthetase), Genebank BG001037 (Thioredoxin reductase 1 ), Genebank BG188151 (Transcribed locus), Genebank CR595522 [3'UTR of hypothetical protein (ORF1)], Genebank CR625648 (metallothionein 2A), Genebank (Genebank) ) M90656 (glutamate-cysteine ligase, catalytic subunit), Genebank NM_000167 (glycerol kinase), Genebank NM_000202 [iduronate 2-sulfatase (Hunter syndrome)], Genebank NM_000214 [ jagged 1 (Alagille syndrome)], Genebank NM_000433 [neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)], Genebank NM_000565 (interleukin 6 receptor), Genebank (Genebank) NM_000574 [CD55 molecule, decay accelerating factor for complement (Cromer blood group)], Genebank NM_000582 [secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1)], Genebank (Genebank) NM_000584 (interleukin 8), Genebank NM_000596 (insulin-like growth factor binding protein 1), Genebank NM_000602 [serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 ], Genebank NM_000660 (transforming growth factor, beta 1), Genebank NM_001001555 (growth factor receptor-bound protein 10), Genebank NM_001007245 (interferon-related developme) ntal regulator 1), gene registration number (Genebank) NM_001007271 (dual specificity phosphatase 13), gene registration number (Genebank) NM_001008211 (optineurin), gene registration number (Genebank) NM_001031716 (oligonucleotide / oligosaccharide-binding fold containing 2A), gene registration Genebank NM_001105 (activin A receptor, type I), Genebank NM_001172 (arginase, type II), Genebank NM_001173 (Rho GTPase activating protein 5), Genebank NM_001300 (Kruppel-like factor 6), Genebank NM_001353 [aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha) -hydroxysteroid dehydrogenase)], Genebank NM_001425 (epithelial membrane protein 3), Genebank NM_001498 (glutamate-cysteine ligase, catalytic subunit), Gene accession number (Genebank) ) NM_001554 (cysteine-rich, angiogenic inducer, 61), Genebank (Genebank) NM_001614 (actin, gamma 1), Genebank (Genebank) NM_001657 [amphiregulin (schwannoma-derived growth factor)], Genebank (Genebank) ) NM_001723 (dystonin), Genebank NM_001730 [Kruppel-like factor 5 (intestinal)], Genebank NM_001748 [calpain 2, (m / II) large subunit], Gene Registration Number (Genebank) NM_001769 (CD9 molecule), Gene Registration Number (Genebank) NM_001780 (CD63 molecule), Gene Registration Number (Genebank) NM_001785 (cytidine deaminase), Gene Registration Number (Genebank) NM_001964 (early growth response 1), Gene Registration Number (Genebank) NM_002061 (glutamate-cysteine ligase, modifier subunit), gene Genebank NM_002064 [glutaredoxin (thioltransferase)], Gene Registration Number (Genebank) NM_002115 [hexokinase 3 (white cell)], Gene Registration Number (Genebank) NM_002143 (hippocalcin), Gene Registration Number (Genebank) NM_002203 [integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)], Genebank NM_002224 (inositol 1,4,5-triphosphate receptor, type 3), Genebank NM_002276 (keratin 19), Genebank NM_002288 (leukocyte-associated immunoglobulin-like receptor 2), Genebank NM_002305 [lectin, galactoside-binding, soluble, 1 (galectin 1)], Genebank NM_002306 (lectin , galactoside-binding, soluble, 3), Genebank NM_002309 (leukemia inhibitory factor (cholinergic differentiation factor)], Genebank NM_002394 [solute carrier family 3 (activators of dibasic and neutral amino acid transport) , member 2], Genebank NM_002 571 [progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein)], Genebank NM_002576 [p21 / Cdc42 / Rac1-activated kinase 1 (STE20 homolog, yeast) )], Genebank NM_002607 (platelet-derived growth factor alpha polypeptide), Genebank (Genebank) NM_002648 (pim-1 oncogene), Genebank NM_002867 (RAB3B, member RAS oncogene family), Genebank (Genebank) NM_002899 (retinol binding protein 1, cellular), Genebank (Genebank) NM_002960 (S100 calcium binding protein A3), Genebank (Genebank) NM_002970 (spermidine / spermine N1-acetyltransferase 1), Gene registration Number (Genebank) NM_003107 [SRY (sex determining region Y) -box 4], Genebank NM_003122 (serine peptidase inhibitor, Kazal type 1), Genebank NM_003225 (trefoil factor 1), Gene registration Number (Genebank) NM_003254 (TIMP metall opeptidase inhibitor 1), Genebank NM_003255 (TIMP metallopeptidase inhibitor 2), Genebank NM_003311 (pleckstrin homology-like domain, family A, member 2), Genebank NM_003330 (thioredoxin reductase 1), Genebank NM_003407 [zinc finger protein 36, C3H type, homolog (mouse)], Genebank NM_003739 [aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)], Genebank NM_003887 (development and differentiation enhancing factor 2), Genebank NM_003897 (immediate early response 3), Genebank NM_003900 (sequestosome 1), Gene registration number (Genebank) NM_003937 [kynureninase (L-kynurenine hydrolase)], Genebank NM_003979 (G protein-coupled receptor, family C, group 5, member A), Genebank NM_004024 (activating transcription factor 3 ), Gene registration number (Genebank) NM_004073 [polo-like kinase 3 (Drosophila)], gene registration number (Genebank) NM_004083 (DNA-damage-inducible transcript 3), gene registration number (Genebank) NM_004177 (syntaxin 3), gene registration number (Genebank) NM_004417 (dual specificity phosphatase 1), Genebank NM_004418 (dual specificity phosphatase 2), Genebank NM_004723 [rho / rac guanine nucleotide exchange factor (GEF) 2], Genebank (Menebank) NM_004748 (cell cycle progression 1), Genebank NM_004751 [glucosaminyl (N-acetyl) transferase 3, mucin type], Genebank NM_004760 (serine / threonine kinase 17a), Genebank NM_004864 (growth differentiation factor 15), Genebank NM_004907 (immediate early response 2), Genebank NM_004925 [aquaporin 3 (Gill blood group)], Genebank NM_004926 (zinc finger protein 36 , C3H type-like 1), Gene Registration Number (Ge nebank) NM_005139 (annexin A3), Genebank NM_005228 {epidermal growth factor receptor [erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian]}, Genebank NM_005242 [coagulation factor II ( thrombin) receptor-like 1], Genebank NM_005261 (GTP binding protein overexpressed in skeletal muscle), Genebank NM_005415 [solute carrier family 20 (phosphate transporter), member 1], gene registration number ( Genebank) NM_005438 (FOS-like antigen 1), Genebank NM_005451 [PDZ and LIM domain 7 (enigma)], Genebank NM_005469 (acyl-CoA thioesterase 8), Genebank (Genebank) NM_005620 (S100 calcium binding protein A11), Genebank (Genebank) NM_005772 (RNA terminal phosphate cyclase-like 1), Gene accession number (Genebank) NM_005953 (metallothionein 2A), Gene registration number (Genebank) NM_005980 (S100 calcium binding protein P), Genebank NM_006091 (coronin, actin binding protein, 2B), genebank (Genebank) NM_006208 (ectonucleotide pyrophosphatase / phosphodiesterase 1), genebank (Genebank) NM_006216 (serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2], Genebank NM_006572 [guanine nucleotide binding protein (G protein), alpha 13], Genebank (Genebank) NM_006617 (nestin), Gene accession number (Genebank) NM_007039 (protein tyrosine phosphatase, non- receptor type 21), genebank NM_007333 (killer cell lectin-like receptor subfamily C, member 3), genebank NM_012250 [related RAS viral (r-ras) oncogene homolog 2], gene registry number Genebank NM_012258 (hairy / enhancer-of-split related with YRPW motif 1), Genebank NM_013246 (cardiotrophin-like cytokine factor 1), Genebank NM_013259 (transgelin 3), Gene registration number (Genebank) NM_014045 (low densi ty lipoprotein receptor-related protein 10), Genebank NM_014059 (chromosome 13 open reading frame 15), Genebank NM_014256 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 3), Genebank No. NM_014331 [solute carrier family 7, (cationic amino acid transporter, y + system) member 11], Genebank No. NM_014624 (S100 calcium binding protein A6), Genebank No. NM_014798 [pleckstrin homology domain containing, family M (with RUN domain) member 1], Genebank NM_015187 (KIAA0746 protein), Genebank NM_016009 (SH3-domain GRB2-like endophilin B1), Genebank ID (Genebank) ) NM_016081 (palladin, cytoskeletal associated protein), Genebank NM_016113 (transient receptor potential cation channel, subfamily V, member 2), Genebank NM_016548 (golgi phosphoprotein 2), Gene accession number (Genebank) NM_016639 (tumo r necrosis factor receptor superfamily, member 12A), genebank NM_017705 (progestin and adipoQ receptor family member V), genebank NM_018357 (La ribonucleoprotein domain family, member 6), genebank (Genebank) NM_018590 (chondroitin sulfate GalNAcT-2), Genebank (Genebank) NM_018639 (WD repeat and SOCS box-containing 2), Genebank (Genebank) NM_018689 (KIAA1199), Genebank (Genebank) NM_018842 (BAI1-associated protein 2-like 1), Genebank NM_018948 (ERBB receptor feedback inhibitor 1), Genebank NM_019096 (GTP binding protein 2), Genebank NM_020148 [spire homolog 1 (Drosophila)] , Gene Registration Number (Genebank) NM_020546 [adenylate cyclase 2 (brain)], Gene Registration Number (Genebank) NM_020870 (SH3 domain containing ring finger 1), Gene Registration Number (Genebank) NM_020962 (neighbor of Punc E11), Gene Registration Number (Genebank) NM_021103 (thymos in, beta 10), Genebank NM_021158 [tribbles homolog 3 (Drosophila)], Genebank NM_021913 (AXL receptor tyrosine kinase), Genebank NM_022153 (chromosome 10 open reading frame 54 ), Genebank NM_022818 (microtubule-associated protein 1 light chain 3 beta), Genebank NM_024847 (transmembrane channel-like 7), Genebank NM_025099 (chromosome 17 open reading frame 68 ), Genebank NM_025106 (splA / ryanodine receptor domain and SOCS box containing 1), Genebank NM_025130 (hexokinase domain containing 1), Genebank NM_025195 (tribbles homolog 1 (Drosophila) )], Genebank NM_030627 (cytoplasmic polyadenylation element binding protein 4), Genebank number (Genebank) NM_030674 (solute carrier family 38, member 1), Genebank NM_031286 (SH3 domain binding glutamic acid- ric h protein like 3), genebank (Genebank) NM_032466 (aspartate beta-hydroxylase), genebank (Genebank) NM_032525 (tubulin, beta 6), genebank (Genebank) NM_032717 (lung cancer metastasis-associated protein), Genebank No. NM_032892 (FERM domain containing 5), Genebank No. NM_033160 (zinc finger protein 658), Genebank No. NM_033260 (forkhead box Q1), Genebank No. NM_052871 (hypothetical protein MGC4677), genebank NM_078487 [cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)], genebank NM_080655 (chromosome 9 open reading frame 30), genebank NM_080725 [ sulfiredoxin 1 homolog (S. cerevisiae)], Genebank NM_080927 (discoidin, CUB and LCCL domain containing 2), Genebank NM_134421 (hippocalcin-like 1), Genebank NM_138961 (endothelial cell adhesion molecules), Genebank NM_144497 [A kinase (PRKA) anchor protein (gravin) 12], Genebank number (Genebank) NM_144652 (leucine zipper-EF-hand containing transmembrane protein 2), Genebank number NM_144778 [muscleblind -like 2 (Drosophila)], Genebank NM_145904 (high mobility group AT-hook 1), Genebank NM_147780 (cathepsin B), Genebank NM_153006 (N-acetylglutamate synthase) , Genebank NM_153020 (RNA binding motif protein 24), Genebank NM_153229 (transmembrane protein 92), Genebank NM_153608 (zinc finger protein 114), Genebank NM_170692 (RAS protein activator like 2), heredity Genebank NM_172210 [colony stimulating factor 1 (macrophage)], Genebank number (Genebank) NM_172364 (calcium channel, voltage-dependent, alpha 2 / delta subunit 4), Genebank number NM_175839 (spermine oxidase ), Genebank NM_178234 (tumor suppressor candidate 3), Genebank NM_178275 (eEF1A2 binding protein), Genebank NM_178859 (organic solute transporter beta), Genebank NM_181985 [leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5], Genebank NM_182485 (cytoplasmic polyadenylation element binding protein 2), Genebank NM_183373 (chromosome 6 open reading frame 145) , Genebank NM_198447 [golgi transport 1 homolog A (S. cerevisiae)], Genebank NM_198833 [serpin peptidase inhibitor, clade B (ovalbumin), member 8], Genebank NM_199330 [homer homolog 2 (Drosophila)], Genebank NM_201555 ( four and a half LIM domains 2), Genebank NM_203380 (acyl-CoA synthetase long-chain family member 5), Genebank NM_203391 (glycerol kinase), Genebank NM_203403 (chromosome 9 open reading frame 150), Genebank NR_002205 (ferritin, heavy polypeptide-like 12), Genebank NR_002802 (trophoblast-derived noncoding RNA), Genebank NR_002823 (aquaporin 7 pseudogene 2), Genebank NR_002834 (dual specificity phosphatase 5 pseudogene), Genebank XM_373277 (similar to microtubule-associated proteins 1A / 1B light chain 3), Genebank XM_932993 [Homo sapiens cDNA FLJ32255 fis, clone PROST 1000226. (AK056817)] and Genebank XR_000951 [Homo sapiens chromosome 14 open reading frame 128, mRNA (cDNA clone MGC: 15504 IMAGE: 2990071), complete cds. (BC007251)]. 제 1항에 있어서, 하기 유전자가 클로르덴에 대한 노출에 의하여 발현이 감소하는 것을 특징으로 하는 바이오마커:The biomarker of claim 1, wherein the expression of the following genes is reduced by exposure to chlordene: 유전자등록번호(Genebank) AF007149(hypothetical protein LOC257407), 유전자등록번호(Genebank) AF118092(predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), 유전자등록번호(Genebank) AF334184(Rac GTPase activating protein 1 pseudogene), 유전자등록번호(Genebank) AL832208(hypothetical protein FLJ32312), 유전자등록번호(Genebank) BC006267(asparaginase like 1), 유전자등록번호(Genebank) BC050292(MGC44478), 유전자등록번호(Genebank) BF591978[Apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) BX405503(Alpha-fetoprotein), 유전자등록번호(Genebank) CD608671(Fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000029[angiotensinogen (serpin peptidase inhibitor, clade A, member 8)], 유전자등록번호(Genebank) NM_000040(apolipoprotein C-III), 유전자등록번호(Genebank) NM_000042[apolipoprotein H (beta-2-glycoprotein I)], 유전자등록번호(Genebank) NM_000156(guanidinoacetate N-methyltransferase), 유전자등록번호(Genebank) NM_000166(gap junction protein, beta 1, 32kDa), 유전자등록번호(Genebank) NM_000204(complement factor I), 유전자등록번호(Genebank) NM_000253(microsomal triglyceride transfer protein), 유전자등록번호(Genebank) NM_000354[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], 유전자등록번호(Genebank) NM_000508(fibrinogen alpha chain), 유전자등록번호(Genebank) NM_000509(fibrinogen gamma chain), 유전자등록번호(Genebank) NM_000607(orosomucoid 1), 유전자등록번호(Genebank) NM_000608(orosomucoid 2), 유전자등록번호(Genebank) NM_000670[alcohol dehydrogenase 4 (class II), pi polypeptide], 유전자등록번호(Genebank) NM_000671[alcohol dehydrogenase 5 (class III), chi polypeptide], 유전자등록번호(Genebank) NM_000672[alcohol dehydrogenase 6 (class V)], 유전자등록번 호(Genebank) NM_000790[dopa decarboxylase (aromatic L-amino acid decarboxylase)], 유전자등록번호(Genebank) NM_000792(deiodinase, iodothyronine, type I), 유전자등록번호(Genebank) NM_000846(glutathione S-transferase A2), 유전자등록번호(Genebank) NM_000851(glutathione S-transferase M5), 유전자등록번호(Genebank) NM_000934[serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], 유전자등록번호(Genebank) NM_001005414[Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA (NM_001005414)], 유전자등록번호(Genebank) NM_001010845(hypothetical protein LOC123876), 유전자등록번호(Genebank) NM_001011554[solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], 유전자등록번호(Genebank) NM_001012271[baculoviral IAP repeat-containing 5 (survivin)], 유전자등록번호(Genebank) NM_001012716(chromosome 18 open reading frame 56), 유전자등록번호(Genebank) NM_001040152(paternally expressed 10), 유전자등록번호(Genebank) NM_001067[topoisomerase (DNA) II alpha 170kDa], 유전자등록번호(Genebank) NM_001071(thymidylate synthetase), 유전자등록번호(Genebank) NM_001134(alpha-fetoprotein), 유전자등록번호(Genebank) NM_001182(aldehyde dehydrogenase 7 family, member A1), 유전자등록번호(Genebank) NM_001237(cyclin A2), 유전자등록번호(Genebank) NM_001311[cysteine-rich protein 1 (intestinal)], 유전자등록번호(Genebank) NM_001443(fatty acid binding protein 1, liver), 유전자등록번 호(Genebank) NM_001739(carbonic anhydrase VA, mitochondrial), 유전자등록번호(Genebank) NM_001756[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], 유전자등록번호(Genebank) NM_001786(cell division cycle 2, G1 to S and G2 to M), 유전자등록번호(Genebank) NM_001789[cell division cycle 25 homolog A (S. pombe)], 유전자등록번호(Genebank) NM_001823(creatine kinase, brain), 유전자등록번호(Genebank) NM_001844[collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], 유전자등록번호(Genebank) NM_001872[carboxypeptidase B2 (plasma)], 유전자등록번호(Genebank) NM_001948(dUTP pyrophosphatase), 유전자등록번호(Genebank) NM_002129(high-mobility group box 2), 유전자등록번호(Genebank) NM_002388(minichromosome maintenance complex component 3), 유전자등록번호(Genebank) NM_002497[NIMA (never in mitosis gene a)-related kinase 2], 유전자등록번호(Genebank) NM_002592(proliferating cell nuclear antigen), 유전자등록번호(Genebank) NM_002614(PDZ domain containing 1), 유전자등록번호(Genebank) NM_002630[progastricsin (pepsinogen C)], 유전자등록번호(Genebank) NM_002729(hematopoietically expressed homeobox), 유전자등록번호(Genebank) NM_002758(mitogen-activated protein kinase kinase 6), 유전자등록번호(Genebank) NM_003258(thymidine kinase 1, soluble), 유전자등록번호(Genebank) NM_003542(histone cluster 1, H4c), 유전자등록번호(Genebank) NM_003579[RAD54- like (S. cerevisiae)], 유전자등록번호(Genebank) NM_003882(WNT1 inducible signaling pathway protein 1), 유전자등록번호(Genebank) NM_003944(selenium binding protein 1), 유전자등록번호(Genebank) NM_003981(protein regulator of cytokinesis 1), 유전자등록번호(Genebank) NM_004111(flap structure-specific endonuclease 1), 유전자등록번호(Genebank) NM_004169[serine hydroxymethyltransferase 1 (soluble)], 유전자등록번호(Genebank) NM_004265(fatty acid desaturase 2), 유전자등록번호(Genebank) NM_004336[BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], 유전자등록번호(Genebank) NM_004701(cyclin B2), 유전자등록번호(Genebank) NM_004772(chromosome 5 open reading frame 13), 유전자등록번호(Genebank) NM_004845(phosphate cytidylyltransferase 1, choline, beta), 유전자등록번호(Genebank) NM_005030[polo-like kinase 1 (Drosophila)], 유전자등록번호(Genebank) NM_005063[stearoyl-CoA desaturase (delta-9-desaturase)], 유전자등록번호(Genebank) NM_005123(nuclear receptor subfamily 1, group H, member 4), 유전자등록번호(Genebank) NM_005165(aldolase C, fructose-bisphosphate), 유전자등록번호(Genebank) NM_005327(hydroxyacyl-Coenzyme A dehydrogenase), 유전자등록번호(Genebank) NM_005502[ATP-binding cassette, sub-family A (ABC1), member 1], 유전자등록번호(Genebank) NM_005573(lamin B1), 유전자등록번호(Genebank) NM_005631[smoothened homolog (Drosophila)], 유전자등록번호(Genebank) NM_005733(kinesin family member 20A), 유전자등록번호(Genebank) NM_005915(minichromosome maintenance complex component 6), 유전자등록번호(Genebank) NM_005940[matrix metallopeptidase 11 (stromelysin 3)], 유전자등록번호(Genebank) NM_005989[aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)], 유전자등록번호(Genebank) NM_006101[NDC80 homolog, kinetochore complex component (S. cerevisiae)], 유전자등록번호(Genebank) NM_006113(vav 3 oncogene), 유전자등록번호(Genebank) NM_006215[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], 유전자등록번호(Genebank) NM_006398(ubiquitin D), 유전자등록번호(Genebank) NM_006444(structural maintenance of chromosomes 2), 유전자등록번호(Genebank) NM_006461(sperm associated antigen 5), 유전자등록번호(Genebank) NM_006472(thioredoxin interacting protein), 유전자등록번호(Genebank) NM_006498(lectin, galactoside-binding, soluble, 2), 유전자등록번호(Genebank) NM_006757[troponin T type 3 (skeletal, fast)], 유전자등록번호(Genebank) NM_006845(kinesin family member 2C), 유전자등록번호(Genebank) NM_006876(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1), 유전자등록번호(Genebank) NM_007111(transcription factor Dp-1), 유전자등록번호(Genebank) NM_007317(kinesin family member 22), 유전자등록번호(Genebank) NM_012068(activating transcription factor 5), 유전자등록번호(Genebank) NM_012484[hyaluronan-mediated motility receptor (RHAMM)], 유전자등록번호(Genebank) NM_013277(Rac GTPase activating protein 1), 유전자등록번 호(Genebank) NM_014176[ubiquitin-conjugating enzyme E2T (putative)], 유전자등록번호(Genebank) NM_014264[polo-like kinase 4 (Drosophila)], 유전자등록번호(Genebank) NM_014333(cell adhesion molecule 1), 유전자등록번호(Genebank) NM_014736(KIAA0101), 유전자등록번호(Genebank) NM_014762(24-dehydrocholesterol reductase), 유전자등록번호(Genebank) NM_014791(maternal embryonic leucine zipper kinase), 유전자등록번호(Genebank) NM_014858(transmembrane and coiled-coil domain family 2), 유전자등록번호(Genebank) NM_015533[dihydroxyacetone kinase 2 homolog (S. cerevisiae)], 유전자등록번호(Genebank) NM_016359(nucleolar and spindle associated protein 1), 유전자등록번호(Genebank) NM_016521(transcription factor Dp family, member 3), 유전자등록번호(Genebank) NM_017855(odontogenic, ameloblast asssociated), 유전자등록번호(Genebank) NM_018136[asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], 유전자등록번호(Genebank) NM_018154[ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], 유전자등록번호(Genebank) NM_018193(Fanconi anemia, complementation group I), 유전자등록번호(Genebank) NM_018410(hypothetical protein DKFZp762E1312), 유전자등록번호(Genebank) NM_018492(PDZ binding kinase), 유전자등록번호(Genebank) NM_018974[unc-93 homolog A (C. elegans)], 유전자등록번호(Genebank) NM_020062(SLC2A4 regulator), 유전자등록번호(Genebank) NM_020530(oncostatin M), 유전자등록번호(Genebank) NM_020918(glycerol-3-phosphate acyltransferase, mitochondrial), 유전자등록번호(Genebank) NM_020995(haptoglobin-related protein), 유전자등록번호(Genebank) NM_021069(sorbin and SH3 domain containing 2), 유전자등록번호(Genebank) NM_022346(non-SMC condensin I complex, subunit G), 유전자등록번호(Genebank) NM_024629(MLF1 interacting protein), 유전자등록번호(Genebank) NM_025149(hypothetical protein FLJ20920), 유전자등록번호(Genebank) NM_025225(patatin-like phospholipase domain containing 3), 유전자등록번호(Genebank) NM_030771(coiled-coil domain containing 34), 유전자등록번호(Genebank) NM_030932[diaphanous homolog 3 (Drosophila)], 유전자등록번호(Genebank) NM_031299(cell division cycle associated 3), 유전자등록번호(Genebank) NM_031942(cell division cycle associated 7), 유전자등록번호(Genebank) NM_031966(cyclin B1), 유전자등록번호(Genebank) NM_032023[Ras association (RalGDS/AF-6) domain family 4], 유전자등록번호(Genebank) NM_032564[diacylglycerol O-acyltransferase homolog 2 (mouse)], 유전자등록번호(Genebank) NM_032638(GATA binding protein 2), 유전자등록번호(Genebank) NM_032828(zinc finger protein 587), 유전자등록번호(Genebank) NM_052968(apolipoprotein A-V), 유전자등록번호(Genebank) NM_054113(calcium and integrin binding family member 3), 유전자등록번호(Genebank) NM_058186(family with sequence similarity 3, member B), 유전자등록번호(Genebank) NM_145740(glutathione S-transferase A1), 유전자등록번호(Genebank) NM_148957(tumor necrosis factor receptor superfamily, member 19), 유전자등록 번호(Genebank) NM_152308(chromosome 16 open reading frame 75), 유전자등록번호(Genebank) NM_152722(hepatocyte cell adhesion molecule), 유전자등록번호(Genebank) NM_153699(glutathione S-transferase A5), 유전자등록번호(Genebank) NM_172164[nuclear autoantigenic sperm protein (histone-binding)], 유전자등록번호(Genebank) NM_174936(proprotein convertase subtilisin/kexin type 9), 유전자등록번호(Genebank) NM_177550[solute carrier family 13 (sodium-dependent citrate transporter), member 5], 유전자등록번호(Genebank) NM_180991(solute carrier organic anion transporter family, member 4C1), 유전자등록번호(Genebank) NM_181712(ankyrin repeat domain 38), 유전자등록번호(Genebank) NM_182617(acyl-CoA synthetase medium-chain family member 2), 유전자등록번호(Genebank) NM_182908[dehydrogenase/reductase (SDR family) member 2], 유전자등록번호(Genebank) NM_198433(aurora kinase A), 유전자등록번호(Genebank) NM_201523(kinesin light chain 4), 유전자등록번호(Genebank) NM_203401(stathmin 1/oncoprotein 18), 유전자등록번호(Genebank) NM_207418(family with sequence similarity 72, member A), 유전자등록번호(Genebank) NR_002932(glutathione S-transferase M1 pseudogene), 유전자등록번호(Genebank) XM_940101[serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] 및 유전자등록번호(Genebank) XM_944838(hypothetical protein LOC285733).Genebank AF007149 (hypothetical protein LOC257407), Genebank AF118092 (predicted protein of HQ2061; Homo sapiens PRO2061 mRNA, complete cds.), Genebank AF334184 (Rac GTPase activating protein 1 pseudogene ), Genebank AL832208 (hypothetical protein FLJ32312), Genebank (Genebank) BC006267 (asparaginase like 1), Genebank (Genebank) BC050292 (MGC44478), Genebank (Genebank) BF591978 [Apolipoprotein H ( beta-2-glycoprotein I)], genebank (Genebank) BX405503 (alpha-fetoprotein), genebank (Genebank) CD608671 (Fibrinogen alpha chain), genebank (Genebank) NM_000029 [angiotensinogen (serpin peptidase inhibitor, clade) A, member 8)], Genebank NM_000040 (apolipoprotein C-III), Genebank NM_000042 [apolipoprotein H (beta-2-glycoprotein I)], Genebank NM_000156 (guanidinoacetate N-methyltr ansferase), Genebank NM_000166 (gap junction protein, beta 1, 32kDa), Genebank (Genebank) NM_000204 (complement factor I), Genebank NM_000253 (microsomal triglyceride transfer protein), Gene registration Number (Genebank) NM_000354 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7], gene registration number (Genebank) NM_000508 (fibrinogen alpha chain), gene registration number (Genebank) NM_000509 (fibrinogen gamma chain) , Gene Registration Number (Genebank) NM_000607 (orosomucoid 1), Gene Registration Number (Genebank) NM_000608 (orosomucoid 2), Gene Registration Number (Genebank) NM_000670 [alcohol dehydrogenase 4 (class II), pi polypeptide], Gene Registration Number (Genebank) NM_000671 [alcohol dehydrogenase 5 (class III), chi polypeptide], Genebank NM_000672 [alcohol dehydrogenase 6 (class V)], Genebank NM_000790 [dopa decarboxylase (aromatic L-amino acid decarboxylase )], gene Genebank NM_000792 (deiodinase, iodothyronine, type I), Genebank NG_000846 (glutathione S-transferase A2), Genebank NM_000851 (glutathione S-transferase M5), Gene Registration Number (Genebank) ) NM_000934 [serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2], Genebank NM_001005414 [Homo sapiens ZW10 interactor (ZWINT), transcript variant 4, mRNA (NM_001005414)] , Genebank NM_001010845 (hypothetical protein LOC123876), Genebank NM_001011554 [solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3], Genebank NM_001012271 [baculoviral IAP repeat- containing 5 (survivin)], Genebank NM_001012716 (chromosome 18 open reading frame 56), Genebank NM_001040152 (paternally expressed 10), Genebank NM_001067 [topoisomerase (D NA) II alpha 170kDa], Genebank NM_001071 (thymidylate synthetase), Genebank NM_001134 (alpha-fetoprotein), Genebank NM_001182 (aldehyde dehydrogenase 7 family, member A1), Gene Genebank NM_001237 (cyclin A2), Genebank NM_001311 [cysteine-rich protein 1 (intestinal)], Genebank NM_001443 (fatty acid binding protein 1, liver), gene registration number (Genebank) NM_001739 (carbonic anhydrase VA, mitochondrial), Genebank NM_001756 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6], Genebank NM_001786 (cell division cycle 2, G1 to S and G2 to M), Genebank NM_001789 [cell division cycle 25 homolog A (S. pombe), Genebank NM_001823 (creatine kinase, brain), Genebank NM_001844 [collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)], Genebank (Genebank) NM_001872 [carboxypeptidase B2 (plasma)], genebank (Genebank) NM_001948 (dUTP pyrophosphatase), genebank (Genebank) NM_002129 (high-mobility group box 2), genebank (Genebank) NM_002388 (minichromosome maintenance complex component 3 ), Genebank NM_002497 [NIMA (never in mitosis gene a) -related kinase 2], Genebank NM_002592 (proliferating cell nuclear antigen), Genebank NM_002614 (PDZ domain containing 1 ), Genebank NM_002630 [progastricsin (pepsinogen C)], Genebank NM_002729 (hematopoietically expressed homeobox), Genebank NM_002758 (mitogen-activated protein kinase kinase 6), heredity Genebank NM_003258 (thymidine kinase 1, soluble), Genebank NM_003542 (histone cluster 1, H4c), Genebank NM_003579 [RAD54-like (S. cerevisiae)], Gene Registration Number (Genebank) NM_003882 (WNT1 inducible signaling pathway protein 1), Genebank NM_003944 (selenium binding protein 1), Genebank NM_003981 (protein regulator of cytokinesis 1), Genebank NM_004111 ( flap structure-specific endonuclease 1), Genebank NM_004169 [serine hydroxymethyltransferase 1 (soluble)], Genebank NM_004265 (fatty acid desaturase 2), Genebank NM_004336 [BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast)], Genebank NM_004701 (cyclin B2), Genebank NM_004772 (chromosome 5 open reading frame 13), Genebank NM_004845 (phosphate cytidylyltransferase 1, choline , beta), Genebank NM_005030 [polo-like kinase 1 (Drosophila)], Genebank NM_005063 [stearoyl-CoA desaturase (delta-9-desaturase)], Genebank NM_005123 (nuclear receptor subfamily 1, group H, member 4), genebank (Genebank) NM_005165 (aldolase C, fructose-bisphosphate), genebank (Genebank) NM_005327 (hydroxyacyl-Coenzyme A dehydrogenase), genebank (Genebank) NM_005502 [ATP-binding cassette, sub-family A (ABC1), member 1], gene registration number (Genebank) NM_005573 (lamin B1), gene registration number (Genebank) NM_005631 [smoothened homolog (Drosophila)], gene registration number ( Genebank) NM_005733 (kinesin family member 20A), Genebank NM_005915 (minichromosome maintenance complex component 6), Genebank NM_005940 [matrix metallopeptidase 11 (stromelysin 3)], Genebank NM_005989 [ aldo-keto reductase family 1, member D1 (delta 4-3-ketoster oid-5-beta-reductase)], Genebank NM_006101 [NDC80 homolog, kinetochore complex component (S. cerevisiae)], Genebank NM_006113 (vav 3 oncogene), Genebank Number (Genebank) NM_006215 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4], Genebank (Genebank) NM_006398 (ubiquitin D), Genebank NM_006444 (structural maintenance of chromosomes 2), Genebank NM_006461 (sperm associated antigen 5), Genebank NM_006472 (thioredoxin interacting protein), Gene registration (Genebank) NM_006498 (lectin, galactoside-binding, soluble, 2), Genebank NM_006757 [troponin T type 3 (skeletal, fast)], Genebank NM_006845 (kinesin family member 2C), Genebank NM_006876 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 1), Genebank NM_007111 (transcription factor Dp-1), Genebank NM_007317 (kinesin family member 22), Genebank NM_ 012068 (activating transcription factor 5), Genebank NM_012484 (hyaluronan-mediated motility receptor (RHAMM)], Genebank NM_013277 (Rac GTPase activating protein 1), Genebank NM_014176 [ ubiquitin-conjugating enzyme E2T (putative)], Genebank NM_014264 [polo-like kinase 4 (Drosophila)], Genebank NM_014333 (cell adhesion molecule 1), Genebank NM_014736 ( KIAA0101), Genebank NM_014762 (24-dehydrocholesterol reductase), Genebank NM_014791 (maternal embryonic leucine zipper kinase), Genebank NM_014858 (transmembrane and coiled-coil domain family 2), Genebank NM_015533 [dihydroxyacetone kinase 2 homolog (S. cerevisiae)], Genebank NM_016359 (nucleolar and spindle associated protein 1), Genebank NM_016521 (transcription factor Dp family, member 3), Genebank NM_017855 (odontogenic, ameloblast associated) , Genebank NM_018136 [asp (abnormal spindle) homolog, microcephaly associated (Drosophila)], Genebank NM_018154 [ASF1 anti-silencing function 1 homolog B (S. cerevisiae)], gene registration number ( Genebank) NM_018193 (Fanconi anemia, complementation group I), Genebank NM_018410 (hypothetical protein DKFZp762E1312), Genebank NM_018492 (PDZ binding kinase), Genebank NM_018974 [unc-93 homolog A (C. elegans)], Genebank NM_020062 (SLC2A4 regulator), Genebank Number (Genebank) NM_020530 (oncostatin M), Genebank Number (Genebank) NM_020918 (glycerol-3-phosphate acyltransferase, mitochondrial), U Genebank NM_020995 (haptoglobin-related protein), Genebank NM_021069 (sorbin and SH3 domain containing 2), Genebank NM_022346 (non-SMC condensin I complex, subunit G), gene Genebank NM_024629 (MLF1 interacting protein), Genebank NM_025149 (hypothetical protein FLJ20920), Genebank NM_025225 (patatin-like phospholipase domain containing 3), Genebank NM_030771 ( coiled-coil domain containing 34), Genebank NM_030932 (diaphanous homolog 3 (Drosophila)], Genebank NM_031299 (cell division cycle associated 3), Genebank NM_031942 (cell division cycle associated 7), Genebank NM_031966 (cyclin B1), Genebank NM_032023 [Ras association (RalGDS / AF-6) domain family 4], Genebank NM_032564 [diacylglycerol O-acyltransferase homolog 2 (mouse)], Genebank NM_032638 (GATA binding protein 2), Genebank NM_032828 (zinc finger protein 587), Genebank NM_052968 (apolipoprotein AV), Genebank (Genebank) NM_054113 (calcium and integrin binding family member 3), Genebank NM_058186 (family with sequence similarity 3, member B), Genebank NM_145740 (glutathione S-transferase A1), Gene accession number (Genebank) ) NM_148957 (tumor necrosis factor receptor superfamily, member 19), Genebank NM_152308 (chromosome 16 open reading frame 75), Genebank NM_152722 (hepatocyte cell adhesion molecule), Genebank NM_153699 (glutathione S-transferase A5), Genebank NM_172164 [nuclear autoantigenic sperm protein (histone-binding)], Genebank NM_174936 (proprotein convertase subtilisin / kexin type 9), Gene registration number (G enebank) NM_177550 [solute carrier family 13 (sodium-dependent citrate transporter), member 5], gene registration number (Genebank) NM_180991 (solute carrier organic anion transporter family, member 4C1), gene registration number (Genebank) NM_181712 (ankyrin repeat domain 38), gene registration number (Genebank) NM_182617 (acyl-CoA synthetase medium-chain family member 2), gene registration number (Genebank) NM_182908 [dehydrogenase / reductase (SDR family) member 2], gene registration number (Genebank) NM_198433 ( aurora kinase A), Genebank NM_201523 (kinesin light chain 4), Genebank NM_203401 (stathmin 1 / oncoprotein 18), Genebank NM_207418 (family with sequence similarity 72, member A ), Genebank NR_002932 (glutathione S-transferase M1 pseudogene), Genebank (Genebank) XM_940101 [serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11] and Genebank (Genebank) ) XM_944838 (hypoth etical protein LOC285733). 제 1항의 바이오마커로부터 선택된, 어느 하나 이상의 유전자의 핵산서열의 전부; 또는 상기 유전자의 단편인 올리고뉴클레오티드; 또는 그의 상보가닥 분자가 집적된, 클로르덴에 대한 노출 여부 확인용 마이크로어레이 칩.All of the nucleic acid sequences of any one or more genes selected from the biomarkers of claim 1; Or an oligonucleotide that is a fragment of the gene; Or a microarray chip for confirming exposure to chlorden having its complementary strand molecules integrated therein. 제 4항에 있어서, 상기 올리고뉴클레오티드; 또는 이의 상보가닥 분자는 상기 바이오마커의 15 내지 50개의 핵산을 포함하는 것을 특징으로 하는 마이크로어레이 칩.The method of claim 4, wherein the oligonucleotide; Or a complementary strand molecule thereof, comprising 15 to 50 nucleic acids of the biomarker. 제 5항에 있어서, 상기 올리고뉴클레오티드; 또는 이의 상보가닥 분자는 상기 바이오마커의 15 내지 30개의 핵산을 포함하는 것을 특징으로 하는 마이크로어레이 칩.The method of claim 5, wherein the oligonucleotide; Or a complementary strand thereof, wherein the microarray chip comprises 15 to 30 nucleic acids of the biomarker. 클로르덴에 대한 노출이 의심되는 개체(실험군) 및 대조군의 체세포로부터 분리된 RNA 시료로부터From RNA samples isolated from somatic cells of subjects (experimental group) and control groups suspected of exposure to chlordene 1) cDNA로 합성하면서 실험군과 대조군을 각기 다른 형광물질로 표지하는 단계;1) labeling the experimental and control groups with different fluorescent materials while synthesizing with cDNA; 2) 단계 1)의 각기 다른 형광물질로 표지된 cDNA를 제 4항의 DNA 마이크로어레이 칩과 혼성화시키는 단계;2) hybridizing cDNA labeled with different fluorescent materials of step 1) with the DNA microarray chip of claim 4; 3) 단계 2)의 반응한 DNA 마이크로어레이 칩을 분석하는 단계; 및3) analyzing the reacted DNA microarray chip of step 2); And 4) 단계 3)의 분석한 데이터에서 상기 DNA 마이크로어레이 칩 상의 유전자의 발현 정도를 대조군과 비교하는 단계를 포함하는, 클로르덴에 대한 노출 여부를 확인하기 위해 상기 바이오마커를 검출하는 방법.4) comparing the expression level of the gene on the DNA microarray chip with the control in the analyzed data of step 3), the method of detecting the biomarker to confirm the exposure to chlorden. 제 7항에 있어서, 상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 방법.8. The method of claim 7, wherein said somatic cells are liver or cells derived from liver cancer cells and tissues. 제 7항에 있어서, 단계 2)의 형광물질은 Cy3, Cy5, FITC(poly L-lysine-fluorescein isothiocyanate), RITC(rhodamine-B-isothiocyanate) 및 로다민(rhodamine)으로 이루어진 군으로부터 선택하여 사용하는 것을 특징으로 하는 방법.The method of claim 7, wherein the fluorescent material of step 2) is selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine) Characterized in that the method. 클로르덴에 대한 노출이 의심되는 개체(실험군) 및 대조군의 체세포로부터 분리된 RNA 시료로부터From RNA samples isolated from somatic cells of subjects (experimental group) and control groups suspected of exposure to chlordene 1) 상기 분리된 RNA를 대상으로, 제 1항의 바이오마커 유전자에 상보적이고 바이오마커 유전자를 증폭할 수 있는 프라이머 쌍을 사용하여 실시간 RT-PCR(Real-time reverse transcript polymerase chain reaction)을 수행하는 단계; 및1) performing real-time reverse transcript polymerase chain reaction (RT-PCR) on the isolated RNA using a pair of primers complementary to the biomarker gene of claim 1 and capable of amplifying the biomarker gene ; And 2) 단계 1)의 유전자 산물의 양을 대조군과 비교하는 단계를 포함하는, 클로르덴에 대한 노출 여부를 확인하기 위해 상기 바이오마커를 검출하는 방법.2) detecting the biomarker to confirm exposure to chlorden, comprising comparing the amount of the gene product of step 1) to a control. 제 10항에 있어서, 상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 방법.The method of claim 10, wherein the somatic cells are liver or cells derived from liver cancer cells and tissues. 제 10항에 있어서, 단계 1)의 프라이머 쌍은 바이오마커 유전자의 증폭 산물이 100 내지 300 bp가 되도록 설계된 15 내지 50머 길이의 정방향 및 역방향 프라이머 쌍인 것을 특징으로 하는 방법.11. The method of claim 10, wherein the primer pair of step 1) is a 15-50mer long forward and reverse primer pair designed to have an amplification product of the biomarker gene of 100-300 bp. 제 12항에 있어서, 프라이머 쌍은 15 내지 30머 길이의 정방향 및 역방향 프라이머 쌍인 것을 특징으로 하는 방법.13. The method of claim 12, wherein the primer pairs are forward and reverse primer pairs of 15 to 30mers in length. 제 4항의 마이크로어레이 칩을 포함하는, 클로르덴에 대한 노출 여부 진단용 키트.A kit for diagnosing exposure to chlorden, comprising the microarray chip of claim 4. 제 14항에 있어서, 추가적으로 인간 체세포를 포함하는 것을 특징으로 하는 키트.The kit of claim 14 further comprising human somatic cells. 제 15항에 있어서, 상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 키트.The kit of claim 15, wherein the somatic cells are cells derived from liver or liver cancer cells and tissues. 제 16항에 있어서, 상기 간암 세포는 HepG2인 것을 특징으로 하는 키트.The kit of claim 16, wherein the liver cancer cells are HepG2. 제 1항의 바이오마커 유전자에 상보적이고, 상기 바이오마커 유전자를 증폭할 수 있는 프라이머 쌍을 포함하는, 클로르덴에 대한 노출 여부 진단용 키트.Claim 1 complementary to the biomarker gene, comprising a primer pair capable of amplifying the biomarker gene, kit for diagnosing exposure to chlorden. 제 18항에 있어서, 상기 프라이머 쌍은 바이오마커 유전자의 증폭 산물이 100 내지 300 bp가 되도록 설계된 15 내지 50머 길이의 정방향 및 역방향 프라이머 쌍인 것을 특징으로 하는 키트.19. The kit of claim 18, wherein the primer pairs are 15-50mer long forward and reverse primer pairs designed to have an amplification product of the biomarker gene of 100-300 bp. 제 19항에 있어서, 프라이머 쌍은 15 내지 30머 길이의 정방향 및 역방향 프라이머 쌍인 것을 특징으로 하는 방법.20. The method of claim 19, wherein the primer pairs are forward and reverse primer pairs of 15 to 30mers in length. 제 18항에 있어서, 상기 프라이머 쌍은 하기 프라이머 쌍 1 내지 16으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 키트:19. The kit of claim 18, wherein the primer pair is selected from the group consisting of the following primer pairs 1-16: 프라이머 쌍 1: 서열번호 1로 기재되는 정방향 프라이머 및 서열번호 2로 기재되는 역방향 프라이머;Primer pair 1: forward primer set forth in SEQ ID NO: 1 and reverse primer set forth in SEQ ID NO: 2; 프라이머 쌍 2: 서열번호 3으로 기재되는 정방향 프라이머 및 서열번호 4로 기재되는 역방향 프라이머;Primer pair 2: forward primer set forth in SEQ ID NO: 3 and reverse primer set forth in SEQ ID NO: 4; 프라이머 쌍 3: 서열번호 5로 기재되는 정방향 프라이머 및 서열번호 6으로 기재되는 역방향 프라이머;Primer pair 3: forward primer set forth in SEQ ID NO: 5 and reverse primer set forth in SEQ ID NO: 6; 프라이머 쌍 4: 서열번호 7로 기재되는 정방향 프라이머 및 서열번호 8로 기재되는 역방향 프라이머;Primer pair 4: forward primer set forth in SEQ ID NO: 7 and reverse primer set forth in SEQ ID NO: 8; 프라이머 쌍 5: 서열번호 9로 기재되는 정방향 프라이머 및 서열번호 10으로 기재되는 역방향 프라이머;Primer pair 5: forward primer set forth in SEQ ID NO: 9 and reverse primer set forth in SEQ ID NO: 10; 프라이머 쌍 6: 서열번호 11로 기재되는 정방향 프라이머 및 서열번호 12로 기재되는 역방향 프라이머;Primer pair 6: forward primer set forth in SEQ ID NO: 11 and reverse primer set forth in SEQ ID NO: 12; 프라이머 쌍 7: 서열번호 13으로 기재되는 정방향 프라이머 및 서열번호 14로 기재되는 역방향 프라이머;Primer pair 7: forward primer set forth in SEQ ID NO: 13 and reverse primer set forth in SEQ ID NO: 14; 프라이머 쌍 8: 서열번호 15로 기재되는 정방향 프라이머 및 서열번호 16으로 기재되는 역방향 프라이머;Primer pair 8: forward primer set forth in SEQ ID NO: 15 and reverse primer set forth in SEQ ID NO: 16; 프라이머 쌍 9: 서열번호 17로 기재되는 정방향 프라이머 및 서열번호 18로 기재되는 역방향 프라이머;Primer pair 9: forward primer set forth in SEQ ID NO: 17 and reverse primer set forth in SEQ ID NO: 18; 프라이머 쌍 10: 서열번호 19로 기재되는 정방향 프라이머 및 서열번호 20으로 기재되는 역방향 프라이머;Primer pair 10: forward primer set forth in SEQ ID NO: 19 and reverse primer set forth in SEQ ID NO: 20; 프라이머 쌍 11: 서열번호 21로 기재되는 정방향 프라이머 및 서열번호 22로 기재되는 역방향 프라이머;Primer pair 11: forward primer as depicted in SEQ ID NO: 21 and reverse primer as depicted in SEQ ID NO: 22; 프라이머 쌍 12: 서열번호 23으로 기재되는 정방향 프라이머 및 서열번호 24로 기재되는 역방향 프라이머;Primer pair 12: forward primer set forth in SEQ ID NO: 23 and reverse primer set forth in SEQ ID NO: 24; 프라이머 쌍 13: 서열번호 25로 기재되는 정방향 프라이머 및 서열번호 26으로 기재되는 역방향 프라이머;Primer pair 13: forward primer set forth in SEQ ID NO: 25 and reverse primer set forth in SEQ ID NO: 26; 프라이머 쌍 14: 서열번호 27로 기재되는 정방향 프라이머 및 서열번호 28로 기재되는 역방향 프라이머;Primer pair 14: forward primer set forth in SEQ ID NO: 27 and reverse primer set forth in SEQ ID NO: 28; 프라이머 쌍 15: 서열번호 29로 기재되는 정방향 프라이머 및 서열번호 30으로 기재되는 역방향 프라이머; 및,Primer pair 15: forward primer set forth in SEQ ID NO: 29 and reverse primer set forth in SEQ ID NO: 30; And, 프라이머 쌍 16: 서열번호 31로 기재되는 정방향 프라이머 및 서열번호 32로 기재되는 역방향 프라이머.Primer pair 16: Forward primer set forth in SEQ ID NO: 31 and reverse primer set forth in SEQ ID NO: 32. 제 18항에 있어서, 추가적으로 인간 체세포를 포함하는 것을 특징으로 하는 키트.19. The kit of claim 18, further comprising human somatic cells. 제 22항에 있어서, 상기 체세포는 간, 또는 간암 세포 및 조직에서 유래한 세포인 것을 특징으로 하는 키트.23. The kit of claim 22, wherein said somatic cells are cells derived from liver or liver cancer cells and tissues. 제 23항에 있어서, 상기 간암 세포는 HepG2인 것을 특징으로 하는 키트.The kit of claim 23, wherein the liver cancer cells are HepG2.
KR1020090016326A 2009-02-26 2009-02-26 Biomarker for identification of exposure to chlordane and the method of identification using thereof KR101018788B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020090016326A KR101018788B1 (en) 2009-02-26 2009-02-26 Biomarker for identification of exposure to chlordane and the method of identification using thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020090016326A KR101018788B1 (en) 2009-02-26 2009-02-26 Biomarker for identification of exposure to chlordane and the method of identification using thereof

Publications (2)

Publication Number Publication Date
KR20100097405A KR20100097405A (en) 2010-09-03
KR101018788B1 true KR101018788B1 (en) 2011-03-03

Family

ID=43004625

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020090016326A KR101018788B1 (en) 2009-02-26 2009-02-26 Biomarker for identification of exposure to chlordane and the method of identification using thereof

Country Status (1)

Country Link
KR (1) KR101018788B1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3233115B1 (en) * 2014-12-19 2021-02-17 Children's Hospital Medical Center Methods and compositions related to transplant-associated thrombotic microangiopathy
CN109444103B (en) * 2018-12-18 2021-09-28 咸阳师范学院 Preparation method of PEI functionalized green fluorescent carbon dots and thrombin detection method based on carbon dots

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100943525B1 (en) 2005-03-18 2010-02-22 (주)지노믹트리 System for Biomarker Screening

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100943525B1 (en) 2005-03-18 2010-02-22 (주)지노믹트리 System for Biomarker Screening

Also Published As

Publication number Publication date
KR20100097405A (en) 2010-09-03

Similar Documents

Publication Publication Date Title
KR101579934B1 (en) Prognosis prediction for colorectal cancer
KR100985090B1 (en) Biomarker for identification of exposure to chrysene and the method of identification using thereof
Chan et al. Discovery of biomarkers of endometrial receptivity through a minimally invasive approach: a validation study with implications for assisted reproduction
KR101008385B1 (en) Biomarker for identification of exposure to Polycyclic Aromatic Hydrocarbons and the method of identification using thereof
US20110190156A1 (en) Molecular signatures for diagnosing scleroderma
KR100994996B1 (en) Biomarkers for identification of exposure to phenanthrene and the method of identification using the same
KR101109739B1 (en) Markers for detecting overproduction of melanin and use thereof
KR20110053612A (en) Marker genes for screening of drug-induced toxicity in human cells and screening method using the same
KR100968762B1 (en) Biomarker for identification of exposure to naphthalene and the method of identification using thereof
KR101018788B1 (en) Biomarker for identification of exposure to chlordane and the method of identification using thereof
KR100967546B1 (en) Biomarker for identification of exposure to benzo[a]anthracene and the method of identification using thereof
Hiyama et al. Differential gene expression profiles between neuroblastomas with high telomerase activity and low telomerase activity
KR100961487B1 (en) Biomarker for identification of exposure to dibenzo?a, h?anthracene and the method of identification using thereof
KR100957055B1 (en) Biomarker for identification of exposure to Trichloroethylene and the method of identification using thereof
KR101017060B1 (en) Biomarker for identification of exposure to toxaphene and the method of identification using thereof
KR101749566B1 (en) Biomarker for identification of genes related to inflammatory response after exposure to diesel exhaust particle and the method of identification using thesame
Song et al. Gene expression analysis identifies potential biomarkers of phenanthrene in human hepatocytes (HepG2)
KR100958545B1 (en) Biomarker for identification of exposure to benzo[k]fluoranthene and the method of identification using thereof
KR100936286B1 (en) Marker genes based on Amiodarone treatment for screening of drug inducing pulmonary toxicity and screening method using thereof
KR100915898B1 (en) Biomarker for diagonosis of exposure to 3-methylcholanthrene and the method of diagonosis using thereof
KR101108694B1 (en) A Biomarker based on methotrexate treatment for screening of drug inducing teratogenicity and screening method using thereof
KR101011155B1 (en) Marker genes based on amiodarone and carbamazepine treatment for screening of drug inducing pulmonary toxicity and screening method using the same
KR101386075B1 (en) Biomarkers for identification of exposure to Hexachlorobenzene and the method of identification using thereof
KR100978791B1 (en) Biomarker for identification of exposure to dichloromethane and the method of identification using thereof
KR20090019501A (en) Marker genes based on carbamazepine treatment for screening of drug inducing pulmonary toxicity and screening method using thereof

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20140128

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20150205

Year of fee payment: 5

LAPS Lapse due to unpaid annual fee