KR20100005366A - A biomarker based on methotrexate treatment for screening of drug inducing teratogenicity and screening method using thereof - Google Patents

Abstract

PURPOSE: A biomarker for screening teratogenicity-inducing chemical is provided to increase or decrease gene expression by methotrexate treatment and monitor chemical. CONSTITUTION: A gene expression of biomarker for screening teratogenicity-inducing chemical is increased or decreased by treating with a drug. The drug is methotrexate. A DNA microarray chip for screening the chemical comprises oligonucleotide containing whole or partial biomarker gene or its complementary oligonucleotide. A method for screening the chemical comprises: a step of treating test compound to human placenta-derived cells; a step of isolating RNA from the compound-treated experimental group and control group; a step of synthesizing cDNA and labeling the experimental group and control group with different color fluorescence; a step of hybridizing cDNA with DNA microarray chip; a step of analyzing DNA microarray chip; and a step of comparing experimental group with the control group.

Description

Biomarker based on methotrexate treatment for screening of drug inducing teratogenicity and screening method using according to methotrexate treatment

The present invention relates to a biomarker for searching for teratogenic drugs and a search method using the same. More specifically, a biomarker for increasing or decreasing gene expression by methotrexate, a teratogenic drug, and a method for searching for a teratogenic drug using the same It is about.

Methotrexate (MTX) was first used clinically in 1948. Recently, it is used as a treatment for many kinds of cancer or rheumatoid arthritis, or psoriasis. And in the case of ectopic pregnancy is also used as a very medically effective and safe material for artificial abortion. However, continuous high intake of this substance is highly toxic to many organs, including the uterus. Here, high concentration means 200 mg / ~ 30 g / (body area) when the continuous intake of more than 24 hours interval (maintain more than 24 hours interval).

In particular, recent studies have shown that fetal malformations due to folic acid deficiency occur when the ingestion of this substance occurs in the early stages of pregnancy. Therefore, the role of folic acid is important in the first trimester of pregnancy. Taking 4 mg of folic acid daily for 12 weeks can reduce the risk of NTD by 72%. Folic acid is an active form of a vitamin that is reduced to tetrahydrofolic acid (THFA) by an enzyme called Dihydrofolate reductase (DHFR). Therefore, this process is essential for fetal DNA synthesis and cell replication. However, methotrexate inhibits this mechanism because it is an analogue that competes with folic acid. In other words, due to the inhibition of purine synthesis and pyrimidine synthesis, precursor nucleotides are not produced, and thus, DNA synthesis, RNA synthesis, and protein synthesis are inhibited. In addition, the mechanism may be inhibited by polyglutamation of methotrexate. This also affects the DHFR described above, but directly inhibits the synthesis of purines and pyrimidines. In the case of pyrimidine synthesis, it is inhibited by the partial lack of pyrimidine substrate, while purine synthesis is first called 5-phosphoribosyl-1-pyrophosphate (PPRP). It inhibits the process of becoming 5-phosphoribosylate. Second, the polyglutamation of an enzyme called 5-amino-imidazole-4-carboxamide ribonucleotide transformylase (AICAR) was performed during purine synthesis. Activity is reduced by MTX. Thus, this process strongly blocks the synthesis of Inosine monophosphate (IMP), a precursor of ATP and GTP. The third and final process occurs inside DNA, where 2'-deoxyuridine 5'-monophosphate (dUMP) is converted into deoxythymidine triphosphate (dTTP). It hinders the process. Therefore, even if UMP is synthesized during pyrimidine synthesis, the process of becoming dNTP is inhibited.

Methotrexate inhibits the synthesis of polyamines in addition to inhibiting DNA synthesis. S-adenosyl-methionine (SAM), which is important in the synthesis of polyamines, requires Methionine, which inhibits the conversion of homocysteine to methionine. Therefore, high concentration of methotrexate inhibits the synthesis of polyamines and acts as a cause of rheumatoid arthritis (RA) or inflammation. At low concentrations they are all cure for these diseases, but at high concentrations they have the opposite effect.

Methotrexate is not only a human embryo (Wilson et al., Teratology , 15: 73-80, 1977; Warkany, Teratology 17 (3): 353-357, 1978), cat (Khera, Teratology) 14: 21-28, 1976), monkey (Wilson, Teratology 9: 159-64, 1974), rabbit (Jordanet et al., Teratology , 15: 73-80, 1977) Rat (Jordan et al., Teratology , 15: 73-80, 1977; Woo et al., Teratology 17 (1): 37-41, 1978) and Mouse (Skalko and Gold, Teratology , 9: 159-164, 1974; Darab et al., Teratology 36: 77-86, 1987) also reported teratogenicity in embryos. In addition to the above, methotrexate also affects the skeletal structure of tissues. For example, partial or complete stiffening of the bones of the fetus or symptoms such as micromandibular fever, cleft palate, monolimb, slitosis and curved legs. In addition to early pregnancy, the effects of methotrexate have been reported at the end of pregnancy. Exposure to 42 mg of methotrexate between 37 and 38 weeks of gestation causes the child to develop pneumonia after birth. In addition, if exposed to the ninth month of pregnancy, growth retardation, the development of emotion or intelligence is delayed, and functional abnormalities are seen in the fetus.

Several genome sequencing projects, including six mammals and 292 microbes, have been completed and reported to the National Center for Biotechnology Information (NCBI). Genome-wide expression studies are being conducted to study the function of genes based on the vast amount of data obtained. DNA microarray analysis is performed to analyze the expression of thousands of genes in one experiment (Schena, M., et. al ., Proc . Natl . Acad . Sci . USA 93: 10614-10619, 1996).

Microarrays integrate a set of oligonucleotides of complementary DNA (cDNA) or 20-25 base pairs in length on glass. cDNA microarrays are produced by labs in schools or by companies such as Agilent and Genomic Solutions, either mechanically immobilizing cDNA collections on a chip or by using ink jetting (Sellheyer, K and Belbin, TJ, J. Am). . Acad Dermatol 51:.. 681-692 , 2004). Oligonucleotide microarrays are made by Affymetrix using a photolithography method directly on the chip, and Agillent, etc. are produced by immobilizing synthesized oligonucleotides (Sellheyer, K. and Belbin). , TJ, J. Am . Acad . Dermatol . 51: 681-692, 2004).

To analyze gene expression, RNA is obtained from samples such as tissues and hybridized with oligonucleotides in DNA microarrays. The obtained RNA is labeled with fluorescence or isotope and converted to cDNA. Oligo microarrays are mainly labeled with two different fluorescences (e.g., Cye3 and Cye5) to perform hybridization reactions on the same chip at the same time. . Gene expression is determined according to the ratio of the two fluorescence intensities (Somasundaram, K., et al ., Genomics Proteomics I: 1-10, 2002).

In combination with recent research on toxic genomics (Toxicogenomics), which is an advanced technique using DNA microarray technology, the expression pattern of genes expressed in specific tissues or cell lines by all chemicals as well as drug and new drug candidates in high throughput. Analysis and quantitative analysis are now possible. Accordingly, by analyzing the frequency of expression of specific genes in specific cells, it is possible to discover genes related to side effects of drugs, and through this, we will understand the molecular mechanisms according to the actions and side effects of drugs, Search and diagnosis of the material will be possible.

Therefore, the present inventors observed and analyzed a gene expression profile by methotrexate treatment, a representative drug causing teratogenicity, as an anticancer agent using oligomicroarray in which 44,000 human genes were accumulated and analyzed in JEG-3 cell line, which is a human chorionic cancer cell. A biomarker capable of detecting a teratogenic drug by detecting a gene overexpressed or underexpressed by methotrexate and confirming the expression of the genes by real-time quantitative RT-PCR method and a search method using the same The present invention has been completed.

An object of the present invention is to provide a biomarker overexpressed or underexpressed by a teratogenic drug and a method for searching for a teratogenic drug using the biomarker.

In order to achieve the above object, the present invention provides a biomarker for searching for teratogenic drugs, characterized in that the expression changes in human chorionic cancer cells stimulated by methotrexate which is a teratogenic drug.

The present invention also provides a DNA microarray chip for teratogenicity-induced drug search in which an oligonucleotide or its complementary strand molecule including all or part of the biomarker sequence is integrated.

The present invention also provides a method for teratogenic drug discovery using the biomarker.

The present invention also provides a teratogenic drug search kit comprising the DNA microarray chip.

In addition, the present invention provides a kit for teratogenic drug search comprising a primer that is complementary to the biomarker and capable of amplifying the biomarker.

The biomarker for searching for teratogenic drugs and the method for searching for teratogenic drugs using the same according to the present invention are to monitor and risk the drug or chemical having the risk of new teratogenicity by using the reaction genes selected through the DNA microarray chip as biomarkers. It is useful for judgment and can be used as a tool to identify mechanisms of action that cause teratogenicity.

Hereinafter, the present invention will be described in detail.

The present invention provides a biomarker for teratogenic drug search, characterized in that the expression changes in human chorionic cancer cells stimulated by methotrexate, a teratogenic drug.

The biomarker may include pregnancy, apoptosis, inflammatory response, morphogenesis, cell cycle arrest, angiogenesis, and cell cycle arrest. , Cell migration, regulation of signal transduction, regulation of neurotransmitter levels, DNA repair, cell development, amino acid metabolism ) Or genes involved in neuron development.

The present invention provides a biomarker, characterized in that selected from the group consisting of:

Genebank AF537113 (TAC3, Tachykinin 3 (neuromedin K, neurokinin beta)), Genebank AJ224867 (Homo sapiens mRNA for GNAS1 protein (IMAGE cDNA clone 359933 (827-k06)). [AJ224867]. ), Gene Registration Number (Genebank) AK074734 (FCGRT, Fc fragment of IgG, receptor, transporter, alpha), Gene Registration Number (Genebank) NM_001856 (COL16A1, Collagen, type XVI, alpha 1), Gene Registration Number (Genebank) CR606430 (PSG11, Pregnancy specific beta-1-glycoprotein 11), Genebank AK075446 (P11, 26 serine protease), Genebank NM_003214 (TEAD3, TEA domain family member 3), Gene registry number (Genebank ) NM_001031850 (PSG6, Pregnancy specific beta-1-glycoprotein 6), Gene Registration Number (Genebank) CR606280 (PSG5, Pregnancy specific beta-1-glycoprotein 5), Gene Registration Number (Genebank) NM_005059 (RLN2, Relaxin 2), Gene Genebank BC064698 (TFCP2L1, Transcription factor CP2-like 1), Gene Registration Number (G enebank) BC005956 (RLN1, Relaxin 1), Gene Registration Number (Genebank) NM_000029 (AGT, Angiotensinogen (serpin peptidase inhibitor, clade A, member 8)), Gene Registration Number (Genebank) BC063127 (PSG4, Pregnancy specific beta-1- glycoprotein 4), gene accession number (Genebank) NM_001124 (ADM, Adrenomedullin), gene accession number (Genebank) AK092458 (PSG1; DKFZp781L10202, Pregnancy specific beta-1-glycoprotein 8), Gene Registration Number (Genebank) M23575 (PSG3, Pregnancy specific beta-1-glycoprotein 3), Gene Registration Number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_031246 (PSG2, Pregnancy specific beta-1-glycoprotein 2), gene registration number (Genebank) AK097048 (CLIC5, Chloride intracellular channel 5), gene registration number (Genebank) CR601901 ( INSL4, Insulin-like 4 (placenta), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank NM_004613 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-) gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (Cpolypeptide, protein-glutamine-gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma) -glutamyltra nsferase), gene registration number (Genebank) NM_004613 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (Genebank) NM_001007232 (INCA, Inhibitory caspase recruitment domain (CARD) protein), gene registration Genebank AK094322 (CKMT; CKMT1; UMTCK, Creatine kinase, mitochondrial 1B), Genebank NM_203339 (CLU, Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)), gene registration number (Genebank) BX386171 (CGB5, Chorionic gonadotropin, beta polypeptide 8), Gene Registration Number (Genebank) NM_003841 (TNFRSF10C, Tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain), Gene Registration Number (Genebank) BC063507 (HSPA1B , Heat shock 70kDa protein 1B, Genebank AL050391 (CASP4, Caspase 4, apoptosis-related cysteine peptidase), Genebank (Genebank) NM_001167 (BIRC4, Baculoviral IAP repeat-containing 4), Gene registry number ( Genebank) NM_004155 (SERPINB9, Serpin peptidase inhibitor, clade B (ovalbumin), member 9), Gene Registration Number (Genebank) CR613579 (GADD45G, Growth arrest and DNA-damage-inducible, gamma), Gene Registration Number (Genebank) NM_001015049 ( BAG5 , BCL2-associated athanogene 5), gene registration number (Genebank) BC033694 (BCL2L11, BCL2-like 11 (apoptosis facilitator)), gene registration number (Genebank) AY358836 (BIRC7, Baculoviral IAP repeat-containing 7 (livin)), gene Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank AK125880 (TP53INP1, Tumor protein p53 inducible nuclear protein 1), Genebank BC052977 (TNFRSF1B, Tumor necrosis factor receptor superfamily, member 1B), Genebank BC047362 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), Genebank U67156 (MAP3K5, Mitogen-activated protein kinase kinase kinase 5), Genebank NM_012479 (YWHAG, Tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activation protein, gamma polypeptide), Genebank NM_004226 (STK17B, Serine / threonine kinase 17b (apoptosis-inducing)) , Gene registration number (Genebank ) NM_012324 (MAPK8IP2, Mitogen-activated protein kinase 8 interacting protein 2), Genebank BG920134 (COPl, Caspase-1 dominant-negative inhibitor pseudo-ICE), Genebank NM_005505 (SCARB1, Casvenger receptor class B, member 1), Genebank NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank (Genebank) NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank AF020763 (IGF1R, Insulin -like growth factor 1 receptor, Genebank NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), Genebank (Genebank) NM_005505 (SCARB1, Scavenger receptor class B, member 1), Genebank A (Genebank) B209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AK092808 (RRAGC, Ras-related GTP binding C), Genebank BC089389 (IHPK3, Inositol hexaphosphate kinase 3), Gene Registry Number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta) , Gene registration number (Genebank) AB007974 (PKC2, protein kinase C, zeta), gene registration number (Genebank) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (Genebank) NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), gene registration Genebank AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Accession Number (Genebank) NM_004574 (04-Sep, Septin 4), Gene Accession Number (Genebank) NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), Genebank (Genebank) BX649005 (SGK, Serum / glucocorticoid regulated kinase), Genebank (Genebank) NM_006290 (TNFAIP3, Tumor necrosis factor, alpha-induced protein 3), Genebank (Kenebank) AK124173 (Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796. [AK124173], CDNA FLJ42179 fis, clone THYMU2030796), Genebank BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), Genebank BC012609 (SERPINB2, Serpin peptidase inhibitor, clade B (ovalbumin), member 2), genebank NM_001621 (AHR, Aryl hydrocarbon receptor), genebank AK122828 (CIDEB, cell death-inducing DFFA-like effector b), genebank (Genebank) AK223503 (CASP1, Caspase1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), Gene Registration Number (Genebank) NM_033027 (AXUD1, AXIN1 up-regulated 1), Gene Registration Number (Genebank) AW057563 (Unknown, Transcribed locus) Genebank NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3), Genebank BX641114 (ANXA4, Annexin A4), Genebank NM_ 001731 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank CN478604 (LGALS7, Lectin, galactoside-binding, soluble, 7 (galectin 7)), genebank (Genebank) NM_004281 (BAG3, BCL2-associated athanogene 3), genebank AY125488 (DEDD2, Death effector domain containing 2), gene registry number (Genebank) AL713801 (SLAMF7, SLAM family member 7), Genebank AK096267 (LOC90525, Src homology 2 domain containing F), Genebank NM_000639 (FASLG, Fas ligand (TNF superfamily, member 6) ), Genebank AK025273 (EGLN3, Egl nine homolog 3 (C. elegans), Genebank BC042844 (CASP10, Caspase 10, apoptosis-related cysteine peptidase), Genebank AB007974 (PKC2, protein kinase C, zeta), Genebank AB029551 (RYBP , RING1 and YY1 binding protein), Genebank AB209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AB209534 (TRA1, Tumor rejection antigen (gp96) 1), Gene Registration Number ( Genebank) AB209613 (DNASE1L3, Deoxyribonuclease I-like 3), Gene Registration Number (Genebank) AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Registration Number (Genebank) AF332558 (BBC3, BCL2 binding component 3), Gene Registration Number (Genebank) AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Gene Registration Number (Genebank) AB096256 (UNC5B, Unc-5 homolog B (C. elegans)), Gene Registration Number (Genebank) AK001361 ( PPP1R15A, Protein phosphatase 1, regulatory (inhibitor) subunit 15A), gene registration number (Genebank ) AI376429 (TNFSF10, Tumor necrosis factor (ligand) superfamily, member 10), Gene Registration Number (Genebank) NM_006665 (HPSE, Heparanase), Gene Registration Number (Genebank) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann) disease)), Genebank BC037961 (IL8RB, Interleukin 8 receptor, beta), Genebank AK127123 (TOLLIP, Toll interacting protein), Genebank NM_001002029 (C4A, Complement component 4B, telomeric), Gene Registration Number (Genebank) NM_002987 (CCL17, Chemokine (CC motif) ligand 17), Gene Registration Number (Genebank) NM_003596 (TPST1, Tyrosylprotein sulfotransferase 1), Gene Registration Number (Genebank) U83171 (CCL22, Chemokine (CC) motif ligand 22), gene accession number (Genebank) NM_001643 (APOA2, Apolipoprotein A-II), gene accession number (Genebank) NM_000625 (NOS2A, Nitric oxide synthase 2A (inducible, hepatocytes)), gene accession number (Genebank) BQ927179 (S100A9, S100 calcium binding protein A9 (calgranulin B)), Genebank (Genebank) NM_020820 (PREX1, Phosphatidylinositol 3,4,5-trisphosphate-dependent RAC exchanger 1), Genebank (Genebank) CD013879 (PTAFR, Platelet-activating factor receptor) Genebank NM_002504 (NFX1, Nucleartranscription factor, X-box binding 1), Genebank NM_173842 (IL1RN, Interleukin 1 receptor antagonist), Genebank NM_005408 (CCL13, Chemokine (CC motif) ligand 13), Gene Registration Number (Genebank) NM_013314 (BLNK, B-cell linker), Gene Registration Number (Genebank) NM_000634 (IL8RA, Interleukin 8 receptor, alpha), Genebank NM_006404 (PROCR, Protein C receptor, endothelial (EPCR)), Genebank NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), Genebank AY499342 (IL31RA, Interleukin 31 receptor A), Genebank M27492 (IL1R1, Interleukin) 1 receptor, type I), gene registration number (Genebank) CR749338 (BDKRB2, Bradykinin receptor B2), Genebank NM_007115 (TNFAIP6, Tumor necrosis factor, alpha-induced protein 6), Genebank CR595353 (CD74, CD74 antigen (invariant polypeptide of major) histocompatibility complex, class II antigen-associated), Genebank AK074480 (ANXA1, Annexin A1), Genebank NM_001838 (CCR7, Chemokine (CC motif) receptor 7), Genebank (Genebank) NM_001295 (CCR1, Chemokine (CC motif) receptor 1), Genebank NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), Genebank AF076494 (IRF7, Interferon regulatory factor 7), Genebank AF186094 (IL1F5, Interleukin 1 family, member 5 (delta)), Genebank AF189279 (PLA2G2E, Phospholipase A2, group IIE), Genebank AF200494 (IL1F8, Interleukin 1 family, member 8 ( eta)), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Gene Registration Number (Genebank) NM_005283 (XCR1, Chemokine (C motif) receptor 1), Gene Registration Number (Genebank) NM_005245 (FAT, FAT tumor suppressor homolog 1 (Drosophila)), Gene Banking Number AF373867 (TBX1, T-box 1), Gene Banking Number (Genebank) BC010091 (BICD, bicaudal D homolog 1 (Drosophila)), Gene Banking Number (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Gene Registration Number (Genebank) NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), Gene Registration Number (Genebank) NM_004235 (KLF4, Kruppel-like factor 4 (gut)), Genebank NM_000118 (ENG, Endoglin (Osler-Rendu-Weber syndrome 1)), Genebank NM_032951 (WBSCR14, MLX interacting protein-like), Gene accession number ( Genebank) AK124904 (FGD6, FYVE, RhoGEF and PH domain containing 6), Gene Accession Number (Genebank) NM_014585 (SLC40A1, Solute carrier family 40 (iron-regulated transporter), member 1), Genebank NM_001003408 (ABLIM1, Actin binding LIM protein 1), Genebank AK096284 (LFNG, Lunatic fringe homolog (Drosophila)), Gene Registry Number Genebank AL833276 (ALPK3, Alpha-kinase 3), Genebank NM_000037 (ANK1, Ankyrin 1, erythrocytic), Genebank BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) ( SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), Gene Registration Number (Genebank) NM_003643 (GCM1, Glial cells missing homolog 1 (Drosophila)), Gene Registration Number (Genebank) NM_002653 (PITX1, Paired-like homeodomain transcription factor 1), Genebank AK131071 (SLC31A2, Solute carrier family 31 (copper transporters), member 2), Genebank NM_001874 (CPM, Carboxypeptidase M), Gene Registration Number ( Genebank) BC087839 (CTGF, Connective tissue growth factor), Genebank (Genebank) N M_002774 (KLK6, Kallikrein 6 (neurosin, zyme)), Gene Registration Number (Genebank) NM_020127 (TUFT1, Tuftelin 1), Gene Registration Number (Genebank) NM_018695 (ERBB2IP, Erbb2 interacting protein), Gene Registration Number (Genebank) NM_003955 ( Suppressor of cytokine signaling 3), Genebank NM_000899 (KITLG, KIT ligand), Genebank AK127621 (SOCS1, Suppressor of cytokine signaling 1), Genebank NM_017556 (FBLP- 1, Filamin binding LIM protein 1), Gene Registration Number (Genebank) NM_002826 (QSCN6, Quiescin Q6), Gene Registration Number (Genebank) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Gene Registration Number (Genebank) AY211386 (FGD3, FYVE, RhoGEF and PH domain containing 3), Gene Registration Number (Genebank) AK092391 (CST6, Cystatin E / M), Gene Registration Number (Genebank) NM_003897 (IER3, Immediate early response 3), Gene Registration Number (Genebank X54457 (CEL, Carboxyl ester lipase), gene Genebank NM_016291 (IHPK2, Inositol hexaphosphate kinase 2), Gene Registration Number (Genebank) BC070068 (HECA, Headcase homolog (Drosophila), Gene Registration Number (Genebank) NM_000224 (KRT18, Keratin 18), Gene Registration Number (Genebank) CR616919 (KRT18, Keratin 18), Genebank AK097304 (LR8, LR8 protein), Genebank NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), Genebank AK027294 (WISP1, WNT1 inducible signaling pathway protein 1), Genebank NM_006291 (TNFAIP2, Tumor necrosis factor, alpha-induced protein 2), gene accession number (Genebank) NM_001024807 (APLP1, Amyloid beta (A4) precursor-like protein 1), gene accession number (Genebank) NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene registration number ( Genebank) AY258066 (OKL38, Pre gnancy-induced growth inhibitor), Genebank NM_014590 (ERVWE1, Endogenous retroviral family W, env (C7), member 1 (syncytin)), Genebank NM_002448 (MSX1, Msh homeo box homolog 1 ( Drosophila), Genebank AJ303079 (PALM2-AKAP2, Paralemmin 2), Genebank NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse), Genebank BX391158 (Homobank) sapiens reticulon 4 receptor (RTN4R), mRNA [NM_023004], Transcribed locus, weakly similar to NP_075380.1 reticulon 4 receptor precursor; nogo receptor; Nogo-66 receptor; UNQ330 / PRO526 [Homo sapiens]), Genebank AB209095 (CDC2L2, Cell division cycle 2-like 2 (PITSLRE proteins)), Genebank BX649103 (ChGn, Chondroitin beta1, 4 N-acetylgalactosaminyltransferase) , Gene Registration Number (Genebank) NM_002702 (POU6F1, POU domain, class 6, transcription factor1), Gene Registration Number (Genebank) AB209321 (CSRP2, Cysteine and glycine-rich protein 2), Gene Registration Number (Genebank) AF075292 (FGF18, Fibroblast growth factor 18), Genebank AF132297 (CISH, Cytokine inducible SH2-containing protein), Genebank AF167706 (CRIM1, Cysteine rich transmembrane BMP regulator 1 (chordin-like), Gene accession number (Genebank) AL137318 (ERBB2IP, Erbb2 interacting protein), gene accession number (Genebank) AK021858 (FOXC1, Forkhead box C1), gene accession number (Genebank) NM_020418 (PCBP4, Poly (rC) binding protein 4), gene registration number ( Genebank) NM_003884 (PCAF, P300 / CBP-associated factor) , Genebank CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha), Genebank (Genebank) D86987 (MFN2, Mitofusin 2), Genebank NM_201433 (GAS7, Growth arrest -specific 7), Genebank AK127230 (Homo sapiens eukaryotic translation initiation factor 4 gamma, 2 (EIF4G2), mRNA [NM_001418], CDNA FLJ45297 fis, clone BRHIP3003395), Genebank AY123223 (SESN2, Sestrin 2), Gene Registration Number (Genebank) NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), Gene Registration Number (Genebank) NM_033044 (MACF1, Microtubule-actin crosslinking factor 1), Gene Registration Number (Genebank) ) AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene Registration Number (Genebank) NM_002191 (INHA, Inhibin, alpha), Gene Registration Number (Genebank) BC067842 (CDKN1C, Cyclin-dependent kinase inhibitor 1C (p57, Kip2)) , Genebank S62138 (DDIT3, DNA-damage-inducible tran script 3), Genebank NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), Genebank AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene registry number ( Genebank) AF033122 (SESN1, Sestrin 1), Gene Registration Number (Genebank) AF211119 (CDKN2A, Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)), Gene Registration Number (Genebank) NM_000800 (FGF1, Fibroblast growth factor 1 (acidic)), Genebank NM_002632 (PGF, Placental growth factor, vascular endothelial growth factor-related protein), Genebank (Genebank) AK075219 (ANGPT2, Angiopoietin 2), Genebank NM_001430 (Genebank) EPAS1, Endothelial PAS domain protein 1), Gene Accession Number (Genebank) AK024680 (Homo sapiens cDNA: FLJ21027 fis, clone CAE07110. [AK024680], CDNA: FLJ21027 fis, clone CAE07110), gene registration number (Genebank) X96753 (CSPG4, Chondroitin sulfate proteoglycan 4 (melanoma-associated)), gene registration number (Genebank) AL833606 (NRP2, Neuropilin 2), gene registration Genebank NM_018534 (NRP2, Neuropilin 2), Gene Accession Number (Genebank) AK095578 (SPHK1, Sphingosine kinase 1), Gene Accession Number (Genebank) AK025719 (IGF2, Insulin-like growth factor 2 (somatomedin A)), Gene Genebank NM_002521 (NPPB, Natriuretic peptide precursor B), Genebank (Genebank) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), Gene registry (Genebank ) BC030792 (CDK5R1, Cyclin-dependent kinase 5, regulatory subunit 1 (p35)), gene registration number (Genebank) AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit), Genebank AF003837 (JAG1 , Jagged 1 (Alagille syndrome)), Genebank AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), Genebank NM_015366 (PRR5; PP610; FLJ20185, Rho GTPase activating protein 8), gene accession number (Genebank) AK126486 (WBSCR20B, Williams-Beuren Syndrome critical region protein 20 copy B), gene accession number (Genebank) CR604926 (CaMKIINalpha, Calcium / calmodulin-dependent protein kinase II inhibitor 1), Gene Registration Number (Genebank) BC050456 (THBS4, Thrombospondin 4), Gene Registration Number (Genebank) NM_016463 (CXXC5, CXXC finger 5), Gene Registration Number (Genebank) NM_003004 (SECTM1, Secreted and transmembrane 1), Gene Registration Number (Genebank) R52269 (RGS3, Regulator of G-protein signaling 3), gene accession number (Genebank) BC034950 (TBK1, TANK-binding kinase 1), gene accession number (Genebank) AF059617 (PLK2, Polo-like kinase 2 ( Drosophila), Genebank NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), Genebank NM_213590 (RFP2, Ret finger protein 2), Genebank AK097205 (ECM1, Extracellular matrix protein 1), heredity Genebank AF227516 (SPRY4, Sprouty homolog 4 (Drosophila)), Gene Registration Number (Genebank) BX647341 (TDO2, Tryptophan 2,3-dioxygenase), Gene Registration Number (Genebank) NM_001045 (SLC6A4, Solute carrier family 6 ( neurotransmitter transporter, serotonin), member 4), gene accession number (Genebank) NM_003490 (SYN3, Synapsin III), gene accession number (Genebank) NM_000240 (MAOA, Monoamine oxidase A), gene accession number (Genebank) AK126731 (GLCCI1, Glucocorticoid induced transcript 1), genebank NM_080542 (COLQ, Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase), genebank BQ054887 (GCHFR, GTP cyclohydrolase I feedback regulator), gene registration Number (Genebank) NM_005629 (SLC6A8, Solute carrier family 6 (neurotransmitter transporter, creatine), member 8), gene accession number (Genebank) AB018258 (ATP10B, ATPase, Class V, type 10B), gene registration number (Genebank) Y18483 ( SLC7A8, Solute carri er family 7 (cationic amino acid transporter, y + system), member 8), Genebank (Genebank) AB019569 (CGA, Glycoprotein hormones, alpha polypeptide), Genebank (Genebank) NM_014585 (SLC40A1, Solute carrier family 40 (iron -regulated transporter, member 1), Genebank BC036890 (TFCP2L4, Grainyhead-like 3 (Drosophila)), Genebank AK095632 (ABTB2, Ankyrin repeat and BTB (POZ) domain containing 2), Genebank NM_181659 (NCOA3, Nuclear receptor coactivator 3), Genebank BC042755 (RGS2, Regulator of G-protein signaling 2, 24 kDa). Genebank (Genebank) NM_175607 (CNTN4, Contactin 4), Genebank (Genebank) NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank (Menebank) NM_016835 (MAPT, Microtubule-associated protein tau) (Genebank) AB028993 (NLGN1, Neuroligin 1), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), Genebank CR936770 ( GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), gene registration number (Genebank) NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), gene registration number (Genebank) NM_005103 (FEZ1 , Fasciculation and elongation protein zeta 1 (zygin I), Genebank NM_000304 (PMP22, Peripheral myelin protein 22), Genebank AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans)), Genebank (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_013975 (LIG3, Ligase III, DNA, ATP-dependent), Gene Registration Number (Genebank) BX248766 (RAD51L1, RAD51-like 1 (S. cerevisiae)), Gene Registration Number (Genebank) CR611116 (APEX1, APEX nuclease (multifunctional DNA repair enzyme) 1), Gene Registration Number (Genebank) BC005077 (FANCF, Fanconi anemia, complementation group F), Gene Registration Number (Genebank) NM_022725 (FANCF, Fanconi anemia) , complementation group F), Genebank D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)), Genebank U63139 (RAD50, RAD50 homolog (S. cerevisiae)), Genebank AK122825 (HMGB1, High-mobility group box 1), Genebank AB067472 (VARS2L, Valyl-tRNA synthetase like), Genebank AK057498 (RUVBL2, RuvB -like 2 (E. coli)), Gene Registration Number (Genebank) BX640816 (NBS1, Nibrin), Gene Registration Number (Genebank) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) Genebank AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), Genebank number NM_006230 (POLD2, olymerase (DNA directed), delta 2, regulatory subunit 50kDa), genebank NG_006230 (POLD2, Polymerase (DNA directed), delta 2, regulatory subunit 50kDa), genebank NM_002412 (MGMT, 6-methylguanine-DNA methyltransferase), gene registry (Genebank) NM_007313 (ABL1, V-abl Abelson murine leukemia viral oncogene homolog 1), gene registration number (Genebank) NM_003362 (UNG, Uracil-DNA glycosylase), gene registration number (Genebank) AF078164 (KUB3, Ku70-binding protein 3), gene registration number (Genebank) NM_004280 (EEF1E1 , Eukaryotic translation elongation factor 1 epsilon 1), Genebank NM_002528 (NTHL1, Nth endonuclease III-like 1 (E. coli)), Genebank AF078847 (GTF2H2, General transcription factor IIH, polypeptide 2, 44kDa), Genebank NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene registration Genebank NM_001184 (ATR, Ataxia telangiectasia and Rad3 related), Genebank NM_001007233 (ERCC8, Excision repair cross-complementing rodent repair deficiency, complementation group 8), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank NM_000051 (ATM, Ataxia telangiectasia mutated (includes complementation groups A, C and D)), Genebank NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank AF061326 (C8orf1, Chromosome 8 open reading frame 1), Genebank AB028993 (NLGN1, Neuroligin 1) ), Genes, etc. Number (Genebank) NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), gene registration number (Genebank) BI494022 (GRLF1, Glucocorticoid receptor DNA binding factor 1), gene registration number (Genebank) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), Genebank NM_016835 (MAPT, Microtubule-associated protein tau), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, ( semaphorin) 3B), Genebank CR936770 (GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), Genebank (Genebank) NM_000304 (PMP22, Peripheral myelin protein 22), gene registry number (Genebank) AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans)), Gene Registration Number (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_058179 (PSAT1, Phosphoserine aminotransferase 1), Gene Registration Number (Genebank) AB209458 (SCLY, Selenocysteine lyase), Gene Registration Number (Genebank) BC065510 (CAD, Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase), gene registration number (Genebank) AK055053 (SHMT2, Serine hydroxymethyltransferase 2 (mitochondrial)), gene registration number (Genebank) NM_1334g (ASsyntase Asase Genebank AK022713 (Homo sapiens cDNA FLJ12651 fis, clone NT2RM4002062, moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12). [AK022713], unnamed protein product; Homo sapiens cDNA FLJ12651 fis, clone NT2RM400206 moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12).), Genebank XM_371677 (LOC389173, Similar to phosphoserine aminotransferase isoform 1), Genebank NM_005504 (BCAT1, Bra nched chain aminotransferase 1, cytosolic, Genebank AK056980 (FLJ23441, Hypothetical protein FLJ23441), Genebank L00972 (CBS, Cystathionine-beta-synthase), Genebank (Menebank) NM_152334 (TARSL2, Threonyl-tRNA synthetase-like 2), gene registration number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), gene registration number (Genebank) NM_080820 (HARS2, Histidyl-tRNA synthetase 2), gene registration number (Genebank) X59303 (VARS2, Valyl-tRNA synthetase), Genebank Number (Genebank) NM_006567 (FARS2, Phenylalanine-tRNA synthetase 2 (mitochondrial)), Gene Registry Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Registration Number (Genebank) ) NM_015936 (CGI-04, Tyrosyl-tRNA synthetase 2 (mitochondrial)), gene registration number (Genebank) AB209246 (PPAT, Phosphoribosyl pyrophosphate amidotransferase), gene registration number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I) Enrollment Number (Genebank) NM_005881 (BCKDK, Branched chain ketoacid dehydrogenase kinase), Gene Registration Number (Genebank) NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene Registration Number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase, Genebank BC036421 (C9orf103, Chromosome 9 open reading frame 103), Genebank AK125213 (YARS, Tyrosyl-tRNA synthetase), Genebank (Genebank) AK027126 (ASS, Argininosuccinate synthetase), Gene Registration Number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) NM_001190 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) AK093306 (PHGDH, Phosphoglycerate dehydrogenase), Gene Registration Number (Genebank) AB067472 (VARS2L, Valyl-tRNA synthetase like), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2) (mitochondrial) Genebank NM_032484 (Homolog of mouse LGP1), BX648021 (B7-H4, V-set domain containing T cell activation inhibitor 1).

1) Biomarkers whose expression is increased by treatment of teratogenic drugs in the biomarkers are as follows:

Genebank AF537113 (TAC3, Tachykinin 3 (neuromedin K, neurokinin beta)), Genebank AJ224867 (Homo sapiens mRNA for GNAS1 protein (IMAGE cDNA clone 359933 (827-k06)). [AJ224867]. ), Gene Registration Number (Genebank) AK074734 (FCGRT, Fc fragment of IgG, receptor, transporter, alpha), Gene Registration Number (Genebank) NM_001856 (COL16A1, Collagen, type XVI, alpha 1), Gene Registration Number (Genebank) CR606430 (PSG11, Pregnancy specific beta-1-glycoprotein 11), Genebank AK075446 (P11, 26 serine protease), Genebank NM_003214 (TEAD3, TEA domain family member 3), Gene registry number (Genebank ) NM_001031850 (PSG6, Pregnancy specific beta-1-glycoprotein 6), Gene Registration Number (Genebank) CR606280 (PSG5, Pregnancy specific beta-1-glycoprotein 5), Gene Registration Number (Genebank) NM_005059 (RLN2, Relaxin 2), Gene Genebank BC064698 (TFCP2L1, Transcription factor CP2-like 1), gene registration number ( Genebank) BC005956 (RLN1, Relaxin 1), Genebank Number (Genebank) NM_000029 (AGT, Angiotensinogen (serpin peptidase inhibitor, clade A, member 8)), Genebank Number BC063127 (PSG4, Pregnancy specific beta-1- glycoprotein 4), gene accession number (Genebank) NM_001124 (ADM, Adrenomedullin), gene accession number (Genebank) AK092458 (PSG1; DKFZp781L10202, Pregnancy specific beta-1-glycoprotein 8), Gene Registration Number (Genebank) M23575 (PSG3, Pregnancy specific beta-1-glycoprotein 3), Gene Registration Number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_031246 (PSG2, Pregnancy specific beta-1-glycoprotein 2), gene registration number (Genebank) AK097048 (CLIC5, Chloride intracellular channel 5), gene registration number (Genebank) CR601901 ( INSL4, Insulin-like 4 (placenta), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank NM_004613 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-) gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (Cpolypeptide, protein-glutamine-gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma) -glutamyltra nsferase), gene registration number (Genebank) NM_004613 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (Genebank) NM_001007232 (INCA, Inhibitory caspase recruitment domain (CARD) protein), gene registration Genebank AK094322 (CKMT; CKMT1; UMTCK, Creatine kinase, mitochondrial 1B), Genebank NM_203339 (CLU, Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)), gene registration number (Genebank) BX386171 (CGB5, Chorionic gonadotropin, beta polypeptide 8), Gene Registration Number (Genebank) NM_003841 (TNFRSF10C, Tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain), Gene Registration Number (Genebank) BC063507 (HSPA1B , Heat shock 70kDa protein 1B, Genebank AL050391 (CASP4, Caspase 4, apoptosis-related cysteine peptidase), Genebank (Genebank) NM_001167 (BIRC4, Baculoviral IAP repeat-containing 4), Gene registry number ( Genebank) NM_004155 (SERPINB9, Serpin peptidase inhibitor, clade B (ovalbumin), member 9), Gene Registration Number (Genebank) CR613579 (GADD45G, Growth arrest and DNA-damage-inducible, gamma), Gene Registration Number (Genebank) NM_001015049 ( BAG5 , BCL2-associated athanogene 5), gene registration number (Genebank) BC033694 (BCL2L11, BCL2-like 11 (apoptosis facilitator)), gene registration number (Genebank) AY358836 (BIRC7, Baculoviral IAP repeat-containing 7 (livin)), gene Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank AK125880 (TP53INP1, Tumor protein p53 inducible nuclear protein 1), Genebank BC052977 (TNFRSF1B, Tumor necrosis factor receptor superfamily, member 1B), Genebank BC047362 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), Genebank U67156 (MAP3K5, Mitogen-activated protein kinase kinase kinase 5), Genebank NM_012479 (YWHAG, Tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activation protein, gamma polypeptide), Genebank NM_004226 (STK17B, Serine / threonine kinase 17b (apoptosis-inducing)) , Gene Registration Number (Genebank) NM_012324 (MAPK8IP2, Mitogen-activated protein kinase 8 interacting protein 2), gene registration number (Genebank) BM920134 (COPl, Caspase-1 dominant-negative inhibitor pseudo-ICE), gene registration number (Genebank) NM_005505 (SCARB1, Casvenger receptor class B, member 1), Genebank NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank AF020763 (IGF1R, Insulin- like growth factor 1 receptor, genebank NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), genebank (Genebank) NM_005505 (SCARB1, Scavenger receptor class B, member 1), genebank A (Genebank) A B209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AK092808 (RRAGC, Ras-related GTP binding C), Genebank BC089389 (IHPK3, Inositol hexaphosphate kinase 3), Gene Registry Number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta) , Gene registration number (Genebank) AB007974 (PKC2, protein kinase C, zeta), gene registration number (Genebank) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (Genebank) NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), gene registration Genebank AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Accession Number (Genebank) NM_004574 (04-Sep, Septin 4), Gene Accession Number (Genebank) NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), Genebank (Genebank) BX649005 (SGK, Serum / glucocorticoid regulated kinase), Genebank (Genebank) NM_006290 (TNFAIP3, Tumor necrosis factor, alpha-induced protein 3), Genebank (Kenebank) AK124173 (Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796. [AK124173], CDNA FLJ42179 fis, clone THYMU2030796), Genebank BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), Genebank BC012609 (SERPINB2, Serpin peptidase inhibitor, clade B (ovalbumin), member 2), genebank NM_001621 (AHR, Aryl hydrocarbon receptor), genebank AK122828 (CIDEB, cell death-inducing DFFA-like effector b), genebank (Genebank) AK223503 (CASP1, Caspase1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), Gene Registration Number (Genebank) NM_033027 (AXUD1, AXIN1 up-regulated 1), Gene Registration Number (Genebank) AW057563 (Unknown, Transcribed locus) Genebank NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3), Genebank BX641114 (ANXA4, Annexin A4), Genebank NM_0 01731 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank CN478604 (LGALS7, Lectin, galactoside-binding, soluble, 7 (galectin 7)), genebank (Genebank) NM_004281 (BAG3, BCL2-associated athanogene 3), genebank AY125488 (DEDD2, Death effector domain containing 2), gene registry number (Genebank) AL713801 (SLAMF7, SLAM family member 7), Genebank AK096267 (LOC90525, Src homology 2 domain containing F), Genebank NM_000639 (FASLG, Fas ligand (TNF superfamily, member 6) ), Genebank AK025273 (EGLN3, Egl nine homolog 3 (C. elegans), Genebank BC042844 (CASP10, Caspase 10, apoptosis-related cysteine peptidase), Genebank AB007974 (PKC2, protein kinase C, zeta), Genebank AB029551 (RYBP , RING1 and YY1 binding protein), Genebank AB209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AB209534 (TRA1, Tumor rejection antigen (gp96) 1), Gene Registration Number ( Genebank) AB209613 (DNASE1L3, Deoxyribonuclease I-like 3), Gene Registration Number (Genebank) AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Registration Number (Genebank) AF332558 (BBC3, BCL2 binding component 3), Gene Registration Number (Genebank) AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Gene Registration Number (Genebank) AB096256 (UNC5B, Unc-5 homolog B (C. elegans)), Gene Registration Number (Genebank) AK001361 ( PPP1R15A, Protein phosphatase 1, regulatory (inhibitor) subunit 15A), gene registration number (Genebank ) AI376429 (TNFSF10, Tumor necrosis factor (ligand) superfamily, member 10), Gene Registration Number (Genebank) NM_006665 (HPSE, Heparanase), Gene Registration Number (Genebank) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann) disease)), Genebank BC037961 (IL8RB, Interleukin 8 receptor, beta), Genebank AK127123 (TOLLIP, Toll interacting protein), Genebank NM_001002029 (C4A, Complement component 4B, telomeric), Gene Registration Number (Genebank) NM_002987 (CCL17, Chemokine (CC motif) ligand 17), Gene Registration Number (Genebank) NM_003596 (TPST1, Tyrosylprotein sulfotransferase 1), Gene Registration Number (Genebank) U83171 (CCL22, Chemokine (CC) motif ligand 22), gene accession number (Genebank) NM_001643 (APOA2, Apolipoprotein A-II), gene accession number (Genebank) NM_000625 (NOS2A, Nitric oxide synthase 2A (inducible, hepatocytes)), gene accession number (Genebank) BQ927179 (S100A9, S100 calcium binding protein A9 ( calgranulin B)), Genebank NM_020820 (PREX1, Phosphatidylinositol 3,4,5-trisphosphate-dependent RAC exchanger 1), Genebank CD013879 (PTAFR, Platelet-activating factor receptor) Genebank NM_002504 (NFX1, Nucleartranscription factor, X-box binding 1), Genebank NM_173842 (IL1RN, Interleukin 1 receptor antagonist), Genebank NM_005408 (CCL13, Chemokine (CC motif) ligand 13 Genebank NM_013314 (BLNK, B-cell linker), Genebank NM_000634 (IL8RA, Interleukin 8 receptor, alpha), Genebank NM_006404 (PROCR, Protein C receptor, endothelial (EPCR)), Genebank NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), Genebank AY499342 (IL31RA, Interleukin 31 receptor A), Genebank M27492 (IL1R1, Interleukin) 1 receptor, type I), gene registration number (Genebank) CR749338 (BDKRB2, Bradykinin receptor B2), Genebank NM_007115 (TNFAIP6, Tumor necrosis factor, alpha-induced protein 6), Genebank CR595353 (CD74, CD74 antigen (invariant polypeptide of major) histocompatibility complex, class II antigen-associated), Genebank AK074480 (ANXA1, Annexin A1), Genebank NM_001838 (CCR7, Chemokine (CC motif) receptor 7), Genebank (Genebank) NM_001295 (CCR1, Chemokine (CC motif) receptor 1), Genebank NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), Genebank AF076494 (IRF7, Interferon regulatory factor 7), Genebank AF186094 (IL1F5, Interleukin 1 family, member 5 (delta)), Genebank AF189279 (PLA2G2E, Phospholipase A2, group IIE), Genebank AF200494 (IL1F8, Interleukin 1 family, member 8 (e ta)), Genebank NM_001015053 (HDAC5, Histone deacetylase 5), Genebank NM_005283 (XCR1, Chemokine (C motif) receptor 1), Genebank NM_005245 (FAT, FAT tumor suppressor homolog 1 (Drosophila)), Genebank AF373867 (TBX1, T-box 1), Genebank (Genebank) BC010091 (BICD, bicaudal D homolog 1 (Drosophila)), Genebank (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Gene Registration Number (Genebank) NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), Gene Registration Number (Genebank) NM_004235 (KLF4, Kruppel- like factor 4 (gut)), Genebank NM_000118 (ENG, Endoglin (Osler-Rendu-Weber syndrome 1)), Genebank NM_032951 (WBSCR14, MLX interacting protein-like), Gene Registry Number Genebank AK124904 (FGD6, FYVE, RhoGEF and PH domain containing 6), Gene Accession Number (Genebank) NM_014585 (SLC40A1, Solute carrier family 40 (iron-regulated transporter), member 1), Genebank NM_001003408 (ABLIM1, Actin binding LIM protein 1), Genebank AK096284 (LFNG, Lunatic fringe homolog (Drosophila)), Gene Registry Number Genebank AL833276 (ALPK3, Alpha-kinase 3), Genebank NM_000037 (ANK1, Ankyrin 1, erythrocytic), Genebank BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) ( SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), Gene Registration Number (Genebank) NM_003643 (GCM1, Glial cells missing homolog 1 (Drosophila)), Gene Registration Number (Genebank) NM_002653 (PITX1, Paired-like homeodomain transcription factor 1), gene accession number (Genebank) AK131071 (SLC31A2, Solute carrier family 31 (copper transporters), member 2), gene accession number (Genebank) NM_001874 (CPM, Carboxypeptidase M), gene registration number ( Genebank) BC087839 (CTGF, Connective tissue growth factor), Genebank (Genebank) N M_002774 (KLK6, Kallikrein 6 (neurosin, zyme)), Gene Registration Number (Genebank) NM_020127 (TUFT1, Tuftelin 1), Gene Registration Number (Genebank) NM_018695 (ERBB2IP, Erbb2 interacting protein), Gene Registration Number (Genebank) NM_003955 ( Suppressor of cytokine signaling 3), Genebank NM_000899 (KITLG, KIT ligand), Genebank AK127621 (SOCS1, Suppressor of cytokine signaling 1), Genebank NM_017556 (FBLP- 1, Filamin binding LIM protein 1), Gene Registration Number (Genebank) NM_002826 (QSCN6, Quiescin Q6), Gene Registration Number (Genebank) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Gene Registration Number (Genebank) AY211386 (FGD3, FYVE, RhoGEF and PH domain containing 3), Gene Registration Number (Genebank) AK092391 (CST6, Cystatin E / M), Gene Registration Number (Genebank) NM_003897 (IER3, Immediate early response 3), Gene Registration Number (Genebank X54457 (CEL, Carboxyl ester lipase), gene Genebank NM_016291 (IHPK2, Inositol hexaphosphate kinase 2), Gene Registration Number (Genebank) BC070068 (HECA, Headcase homolog (Drosophila), Gene Registration Number (Genebank) NM_000224 (KRT18, Keratin 18), Gene Registration Number (Genebank) CR616919 (KRT18, Keratin 18), Genebank AK097304 (LR8, LR8 protein), Genebank NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), Genebank AK027294 (WISP1, WNT1 inducible signaling pathway protein 1), Genebank NM_006291 (TNFAIP2, Tumor necrosis factor, alpha-induced protein 2), gene accession number (Genebank) NM_001024807 (APLP1, Amyloid beta (A4) precursor-like protein 1), gene accession number (Genebank) NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene registration number ( Genebank) AY258066 (OKL38, Pre gnancy-induced growth inhibitor), Genebank NM_014590 (ERVWE1, Endogenous retroviral family W, env (C7), member 1 (syncytin)), Genebank NM_002448 (MSX1, Msh homeo box homolog 1 ( Drosophila), Genebank AJ303079 (PALM2-AKAP2, Paralemmin 2), Genebank NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse), Genebank BX391158 (Homobank) sapiens reticulon 4 receptor (RTN4R), mRNA [NM_023004], Transcribed locus, weakly similar to NP_075380.1 reticulon 4 receptor precursor; nogo receptor; Nogo-66 receptor; UNQ330 / PRO526 [Homo sapiens]), Genebank AB209095 (CDC2L2, Cell division cycle 2-like 2 (PITSLRE proteins)), Genebank BX649103 (ChGn, Chondroitin beta1, 4N-acetylgalactosaminyltransferase), Genebank (Genebank) NM_002702 (POU6F1, POU domain, class 6, transcription factor1), Genebank (Genebank) AB209321 (CSRP2, Cysteine and glycine-rich protein 2), Genebank AF075292 (FGF18, Fibroblast growth factor 18), Genebank AF132297 (CISH, Cytokine inducible SH2-containing protein), Genebank (Genebank) AF167706 (CRIM1, Cysteine rich transmembrane BMP regulator 1 (chordin-like), Gene accession number ( Genebank) AL137318 (ERBB2IP, Erbb2 interacting protein), Genebank AK021858 (FOXC1, Forkhead box C1), Genebank Number (Genebank) NM_020418 (PCBP4, Poly (rC) binding protein 4), Gene Registration Number (Genebank) NM_003884 (PCAF, P300 / CBP-associated factor) Gene Registration Number (Genebank) CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha), Gene Registration Number (Genebank) D86987 (MFN2, Mitofusin 2), Gene Registration Number (Genebank) NM_201433 (GAS7, Growth arrest- specific 7), Genebank AK127230 (Homo sapiens eukaryotic translation initiation factor 4 gamma, 2 (EIF4G2), mRNA [NM_001418], CDNA FLJ45297 fis, clone BRHIP3003395), Genebank AY123223 (SESN2, Sestrin 2), gene registration number (Genebank) NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), gene registration number (Genebank) NM_033044 (MACF1, Microtubule-actin crosslinking factor 1), gene registration number (Genebank) AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene Registration Number (Genebank) NM_002191 (INHA, Inhibin, alpha), Gene Registration Number (Genebank) BC067842 (CDKN1C, Cyclin-dependent kinase inhibitor 1C (p57, Kip2)), Genebank No. S62138 (DDIT3, DNA-damage-inducible tran script 3), Genebank NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), Genebank AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene registry number ( Genebank) AF033122 (SESN1, Sestrin 1), Gene Registration Number (Genebank) AF211119 (CDKN2A, Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)), Gene Registration Number (Genebank) NM_000800 (FGF1, Fibroblast growth factor 1 (acidic)), Genebank NM_002632 (PGF, Placental growth factor, vascular endothelial growth factor-related protein), Genebank (Genebank) AK075219 (ANGPT2, Angiopoietin 2), Genebank NM_001430 (Genebank) EPAS1, Endothelial PAS domain protein 1), Gene Accession Number (Genebank) AK024680 (Homo sapiens cDNA: FLJ21027 fis, clone CAE07110. [AK024680], CDNA: FLJ21027 fis, clone CAE07110), gene registration number (Genebank) X96753 (CSPG4, Chondroitin sulfate proteoglycan 4 (melanoma-associated)), gene registration number (Genebank) AL833606 (NRP2, Neuropilin 2), gene registration Genebank NM_018534 (NRP2, Neuropilin 2), Gene Accession Number (Genebank) AK095578 (SPHK1, Sphingosine kinase 1), Gene Accession Number (Genebank) AK025719 (IGF2, Insulin-like growth factor 2 (somatomedin A)), Gene Genebank NM_002521 (NPPB, Natriuretic peptide precursor B), Genebank (Genebank) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), Gene registry (Genebank ) BC030792 (CDK5R1, Cyclin-dependent kinase 5, regulatory subunit 1 (p35)), gene registration number (Genebank) AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit), Genebank AF003837 (JAG 1, Jagged 1 (Alagille syndrome)), gene registration number (Genebank) AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), gene registration number (Genebank) NM_015366 (PRR5; PP610; FLJ20185, Rho GTPase activating protein 8), gene accession number (Genebank) AK126486 (WBSCR20B, Williams-Beuren Syndrome critical region protein 20 copy B), gene accession number (Genebank) CR604926 (CaMKIINalpha, Calcium / calmodulin-dependent protein kinase II inhibitor 1), Gene Registration Number (Genebank) BC050456 (THBS4, Thrombospondin 4), Gene Registration Number (Genebank) NM_016463 (CXXC5, CXXC finger 5), Gene Registration Number (Genebank) NM_003004 (SECTM1, Secreted and transmembrane 1), Gene Registration Number (Genebank) R52269 (RGS3, Regulator of G-protein signaling 3), gene accession number (Genebank) BC034950 (TBK1, TANK-binding kinase 1), gene accession number (Genebank) AF059617 (PLK2, Polo-like kinase 2 ( Drosophila), Genebank NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), Genebank NM_213590 (RFP2, Ret finger protein 2), Genebank AK097205 (ECM1, Extracellular matrix protein 1), heredity Genebank AF227516 (SPRY4, Sprouty homolog 4 (Drosophila)), Gene Registration Number (Genebank) BX647341 (TDO2, Tryptophan 2,3-dioxygenase), Gene Registration Number (Genebank) NM_001045 (SLC6A4, Solute carrier family 6 ( neurotransmitter transporter, serotonin), member 4), gene accession number (Genebank) NM_003490 (SYN3, Synapsin III), gene accession number (Genebank) NM_000240 (MAOA, Monoamine oxidase A), gene accession number (Genebank) AK126731 (GLCCI1, Glucocorticoid induced transcript 1), genebank NM_080542 (COLQ, Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase), genebank BQ054887 (GCHFR, GTP cyclohydrolase I feedback regulator), gene registration Number (Genebank) NM_005629 (SLC6A8, Solute carrier family 6 (neurotransmitter transporter, creatine), member 8), gene accession number (Genebank) AB018258 (ATP10B, ATPase, Class V, type 10B), gene registration number (Genebank) Y18483 ( SLC7A8, Solute carrie r family 7 (cationic amino acid transporter, y + system), member 8), genebank (Genebank) AB019569 (CGA, Glycoprotein hormones, alpha polypeptide), genebank (Genebank) NM_014585 (SLC40A1, Solute carrier family 40 (iron -regulated transporter, member 1), Genebank BC036890 (TFCP2L4, Grainyhead-like 3 (Drosophila)), Genebank AK095632 (ABTB2, Ankyrin repeat and BTB (POZ) domain containing 2), Genebank NM_181659 (NCOA3, Nuclear receptor coactivator 3), Genebank BC042755 (RGS2, Regulator of G-protein signaling 2, 24 kDa).

2) Among the biomarkers, biomarkers whose expression is reduced by teratogenic drug treatment are as follows:

Genebank (Genebank) NM_175607 (CNTN4, Contactin 4), Genebank (Genebank) NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank (Menebank) NM_016835 (MAPT, Microtubule-associated protein tau) (Genebank) AB028993 (NLGN1, Neuroligin 1), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), Genebank CR936770 ( GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), gene registration number (Genebank) NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), gene registration number (Genebank) NM_005103 (FEZ1 , Fasciculation and elongation protein zeta 1 (zygin I), Genebank NM_000304 (PMP22, Peripheral myelin protein 22), Genebank AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans) )), Genebank (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_013975 (LIG3, Ligase III, DNA, ATP-dependent), Gene Registration Number (Genebank) BX248766 (RAD51L1, RAD51-like 1 (S. cerevisiae)), Gene Registration Number (Genebank) CR611116 (APEX1, APEX nuclease (multifunctional DNA repair enzyme) 1), Gene Registration Number (Genebank) BC005077 (FANCF, Fanconi anemia, complementation group F), Gene Registration Number (Genebank) NM_022725 (FANCF, Fanconi anemia) , complementation group F), Genebank D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)), Genebank U63139 (RAD50, RAD50 homolog (S. cerevisiae)), Genebank AK122825 (HMGB1, High-mobility group box 1), Genebank AB067472 (VARS2L, Valyl-tRNA synthetase like), Genebank AK057498 (RUVBL2, RuvB -like 2 (E. coli)), Gene Registration Number (Genebank) BX640816 (NBS1, Nibrin), Gene Registration Number (Genebank) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) Genebank AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), Genebank number NM_006230 (POLD2, olymerase (DNA directed), delta 2, regulatory subunit 50kDa, Genebank NM_006230 (POLD2, Polymerase (DNA directed), delta 2, regulatory subunit 50kDa), Genebank NM_002412 (MGMT, -6-methylguanine-DNA methyltransferase), Gene Registration Number (Genebank) NM_007313 (ABL1, V-abl Abelson murine leukemia viral oncogene homolog 1), gene registration number (Genebank) NM_003362 (UNG, Uracil-DNA glycosylase), gene registration number (Genebank) AF078164 (KUB3, Ku70-binding protein 3), gene registration number (Genebank) NM_004280 (EEF1E1 , Eukaryotic translation elongation factor 1 epsilon 1), Genebank NM_002528 (NTHL1, Nth endonuclease III-like 1 (E. coli)), Genebank AF078847 (GTF2H2, General transcription factor IIH, polypeptide 2, 44kDa), Genebank NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene registration Genebank NM_001184 (ATR, Ataxia telangiectasia and Rad3 related), Genebank NM_001007233 (ERCC8, Excision repair cross-complementing rodent repair deficiency, complementation group 8), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank NM_000051 (ATM, Ataxia telangiectasia mutated (includes complementation groups A, C and D)), Genebank NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank AF061326 (C8orf1, Chromosome 8 open reading frame 1), Genebank AB028993 (NLGN1, Neuroligin 1) ), Genes, etc. Number (Genebank) NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), gene registration number (Genebank) BI494022 (GRLF1, Glucocorticoid receptor DNA binding factor 1), gene registration number (Genebank) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), Genebank NM_016835 (MAPT, Microtubule-associated protein tau), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, ( semaphorin) 3B), Genebank CR936770 (GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), Genebank (Genebank) NM_000304 (PMP22, Peripheral myelin protein 22), gene registry number (Genebank) AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans)), Gene Registration Number (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_058179 (PSAT1, Phosphoserine aminotransferase 1), Gene Registration Number (Genebank) AB209458 (SCLY, Selenocysteine lyase), Gene Registration Number (Genebank) BC065510 (CAD, Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase), gene registration number (Genebank) AK055053 (SHMT2, Serine hydroxymethyltransferase 2 (mitochondrial)), gene registration number (Genebank) NM_1334g (ASsyntase Asase Genebank AK022713 (Homo sapiens cDNA FLJ12651 fis, clone NT2RM4002062, moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12). [AK022713], unnamed protein product; Homo sapiens cDNA FLJ12651 fis, clone NT2RM400206 moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12).), Genebank XM_371677 (LOC389173, Similar to phosphoserine aminotransferase isoform 1), Genebank NM_005504 (BCAT1, Bran ched chain aminotransferase 1, cytosolic), gene accession number (Genebank) AK056980 (FLJ23441, Hypothetical protein FLJ23441), gene accession number (Genebank) L00972 (CBS, Cystathionine-beta-synthase), gene accession number (Genebank) NM_152334 (TARSL2, Threonyl-tRNA synthetase-like 2), gene registration number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), gene registration number (Genebank) NM_080820 (HARS2, Histidyl-tRNA synthetase 2), gene registration number (Genebank) X59303 (VARS2, Valyl-tRNA synthetase), Genebank Number (Genebank) NM_006567 (FARS2, Phenylalanine-tRNA synthetase 2 (mitochondrial)), Gene Registry Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Registration Number (Genebank) ) NM_015936 (CGI-04, Tyrosyl-tRNA synthetase 2 (mitochondrial)), gene registration number (Genebank) AB209246 (PPAT, Phosphoribosyl pyrophosphate amidotransferase), gene registration number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I) Enrollment Number (Genebank) NM_005881 (BCKDK, Branched chain ketoacid dehydrogenase kinase), Gene Registration Number (Genebank) NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene Registration Number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase, Genebank BC036421 (C9orf103, Chromosome 9 open reading frame 103), Genebank AK125213 (YARS, Tyrosyl-tRNA synthetase), Genebank (Genebank) AK027126 (ASS, Argininosuccinate synthetase), Gene Registration Number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) NM_001190 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) AK093306 (PHGDH, Phosphoglycerate dehydrogenase), Gene Registration Number (Genebank) AB067472 (VARS2L, Valyl-tRNA synthetase like), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2) (mitochondrial) Genebank NM_032484 (Homolog of mouse LGP1), BX648021 (B7-H4, V-set domain containing T cell activation inhibitor 1).

The inventors of the present invention, in order to find a biomarker for searching for teratogenic drugs, methotrexate, an anticancer drug showing teratogenicity to human placental choriocarcinoma cell line (JEG-3) to confirm cytotoxicity. As a result, it was confirmed that the methotrexate was toxic to human chorionic cancer cell line (JEG-3) (see FIG. 1), and the concentration for the treatment of methotrexate was determined based on the experiment.

Subsequently, methotrexate was treated to human chorionic cancer cell lines at the determined concentration, mRNA was isolated from the drug-treated cell line, and labeled with fluorescent substance Cy5 while synthesizing cDNA. It was. The fluorescently labeled cDNA was hybridized with a 44 k human whole genome oligomicroarray chip (Agilent, USA) and analyzed for differences in gene expression patterns by scanning fluorescent images (see FIGS. 2 and 3). In the analysis, when the median ratio (Cy5 / Cy3 ratio) was 2 times or more, it was classified as a gene with increased expression, and when it was 0.666 or less, it was classified as a gene with reduced expression. As a result, it was confirmed that the gene with increased expression was 0.58% (259 of 44,290 genes) and the gene with reduced expression was 0.19% (82 of 44,290 genes). At this time, apoptosis, pregnancy, angiogenesis, morphogenesis, inflammatory response, cell cycle arrest or Genes involved in neuron development were selected (see Table 2). The genes have not been reported to be toxic in human chorionic cancer cells when treated with methotrexate.

Then, the present inventors isolated the apoptosis, pregnancy, and angiogenesis-related genes of the genes and examined the expression pattern by real-time reverse transcript polymerase chain reaction (RT-PCR) method. As a result, it was confirmed that the expression of the seven genes appeared similar to the oligomicroarray chip results (see Table 4).

The present invention also provides a DNA microarray chip for teratogenicity-induced drug search in which an oligonucleotide comprising all or part of the biomarker sequence or its complementary strand oligonucleotide is integrated.

The oligonucleotide or its complementary oligonucleotide comprises 18 to 30 nucleic acids of the biomarker, preferably 20 to 25 nucleic acids.

DNA microarray chip for teratogenicity drug search of the present invention can be produced by methods known to those skilled in the art. The method of manufacturing the microarray chip is as follows. In order to immobilize the searched biomarker as a probe DNA molecule on a substrate of a DNA chip, a micropipetting method or a pin-shaped spotter using a piezoelectric method is used. It is preferable to use a used method and the like, but is not limited thereto. The substrate of the DNA microarray chip is preferably coated with one active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde, It is not limited to this. In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane, and nitrocellulose membrane, but is not limited thereto, and preferably, amino-silane-coated slide glass. Was used.

The present invention also provides a method for teratogenic drug discovery using the biomarker.

It provides a teratogenic drug search method comprising the following process of the present invention:

1) treating the test compound with human placental derived cells;

2) separating RNA from the experimental group cells treated with the test compound of step 1) and control cells not treated with the test compound;

3) synthesizing RNA of the experimental group and the control group of step 2) with cDNA and labeling the fluorescent substance of the experimental group and the control group, respectively;

4) hybridizing cDNA labeled with different fluorescent materials of step 3) with DNA microarray chip;

5) analyzing the reacted DNA microarray chip of step 4); And

6) confirming the expression level of the biomarker of the present invention in the analyzed data of step 5) compared to the control.

In the search method, the human placental-derived cells of step 1) are preferably human chorionic cancer cells, more preferably JEG-3, but is not limited thereto.

In the search method, the fluorescent material of step 3) is preferably selected from the group consisting of Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine). One is not limited thereto, and any fluorescent material known to those skilled in the art may be used.

In the search method, the DNA microarray chip of step 5) preferably uses Whole Human Genome Oligo Microarray (Agilent, USA) and the like, but is not limited thereto. Can be used as long as the microarray chip is loaded, and it is most preferable to use the DNA microarray chip produced by the present inventor. As for the analysis method of step 5), GenePix 4.1 software (Axon Instruments, USA) is preferably used, but is not limited thereto, and analysis software known to those skilled in the art may be used.

In addition, the present invention provides a method for teratogenic drug discovery comprising the following process:

1) treating the test compound with human placental derived cells;

2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound;

3) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 2) using a primer complementary to the biomarker of the present invention and capable of amplifying the biomarker; And

4) confirming the expression level by comparing the amplification product of step 3) with the control.

In the search method, the human placental-derived cells of step 1) are preferably human chorionic cancer cells, more preferably JEG-3, but is not limited thereto.

In the above search method, the primer of step 3) is complementary to the biomarker found in the present invention, and may be used as long as it is a primer designed to amplify the biomarker and the amplification product is 100 to 300 bp. In the present invention, 12 pairs of forward and reverse primers set forth in SEQ ID NOS: 1 to 24 are provided, but the present invention is not limited thereto.

In addition, the present invention provides a kit for teratogenicity-induced drug search comprising the DNA microarray chip.

The DNA microarray chip is preferably used by the method of the present invention, but is not limited thereto.

The search kit may further include human placental-derived cells, and the human placental-derived cells are preferably human chorionic cancer cells, and more preferably JEG-3, but is not limited thereto.

The search kit may further include a fluorescent material, and the fluorescent material may be composed of a streptadin-like phosphatease conjugate, a chemical fluorescence (chemiflurorensce), and a chemiluminescent material (chemiluminescent). Preferably, but not limited to selected from the group, in the preferred embodiment of the present invention used Cy3 and Cy5.

The detection kit may further include a reaction reagent, and the reaction reagent may be a buffer solution used for hybridization, reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), and chemical fluorescence staining agents. It may be composed of a labeling reagent such as an inducing agent, a washing buffer, and the like, but is not limited thereto, and may include all reaction reagents required for hybridization of DNA microarray chips known to those skilled in the art.

In addition, the present invention provides a kit for teratogenic drug search comprising a primer that is complementary to the biomarker and capable of amplifying the biomarker.

Preferably, the primers use two or more forward and reverse primer pairs selected from the group consisting of sequences represented by SEQ ID NOs: 1 to 24, but are not limited thereto, and are complementary to the biomarkers and amplify the biomarkers. Both forward and reverse primer pairs designed to be 100 to 300bp can be used.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1> Cell Culture and Chemical Treatment

<1-1> Cell Culture

Human chorionic cancer cell line JEG-3 cells (KCLB No. 30036, Korean Cell Line Bank, Korea) were cultured in 100 mm Dish with DMEM medium (Dulbecco's Modified Eagle Medium, GIBCO, USA) to which 10% FBS was added. The present inventors have selected methotrexate (Sigma aldrich M8407, 59-05-2), which is a representative drug having teratogenicity as a side effect, through conventional studies and reports, and dissolved in sterile distilled water. Vehicle concentration was less than 0.1% in all experiments.

<1-2> cytotoxicity test ( MTT assay ) And chemical processing

MTT experiments using JEG-3 cells were performed by the method of Mossman et al . ( J. Immunol . Methods , 65, 55-63, 1983). Cells were treated with methotrexate dissolved in sterile distilled water in DMEM medium (Dulbecco's Modified Eagle Medium, GIBCO, USA) at 5 × 10 ⁴ / well cell number in 24-well plates, and after 48 hours, MTT (3- (4,5) 75 µl of 4 mg / ml of -dimethylthiazol-2,5-diphenyltetra zolium bromide) were mixed and incubated for 3 hours at 37 ° C. After that, the medium was removed and the formed formazan crystal was dissolved in 500 µl of DMSO. was. the OD value in the following 96- well plates by dispensing 100 ㎕ (aliquot) and transferred to the absorbance 540 nm was measured. the concentration showing a result, the 70% survival rate examined the cytotoxicity of methotrexate in the JEG-3 cell line (IC ₃₀ ) Was 4.570 mM (FIG. 1), determined by the concentration, and microarray experiments were performed.

< Example  2> Microarray  Experiment

<2-1> target RNA Isolation and Labeling of Fluorescent Materials

After dispensing JEG-3 cells in a 100 mm dish at a concentration of 1.8 × 10 ⁶ cells / ml, the cells were treated for 48 hours at the concentration of methotrexate determined in Example <1-2>. Thereafter, the whole cells were separated from the treated cells using a trizol reagent (Invitrogen life technologies, USA) according to the manufacturer's method, and purified using the RNeasy mini kit (Qiagen, USA). Genome DNA was removed using RNase-free DNase set (Qiagen, USA) during RNA purification. The amount of each total RNA sample was measured by spectrophotometer, and the purity was confirmed by Agilent Human 44K Bioanalyzer (Agilent Technologies, USA).

<2-2> Labeled cDNA  Produce

CDNA was prepared using total RNA of the methotrexate treatment group obtained in Example 2-1 for oligo microarray analysis. The obtained total RNA 30 ㎍ and oligo (dT) primer 2 ㎍ (1 ㎍ / ㎕) was mixed and reacted for 10 minutes at 65 ℃ immediately annealed on ice. Reagents were mixed as shown in Table 1 for Reverse Transcript reaction of the annealed RNA.

Configuration Volume (μl) 5X first strand buffer 6 dNTPs 0.6 0.1 M DDT 3 SuperScript II enzyme 3 Cy-3 or Cy-5 dUTP 2

Total RNA isolated from the control JEG-3 cell line was labeled with Cy3-dUTP (green), and RNA isolated from methotrexate treated JEG-3 cell line was labeled with Cy5-dUTP (red). At this time, the two samples were mixed and purified using a Microcon YM-30 column (Millipore, USA).

<2-3> Hybridization  reaction

Hybridization and washing procedures were carried out according to the instructions of Genome Co., Ltd .. Hybridization was performed in a 62 ° C. oven for 12 hours. A 44 k Whole Human Genome oligo microarray (Agilent, USA) was used as the DNA microarray chip. After washing (washing in 2XSSC / 0.1% SDS for 2 minutes, washing in 1XSSC for 3 minutes and 0.2XSSC for 2 minutes), the slides were dried by centrifugation at 800 rpm for 3 minutes.

<2-4> Fluorescence Image Acquisition

Hybridization images on the slides were scanned with the Genepix 4000B (Axon Instruments, USA). Chips washed with unbound genes were obtained with a fluorescence image using a laser fluorescence scanner. In this case, the green fluorescence image in the control group, the red fluorescence image represents the activity level of the gene specifically expressed only in the experimental group, and the yellow fluorescence image is the complementary color of green and red, which means that there is no significant difference between the two groups. Scanned images were analyzed with GenePix 4.1 software (Axon Instruments, USA) to obtain gene expression rates. Biomarkers for methotrexate were selected from the data thus obtained (FIGS. 2 and 3).

As a result, among the approximately 44,000 genes present on the oligo chip, 0.58% (44,290) of the genes showed an increase in the expression of the median ratio (Cy5 / Cy3 ratio) by 1.5 times or more by methotrexate treatment. 259 of the genes), and the gene showing a decrease in gene expression up to 0.666-fold was 0.19% (82 of 44,290 genes).

At this time, when the genes whose expression is significantly changed by methotrexate are classified by function, pregnancy, apoptosis, inflammatory response, morphogenesis, and cellular which are judged to function on teratogenicity Cell Cycle arrest, angiogenesis, Cell cycle arrest, Cell migration, Regulation of signal transduction, Regulation of neurotransmitter levels Genes related to DNA repair, cell development, amino acid metabolism or neuron development were selected (see Table 2). There are no reports that these genes are associated with toxicity in human chorionic cancer cells when treated with methotrexate used in the present invention.

Gene whose expression is increased by methotrexate Registration Number ( GeneBank ) Gene abbreviation Gene name Ratio of medians (a) pregnancy Pregnancy ) AF537113 TAC3 Tachykinin 3 (neuromedin K, neurokinin beta) 11.67 AJ224867 Homo sapiens mRNA for GNAS1 protein (IMAGE cDNA clone 359933 (827-k06)). [AJ224867] 3.35 AK074734 FCGRT Fc fragment of IgG, receptor, transporter, alpha 4.37 NM_001856 COL16A1 Collagen, type XVI, alpha 1 4.35 CR606430 PSG11 Pregnancy specific beta-1-glycoprotein 11 10.53 AK075446 P11 26 serine protease 19.89 NM_003214 TEAD3 TEA domain family member 3 2.63 NM_001031850 PSG6 Pregnancy specific beta-1-glycoprotein 6 3.39 CR606280 PSG5 Pregnancy specific beta-1-glycoprotein 5 2.11 NM_005059 RLN2 Relaxin 2 3.23 BC064698 TFCP2L1 Transcription factor CP2-like 1 2.10 BC005956 RLN1 Relaxin 1 3.01 NM_000029 AGT Angiotensinogen (serpin peptidase inhibitor, clade A, member 8) 2.68 BC063127 PSG4 Pregnancy specific beta-1-glycoprotein 4 7.34 NM_001124 ADM Adrenomedullin 4.20 AK092458 PSG1; DKFZp781L10202 Pregnancy specific beta-1-glycoprotein 8 7.01 M23575 PSG3 Pregnancy specific beta-1-glycoprotein 3 13.49 NM_001712 CEACAM1 Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) 10.79 NM_031246 PSG2 Pregnancy specific beta-1-glycoprotein 2 12.62 AK097048 CLIC5 Chloride intracellular channel 5 2.36 CR601901 INSL4 Insulin-like 4 (placenta) 6.50 (b) apoptosis ( Apoptosis ) NM_000875 IGF1R Insulin-like growth factor 1 receptor 2.09 NM_004613 TGM2 Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 9.31 NM_198951 TGM2 Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 8.00 NM_004613 TGM2 Transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 9.31 NM_001007232 INCA Inhibitory caspase recruitment domain (CARD) protein 2.63 AK094322 CKMT; CKMT1; UMTCK Creatine kinase, mitochondrial 1B 2.58 NM_203339 CLU Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J) 5.90 BX386171 CGB5 Chorionic gonadotropin, beta polypeptide 8 2.08 NM_003841 TNFRSF10C Tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain 2.46 BC063507 HSPA1B Heat shock 70kDa protein 1B 2.17 AL050391 CASP4 Caspase 4, apoptosis-related cysteine peptidase 2.19 NM_001167 BIRC4 Baculoviral IAP repeat-containing 4 2.10 NM_004155 SERPINB9 Serpin peptidase inhibitor, clade B (ovalbumin), member 9 4.04 CR613579 GADD45G Growth arrest and DNA-damage-inducible, gamma 3.26 NM_001015049 BAG5 BCL2-associated athanogene 5 2.11 BC033694 BCL2L11 BCL2-like 11 (apoptosis facilitator) 2.46 BX640923 MDM4 Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse) 2.22 AY358836 BIRC7 Baculoviral IAP repeat-containing 7 (livin) 3.46 AK129595 GADD45B Growth arrest and DNA-damage-inducible, beta 3.01 AK125880 TP53INP1 Tumor protein p53 inducible nuclear protein 1 2.83 BC052977 TNFRSF1B Tumor necrosis factor receptor superfamily, member 1B 3.89 BC047362 PHLDA1 Pleckstrin homology-like domain, family A, member 1 2.19 U67156 MAP3K5 Mitogen-activated protein kinase kinase kinase 5 2.07 NM_012479 YWHAG Tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activation protein, gamma polypeptide 2.24 NM_004226 STK17B Serine / threonine kinase 17b (apoptosis-inducing) 2.42 NM_012324 MAPK8IP2 Mitogen-activated protein kinase 8 interacting protein 2 2.44 BM920134 COPl Caspase-1 dominant-negative inhibitor pseudo-ICE 6.54 NM_005505 SCARB1 Scavenger receptor class B, member 1 4.31 NM_003842 TNFRSF10B Tumor necrosis factor receptor superfamily, member 10b 2.26 NM_000878 IL2RB Interleukin 2 receptor, beta 3.10 NM_003840 TNFRSF10D Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain 3.57 NM_000875 IGF1R Insulin-like growth factor 1 receptor 2.09 AF020763 IGF1R Insulin-like growth factor 1 receptor 3.26 NM_004862 LITAF Lipopolysaccharide-induced TNF factor 2.86 NM_005505 SCARB1 Scavenger receptor class B, member 1 3.58 AB209436 SCARB1 Scavenger receptor class B, member 1 3.24 AK092808 RRAGC Ras-related GTP binding C 3.41 BC089389 IHPK3 Inositol hexaphosphate kinase 3 12.24 NM_148957 TNFRSF19 Tumor necrosis factor receptor superfamily, member 19 3.38 NM_002744 PRKCZ Protein kinase C, zeta 2.35 NM_002744 PRKCZ Protein kinase C, zeta 2.35 AB007974 PKC2 protein kinase C, zeta 2.35 NM_021960 MCL1 Myeloid cell leukemia sequence 1 (BCL2-related) 2.09 NM_003842 TNFRSF10B Tumor necrosis factor receptor superfamily, member 10b 2.26 NM_000878 IL2RB Interleukin 2 receptor, beta 3.10 NM_003840 TNFRSF10D Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain 3.57 AF020763 IGF1R Insulin-like growth factor 1 receptor 3.26 NM_004574 Septin 4 4.57 NM_004862 LITAF Lipopolysaccharide-induced TNF factor 2.86 BX649005 SGK Serum / glucocorticoid regulated kinase 3.24 NM_006290 TNFAIP3 Tumor necrosis factor, alpha-induced protein 3 2.62 AK124173 CDNA FLJ42179 fis, clone THYMU2030796 10.94 BX537586 STK17A Serine / threonine kinase 17a (apoptosis-inducing) 3.35 BC012609 SERPINB2 Serpin peptidase inhibitor, clade B (ovalbumin), member 2 4.96 NM_001621 AHR Aryl hydrocarbon receptor 2.32 AK122828 CIDEB Cell death-inducing DFFA-like effector b 2.03 AK223503 CASP1 Caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) 8.49 NM_033027 AXUD1 AXIN1 up-regulated 1 2.55 AW057563 Unknown Transcribed locus 2.57 NM_003311 PHLDA2 Pleckstrin homology-like domain, family A, member 2 7.41 NM_001165 BIRC3 Baculoviral IAP repeat-containing 3 2.66 BX641114 ANXA4 Annexin A4 2.18 NM_001731 BTG1 B-cell translocation gene 1, anti-proliferative 2.50 AI076466 BTG1 B-cell translocation gene 1, anti-proliferative 2.27 CN478604 LGALS7 Lectin, galactoside-binding, soluble, 7 3.40 NM_004281 BAG3 BCL2-associated athanogene 3 2.22 AY125488 DEDD2 Death effector domain containing 2 2.86 AL713801 SLAMF7 SLAM family member 7 3.57 AK096267 LOC90525 Src homology 2 domain containing F 3.49 NM_000639 FASLG Fas ligand (TNF superfamily, member 6) 3.02 AK025273 EGLN3 Egl nine homolog 3 (C. elegans) 6.93 BC042844 CASP10 Caspase 10, apoptosis-related cysteine peptidase 2.24 AB007974 PKC2 protein kinase C, zeta 2.35 AB029551 RYBP RING1 and YY1 binding protein 2.80 AB209436 SCARB1 Scavenger receptor class B, member 1 3.24 AB209534 TRA1 Tumor rejection antigen (gp96) 1 2.56 AB209613 DNASE1L3 Deoxyribonuclease I-like 3 2.02 AF020763 IGF1R Insulin-like growth factor 1 receptor 3.26 AF332558 BBC3 BCL2 binding component 3 3.45 AI076466 BTG1 B-cell translocation gene 1, anti-proliferative 2.27 AB096256 UNC5B Unc-5 homolog B (C. elegans) 2.18 AK001361 PPP1R15A Protein phosphatase 1, regulatory (inhibitor) subunit 15A 2.22 AI376429 TNFSF10 Tumor necrosis factor (ligand) superfamily, member 10 2.36 (c) inflammatory reactions ( Inflammatory response) NM_006665 HPSE Heparanase 4.62 X02812 TGFB1 Transforming growth factor, beta 1 (Camurati-Engelmann disease) 4.61 BC037961 IL8RB Interleukin 8 receptor, beta 7.48 AK127123 TOLLIP Toll interacting protein 2.03 NM_001002029 C4A Complement component 4B, telomeric 5.04 NM_002987 CCL17 Chemokine (C-C motif) ligand 17 5.21 NM_003596 TPST1 Tyrosylprotein sulfotransferase 1 2.44 U83171 CCL22 Chemokine (C-C motif) ligand 22 2.78 NM_001643 APOA2 Apolipoprotein A-II 4.14 NM_000625 NOS2A Nitric oxide synthase 2A (inducible, hepatocytes) 4.84 BQ927179 S100A9 S100 calcium binding protein A9 (calgranulin B) 2.59 NM_020820 PREX1 Phosphatidylinositol 3,4,5-trisphosphate-dependent RAC exchanger 1 3.23 CD013879 PTAFR Platelet-activating factor receptor 2.91 NM_002504 NFX1 Nuclear transcription factor, X-box binding 1 2.06 NM_173842 IL1RN Interleukin 1 receptor antagonist 4.74 NM_005408 CCL13 Chemokine (C-C motif) ligand 13 2.63 NM_013314 BLNK B-cell linker 2.32 NM_000634 IL8RA Interleukin 8 receptor, alpha 9.18 NM_006404 PROCR Protein C receptor, endothelial (EPCR) 8.93 NM_002182 IL1RAP Interleukin 1 receptor accessory protein 2.90 AY499342 IL31RA Interleukin 31 receptor A 1.91 M27492 IL1R1 Interleukin 1 receptor, type I 3.42 CR749338 BDKRB2 Bradykinin receptor B2 2.45 NM_007115 TNFAIP6 Tumor necrosis factor, alpha-induced protein 6 7.80 CR595353 CD74 CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) 11.86 AK074480 ANXA1 Annexin A1 3.95 NM_001838 CCR7 Chemokine (C-C motif) receptor 7 4.46 NM_001295 CCR1 Chemokine (C-C motif) receptor 1 2.20 NM_000963 PTGS2 Prostaglandin G-H synthase and cyclooxygenase 3.13 AF076494 IRF7 Interferon regulatory factor 7 2.04 AF186094 IL1F5 Interleukin 1 family, member 5 (delta) 2.74 AF189279 PLA2G2E Phospholipase A2, group IIE 2.40 AF200494 IL1F8 Interleukin 1 family, member 8 (eta) 3.16 NM_001015053 HDAC5 Histone deacetylase 5 2.08 NM_005283 XCR1 Chemokine (C motif) receptor 1 3.53 (d) morphology ( Morphogenesis) NM_005245 FAT FAT tumor suppressor homolog 1 (Drosophila) 3.64 AF373867 TBX1 T-box 1 4.45 BC010091 BICD bicaudal D homolog 1 (Drosophila) 4.13 NM_012396 PHLDA3 Pleckstrin homology-like domain, family A, member 3 2.73 NM_016569 TBX3 T-box 3 (ulnar mammary syndrome) 4.00 NM_000307 POU3F4 POU domain, class 3, transcription factor 4 3.82 NM_004235 KLF4 Kruppel-like factor 4 (gut) 3.27 NM_000118 ENG Endoglin (Osler-Rendu-Weber syndrome 1) 2.47 NM_032951 WBSCR14 MLX interacting protein-like 5.61 AK124904 FGD6 FYVE, RhoGEF and PH domain containing 6 2.42 NM_001003408 ABLIM1 Actin binding LIM protein 1 4.79 AK096284 LFNG Lunatic fringe homolog (Drosophila) 2.21 AL833276 ALPK3 Alpha-kinase 3 3.01 NM_000037 ANK1 Ankyrin 1, erythrocytic 3.37 NM_003643 GCM1 Glial cells missing homolog 1 (Drosophila) 2.09 NM_002653 PITX1 Paired-like homeodomain transcription factor 1 2.29 AK131071 SLC31A2 Solute carrier family 31 (copper transporters), member 2 5.37 NM_001874 CPM Carboxypeptidase M 2.23 BC087839 CTGF Connective tissue growth factor 6.31 NM_002774 KLK6 Kallikrein 6 (neurosin, zyme) 4.99 NM_020127 TUFT1 Tuftelin 1 2.08 AK095632 ABTB2 Ankyrin repeat and BTB (POZ) domain containing 2 4.65 NM_018695 ERBB2IP Erbb2 interacting protein 3.06 NM_003955 SOCS3 Suppressor of cytokine signaling 3 2.62 NM_000899 KITLG KIT ligand 7.12 AK127621 SOCS1 Suppressor of cytokine signaling 1 3.34 NM_017556 FBLP-1 Filamin binding LIM protein 1 3.57 NM_002826 QSCN6 Quiescin Q6 2.17 Y11307 CYR61 Cysteine-rich, angiogenic inducer, 61 4.93 AY211386 FGD3 FYVE, RhoGEF and PH domain containing 3 2.44 AK092391 CST6 Cystatin E / M 4.90 NM_003897 IER3 Immediate early response 3 6.66 X54457 CEL Carboxyl ester lipase (bile salt-stimulated lipase) 13.32 NM_016291 IHPK2 Inositol hexaphosphate kinase 2 2.26 BC070068 HECA Headcase homolog (Drosophila) 2.31 NM_000224 KRT18 Keratin 18 3.06 CR616919 KRT18 Keratin 18 2.41 AK097304 LR8 LR8 protein 3.89 NM_001012661 SLC3A2 Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 3.84 BM913048 TIMP1 TIMP metallopeptidase inhibitor 1 2.89 AK027294 WISP1 WNT1 inducible signaling pathway protein 1 2.15 NM_006291 TNFAIP2 Tumor necrosis factor, alpha-induced protein 2 5.06 NM_001024807 APLP1 Amyloid beta (A4) precursor-like protein 1 10.52 NM_153609 TMPRSS6 Transmembrane protease, serine 6 6.70 AY258066 OKL38 Pregnancy-induced growth inhibitor 2.10 NM_014590 ERVWE1 Endogenous retroviral family W, env (C7), member 1 (syncytin) 8.82 NM_002448 MSX1 Msh homeo box homolog 1 (Drosophila) 3.00 AJ303079 PALM2-AKAP2 Paralemmin 2 2.04 NM_031483 ITCH Itchy homolog E3 ubiquitin protein ligase (mouse) 2.75 BX391158 Transcribed locus, weakly similar to NP_075380.1 reticulon 4 receptor precursor; nogo receptor; Nogo-66 receptor; UNQ330 / PRO526 [Homo sapiens] 3.39 AB209095 CDC2L2 Cell division cycle 2-like 2 (PITSLRE proteins) 2.08 BX649103 ChGn Chondroitin beta1,4 N-acetylgalactosaminyltransferase 3.46 NM_002702 POU6F1 POU domain, class 6, transcription factor 1 2.15 AB209321 CSRP2 Cysteine and glycine-rich protein 2 2.08 AF075292 FGF18 Fibroblast growth factor 18 6.95 AF132297 CISH Cytokine inducible SH2-containing protein 3.35 AF167706 CRIM1 Cysteine rich transmembrane BMP regulator 1 (chordin-like) 2.34 AL137318 ERBB2IP Erbb2 interacting protein 2.51 AK021858 FOXC1 Forkhead box C1 3.32 (e) cell cycle interference ( Cell cycle arrest) NM_020418 PCBP4 Poly (rC) binding protein 4 2.90 NM_003884 PCAF P300 / CBP-associated factor 2.52 CR612719 GADD45A Growth arrest and DNA-damage-inducible, alpha 3.69 D86987 MFN2 Mitofusin 2 2.63 NM_201433 GAS7 Growth arrest-specific 7 3.44 AK127230 CDNA FLJ45297 fis, clone BRHIP3003395 2.09 AY123223 SESN2 Sestrin 2 2.12 NM_078467 CDKN1A Cyclin-dependent kinase inhibitor 1A (p21, Cip1) 15.42 NM_033044 MACF1 Microtubule-actin crosslinking factor 1 2.84 AB209869 ERN1 Endoplasmic reticulum to nucleus signaling 1 3.56 NM_002191 INHA Inhibin, alpha 4.82 BC067842 CDKN1C Cyclin-dependent kinase inhibitor 1C (p57, Kip2) 10.67 S62138 DDIT3 DNA-damage-inducible transcript 3 2.54 NM_078487 CDKN2B Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 2.46 AB209869 ERN1 Endoplasmic reticulum to nucleus signaling 1 3.56 AF033122 SESN1 Sestrin 1 2.48 AF211119 CDKN2A Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) 5.50 (f) angiogenesis Angiogenesis) NM_000800 FGF1 Fibroblast growth factor 1 (acidic) 7.67 NM_002632 PGF Placental growth factor, vascular endothelial growth factor-related protein 6.09 AK075219 ANGPT2 Angiopoietin 2 2.53 NM_001430 EPAS1 Endothelial PAS domain protein 1 3.98 AK024680 CDNA: FLJ21027 fis, clone CAE07110 3.95 X96753 CSPG4 Chondroitin sulfate proteoglycan 4 (melanoma-associated) 2.09 AL833606 NRP2 Neuropilin 2 2.74 NM_018534 NRP2 Neuropilin 2 4.14 AK095578 SPHK1 Sphingosine kinase 1 3.60 AK025719 IGF2 Insulin-like growth factor 2 (somatomedin A) 2.53 NM_002521 NPPB Natriuretic peptide precursor B 5.62 (g) cell migration ( Cell migration) BX647459 SERPINE2 Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 2.20 BC030792 CDK5R1 Cyclin-dependent kinase 5, regulatory subunit 1 (p35) 2.01 AB208909 ITGB2 Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) 3.69 AF003837 JAG1 Jagged 1 (Alagille syndrome) 5.74 AF480883 PPAP2B Phosphatidic acid phosphatase type 2B 2.64 NM_015366 PRR5; PP610; FLJ20185 Rho GTPase activating protein 8 2.25 AK126486 WBSCR20B Williams-Beuren Syndrome critical region protein 20 copy B 2.03 CR604926 CaMKIINalpha Calcium / calmodulin-dependent protein kinase II inhibitor 1 2.68 BC050456 THBS4 Thrombospondin 4 2.66 (h) control of signaling; Regulation of signal transduction) NM_016463 CXXC5 CXXC finger 5 2.07 NM_003004 SECTM1 Secreted and transmembrane 1 2.69 R52269 RGS3 Regulator of G-protein signaling 3 3.42 BC034950 TBK1 TANK-binding kinase 1 2.03 AF059617 PLK2 Polo-like kinase 2 (Drosophila) 2.88 NM_005415 SLC20A1 Solute carrier family 20 (phosphate transporter), member 1 2.41 NM_213590 RFP2 Ret finger protein 2 2.35 BC042755 RGS2 Regulator of G-protein signaling 2, 24kDa 9.24 AK097205 ECM1 Extracellular matrix protein 1 5.65 AF227516 SPRY4 Sprouty homolog 4 (Drosophila) 3.47 (i) regulation of neuron levels; Regulation of neurotransmitter levels) BX647341 TDO2 Tryptophan 2,3-dioxygenase 8.35 NM_001045 SLC6A4 Solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 2.70 NM_003490 SYN3 Synapsin III 2.34 NM_000240 MAOA Monoamine oxidase A 2.03 AK126731 GLCCI1 Glucocorticoid induced transcript 1 2.84 NM_080542 COLQ Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase 6.90 BQ054887 GCHFR GTP cyclohydrolase I feedback regulator 2.75 NM_005629 SLC6A8 Solute carrier family 6 (neurotransmitter transporter, creatine), member 8 2.11 AB018258 ATP10B ATPase, Class V, type 10B 4.95 Y18483 SLC7A8 Solute carrier family 7 (cationic amino acid transporter, y + system), member 8 3.76 NM_000735 CGA Glycoprotein hormones, alpha polypeptide 8.07 NM_181659 NCOA3 Nuclear receptor coactivator 3 2.06 AK023574 SLC40A1 Solute carrier family 40 (iron-regulated transporter), member 1 3.06 AK095632 ABTB2 Ankyrin repeat and BTB (POZ) domain containing 2 4.65 BC036890 TFCP2L4 Grainyhead-like 3 (Drosophila) 4.11

Genes whose expression is reduced by methotrexate Registration Number ( GeneBank ) Gene abbreviation Gene name Ratio of medians (a) neuron development Neuron development) NM_175607 CNTN4 Contactin 4 0.31 NM_000216 KAL1 Kallmann syndrome 1 sequence 0.43 NM_016835 MAPT Microtubule-associated protein tau 0.38 AB028993 NLGN1 Neuroligin 1 0.25 AB209322 SEMA3B Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B 0.48 CR936770 GNAO1 Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O 0.49 NM_133631 ROBO1 Roundabout, axon guidance receptor, homolog 1 (Drosophila) 0.39 NM_005103 FEZ1 Fasciculation and elongation protein zeta 1 (zygin I) 0.43 NM_000304 PMP22 Peripheral myelin protein 22 0.43 AF196185 PARD3 Par-3 partitioning defective 3 homolog (C. elegans) 0.28 NM_080881 DBN1 Drebrin 1 0.44 (b) DNA  restore( DNA repair) NM_013975 LIG3 Ligase III, DNA, ATP-dependent 0.49 BX248766 RAD51L1 RAD51-like 1 (S. cerevisiae) 0.43 CR611116 APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 0.33 BC005077 FANCF Fanconi anemia, complementation group F 0.40 NM_022725 FANCF Fanconi anemia, complementation group F 0.49 D42045 DCLRE1A DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) 0.43 U63139 RAD50 RAD50 homolog (S. cerevisiae) 0.36 AK122825 HMGB1 High-mobility group box 1 0.37 AB067472 VARS2L Valyl-tRNA synthetase like 0.46 AK057498 RUVBL2 RuvB-like 2 (E. coli) 0.42 BX640816 NBS1 Nibrin 0.31 AK092872 ERCC2 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) 0.40 AK092872 ERCC2 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) 0.40 NM_006230 POLD2 Polymerase (DNA directed), delta 2, regulatory subunit 50kDa 0.29 NM_006230 POLD2 Polymerase (DNA directed), delta 2, regulatory subunit 50kDa 0.29 NM_002412 MGMT O-6-methylguanine-DNA methyltransferase 0.48 NM_007313 ABL1 V-abl Abelson murine leukemia viral oncogene homolog 1 0.49 NM_003362 UNG Uracil-DNA glycosylase 0.41 AF078164 KUB3 Ku70-binding protein 3 0.45 NM_004280 EEF1E1 Eukaryotic translation elongation factor 1 epsilon 1 0.46 NM_002528 NTHL1 Nth endonuclease III-like 1 (E. coli) 0.42 AF078847 GTF2H2 General transcription factor IIH, polypeptide 2, 44kDa 0.44 NM_007215 POLG2 Polymerase (DNA directed), gamma 2, accessory subunit 0.45 NM_001184 ATR Ataxia telangiectasia and Rad3 related 0.41 NM_001007233 ERCC8 Excision repair cross-complementing rodent repair deficiency, complementation group 8 0.41 BM467105 CIB1 Calcium and integrin binding 1 (calmyrin) 0.44 BM467105 CIB1 Calcium and integrin binding 1 (calmyrin) 0.44 NM_000051 ATM Ataxia telangiectasia mutated (includes complementation groups A, C and D) 0.48 (c) cell development ( Cell development) NM_000216 KAL1 Kallmann syndrome 1 sequence 0.43 AF061326 C8orf1 Chromosome 8 open reading frame 1 0.46 AB028993 NLGN1 Neuroligin 1 0.25 NM_133631 ROBO1 Roundabout, axon guidance receptor, homolog 1 (Drosophila) 0.39 BI494022 GRLF1 Glucocorticoid receptor DNA binding factor 1 0.34 NM_024342 GRLF1 Glucocorticoid receptor DNA binding factor 1 0.28 NM_175607 CNTN4 Contactin 4 0.31 NM_016835 MAPT Microtubule-associated protein tau 0.38 AB209322 SEMA3B Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B 0.48 CR936770 GNAO1 Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O 0.49 NM_000304 PMP22 Peripheral myelin protein 22 0.43 AF196185 PARD3 Par-3 partitioning defective 3 homolog (C. elegans) 0.28 NM_080881 DBN1 Drebrin 1 0.44 (d) amino acid metabolism ( Amino acid metabolism) NM_058179 PSAT1 Phosphoserine aminotransferase 1 0.31 AB209458 SCLY Selenocysteine lyase 0.41 BC065510 CAD Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase 0.40 AK055053 SHMT2 Serine hydroxymethyltransferase 2 (mitochondrial) 0.42 NM_133436 ASNS Asparagine synthetase 0.33 AK022713 unnamed protein product; Homo sapiens cDNA FLJ12651 fis, clone NT2RM4002062, moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12). 0.21 XM_371677 LOC389173 Similar to phosphoserine aminotransferase isoform 1 0.27 NM_005504 BCAT1 Branched chain aminotransferase 1, cytosolic 0.12 AK056980 FLJ23441 Hypothetical protein FLJ23441 0.41 L00972 CBS Cystathionine-beta-synthase 0.47 NM_152334 TARSL2 Threonyl-tRNA synthetase-like 2 0.36 AK023909 BCAT2 Branched chain aminotransferase 2, mitochondrial 0.35 NM_080820 HARS2 Histidyl-tRNA synthetase 2 0.26 X59303 VARS2 Valyl-tRNA synthetase 0.33 NM_006567 FARS2 Phenylalanine-tRNA synthetase 2 (mitochondrial) 0.46 AK122685 GLUD1 Glutamate dehydrogenase 1 0.34 NM_015936 CGI-04 Tyrosyl-tRNA synthetase 2 (mitochondrial) 0.47 AB209246 PPAT Phosphoribosyl pyrophosphate amidotransferase 0.44 NM_001801 CDO1 Cysteine dioxygenase, type I 0.45 NM_005881 BCKDK Branched chain ketoacid dehydrogenase kinase 0.48 NM_007215 POLG2 Polymerase (DNA directed), gamma 2, accessory subunit 0.45 NM_001698 AUH AU RNA binding protein / enoyl-Coenzyme A hydratase 0.39 BC036421 C9orf103 Chromosome 9 open reading frame 103 0.38 AK125213 YARS Tyrosyl-tRNA synthetase 0.38 AK027126 ASS Argininosuccinate synthetase 0.19 AK023909 BCAT2 Branched chain aminotransferase 2, mitochondrial 0.35 NM_001190 BCAT2 Branched chain aminotransferase 2, mitochondrial 0.38 AK093306 PHGDH Phosphoglycerate dehydrogenase 0.16 AB067472 VARS2L Valyl-tRNA synthetase like 0.46 NM_018122 FLJ10514 Aspartyl-tRNA synthetase 2 (mitochondrial) 0.38 NM_032484 LGP1 Homolog of mouse LGP1 0.49 BX 648021 B7-H4 V-set domain containing T cell activation inhibitor 1 0.27

< Example  3> Real time RT - PCR (Real - time reverse transcriptase polymerase chain  reaction)

Among genes overexpressed and underexpressed in Example 2, which were induced by teratogenicity-inducing drugs, mechanism-related genes such as signaling, transport, and transcription were selected. These genes are genebank NM_181659 (Nuclear receptor coactivator 3), genebank NM_000735 (Glycoprotein hormones, alpha polypeptide), genebank BC042755 (Regulator of G-protein signaling 2, 24kDa) , Gene Registration Number (Genebank) AB018258 (ATPase, Class V, type 10B), Gene Registration Number (Genebank) Y18483 [Solute carrier family 7 (cationic amino acid transporter, y + system), member 8], Gene Registration Number (Genebank) BC036890 [Grainyhead-like 3 (Drosophila)], Genebank NM_032484 (Homolog of mouse LGP1), Genebank AK095632 [Ankyrin repeat and BTB (POZ) domain containing 2], Genebank (Genebank) ) AK126731 (Glucocorticoid induced transcript 1), Genebank AK023574 [Solute carrier family 40 (iron-regulated transporter), member 1] and Genebank BX648021 (V-set domain containing T cell activation inhibitor 1 ) to be.

Quantitative real-time RT-PCR was performed using My IQ Real-time PCR (Bio-rad, USA) to investigate and quantify the expression changes of the genes.

Specifically, cDNA was synthesized by performing reverse transcription using an oligo dT primer and a Superscript kit (Omniscipt ™ kit, Qiagen, Co., USA). 0.2 μl of the cDNA, 3.8 μl of water, 0.5 μl of sense primer, 0.5 μl of antisense primer, 5 μl of Cyberrin I stained supermix (Bio-rad, USA), mixed in a PCR tube, Step 1: 95 ° C., 3 minutes ; Step 2 (repeat 45): Step 2-1: 95 ° C., 10 seconds; Step 2-2: 55 to 65 ° C. 45 seconds; Step 3: 95 ° C., 1 minute; Step 4: 55 ° C., 1 minute; Step 5 (80 repetitions): The reaction was performed on a My IQ real-time PCR machine designed program at 55 ° C., 10 seconds. To quantify the PCR products were stained with SYBR Green I stain (Bio-rad, USA). Cyberrin I staining is a staining method that binds to double-stranded DNA. As the double-stranded DNA is generated during PCR, the fluorescence intensity increases. First, primers for the target gene and endogenous control (GAPDH) used for PCR were added to the Cyberrin master mix, followed by PCR, followed by a primer optimization process to select an appropriate concentration. Was performed. Synthesized cDNA samples and each primer (Table 4) were mixed, PCR was performed after the addition of the Cyberrin master mix and analyzed using quantification software (Table 5).

Primer sequence Registration Number (GeneBank) Gene name PCR primer sequence (5 '-> 3') Primer reaction temperature (℃) AK126731 Glucocorticoid induced transcript 1 Sense (SEQ ID NO: 1) GCATGAAAGACAAAGCTACTCAGA 57 Antisense (SEQ ID NO: 2) GAACGCTGATGTGACCTCTTT AK023574 Solute carrier family 40 (iron-regulated transporter), member 1 Sense (SEQ ID NO: 3) CGAGATGGATGGGTCTCCTA 58.7 Antisense (SEQ ID NO: 4) GCTGATGCTCCCATCAAAAT BX648021 V-set domain containing T cell activation inhibitor 1 Sense (SEQ ID NO: 5) TGCACTCATCATTGGCTTTG 55 Antisense (SEQ ID NO: 6) TTCAAAAGTGCAGCTCAGGA NM_181659 Nuclear receptor coactivator 3 Sense (SEQ ID NO: 7) GGTAGGCGGCATGAGTATGTC 64.3 Antisense (SEQ ID NO: 8) TGTTACTGGAACCCCCATACCT NM_000735 Glycoprotein hormones, alpha polypeptide Sense (SEQ ID NO: 9) ATTCCGCTCCTGATGTGC 55 Antisense (SEQ ID NO: 10) GCCCATGCACTGAAGTATTG BC042755 Regulator of G-protein signaling 2, 24kDa Sense (SEQ ID NO: 11) CAACTGCCCAGAAAAGGGTA 57 Antisense (SEQ ID NO: 12) ATGGCAGGTCACAGTCCTTC AB018258 ATPase, Class V, type 10B Sense (SEQ ID NO: 13) TAAGCAGGAGACAGCGGTCAACAT 57 Antisense (SEQ ID NO: 14) TGGTGTCTTGGAAGGTAAGCGGAA Y18483 Solute carrier family 7 (cationic amino acid transporter, y + system), member 8 Sense (SEQ ID NO: 15) ACCGAAACAACACCGAAAAG 57 Antisense (SEQ ID NO: 16) GATTCCAGAGCCGATGATGT BC036890 Grainyhead-like 3 (Drosophila) Sense (SEQ ID NO: 17) GTGGAGCACATTGAGGAGGT 58.7 Antisense (SEQ ID NO: 18) CCCAAGCCACAGTCATAGGT NM_032484 Homolog of mouse LGP1 Sense (SEQ ID NO: 19) AGCAGCAACCCTGAGTCAAT 57 Antisense (SEQ ID NO: 20) CCCGCAGGAAGTACATGAAT AK095632 Ankyrin repeat and BTB (POZ) domain containing 2 Sense (SEQ ID NO: 21) ACTGCTTCAGCCACTCAGC 64.3 Antisense (SEQ ID NO: 22) GACAGCACGTCCGCTTTAG NM_00404 (House Keeping Gene) Homo sapiens beta-2-microglobulin Sense (SEQ ID NO: 23) GTGCTCGCGCGCTACTCTCTCT Antisense (SEQ ID NO: 24) GTAATACGACTCACTATAGGGACCTCTAAGTTGCCAGCCCT

Registration Number ( GeneBank ) Gene name real time PCR (Relative magnification) cDNA Microarray ( Cy3 Of Cy5  ratio) AK126731 Glucocorticoid induced transcript  One 2.59 2.886 AK023574 Solute carrier family 40 (iron-regulatedtransporter), member 1 0.71 3.06 BX648021 V-set domain containing T cell activation inhibitor 1 0.92 0.27 NM_181659 Nuclear receptor coactivator 3 2.45 2.06 NM_000735 Glycoprotein hormones, alpha polypeptide 6.01 8.07 BC042755 Regulator of  G- protein signalling  2, 24 kDa 5.67 9.24 AB018258 ATPase , Class  V, type  10B 2.65 4.95 Y18483 Solute carrier family 7 (cationic amino acid transporter, y + system), member 8 0.71 3.76 BC036890 Grainyhead-like 3 (Drosophila) 0.08 4.11 NM _032484 Homolog of mouse LGP1 0.65 0.49 AK095632 Ankyrin repeat and BTB (POZ) domain containing 2 0.14 4.65

As a result, it was confirmed that the gene expression amount of the six overexpressed genes was very similar to the oligo microarray result of the gene expression by teratogenic drugs.

1 is a graph showing cytotoxicity of methotrexate, a teratogenic drug, in human placental-derived choriocarcinoma cell line.

FIG. 2 is a graph showing the results of analysis of the expression level of the methotrexate-treated group, which is labeled with Cy3 and Cy5, and the untreated group, respectively, on a microarray chip, using a volcano plot.

Figure 3 is a diagram showing the results of analyzing the gene expression of human chorionic cancer cell line treated with methotrexate using a microarray chip.

<110> Korea Institute of Science and Technology <120> Marker genes based on Methotrexate treatment for screening of          drug inducing teratogenicity and screening method using jelly <130> 8p-05-44 <160> 24 <170> KopatentIn 1.71 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Glucocorticoid induced transcript 1 sense primer <400> 1 gcatgaaaga caaagctact caga 24 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glucocorticoid induced transcript 1 antisense primer <400> 2 gaacgctgat gtgacctctt t 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier family 40 (iron-regulated transporter), member 1          sense primer <400> 3 cgagatggat gggtctccta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier family 40 (iron-regulated transporter), member 1          antisense primer <400> 4 gctgatgctc ccatcaaaat 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> V-set domain containing T cell activation inhibitor 1 sense          primer <400> 5 tgcactcatc attggctttg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> V-set domain containing T cell activation inhibitor 1 antisense          primer <400> 6 ttcaaaagtg cagctcagga 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nuclear receptor coactivator 3 sense primer <400> 7 ggtaggcggc atgagtatgt c 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Nuclear receptor coactivator 3 antisense primer <400> 8 tgttactgga acccccatac ct 22 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Glycoprotein hormones, alpha polypeptide sense primer <400> 9 attccgctcc tgatgtgc 18 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glycoprotein hormones, alpha polypeptide antisense primer <400> 10 gcccatgcac tgaagtattg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Regulator of G-protein signaling 2, 24kDa snese primer <400> 11 caactgccca gaaaagggta 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Regulator of G-protein signaling 2, 24kDa antisense primer <400> 12 atggcaggtc acagtccttc 20 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ATPase, Class V, type 10B snese primer <400> 13 taagcaggag acagcggtca acat 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> ATPase, Class V, type 10B antisense primer <400> 14 tggtgtcttg gaaggtaagc ggaa 24 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier family 7 (cationic amino acid transporter, y +          system), member 8 sense primer <400> 15 accgaaacaa caccgaaaag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Solute carrier family 7 (cationic amino acid transporter, y +          system), member 8 antisense primer <400> 16 gattccagag ccgatgatgt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Grainyhead-like 3 (Drosophila) sense primer <400> 17 gtggagcaca ttgaggaggt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Grainyhead-like 3 (Drosophila) antisense primer <400> 18 cccaagccac agtcataggt 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Homolog of mouse LGP1 sense primer <400> 19 agcagcaacc ctgagtcaat 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Homolog of mouse LGP1 antisense primer <400> 20 cccgcaggaa gtacatgaat 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ankyrin repeat and BTB (POZ) domain containing 2 sense primer <400> 21 actgcttcag ccactcagc 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ankyrin repeat and BTB (POZ) domain containing 2 antisense primer <400> 22 gacagcacgt ccgctttag 19 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Homo sapiens beta-2-microglobulin sense primer <400> 23 gtgctcgcgc gctactctct ct 22 <210> 24 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Homo sapiens beta-2-microglobulin antisense primer <400> 24 gtaatacgac tcactatagg gacctctaag ttgccagccc t 41  

Claims (19)

Biomarkers for teratogenic drugs search comprising genes selected from the following groups: Genebank AF537113 (TAC3, Tachykinin 3 (neuromedin K, neurokinin beta)), Genebank AJ224867 (Homo sapiens mRNA for GNAS1 protein (IMAGE cDNA clone 359933 (827-k06)). [AJ224867]. ), Gene Registration Number (Genebank) AK074734 (FCGRT, Fc fragment of IgG, receptor, transporter, alpha), Gene Registration Number (Genebank) NM_001856 (COL16A1, Collagen, type XVI, alpha 1), Gene Registration Number (Genebank) CR606430 (PSG11, Pregnancy specific beta-1-glycoprotein 11), Genebank AK075446 (P11, 26 serine protease), Genebank NM_003214 (TEAD3, TEA domain family member 3), Gene registry number (Genebank ) NM_001031850 (PSG6, Pregnancy specific beta-1-glycoprotein 6), Gene Registration Number (Genebank) CR606280 (PSG5, Pregnancy specific beta-1-glycoprotein 5), Gene Registration Number (Genebank) NM_005059 (RLN2, Relaxin 2), Gene Genebank BC064698 (TFCP2L1, Transcription factor CP2-like 1), Gene Registration Number (G enebank) BC005956 (RLN1, Relaxin 1), Gene Registration Number (Genebank) NM_000029 (AGT, Angiotensinogen (serpin peptidase inhibitor, clade A, member 8)), Gene Registration Number (Genebank) BC063127 (PSG4, Pregnancy specific beta-1- glycoprotein 4), gene accession number (Genebank) NM_001124 (ADM, Adrenomedullin), gene accession number (Genebank) AK092458 (PSG1; DKFZp781L10202, Pregnancy specific beta-1-glycoprotein 8), Gene Registration Number (Genebank) M23575 (PSG3, Pregnancy specific beta-1-glycoprotein 3), Gene Registration Number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_031246 (PSG2, Pregnancy specific beta-1-glycoprotein 2), gene registration number (Genebank) AK097048 (CLIC5, Chloride intracellular channel 5), gene registration number (Genebank) CR601901 ( INSL4, Insulin-like 4 (placenta), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank NM_004613 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-) gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (Cpolypeptide, protein-glutamine-gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma) -glutamyltran sferase, Genebank NM_004613 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), Genebank NM_001007232 (INCA, Inhibitory caspase recruitment domain (CARD) protein), Gene Registration Genebank AK094322 (CKMT; CKMT1; UMTCK, Creatine kinase, mitochondrial 1B), Genebank NM_203339 (CLU, Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)), gene registration number (Genebank) BX386171 (CGB5, Chorionic gonadotropin, beta polypeptide 8), Gene Registration Number (Genebank) NM_003841 (TNFRSF10C, Tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain), Gene Registration Number (Genebank) BC063507 (HSPA1B , Heat shock 70kDa protein 1B, Genebank AL050391 (CASP4, Caspase 4, apoptosis-related cysteine peptidase), Genebank (Genebank) NM_001167 (BIRC4, Baculoviral IAP repeat-containing 4), Gene registry number ( Genebank) NM_004155 (SERPINB9, Serpin peptidase inhibitor, clade B (ovalbumin), member 9), Gene Registration Number (Genebank) CR613579 (GADD45G, Growth arrest and DNA-damage-inducible, gamma), Gene Registration Number (Genebank) NM_001015049 ( BAG5 , BCL2-associated athanogene 5), gene registration number (Genebank) BC033694 (BCL2L11, BCL2-like 11 (apoptosis facilitator)), gene registration number (Genebank) AY358836 (BIRC7, Baculoviral IAP repeat-containing 7 (livin)), gene Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank AK125880 (TP53INP1, Tumor protein p53 inducible nuclear protein 1), Genebank BC052977 (TNFRSF1B, Tumor necrosis factor receptor superfamily, member 1B), Genebank BC047362 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), Genebank U67156 (MAP3K5, Mitogen-activated protein kinase kinase kinase 5), Genebank NM_012479 (YWHAG, Tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activation protein, gamma polypeptide), Genebank NM_004226 (STK17B, Serine / threonine kinase 17b (apoptosis-inducing)) , Gene registration number (Genebank ) NM_012324 (MAPK8IP2, Mitogen-activated protein kinase 8 interacting protein 2), Genebank BG920134 (COPl, Caspase-1 dominant-negative inhibitor pseudo-ICE), Genebank NM_005505 (SCARB1, Casvenger receptor class B, member 1), Genebank NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank (Genebank) NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank AF020763 (IGF1R, Insulin -like growth factor 1 receptor, Genebank NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), Genebank (Genebank) NM_005505 (SCARB1, Scavenger receptor class B, member 1), Genebank A (Genebank) B209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AK092808 (RRAGC, Ras-related GTP binding C), Genebank BC089389 (IHPK3, Inositol hexaphosphate kinase 3), Gene Registry Number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta) , Gene registration number (Genebank) AB007974 (PKC2, protein kinase C, zeta), gene registration number (Genebank) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (Genebank) NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), gene registration Genebank AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Accession Number (Genebank) NM_004574 (04-Sep, Septin 4), Gene Accession Number (Genebank) NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), Genebank (Genebank) BX649005 (SGK, Serum / glucocorticoid regulated kinase), Genebank (Genebank) NM_006290 (TNFAIP3, Tumor necrosis factor, alpha-induced protein 3), Genebank (Kenebank) AK124173 (Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796. [AK124173], CDNA FLJ42179 fis, clone THYMU2030796), Genebank BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), Genebank BC012609 (SERPINB2, Serpin peptidase inhibitor, clade B (ovalbumin), member 2), genebank NM_001621 (AHR, Aryl hydrocarbon receptor), genebank AK122828 (CIDEB, cell death-inducing DFFA-like effector b), genebank (Genebank) AK223503 (CASP1, Caspase1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), Gene Registration Number (Genebank) NM_033027 (AXUD1, AXIN1 up-regulated 1), Gene Registration Number (Genebank) AW057563 (Unknown, Transcribed locus) Genebank NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3), Genebank BX641114 (ANXA4, Annexin A4), Genebank NM_ 001731 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank CN478604 (LGALS7, Lectin, galactoside-binding, soluble, 7 (galectin 7)), genebank (Genebank) NM_004281 (BAG3, BCL2-associated athanogene 3), genebank AY125488 (DEDD2, Death effector domain containing 2), gene registry number (Genebank) AL713801 (SLAMF7, SLAM family member 7), Genebank AK096267 (LOC90525, Src homology 2 domain containing F), Genebank NM_000639 (FASLG, Fas ligand (TNF superfamily, member 6) ), Genebank AK025273 (EGLN3, Egl nine homolog 3 (C. elegans), Genebank BC042844 (CASP10, Caspase 10, apoptosis-related cysteine peptidase), Genebank AB007974 (PKC2, protein kinase C, zeta), Genebank AB029551 (RYBP , RING1 and YY1 binding protein), Genebank AB209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AB209534 (TRA1, Tumor rejection antigen (gp96) 1), Gene Registration Number ( Genebank) AB209613 (DNASE1L3, Deoxyribonuclease I-like 3), Gene Registration Number (Genebank) AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Registration Number (Genebank) AF332558 (BBC3, BCL2 binding component 3), Gene Registration Number (Genebank) AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Gene Registration Number (Genebank) AB096256 (UNC5B, Unc-5 homolog B (C. elegans)), Gene Registration Number (Genebank) AK001361 ( PPP1R15A, Protein phosphatase 1, regulatory (inhibitor) subunit 15A), gene registration number (Genebank ) AI376429 (TNFSF10, Tumor necrosis factor (ligand) superfamily, member 10), Gene Registration Number (Genebank) NM_006665 (HPSE, Heparanase), Gene Registration Number (Genebank) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann) disease)), Genebank BC037961 (IL8RB, Interleukin 8 receptor, beta), Genebank AK127123 (TOLLIP, Toll interacting protein), Genebank NM_001002029 (C4A, Complement component 4B, telomeric), Gene Registration Number (Genebank) NM_002987 (CCL17, Chemokine (CC motif) ligand 17), Gene Registration Number (Genebank) NM_003596 (TPST1, Tyrosylprotein sulfotransferase 1), Gene Registration Number (Genebank) U83171 (CCL22, Chemokine (CC) motif ligand 22), gene accession number (Genebank) NM_001643 (APOA2, Apolipoprotein A-II), gene accession number (Genebank) NM_000625 (NOS2A, Nitric oxide synthase 2A (inducible, hepatocytes)), gene registration number (Genebank) BQ927179 (S100A9, S100 calcium binding protein A9 (calgranulin B)), Genebank (Genebank) NM_020820 (PREX1, Phosphatidylinositol 3,4,5-trisphosphate-dependent RAC exchanger 1), Genebank (Genebank) CD013879 (PTAFR, Platelet-activating factor receptor) Genebank NM_002504 (NFX1, Nucleartranscription factor, X-box binding 1), Genebank NM_173842 (IL1RN, Interleukin 1 receptor antagonist), Genebank NM_005408 (CCL13, Chemokine (CC motif) ligand 13), Gene Registration Number (Genebank) NM_013314 (BLNK, B-cell linker), Gene Registration Number (Genebank) NM_000634 (IL8RA, Interleukin 8 receptor, alpha), Genebank NM_006404 (PROCR, Protein C receptor, endothelial (EPCR)), Genebank NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), Genebank AY499342 (IL31RA, Interleukin 31 receptor A), Genebank M27492 (IL1R1, Interleukin) 1 receptor, type I), gene registration number (Genebank) CR749338 (BDKRB2, Bradykinin receptor B2), Genebank NM_007115 (TNFAIP6, Tumor necrosis factor, alpha-induced protein 6), Genebank CR595353 (CD74, CD74 antigen (invariant polypeptide of major) histocompatibility complex, class II antigen-associated), Genebank AK074480 (ANXA1, Annexin A1), Genebank NM_001838 (CCR7, Chemokine (CC motif) receptor 7), Genebank (Genebank) NM_001295 (CCR1, Chemokine (CC motif) receptor 1), Genebank NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), Genebank AF076494 (IRF7, Interferon regulatory factor 7), Genebank AF186094 (IL1F5, Interleukin 1 family, member 5 (delta)), Genebank AF189279 (PLA2G2E, Phospholipase A2, group IIE), Genebank AF200494 (IL1F8, Interleukin 1 family, member 8 (eta)), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Gene Registration Number (Genebank) NM_005283 (XCR1, Chemokine (C motif) receptor 1), Gene Registration Number (Genebank) NM_005245 (FAT, FAT tumor suppressor homolog 1 (Drosophila)), Genebank AF373867 (TBX1, T-box 1), Genebank (Genebank) BC010091 (BICD, bicaudal D homolog 1 (Drosophila)), Genebank (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Gene Registration Number (Genebank) NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), Gene Registration Number (Genebank) NM_004235 (KLF4, Kruppel- like factor 4 (gut)), Genebank NM_000118 (ENG, Endoglin (Osler-Rendu-Weber syndrome 1)), Genebank NM_032951 (WBSCR14, MLX interacting protein-like), Gene Registration Genebank AK124904 (FGD6, FYVE, RhoGEF and PH domain containing 6), Gene Accession Number (Genebank) NM_014585 (SLC40A1, Solute carrier fami ly 40 (iron-regulated transporter), member 1), gene registration number (Genebank) NM_001003408 (ABLIM1, Actin binding LIM protein 1), gene registration number (Genebank) AK096284 (LFNG, Lunatic fringe homolog (Drosophila)), gene registration Genebank AL833276 (ALPK3, Alpha-kinase 3), Gene Registration Number (Genebank) NM_000037 (ANK1, Ankyrin 1, erythrocytic), Gene Registration Number (Genebank) BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) (SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), gene registration number (Genebank) NM_003643 (GCM1, Glial cells missing homolog 1 (Drosophila)), gene registration number (Genebank) NM_002653 (PITX1) , Paired-like homeodomain transcription factor 1), gene accession number (Genebank) AK131071 (SLC31A2, Solute carrier family 31 (copper transporters), member 2), gene accession number (Genebank) NM_001874 (CPM, Carboxypeptidase M) Genebank BC087839 (CTGF, Connective tissue growth factor), Gene Accession Number (Genebank) NM_002774 (KLK6, Kallikrein 6 (neurosin, zyme)), Gene Registration Number (Genebank) NM_020127 (TUFT1, Tuftelin 1), Gene Registration Number (Genebank) NM_018695 (ERBB2IP, Erbb2 interacting protein), Gene Registration Number (Genebank) NM_003955 ( Suppressor of cytokine signaling 3), Genebank NM_000899 (KITLG, KIT ligand), Genebank AK127621 (SOCS1, Suppressor of cytokine signaling 1), Genebank NM_017556 (FBLP- 1, Filamin binding LIM protein 1), Gene Registration Number (Genebank) NM_002826 (QSCN6, Quiescin Q6), Gene Registration Number (Genebank) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Gene Registration Number (Genebank) AY211386 (FGD3, FYVE, RhoGEF and PH domain containing 3), Gene Registration Number (Genebank) AK092391 (CST6, Cystatin E / M), Gene Registration Number (Genebank) NM_003897 (IER3, Immediate early response 3), Gene Registration Number (Genebank X54457 (CEL, Carboxyl ester lipase), gene Genebank NM_016291 (IHPK2, Inositol hexaphosphate kinase 2), Gene Registration Number (Genebank) BC070068 (HECA, Headcase homolog (Drosophila), Gene Registration Number (Genebank) NM_000224 (KRT18, Keratin 18), Gene Registration Number (Genebank) CR616919 (KRT18, Keratin 18), Genebank AK097304 (LR8, LR8 protein), Genebank NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), Genebank AK027294 (WISP1, WNT1 inducible signaling pathway protein 1), Genebank NM_006291 (TNFAIP2, Tumor necrosis factor, alpha-induced protein 2), gene accession number (Genebank) NM_001024807 (APLP1, Amyloid beta (A4) precursor-like protein 1), gene accession number (Genebank) NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene registration number ( Genebank) AY258066 (OKL38, Pr egnancy-induced growth inhibitor), Genebank NM_014590 (ERVWE1, Endogenous retroviral family W, env (C7), member 1 (syncytin)), Genebank NM_002448 (MSX1, Msh homeo box homolog 1 ( Drosophila), Genebank AJ303079 (PALM2-AKAP2, Paralemmin 2), Genebank NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse), Genebank BX391158 (Homobank) sapiens reticulon 4 receptor (RTN4R), mRNA [NM_023004], Transcribed locus, weakly similar to NP_075380.1 reticulon 4 receptor precursor; nogo receptor; Nogo-66 receptor; UNQ330 / PRO526 [Homo sapiens]), Genebank AB209095 (CDC2L2, Cell division cycle 2-like 2 (PITSLRE proteins)), Genebank BX649103 (ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase) , Gene Registration Number (Genebank) NM_002702 (POU6F1, POU domain, class 6, transcription factor1), Gene Registration Number (Genebank) AB209321 (CSRP2, Cysteine and glycine-rich protein 2), Gene Registration Number (Genebank) AF075292 (FGF18, Fibroblast growth factor 18), Genebank AF132297 (CISH, Cytokine inducible SH2-containing protein), Genebank AF167706 (CRIM1, Cysteine rich transmembrane BMP regulator 1 (chordin-like), Gene accession number (Genebank) AL137318 (ERBB2IP, Erbb2 interacting protein), gene accession number (Genebank) AK021858 (FOXC1, Forkhead box C1), gene accession number (Genebank) NM_020418 (PCBP4, Poly (rC) binding protein 4), gene registration number ( Genebank) NM_003884 (PCAF, P300 / CBP-associated factor) Gene Registration Number (Genebank) CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha), Gene Registration Number (Genebank) D86987 (MFN2, Mitofusin 2), Gene Registration Number (Genebank) NM_201433 (GAS7, Growth arrest- specific 7), Genebank AK127230 (Homo sapiens eukaryotic translation initiation factor 4 gamma, 2 (EIF4G2), mRNA [NM_001418], CDNA FLJ45297 fis, clone BRHIP3003395), Genebank AY123223 (SESN2, Sestrin 2), gene registration number (Genebank) NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), gene registration number (Genebank) NM_033044 (MACF1, Microtubule-actin crosslinking factor 1), gene registration number (Genebank) AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene Registration Number (Genebank) NM_002191 (INHA, Inhibin, alpha), Gene Registration Number (Genebank) BC067842 (CDKN1C, Cyclin-dependent kinase inhibitor 1C (p57, Kip2)), Genebank S62138 (DDIT3, DNA-damage-inducible trans cript 3), Genebank NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), Genebank AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene registry number ( Genebank) AF033122 (SESN1, Sestrin 1), Gene Registration Number (Genebank) AF211119 (CDKN2A, Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)), Gene Registration Number (Genebank) NM_000800 (FGF1, Fibroblast growth factor 1 (acidic)), Genebank NM_002632 (PGF, Placental growth factor, vascular endothelial growth factor-related protein), Genebank (Genebank) AK075219 (ANGPT2, Angiopoietin 2), Genebank NM_001430 (Genebank) EPAS1, Endothelial PAS domain protein 1), Gene Accession Number (Genebank) AK024680 (Homo sapiens cDNA: FLJ21027 fis, clone CAE07110. [AK024680], CDNA: FLJ21027 fis, clone CAE07110), gene registration number (Genebank) X96753 (CSPG4, Chondroitin sulfate proteoglycan 4 (melanoma-associated)), gene registration number (Genebank) AL833606 (NRP2, Neuropilin 2), gene registration Genebank NM_018534 (NRP2, Neuropilin 2), Gene Accession Number (Genebank) AK095578 (SPHK1, Sphingosine kinase 1), Gene Accession Number (Genebank) AK025719 (IGF2, Insulin-like growth factor 2 (somatomedin A)), Gene Genebank NM_002521 (NPPB, Natriuretic peptide precursor B), Genebank (Genebank) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), Gene registry (Genebank ) BC030792 (CDK5R1, Cyclin-dependent kinase 5, regulatory subunit 1 (p35)), gene registration number (Genebank) AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit), Genebank AF003837 (JAG1 , Jagged 1 (Alagille syndrome)), Genebank AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), Genebank NM_015366 (PRR5; PP610; FLJ20185, Rho GTPase activating protein 8), gene accession number (Genebank) AK126486 (WBSCR20B, Williams-Beuren Syndrome critical region protein 20 copy B), gene accession number (Genebank) CR604926 (CaMKIINalpha, Calcium / calmodulin-dependent protein kinase II inhibitor 1), Gene Registration Number (Genebank) BC050456 (THBS4, Thrombospondin 4), Gene Registration Number (Genebank) NM_016463 (CXXC5, CXXC finger 5), Gene Registration Number (Genebank) NM_003004 (SECTM1, Secreted and transmembrane 1), Gene Registration Number (Genebank) R52269 (RGS3, Regulator of G-protein signaling 3), gene accession number (Genebank) BC034950 (TBK1, TANK-binding kinase 1), gene accession number (Genebank) AF059617 (PLK2, Polo-like kinase 2 ( Drosophila), Genebank NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), Genebank NM_213590 (RFP2, Ret finger protein 2), Genebank AK097205 (ECM1, Extracellular matrix protein 1), heredity Genebank AF227516 (SPRY4, Sprouty homolog 4 (Drosophila)), Gene Registration Number (Genebank) BX647341 (TDO2, Tryptophan 2,3-dioxygenase), Gene Registration Number (Genebank) NM_001045 (SLC6A4, Solute carrier family 6 ( neurotransmitter transporter, serotonin), member 4), gene accession number (Genebank) NM_003490 (SYN3, Synapsin III), gene accession number (Genebank) NM_000240 (MAOA, Monoamine oxidase A), gene accession number (Genebank) AK126731 (GLCCI1, Glucocorticoid induced transcript 1), Genebank NM_080542 (COLQ, Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase), Genebank BQ054887 (GCHFR, GTP cyclohydrolase I feedback regulator), Gene Genebank NM_005629 (SLC6A8, Solute carrier family 6 (neurotransmitter transporter, creatine), member 8), Genebank AB018258 (ATP10B, ATPase, Class V, type 10B), Genebank number Y18483 (SLC7A8, Solute carri er family 7 (cationic amino acid transporter, y + system), member 8), Genebank (Genebank) AB019569 (CGA, Glycoprotein hormones, alpha polypeptide), Genebank (Genebank) NM_014585 (SLC40A1, Solute carrier family 40 (iron -regulated transporter, member 1), Genebank BC036890 (TFCP2L4, Grainyhead-like 3 (Drosophila)), Genebank AK095632 (ABTB2, Ankyrin repeat and BTB (POZ) domain containing 2), Genebank NM_181659 (NCOA3, Nuclear receptor coactivator 3), Genebank BC042755 (RGS2, Regulator of G-protein signaling 2, 24 kDa). Genebank (Genebank) NM_175607 (CNTN4, Contactin 4), Genebank (Genebank) NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank (Menebank) NM_016835 (MAPT, Microtubule-associated protein tau) (Genebank) AB028993 (NLGN1, Neuroligin 1), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), Genebank CR936770 ( GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), gene registration number (Genebank) NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), gene registration number (Genebank) NM_005103 (FEZ1 , Fasciculation and elongation protein zeta 1 (zygin I), Genebank NM_000304 (PMP22, Peripheral myelin protein 22), Genebank AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans) )), Genebank (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_013975 (LIG3, Ligase III, DNA, ATP-dependent), Gene Registration Number (Genebank) BX248766 (RAD51L1, RAD51-like 1 (S. cerevisiae)), Gene Registration Number (Genebank) CR611116 (APEX1, APEX nuclease (multifunctional DNA repair enzyme) 1), Gene Registration Number (Genebank) BC005077 (FANCF, Fanconi anemia, complementation group F), Gene Registration Number (Genebank) NM_022725 (FANCF, Fanconi anemia) , complementation group F), Genebank D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)), Genebank U63139 (RAD50, RAD50 homolog (S. cerevisiae)), Genebank AK122825 (HMGB1, High-mobility group box 1), Genebank AB067472 (VARS2L, Valyl-tRNA synthetase like), Genebank AK057498 (RUVBL2, RuvB -like 2 (E. coli)), Gene Registration Number (Genebank) BX640816 (NBS1, Nibrin), Gene Registration Number (Genebank) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) Genebank AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), Genebank number NM_006230 (POLD2, olymerase (DNA directed), delta 2, regulatory subunit 50kDa, Genebank NM_006230 (POLD2, Polymerase (DNA directed), delta 2, regulatory subunit 50kDa), Genebank NM_002412 (MGMT, -6-methylguanine-DNA methyltransferase), Gene Registration Number (Genebank) NM_007313 (ABL1, V-abl Abelson murine leukemia viral oncogene homolog 1), gene registration number (Genebank) NM_003362 (UNG, Uracil-DNA glycosylase), gene registration number (Genebank) AF078164 (KUB3, Ku70-binding protein 3), gene registration number (Genebank) NM_004280 (EEF1E1 , Eukaryotic translation elongation factor 1 epsilon 1), Genebank NM_002528 (NTHL1, Nth endonuclease III-like 1 (E. coli)), Genebank AF078847 (GTF2H2, General transcription factor IIH, polypeptide 2, 44kDa), Genebank NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene registration Genebank NM_001184 (ATR, Ataxia telangiectasia and Rad3 related), Genebank NM_001007233 (ERCC8, Excision repair cross-complementing rodent repair deficiency, complementation group 8), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank NM_000051 (ATM, Ataxia telangiectasia mutated (includes complementation groups A, C and D)), Genebank NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank AF061326 (C8orf1, Chromosome 8 open reading frame 1), Genebank AB028993 (NLGN1, Neuroligin 1) ), Genes, etc. Genebank NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), Gene Registration Number (Genebank) BI494022 (GRLF1, Glucocorticoid receptor DNA binding factor 1), Gene Registration Number (Genebank) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), Genebank NM_016835 (MAPT, Microtubule-associated protein tau), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), gene registration number (Genebank) CR936770 (GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), gene registration number (Genebank) NM_000304 (PMP22, Peripheral myelin protein 22), gene registration Number (Genebank) AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans)), Gene Registration Number (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_058179 (PSAT1, Phosphoserine aminotransferase 1), Gene Registration Number (Genebank) AB209458 (SCLY, Selenocysteine lyase), Gene Registration Number (Genebank) BC065510 (CAD, Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase), gene registration number (Genebank) AK055053 (SHMT2, Serine hydroxymethyltransferase 2 (mitochondrial)), gene registration number (Genebank) NM_1334g (ASsyntase Asase Genebank AK022713 (Homo sapiens cDNA FLJ12651 fis, clone NT2RM4002062, moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12). [AK022713], unnamed protein product; Homo sapiens cDNA FLJ12651 fis, clone NT2RM400 , moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12).), Genebank XM_371677 (LOC389173, Similar to phosphoserine aminotransferase isoform 1), Genebank NM_005504 (BCAT1, Bra nched chain aminotransferase 1, cytosolic, Genebank AK056980 (FLJ23441, Hypothetical protein FLJ23441), Genebank L00972 (CBS, Cystathionine-beta-synthase), Genebank (Menebank) NM_152334 (TARSL2, Threonyl-tRNA synthetase-like 2), gene registration number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), gene registration number (Genebank) NM_080820 (HARS2, Histidyl-tRNA synthetase 2), gene registration number (Genebank) X59303 (VARS2, Valyl-tRNA synthetase), Genebank Number (Genebank) NM_006567 (FARS2, Phenylalanine-tRNA synthetase 2 (mitochondrial)), Gene Registry Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Registration Number (Genebank) ) NM_015936 (CGI-04, Tyrosyl-tRNA synthetase 2 (mitochondrial)), gene registration number (Genebank) AB209246 (PPAT, Phosphoribosyl pyrophosphate amidotransferase), gene registration number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I) Enrollment Number (Genebank) NM_005881 (BCKDK, Branched chain ketoacid dehydrogenase kinase), Gene Registration Number (Genebank) NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene Registration Number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase, Genebank BC036421 (C9orf103, Chromosome 9 open reading frame 103), Genebank AK125213 (YARS, Tyrosyl-tRNA synthetase), Genebank (Genebank) AK027126 (ASS, Argininosuccinate synthetase), Gene Registration Number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) NM_001190 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) AK093306 (PHGDH, Phosphoglycerate dehydrogenase), Gene Registration Number (Genebank) AB067472 (VARS2L, Valyl-tRNA synthetase like), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2) (mitochondrial) Genebank NM_032484 (Homolog of mouse LGP1), BX648021 (B7-H4, V-set domain containing T cell activation inhibitor 1). The biomarker of claim 1, wherein the expression of the following genes is increased by treatment of teratogenic drugs. Genebank AF537113 (TAC3, Tachykinin 3 (neuromedin K, neurokinin beta)), Genebank AJ224867 (Homo sapiens mRNA for GNAS1 protein (IMAGE cDNA clone 359933 (827-k06)). [AJ224867]. Genebank AK074734 (FCGRT, Fc fragment of IgG, receptor, transporter, alpha), Genebank NM_001856 (COL16A1, Collagen, type XVI, alpha 1), Genebank (Genebank) CR606430 (PSG11, Pregnancy specific beta-1-glycoprotein 11), Genebank AK075446 (P11, 26 serine protease), Genebank NM_003214 (TEAD3, TEA domain family member 3), Gene Registration Number ( Genebank) NM_001031850 (PSG6, Pregnancy specific beta-1-glycoprotein 6), Gene Registration Number (Genebank) CR606280 (PSG5, Pregnancy specific beta-1-glycoprotein 5), Gene Registration Number (Genebank) NM_005059 (RLN2, Relaxin 2), Genebank BC064698 (TFCP2L1, Transcription factor CP2-like 1), Gene Registration Number ( Genebank) BC005956 (RLN1, Relaxin 1), Genebank Number (Genebank) NM_000029 (AGT, Angiotensinogen (serpin peptidase inhibitor, clade A, member 8)), Genebank Number BC063127 (PSG4, Pregnancy specific beta-1- glycoprotein 4), gene accession number (Genebank) NM_001124 (ADM, Adrenomedullin), gene accession number (Genebank) AK092458 (PSG1; DKFZp781L10202, Pregnancy specific beta-1-glycoprotein 8), Gene Registration Number (Genebank) M23575 (PSG3, Pregnancy specific beta-1-glycoprotein 3), Gene Registration Number (Genebank) NM_001712 (CEACAM1, Carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)), gene registration number (Genebank) NM_031246 (PSG2, Pregnancy specific beta-1-glycoprotein 2), gene registration number (Genebank) AK097048 (CLIC5, Chloride intracellular channel 5), gene registration number (Genebank) CR601901 ( INSL4, Insulin-like 4 (placenta), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank NM_004613 (TGM2, Transglutaminase 2 (C polypeptide, protein-glutamine-) gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (Cpolypeptide, protein-glutamine-gamma-glutamyltransferase), Genebank NM_198951 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma) -glutamyltra nsferase), gene registration number (Genebank) NM_004613 (TGM2, Transglutaminase2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)), gene registration number (Genebank) NM_001007232 (INCA, Inhibitory caspase recruitment domain (CARD) protein), gene registration Genebank AK094322 (CKMT; CKMT1; UMTCK, Creatine kinase, mitochondrial 1B), Genebank NM_203339 (CLU, Clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)), gene registration number (Genebank) BX386171 (CGB5, Chorionic gonadotropin, beta polypeptide 8), Gene Registration Number (Genebank) NM_003841 (TNFRSF10C, Tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain), Gene Registration Number (Genebank) BC063507 (HSPA1B , Heat shock 70kDa protein 1B), Gene Registration Number (Genebank) AL050391 (CASP4, Caspase 4, apoptosis-related cysteine peptidase), Gene Registration Number (Genebank) NM_001167 (BIRC4, Baculoviral IAP repeat-containing 4), Gene Registration Number ( Genebank) NM_004155 (SERPINB9, Serpin peptidase inhibitor, clade B (ovalbumin), member 9), Gene Registration Number (Genebank) CR613579 (GADD45G, Growth arrest and DNA-damage-inducible, gamma), Gene Registration Number (Genebank) NM_001015049 ( BAG5 , BCL2-associated athanogene 5), gene registration number (Genebank) BC033694 (BCL2L11, BCL2-like 11 (apoptosis facilitator)), gene registration number (Genebank) AY358836 (BIRC7, Baculoviral IAP repeat-containing 7 (livin)), gene Genebank AK129595 (GADD45B, Growth arrest and DNA-damage-inducible, beta), Genebank AK125880 (TP53INP1, Tumor protein p53 inducible nuclear protein 1), Genebank BC052977 (TNFRSF1B, Tumor necrosis factor receptor superfamily, member 1B), Genebank BC047362 (PHLDA1, Pleckstrin homology-like domain, family A, member 1), Genebank U67156 (MAP3K5, Mitogen-activated protein kinase kinase kinase 5), Genebank NM_012479 (YWHAG, Tyrosine 3-monooxygenase / tryptophan 5-monooxygenase activation protein, gamma polypeptide), Genebank NM_004226 (STK17B, Serine / threonine kinase 17b (apoptosis-inducing)) , Gene Registration Number (Genebank) NM_012324 (MAPK8IP2, Mitogen-activated protein kinase 8 interacting protein 2), gene registration number (Genebank) BM920134 (COPl, Caspase-1 dominant-negative inhibitor pseudo-ICE), gene registration number (Genebank) NM_005505 (SCARB1, Casvenger receptor class B, member 1), Genebank NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), Genebank NM_000875 (IGF1R, Insulin-like growth factor 1 receptor), Genebank AF020763 (IGF1R, Insulin- like growth factor 1 receptor, genebank NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), genebank (Genebank) NM_005505 (SCARB1, Scavenger receptor class B, member 1), genebank A (Genebank) A B209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AK092808 (RRAGC, Ras-related GTP binding C), Genebank BC089389 (IHPK3, Inositol hexaphosphate kinase 3), Gene Registry Number (Genebank) NM_148957 (TNFRSF19, Tumor necrosis factor receptor superfamily, member 19), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta), Genebank NM_002744 (PRKCZ, Protein kinase C, zeta) , Gene registration number (Genebank) AB007974 (PKC2, protein kinase C, zeta), gene registration number (Genebank) NM_021960 (MCL1, Myeloid cell leukemia sequence 1 (BCL2-related)), gene registration number (Genebank) NM_003842 (TNFRSF10B, Tumor necrosis factor receptor superfamily, member 10b), Genebank NM_000878 (IL2RB, Interleukin 2 receptor, beta), Genebank NM_003840 (TNFRSF10D, Tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain), gene registration Genebank AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Gene Accession Number (Genebank) NM_004574 (04-Sep, Septin 4), Gene Accession Number (Genebank) NM_004862 (LITAF, Lipopolysaccharide-induced TNF factor), Genebank (Genebank) BX649005 (SGK, Serum / glucocorticoid regulated kinase), Genebank (Genebank) NM_006290 (TNFAIP3, Tumor necrosis factor, alpha-induced protein 3), Genebank (Kenebank) AK124173 (Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796. [AK124173], CDNA FLJ42179 fis, clone THYMU2030796), Genebank BX537586 (STK17A, Serine / threonine kinase 17a (apoptosis-inducing)), Genebank BC012609 (SERPINB2, Serpin peptidase inhibitor, clade B (ovalbumin), member 2), genebank NM_001621 (AHR, Aryl hydrocarbon receptor), genebank AK122828 (CIDEB, cell death-inducing DFFA-like effector b), genebank (Genebank) AK223503 (CASP1, Caspase1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase)), Gene Registration Number (Genebank) NM_033027 (AXUD1, AXIN1 up-regulated 1), Gene Registration Number (Genebank) AW057563 (Unknown, Transcribed locus) ), Genebank NM_003311 (PHLDA2, Pleckstrin homology-like domain, family A, member 2), Genebank NM_001165 (BIRC3, Baculoviral IAP repeat-containing 3), Genebank (Genebank) BX641114 (ANXA4, Annexin A4), Genebank NM_ 001731 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank CN478604 (LGALS7, Lectin, galactoside-binding, soluble, 7 (galectin 7)), genebank (Genebank) NM_004281 (BAG3, BCL2-associated athanogene 3), genebank AY125488 (DEDD2, Death effector domain containing 2), gene registry number (Genebank) AL713801 (SLAMF7, SLAM family member 7), Genebank AK096267 (LOC90525, Src homology 2 domain containing F), Genebank NM_000639 (FASLG, Fas ligand (TNF superfamily, member 6) ), Genebank AK025273 (EGLN3, Egl nine homolog 3 (C. elegans), Genebank BC042844 (CASP10, Caspase 10, apoptosis-related cysteine peptidase), Genebank AB007974 (PKC2, protein kinase C, zeta), Genebank AB029551 (RYBP , RING1 and YY1 binding protein), Genebank AB209436 (SCARB1, Scavenger receptor class B, member 1), Genebank AB209534 (TRA1, Tumor rejection antigen (gp96) 1), Gene Registration Number ( Genebank) AB209613 (DNASE1L3, Deoxyribonuclease I-like 3), Genebank AF020763 (IGF1R, Insulin-like growth factor 1 receptor), Genebank AF332558 (BBC3, BCL2 binding component 3), Gene Genebank AI076466 (BTG1, B-cell translocation gene 1, anti-proliferative), Genebank AB096256 (UNC5B, Unc-5 homolog B (C. elegans)), Genebank AK001361 (PPP1R15A, Protein phosphatase 1, regulatory (inhibitor) subunit 15A), gene registration number (Genebank ) AI376429 (TNFSF10, Tumor necrosis factor (ligand) superfamily, member 10), Gene Registration Number (Genebank) NM_006665 (HPSE, Heparanase), Gene Registration Number (Genebank) X02812 (TGFB1, Transforming growth factor, beta 1 (Camurati-Engelmann) disease)), Genebank BC037961 (IL8RB, Interleukin 8 receptor, beta), Genebank AK127123 (TOLLIP, Toll interacting protein), Genebank NM_001002029 (C4A, Complement component 4B, telomeric), Gene Registration Number (Genebank) NM_002987 (CCL17, Chemokine (CC motif) ligand 17), Gene Registration Number (Genebank) NM_003596 (TPST1, Tyrosylprotein sulfotransferase 1), Gene Registration Number (Genebank) U83171 (CCL22, Chemokine (CC) motif ligand 22), gene accession number (Genebank) NM_001643 (APOA2, Apolipoprotein A-II), gene accession number (Genebank) NM_000625 (NOS2A, Nitric oxide synthase 2A (inducible, hepatocytes)), gene accession number (Genebank) BQ927179 (S100A9, S100 calcium binding protein A9 ( calgranulin B)), Genebank NM_020820 (PREX1, Phosphatidylinositol 3,4,5-trisphosphate-dependent RAC exchanger 1), Genebank CD013879 (PTAFR, Platelet-activating factor receptor) Genebank NM_002504 (NFX1, Nucleartranscription factor, X-box binding 1), Genebank NM_173842 (IL1RN, Interleukin 1 receptor antagonist), Genebank NM_005408 (CCL13, Chemokine (CC motif) ligand 13 Genebank NM_013314 (BLNK, B-cell linker), Genebank NM_000634 (IL8RA, Interleukin 8 receptor, alpha), Genebank NM_006404 (PROCR, Protein C receptor, endothelial) (EPCR)), Genebank NM_002182 (IL1RAP, Interleukin 1 receptor accessory protein), Genebank AY499342 (IL31RA, Interleukin 31 receptor A), Genebank M27492 (IL1R1, Interleukin 1 receptor, type I), gene registration number (Genebank) CR749338 (BDKRB2, Bradykinin receptor B2), Genebank NM_007115 (TNFAIP6, Tumor necrosis factor, alpha-induced protein 6), Genebank CR595353 (CD74, CD74 antigen (invariant polypeptide of major) histocompatibility complex, class II antigen-associated), Genebank AK074480 (ANXA1, Annexin A1), Genebank NM_001838 (CCR7, Chemokine (CC motif) receptor 7), Genebank (Genebank) NM_001295 (CCR1, Chemokine (CC motif) receptor 1), Genebank NM_000963 (PTGS2, Prostaglandin-endoperoxide synthase 2 (prostaglandin G / H synthase and cyclooxygenase)), Genebank AF076494 (IRF7, Interferon regulatory factor 7), Genebank AF186094 (IL1F5, Interleukin 1 family, member 5 (delta)), Genebank AF189279 (PLA2G2E, Phospholipase A2, group IIE), Genebank AF200494 (IL1F8, Interleukin 1 family, member 8 (eta)), Gene Registration Number (Genebank) NM_001015053 (HDAC5, Histone deacetylase 5), Gene Registration Number (Genebank) NM_005283 (XCR1, Chemokine (C motif) receptor 1), Gene Registration Number (Genebank) NM_005245 (FAT, FAT tumor suppressor homolog 1 (Drosophila)), Genebank AF373867 (TBX1, T-box 1), Genebank (Genebank) BC010091 (BICD, bicaudal D homolog 1 (Drosophila)), Genebank (Genebank) NM_012396 (PHLDA3, Pleckstrin homology-like domain, family A, member 3), Gene Registration Number (Genebank) NM_016569 (TBX3, T-box 3 (ulnar mammary syndrome)), Gene Registration Number (Genebank) NM_004235 (KLF4, Kruppel- like factor 4 (gut)), Genebank NM_000118 (ENG, Endoglin (Osler-Rendu-Weber syndrome 1)), Genebank NM_032951 (WBSCR14, MLX interacting protein-like), Gene Registry Number Genebank AK124904 (FGD6, FYVE, RhoGEF and PH domain containing 6), Gene Accession Number (Genebank) NM_014585 (SLC40A1, Solute carrier famil y 40 (iron-regulated transporter), member 1), Genebank NM_001003408 (ABLIM1, Actin binding LIM protein 1), Genebank AK096284 (LFNG, Lunatic fringe homolog (Drosophila)), Gene Registration Genebank AL833276 (ALPK3, Alpha-kinase 3), Gene Registration Number (Genebank) NM_000037 (ANK1, Ankyrin 1, erythrocytic), Gene Registration Number (Genebank) BX647757 (Homo sapiens sex comb on midleg-like 1 (Drosophila) (SCML1), mRNA [NM_006746], sex comb on midleg-like 1 (Drosophila), gene registration number (Genebank) NM_003643 (GCM1, Glial cells missing homolog 1 (Drosophila)), gene registration number (Genebank) NM_002653 (PITX1) , Paired-like homeodomain transcription factor 1), gene accession number (Genebank) AK131071 (SLC31A2, Solute carrier family 31 (copper transporters), member 2), gene accession number (Genebank) NM_001874 (CPM, Carboxypeptidase M) Genebank BC087839 (CTGF, Connective tissue growth factor), Gene Accession Number (Genebank) NM_002774 (KLK6, Kallikrein 6 (neurosin, zyme)), Gene Registration Number (Genebank) NM_020127 (TUFT1, Tuftelin 1), Gene Registration Number (Genebank) NM_018695 (ERBB2IP, Erbb2 interacting protein), Gene Registration Number (Genebank) NM_003955 ( Suppressor of cytokine signaling 3), Genebank NM_000899 (KITLG, KIT ligand), Genebank AK127621 (SOCS1, Suppressor of cytokine signaling 1), Genebank NM_017556 (FBLP- 1, Filamin binding LIM protein 1), Gene Registration Number (Genebank) NM_002826 (QSCN6, Quiescin Q6), Gene Registration Number (Genebank) Y11307 (CYR61, Cysteine-rich, angiogenic inducer, 61), Gene Registration Number (Genebank) AY211386 (FGD3, FYVE, RhoGEF and PH domain containing 3), Gene Registration Number (Genebank) AK092391 (CST6, Cystatin E / M), Gene Registration Number (Genebank) NM_003897 (IER3, Immediate early response 3), Gene Registration Number (Genebank X54457 (CEL, Carboxyl ester lipase), gene Genebank NM_016291 (IHPK2, Inositol hexaphosphate kinase 2), Gene Registry Number (Genebank) BC070068 (HECA, Headcase homolog (Drosophila), Gene Registration Number (Genebank) NM_000224 (KRT18, Keratin 18), Gene Registration Number (Genebank) CR616919 (KRT18, Keratin 18), Genebank AK097304 (LR8, LR8 protein), Genebank NM_001012661 (SLC3A2, Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Genebank BM913048 (TIMP1, TIMP metallopeptidase inhibitor 1), Genebank AK027294 (WISP1, WNT1 inducible signaling pathway protein 1), Genebank NM_006291 (TNFAIP2, Tumor necrosis factor, alpha-induced protein 2), gene accession number (Genebank) NM_001024807 (APLP1, Amyloid beta (A4) precursor-like protein 1), gene accession number (Genebank) NM_153609 (TMPRSS6, Transmembrane protease, serine 6), gene registration number ( Genebank) AY258066 (OKL38, Pr egnancy-induced growth inhibitor), Genebank NM_014590 (ERVWE1, Endogenous retroviral family W, env (C7), member 1 (syncytin)), Genebank NM_002448 (MSX1, Msh homeo box homolog 1 ( Drosophila), Genebank AJ303079 (PALM2-AKAP2, Paralemmin 2), Genebank NM_031483 (ITCH, Itchy homolog E3 ubiquitin protein ligase (mouse), Genebank BX391158 (Homobank) sapiens reticulon 4 receptor (RTN4R), mRNA [NM_023004], Transcribed locus, weakly similar to NP_075380.1 reticulon 4 receptor precursor; nogo receptor; Nogo-66 receptor; UNQ330 / PRO526 [Homo sapiens]), Genebank AB209095 (CDC2L2, Cell division cycle 2-like 2 (PITSLRE proteins)), Genebank BX649103 (ChGn, Chondroitin beta1,4 N-acetylgalactosaminyltransferase) , Gene Registration Number (Genebank) NM_002702 (POU6F1, POU domain, class 6, transcription factor1), Gene Registration Number (Genebank) AB209321 (CSRP2, Cysteine and glycine-rich protein 2), Gene Registration Number (Genebank) AF075292 (FGF18, Fibroblast growth factor 18), Genebank AF132297 (CISH, Cytokine inducible SH2-containing protein), Genebank AF167706 (CRIM1, Cysteine rich transmembrane BMP regulator 1 (chordin-like), Gene accession number (Genebank) AL137318 (ERBB2IP, Erbb2 interacting protein), gene accession number (Genebank) AK021858 (FOXC1, Forkhead box C1), gene accession number (Genebank) NM_020418 (PCBP4, Poly (rC) binding protein 4), gene registration number ( Genebank) NM_003884 (PCAF, P300 / CBP-associated factor), Genebank No. CR612719 (GADD45A, Growth arrest and DNA-damage-inducible, alpha), Genebank No. D86987 (MFN2, Mitofusin 2), Genebank No. NM_201433 (GAS7, Growth arrest-specific 7), Genebank AK127230 (Homo sapiens eukaryotic translation initiation factor 4 gamma, 2 (EIF4G2), mRNA [NM_001418], CDNA FLJ45297 fis, clone BRHIP3003395), Genebank AY123223 (SESN2, Sestrin 2) ), Genebank NM_078467 (CDKN1A, Cyclin-dependent kinase inhibitor 1A (p21, Cip1)), Genebank NM_033044 (MACF1, Microtubule-actin crosslinking factor 1), Genebank AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), gene registration number (Genebank) NM_002191 (INHA, Inhibin, alpha), gene registration number (Genebank) BC067842 (CDKN1C, Cyclin-dependent kinase inhibitor 1C (p57, Kip2)), gene Genebank S62138 (DDIT3, DNA-damage-inducible trans cript 3), Genebank NM_078487 (CDKN2B, Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)), Genebank AB209869 (ERN1, Endoplasmic reticulum to nucleus signaling 1), Gene registry number ( Genebank) AF033122 (SESN1, Sestrin 1), Gene Registration Number (Genebank) AF211119 (CDKN2A, Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)), Gene Registration Number (Genebank) NM_000800 (FGF1, Fibroblast growth factor 1 (acidic)), Genebank NM_002632 (PGF, Placental growth factor, vascular endothelial growth factor-related protein), Genebank (Genebank) AK075219 (ANGPT2, Angiopoietin 2), Genebank NM_001430 (Genebank) EPAS1, Endothelial PAS domain protein 1), Gene Accession Number (Genebank) AK024680 (Homo sapiens cDNA: FLJ21027 fis, clone CAE07110. [AK024680], CDNA: FLJ21027 fis, clone CAE07110), gene registration number (Genebank) X96753 (CSPG4, Chondroitin sulfate proteoglycan 4 (melanoma-associated)), gene registration number (Genebank) AL833606 (NRP2, Neuropilin 2), gene registration Genebank NM_018534 (NRP2, Neuropilin 2), Gene Accession Number (Genebank) AK095578 (SPHK1, Sphingosine kinase 1), Gene Accession Number (Genebank) AK025719 (IGF2, Insulin-like growth factor 2 (somatomedin A)), Gene Genebank NM_002521 (NPPB, Natriuretic peptide precursor B), Genebank (Genebank) BX647459 (SERPINE2, Serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2), Gene registry (Genebank ) BC030792 (CDK5R1, Cyclin-dependent kinase 5, regulatory subunit 1 (p35)), gene registration number (Genebank) AB208909 (ITGB2, Integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit), Genebank AF003837 (JAG 1, Jagged 1 (Alagille syndrome)), gene registration number (Genebank) AF480883 (PPAP2B, Phosphatidic acid phosphatase type 2B), gene registration number (Genebank) NM_015366 (PRR5; PP610; FLJ20185, Rho GTPase activating protein 8), gene accession number (Genebank) AK126486 (WBSCR20B, Williams-Beuren Syndrome critical region protein 20 copy B), gene accession number (Genebank) CR604926 (CaMKIINalpha, Calcium / calmodulin-dependent protein kinase II inhibitor 1), Gene Registration Number (Genebank) BC050456 (THBS4, Thrombospondin 4), Gene Registration Number (Genebank) NM_016463 (CXXC5, CXXC finger 5), Gene Registration Number (Genebank) NM_003004 (SECTM1, Secreted and transmembrane 1), Gene Registration Number (Genebank) R52269 (RGS3, Regulator of G-protein signaling 3), gene accession number (Genebank) BC034950 (TBK1, TANK-binding kinase 1), gene accession number (Genebank) AF059617 (PLK2, Polo-like kinase 2 ( Drosophila), Genebank NM_005415 (SLC20A1, Solute carrier family 20 (phosphate transporter), member 1), Genebank NM_213590 (RFP2, Ret finger protein 2), Genebank AK097205 (ECM1, Extracellular matrix protein 1), heredity Genebank AF227516 (SPRY4, Sprouty homolog 4 (Drosophila)), Gene Registration Number (Genebank) BX647341 (TDO2, Tryptophan 2,3-dioxygenase), Gene Registration Number (Genebank) NM_001045 (SLC6A4, Solute carrier family 6 ( neurotransmitter transporter, serotonin), member 4), gene accession number (Genebank) NM_003490 (SYN3, Synapsin III), gene accession number (Genebank) NM_000240 (MAOA, Monoamine oxidase A), gene accession number (Genebank) AK126731 (GLCCI1, Glucocorticoid induced transcript 1), genebank NM_080542 (COLQ, Collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase), genebank BQ054887 (GCHFR, GTP cyclohydrolase I feedback regulator), gene registration Number (Genebank) NM_005629 (SLC6A8, Solute carrier family 6 (neurotransmitter transporter, creatine), member 8), gene accession number (Genebank) AB018258 (ATP10B, ATPase, Class V, type 10B), gene registration number (Genebank) Y18483 ( SLC7A8, Solute carrie r family 7 (cationic amino acid transporter, y + system), member 8), genebank (Genebank) AB019569 (CGA, Glycoprotein hormones, alpha polypeptide), genebank (Genebank) NM_014585 (SLC40A1, Solute carrier family 40 (iron -regulated transporter, member 1), Genebank BC036890 (TFCP2L4, Grainyhead-like 3 (Drosophila)), Genebank AK095632 (ABTB2, Ankyrin repeat and BTB (POZ) domain containing 2), Genebank NM_181659 (NCOA3, Nuclear receptor coactivator 3), Genebank BC042755 (RGS2, Regulator of G-protein signaling 2, 24 kDa). The biomarker of claim 1, wherein the following genes are reduced in expression by treatment of teratogenic drugs. Genebank (Genebank) NM_175607 (CNTN4, Contactin 4), Genebank (Genebank) NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank (Menebank) NM_016835 (MAPT, Microtubule-associated protein tau) (Genebank) AB028993 (NLGN1, Neuroligin 1), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), Genebank CR936770 ( GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), gene registration number (Genebank) NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), gene registration number (Genebank) NM_005103 (FEZ1 , Fasciculation and elongation protein zeta 1 (zygin I), Genebank NM_000304 (PMP22, Peripheral myelin protein 22), Genebank AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans)), Genebank (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_013975 (LIG3, Ligase III, DNA, ATP-dependent), Gene Registration Number (Genebank) BX248766 (RAD51L1, RAD51-like 1 (S. cerevisiae)), Gene Registration Number (Genebank) CR611116 (APEX1, APEX nuclease (multifunctional DNA repair enzyme) 1), Gene Registration Number (Genebank) BC005077 (FANCF, Fanconi anemia, complementation group F), Gene Registration Number (Genebank) NM_022725 (FANCF, Fanconi anemia) , complementation group F), Genebank D42045 (DCLRE1A, DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)), Genebank U63139 (RAD50, RAD50 homolog (S. cerevisiae)), Genebank AK122825 (HMGB1, High-mobility group box 1), Genebank AB067472 (VARS2L, Valyl-tRNA synthetase like), Genebank AK057498 (RUVBL2, RuvB -like 2 (E. coli)), Gene Registration Number (Genebank) BX640816 (NBS1, Nibrin), Gene Registration Number (Genebank) AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D) Genebank AK092872 (ERCC2, Excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)), Genebank number NM_006230 (POLD2, olymerase (DNA directed), delta 2, regulatory subunit 50kDa), genebank NM_006230 (POLD2, Polymerase (DNA directed), delta 2, regulatory subunit 50kDa), genebank NM_002412 (MGMT, -6-methylguanine-DNA methyltransferase), gene Registration Number (Genebank) NM_007313 (ABL1, V-abl Abelson murine leukemia viral oncogene homolog 1), gene registration number (Genebank) NM_003362 (UNG, Uracil-DNA glycosylase), gene registration number (Genebank) AF078164 (KUB3, Ku70-binding protein 3), gene registration number (Genebank) NM_004280 (EEF1E1 , Eukaryotic translation elongation factor 1 epsilon 1), Genebank NM_002528 (NTHL1, Nth endonuclease III-like 1 (E. coli)), Genebank AF078847 (GTF2H2, General transcription factor IIH, polypeptide 2, 44kDa), Genebank NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene registration Genebank NM_001184 (ATR, Ataxia telangiectasia and Rad3 related), Genebank NM_001007233 (ERCC8, Excision repair cross-complementing rodent repair deficiency, complementation group 8), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank BM467105 (CIB1, Calcium and integrin binding 1 (calmyrin)), Genebank NM_000051 (ATM, Ataxia telangiectasia mutated (includes complementation groups A, C and D)), Genebank NM_000216 (KAL1, Kallmann syndrome 1 sequence), Genebank AF061326 (C8orf1, Chromosome 8 open reading frame 1), Genebank AB028993 (NLGN1, Neuroligin 1), genes etc. Genebank NM_133631 (ROBO1, Roundabout, axon guidance receptor, homolog 1 (Drosophila)), Gene Registration Number (Genebank) BI494022 (GRLF1, Glucocorticoid receptor DNA binding factor 1), Gene Registration Number (Genebank) NM_024342 (GRLF1, Glucocorticoid receptor DNA binding factor 1), Genebank NM_016835 (MAPT, Microtubule-associated protein tau), Genebank AB209322 (SEMA3B, Sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B), gene registration number (Genebank) CR936770 (GNAO1, Guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O), gene registration number (Genebank) NM_000304 (PMP22, Peripheral myelin protein 22), gene registration Number (Genebank) AF196185 (PARD3, Par-3 partitioning defective 3 homolog (C. elegans)), Gene Registration Number (Genebank) NM_080881 (DBN1, Drebrin 1), Gene Registration Number (Genebank) NM_058179 (PSAT1, Phosphoserine aminotransferase 1), Gene Registration Number (Genebank) AB209458 (SCLY, Selenocysteine lyase), Gene Registration Number (Genebank) BC065510 (CAD, Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase), gene registration number (Genebank) AK055053 (SHMT2, Serine hydroxymethyltransferase 2 (mitochondrial)), gene registration number (Genebank) NM_1334g (ASsyntase Asase Genebank AK022713 (Homo sapiens cDNA FLJ12651 fis, clone NT2RM4002062, moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12). [AK022713], unnamed protein product; Homo sapiens cDNA FLJ12651 fis, clone NT2RM400206 moderately similar to ASPARTYL-TRNA SYNTHETASE (EC 6.1.1.12).), Genebank XM_371677 (LOC389173, Similar to phosphoserine aminotransferase isoform 1), Genebank NM_005504 (BCAT1, Bra nched chain aminotransferase 1, cytosolic, Genebank AK056980 (FLJ23441, Hypothetical protein FLJ23441), Genebank L00972 (CBS, Cystathionine-beta-synthase), Genebank (Menebank) NM_152334 (TARSL2, Threonyl-tRNA synthetase-like 2), gene registration number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), gene registration number (Genebank) NM_080820 (HARS2, Histidyl-tRNA synthetase 2), gene registration number (Genebank) X59303 (VARS2, Valyl-tRNA synthetase), Genebank Number (Genebank) NM_006567 (FARS2, Phenylalanine-tRNA synthetase 2 (mitochondrial)), Gene Registry Number (Genebank) AK122685 (GLUD1, Glutamate dehydrogenase 1), Gene Registration Number (Genebank) ) NM_015936 (CGI-04, Tyrosyl-tRNA synthetase 2 (mitochondrial)), gene registration number (Genebank) AB209246 (PPAT, Phosphoribosyl pyrophosphate amidotransferase), gene registration number (Genebank) NM_001801 (CDO1, Cysteine dioxygenase, type I) Enrollment Number (Genebank) NM_005881 (BCKDK, Branched chain ketoacid dehydrogenase kinase), Gene Registration Number (Genebank) NM_007215 (POLG2, Polymerase (DNA directed), gamma 2, accessory subunit), Gene Registration Number (Genebank) NM_001698 (AUH, AU RNA binding protein / enoyl-Coenzyme A hydratase, Genebank BC036421 (C9orf103, Chromosome 9 open reading frame 103), Genebank AK125213 (YARS, Tyrosyl-tRNA synthetase), Genebank (Genebank) AK027126 (ASS, Argininosuccinate synthetase), Gene Registration Number (Genebank) AK023909 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) NM_001190 (BCAT2, Branched chain aminotransferase 2, mitochondrial), Gene Registration Number (Genebank) AK093306 (PHGDH, Phosphoglycerate dehydrogenase), Gene Registration Number (Genebank) AB067472 (VARS2L, Valyl-tRNA synthetase like), Gene Registration Number (Genebank) NM_018122 (FLJ10514, Aspartyl-tRNA synthetase 2) (mitochondrial) Genebank NM_032484 (Homolog of mouse LGP1), BX648021 (B7-H4, V-set domain containing T cell activation inhibitor 1). The biomarker of claim 1, wherein the teratogenic drug is methotrexate. An oligonucleotide comprising all or a part of the biomarker gene sequence of claim 1, or a DNA microarray chip for teratogenicity drug search, wherein the complementary oligonucleotide is integrated. 1) treating the test compound with human placental derived cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) labeling the experimental group and the control group with different fluorescent materials while synthesizing the RNA of the experimental group and the control group of step 2) with cDNA; 4) hybridizing cDNA labeled with different fluorescent materials of step 3) with DNA microarray chip of claim 5; 5) analyzing the reacted DNA microarray chip of step 4); And 6) teratogenic drug search method comprising the step of confirming the expression level of the biomarker of claim 1 in the analyzed data of step 5) compared to the control. The method of claim 6, wherein the human placental derived cells of step 1) are human chorionic cancer cells. 8. The method of claim 7, wherein the human chorionic cancer cells are JEG-3 cells. The method of claim 6, wherein the fluorescent material of step 3) is any one selected from the group consisting of Cy3, Cy5, poly L-lysine-fluoresceinisothiocyanate (FITC), rhodamine-B-isothiocyanate (RITC), and rhodamine (rhodamine) Search method characterized by. 1) treating the test compound with human placental derived cells; 2) separating RNA from the test cell treated with the test compound of step 1) and the control cell not treated with the test compound; 3) performing a real-time reverse transcript polymerase chain reaction (RT-PCR) using the RNA of step 2) using a primer complementary to the biomarker of claim 1 and capable of amplifying the biomarker; 4) teratogenic drug search method comprising the step of confirming the expression level by comparing the gene product of step 3) with the control. The method of claim 10, wherein the human placental derived cells of step 1) are human chorionic cancer cells. The method of claim 11, wherein the human chorionic cancer cells are JEG-3 cells. The method of claim 10, wherein the primer of step 3) is at least two forward and reverse primer pairs selected from the group consisting of SEQ ID NOs: 1 to 24. Teratogenicity-inducing drug search kit comprising a DNA microarray chip of claim 5. 15. The kit of claim 14 further comprising human chorionic cancer cells, primary human placental cells or placental tissue derived cells. 15. The method of claim 14, further comprising any one selected from the group of fluorescent materials consisting of a streptadin- like phosphatease conjugate, a chemilurorensce and a chemiluminescent. Kit characterized in that. 15. The method according to claim 14, wherein the buffer is used for hybridization, a reverse transcriptase for synthesizing cDNA from RNA, cNTPs and rNTP (premixed or separated feed), labeling reagents such as chemical inducers of fluorescent dyes, and wash buffers. Kit comprising any one selected from the group of reaction reagents. Teratogenicity-inducing drug search kit comprising a primer capable of amplifying a biomarker and complementary to the biomarker of claim 1. 19. The kit of claim 18, wherein said primers are two or more forward and reverse primer pairs selected from the group consisting of the sequences set forth in SEQ ID NOs: 1-24.

Images