KR20080087292A - Dna chip, gene analysis test kit and gene information test method using oligo-gene chip - Google Patents

Abstract

A DNA chip using an oligo-gene chip, a diagnostic kit for testing genes and a method for genetic information are provided to detect viral genes existing in porcine blood or tissue, test genotypes with high specificity and acquire genetic information rapidly at low cost through one test different from a conventional testing method requiring several steps. A DNA chip comprises at least one sequence structure of an oligo-gene probe of a table 1, wherein the sequence structure includes a target gene region of a table 2. In the table 1 and 2, R is A or G, Y is C or T, C1 is a positive control, and C2 is a negative control. A diagnostic kit for testing PMWC related virus PRRSV, PCV2, and PPV genes is characterized in that an amplification means is each of a primer for RT-PCR primer sequences described in table 3. In the table 3, a Cy3 fluorescent material is attached to 5' of PR_NA-F, PR_EU-F, PC-F, and PP-F primer, R is A or G, W is A or T, K is G or T, and Y is C or T. A method for testing genetic information of the PMWS related causing virus comprises the steps of: (a) extracting RNA from porcine serum or blood; (b) amplifying the extract through multiplex RT-PCR or multiplex PCR; (c) hybridizing genes of the amplified each viruses into an oligo gene probe; and (d) identifying genetic information of specifically bonded viruses during the hybridization.

Description

DNA chip, genetic test diagnostic kit and genetic information test method using oligo gene chip {DNA CHIP, GENE ANALYSIS TEST KIT AND GENE INFORMATION TEST METHOD USING OLIGO-GENE CHIP}

1 is a photograph showing an oligo gene chip for PMWS-associated viral gene positive response and genotyping according to the present invention.

Figure 2 is a schematic diagram showing the type and location of the probe of the oligo gene chip for gene positive response and genotyping of the PMWS-associated virus according to the present invention.

3 is a photograph showing the components constituting the oligo gene chip kit for gene positive reaction and genotyping of PMWS-associated virus according to the present invention.

Figure 4 is a flow chart of the use of oligo gene chip for gene positive reaction and genotyping of PMWS-associated virus according to the present invention.

Figure 5 is a schematic diagram showing the relationship between the prior art and the present invention for positive identification and genotyping of PMWS-associated virus.

The present invention relates to a DNA chip using a oligo gene chip, a genetic test diagnostic kit, and a method for testing genetic information. In particular, a specific oligo DNA probe can be used to rapidly detect a causative viral gene for PMWS that is causing enormous damage to the hog industry. By accurately diagnosing, it relates to DNA chip, genetic test diagnostic kit, and genetic information test method using oligo gene chip that provides positive identification of each virus, genotype and vaccine strain classification, and PCV2 genotype classification at once. .

In general, PMWS is a disease that can occur in all pigs from weaning pigs to growing pigs, and has an infection rate of 5 to 50% depending on the infected farm. The mortality rate of weaning piglets infected with PMWS is not very high, but growth delay is accompanied by gradual weight loss after weaning, and the mortality rate is relatively high in individuals with such symptoms. The disease progresses due to a decrease in systemic immune function, which prevents the digestive and respiratory diseases from functioning, and the secondary symptom is accelerated. The autopsy findings suggest that lymph nodes of the whole body are 3 ~ 4 times larger than usual, and symptoms of mixed infectious agents are intensified.

In addition, PCV2 is the main cause of pathogens involved in the generation of PMWS, and viral pathogens such as PRRSV and PPV, and bacterial pathogens such as Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, and others are known. However, not all pigs infected with PCV2 show symptoms of systemic wasting syndrome, and the extent of symptoms is reported to increase when immune cells are activated by secondary infection or vaccine immunity. In particular, the onset of vaccine immunity is known as bacterial inactivation vaccine, which mainly correspond to pleural pneumonia and mycoplasma pneumonia vaccine.

Furthermore, the PCV2 originates in the United States, France, Spain, Ireland, Denmark, the United Kingdom, Germany, etc., starting in Canada in 1991, and is a circular outer strand that has been confirmed in Japan, Taiwan, etc. in Asia. As a DNA virus, it belongs to Circoviridae. Unlike the non-pathogenic PCV1 found in pig kidney cells in 1974, PCV2 is known to be one of the causes of PMWS due to infection, and has a strong resistance to disinfectants, organic solvents, and heat. It was first reported in 1998 in Korea, and was confirmed scattered throughout the country in 1999. Domestic infections occurred in pigs 6-12 weeks old and mortality was extremely low, reaching an average of 1-5%. However, in farms with poor hygiene management, mortality was more than 20%, and more than 80% of pigs showed mixed infection with other causative agents. Mixed infections cause more than 20% mortality, with clinical symptoms such as weight loss, atrophy, dyspnea, cough, pneumonia, diarrhea, cyanosis, and neurological symptoms.

Here, the PRRSV is a virus belonging to the arteririviridae (artiriviridae) is weak to heat and inactivates easily and dies in an organic solvent, so it is easily killed when exposed to the external environment, but difficult to eradicate, and has a distinct continental antigenic and genetic variation. Known. It is divided into respiratory malformations showing pneumonia, and genital malformations such as mortality of similar acids and weaning piglets. The path of infection is a direct infection due to the movement of pigs between farms or the movement of people and vehicles, and the contact between pigs in farms and the continuous circulation infection through oral or respiratory organs are suspected. In addition, infection by coagulation and artificial insemination through the semen of the sows are also being made. Infected pigs have a pattern of sustained release of the virus for about 100 days regardless of the retention of the antibody. The PRRS virus is widely distributed throughout the world and causes diseases in pigs. Isolation for the virus was reported in 1993. As a result of the recent confirmation of domestic antibody-positive pigs in pig farms, about 60% of farms were infected with PRRS virus, and each farm had a variety of infections ranging from 5 to 90%. Possession of positive pigs was confirmed to be about 21%. Infected sows showed similar acids, delivery of frail piglets, dyspnea and neurological symptoms.

Recently, the spread of PRRS virus in Korea is spreading disease through the continuous infection of subclinical PRRS virus, and its clinical symptoms and degree of damage are unclear.

In Europe, where bacterial pathogens have been eradicated, PCV2 and PPV have been identified as the major causes of PMWS, but PCV2 and PRRSV have been reported to be the major causes of PMWS in Korea (see Korean Patent Application No. 10-2004-0068570). .

On the other hand, the PMWS test method used in Korea is called PMWS when all three clinical symptoms, pathological findings, and PCV2 detection methods are satisfied, but as mentioned above, PRRSV, PPV and other factors cannot be ignored.

Furthermore, there is a demand for the development of a diagnosis system that can simultaneously and easily obtain the genetic information for each virus while simultaneously testing PCV2, PRRSV, and PPV, which are known as the major causes of the PMWS-induced virus. In addition, such a gene chip is a tool that allows large-scale analysis of genotype and gene mutations in a short time, and its importance is increasing in recent years. Gene chips have been used to detect drug-related genes and mass screens of other useful genes, and have been used to detect large amounts of genetic information in living organisms. Recently, they are being developed as early disease diagnosis technologies such as early detection of cancer-related viruses and SARS virus detection. Human Papillomavirus (HPV) gene chips approved by KFDA are commercially available gene chips (Korean Patent Registration, KR 10-0382703, KR 10-0437626).

However, the conventional test method for the suspected conventional PMWS sample is to test the PCV2, PRRSV, PPV and related viruses through the fluorescence antibody test, immunohistochemical staining, PCR techniques, etc. to distinguish the genotype of the virus Gene sequencing was used to determine the genotype, and these methods were limited in testing many causative agents with little manpower, and had a problem of cost and time.

Accordingly, the present invention has been invented to solve the above problems, by using a specific oligo DNA probe to quickly and accurately diagnose the causal virus gene for PMWS, which causes enormous damage to the hog industry, positive for each virus In the case of identification and PRRSV, the purpose of the present invention is to provide a DNA chip, a genetic test diagnostic kit, and a genetic information test method using an oligo gene chip that provides a genetic chip capable of testing genotype and vaccine strain classification and PCV2 genotype classification at once.

Another object of the present invention is to improve the reactivity with the target gene by developing a synthetic structure of the probe and the technique of dense immobilization while adjusting the distance between the probe to be immobilized by using a guanine recognition slide, especially in the gene chip technology. To provide a sensitive gene chip that can be detected.

In addition, another object of the present invention is to provide a method for detecting the genes of PRRSV, PCV2, PPV, and PRRSV vaccine strains and genotypes of each virus at the same time using the same sample.

Furthermore, another object of the present invention is to provide a technology for cleanly classifying vaccine strains at the level of Single Nucleotide Polymorphism (SNP), which is known to be a very difficult technique for genetic chip development.

A feature of the present invention provides a DNA chip comprising at least one base sequence structure of the oligo gene probe of Table 1 having a target gene region as shown in Table 2 in the base sequence structure of the oligo gene probe.

[Table 1] Sequence structure of oligogene probe

Among the bases is Y = C, T and is well known to those skilled in the art.

C1 is positive control and C2 is negative control

TABLE 2 Target gene regions in probes and their reverse sequences.

Of the bases, R = A, G, Y = C, T, well known to those skilled in the art.

Said C1 is positive control and said C2 is negative control.

The present invention provides a DNA chip comprising at least one base sequence structure of the oligo gene probe of Table 1 having a target gene region of Table 2 in the base sequence structure of the oligogene probe.

In addition, the present invention provides a DNA chip comprising a homologous probe of 10-mer or more of the target gene region in the base sequence structure, and includes a probe as an inversion base of the target gene region in the probe as shown in Table 2, or a reverse base It provides a DNA chip comprising a homologous probe of 10-mer or more of the sequence, and the target gene region or its inverted base in the probe as shown in Table 2 with a sequence substituted with peptide nucleic acid (PNA) or Locked nucleic acid (LNA) Provided is a DNA chip containing a designed probe.

On the other hand, the present invention provides a DNA chip comprising a DNA chip reaction control probe made to react with a specific primer attached to the fluorescent die, and with or without the reaction of the DAN chip reaction control probe The reaction conditions are checked for correctness and the location of the DNA probes and other positive probes based on the DNA chip reaction control.

In addition, the present invention provides a gene chip for simultaneously or individually identifying the genes of PMWS-associated virus PRRSV, PCV2, PPV using guanine recognition DNA chip substrate, while the amplification means is a complex reverse transcriptase chain of Table 3 PMWS related virus PRRSV, PCV2, PPV gene test diagnostic kit, characterized in that each primer used for reverse transcriptase chain reaction in the reaction or complex polymerase chain reaction primer base sequence.

The present invention extracts RNA from pig serum or blood and amplifies it using Multiplex RT-PCR (hereinafter referred to as 'MP RT-PCR') or Multiplex PCR (hereinafter referred to as 'MP PCR'), amplification It provides a method for examining genetic information of a PMWS-associated causal virus comprising raising a gene of each virus and performing hybridization reaction with a gene chip and confirming genetic information of viruses specifically bound in the reaction.

The PMWS-associated virus PRRSV, PCV2, and PPV genetic test diagnostic kits are characterized by attaching Cy3 to the 5 ′ terminal position of a forward primer or reverse primer, and in addition to Cy3, Cy5, biotin-binding material, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC), selected from the group consisting of x-rhodamine and Texas red It can also be attached.

In addition, the present invention is characterized in that the positive identification and genotyping of the genotype test oligobase chip of the PMWS-associated oligonucleotide chip is characterized in that the form shown in Figure 2, simultaneously testing the genotype and genotype of the vaccine strain of PRRSV virus, PCV2 Provided is a genetic chip characterized by examining the genotype of a virus.

[Table 1] Sequence structure of oligogene probe

Among the bases is Y = C, T and is well known to those skilled in the art.

[Table 2] Target gene region in the probe and its inverted base

Of the bases, R = A, G, Y = C, T, well known to those skilled in the art.

[Table 3] Complex reverse transcriptase polymerase chain reaction primer sequences

Synthesis by attaching Cy3 fluorescent material to 5` of PR_NA-F, PR_EU-F, PC-F, PP-F primer

Of the bases, R = A, G, W = A, T, K = G, T, Y = C, T, and are well known to those skilled in the art.

In the present invention, the reagent used for RNA extraction is extracted RNA according to the user's manual using the RNeasy Mini Kit of Qiagen, PRRSV North America (NA) ORF6 region 334bp, PRRSV Europe (EU) ORF6 region 367bp MP MP PCR was performed on RT-PCR, PCV2 ORF2 region 493bp, and PPV VP2 region 330bp. At this time, the enzyme and the reaction solution used in the complex reverse transcriptase polymerase chain reaction were used Qiagen Onestep RT-PCR kit, and attached to Cy3 at the 5` end of the primer to confirm the reaction after hybridization with the oligo gene chip.

In the present invention, the PMWS-associated virus amplification primer sequences used in the complex reverse transcriptase polymerase chain reaction are described in Table 3 above, and the genotype probe constituting the oligo gene chip is Table 1 above. In addition, the glass slide for immobilizing the probe used in the present invention used a guanine recognition glass slide of Biometrics Technology Co., Ltd., which selectively recognizes a region having a continuous guanine base in the probe to detect a gene at a predetermined distance. It is a groundbreaking technology that places and locks tightly.

In the present invention, the reagents used for RNA extraction are extracted using RNA of Qiagen's RNeasy Mini Kit, according to a user manual, and PRRSV North America (NA) ORF6 region 334bp, PRRSV Europe OR (EU) ORF6 region 367bp MP RT-PCR, PCV2 ORF2 region 493bp, PPV VP2 region 330bp are subjected to MP PCR. At this time, the enzyme and the reaction solution used for the complex reverse transcriptase polymerase chain reaction were used with Qiagen Onestep RT-PCR kit, and attached to Cy3 at the 5` end of the primer to check the reaction after hybridization with the oligo gene chip. It was.

(Example)

Hereinafter, preferred embodiments of the present invention are described. However, the following examples are only examples for demonstrating the constitution and effects of the present invention, and the present invention is not limited to the following examples.

1. Fabrication of oligonucleotide chips

In the manufacture of oligogene chip, the probe was immobilized on the guanine recognition glass slide of Biometrics Technology Co., Ltd. according to the manufacturer's manual.

(1) Synthesis of Oligo Gene Probes of PMWS-associated Virus

Oligo-gene probes specific to the genetic information of each virus used for PMWS-related virus detection were synthesized by inducing nine guanine groups consecutively at the 5 ′ end.

The structure of the probe is largely divided into three areas, the area immobilized on the guanine recognition slide, the area that reacts with the target gene, and the area that connects the two areas to create a constant space. This area can be omitted. Examples of probe 2 in Table 1 include the region GGGGGGGGG to be immobilized on the slide, the region TTT to create a space, and the region ATGACAGAAGTCATCTAAGGACG to react with the target gene, which is applied to all probe designs without being limited thereto. In addition, the consecutive number of guanine is not limited to 9, can be in the range of 5 to 15, the space to create a space does not limit any base of A, T, C, nor sequence sequence, The base number is also not limited to 0-12. In addition, the target gene is limited to a sequence including all or part of the base sequence of Table 1. Among the probes in Table 1, C1 is a hybrid that can be hybridized between the chip and the PCR product, and the complementary Cy3 labeled primer is included in the PCR reagent. Is a positive control. This can play two roles: firstly, it is possible to set the standard of all probes in chip analysis, and secondly, the result can be analyzed as a control when the hybridization reaction is wrong. In addition, the C2 probe is a negative control to confirm non-specific sticking during the chip hybridization reaction.

(2) Fixing PMWS-associated Virus Oligo Gene Probes

Oligo Gene Probe was immobilized to the Guanine Recognition Glass Slide of Biometrics Technology Co., Ltd. according to the manufacturer's manual.

2. Sampling and RNA Extraction

(1) PMWS-related virus sample

Samples of PMWS-related virus samples were obtained from the National Veterinary Research and Quarantine Service, and the samples were stored in the form of whole blood, tissue and virus cultures. Extraction of sample RNA or DNA was performed in a quarantine. RNA and DNA were extracted according to the manual determined using Qiagne's RNeasy mini kit.

3. PMWS related virus gene test using oligo gene chip

(1) complex reverse transcriptase chain reaction (MP RT-PCR) and complex polymerase chain reaction (MP PCR)

Primers used for MP RT-PCR for PRRSV gene amplification among PMWS-related viruses were amplified using PR_NA-F (Cy3 labeled), PR_NA-R, PR_EU-F (Cy3 labeled), and PR_EU-R (Table 3 above). The length of the sequence is 334 bp for PRRSV North America and 367 bp for PRRSV Europe.

MP RT-PCR is performed in the following manner. Using Qiagen's OneStep RT-PCR Kit, prepare a final volume of 25 ul of reaction mixture solution according to the prescribed manual. The amount of primer used is 10 pmol each 25 ul of the reaction solution, the appropriate amount of DNA chip reaction control primer HC. Synthesis of RNA into DNA at 50 ° C for 30 minutes in a PCR thermocycler (Biometra) (Reverse transcription), followed by an initial PCR activation step at 95 ° C for 15 minutes, and degeneration for 20 seconds at 94 ° C. (denaturation), annealing for 55 seconds at 20 degrees (primer annealing), and amplification of DNA by repeating the extension process 35 times at 72 degrees 30 seconds.

Among the PMWS-related viruses, primers used for MP PCR for amplifying the DNA virus PCV2 and PPV genes are PC-F (Cy3 labeled), PC-R, PP-F (Cy3 labeled), and PP-R (Table 3). The length of the amplified sequence is PCV2 493bp, PPV 330bp.

MP PCR is performed in the following manner. Using Qiagen's Taq DNA Polymerase Kit, a final volume of 25 ul of reaction mixture solution is prepared according to the prescribed manual. In this case, the amount of primers used is 10 pmol in 25ul of the reaction solution, and the appropriate amount of DNA Chip reaction control primer HC is added. Initial PCR activation step at 94 degrees for 1 minute in PCR thermocycler (Biometra), denaturation at 94 degrees for 20 seconds, initial annealing at 55 degrees for 20 seconds, 72 degrees 30 DNA amplification is repeated 35 times in an extension process.

Take 10 ul of the sample in the resulting amplified solution, mix it with a loading dye, and electrophores on 1.5% agar gel to dye for 15 min in 1ug / ml Ethidium Bromide (Sigma) solution. Afterwards, check the DNA size under ultraviolet light.

(2) hybridization

Hybridization of the genes of the PMWS-associated virus amplified on the chip substrate on which the oligo gene probe is immobilized is performed. A 50 ul capacity rubber well plate is used as a hybridization reaction chamber.

40ul of saline-sodium citrate (SSC, SDS, formamide) and 10ul of MP RT-PCR amplification product are mixed and sprayed on the chip substrate to which the rubber well plate is attached. The rubber well plate is sealed using a plate sealer to prevent evaporation of the solution, and then reacted for 1 to 2 hours in an incubator (40 degrees to 55 degrees).

After completion of the hybridization reaction, remove the rubber well plate and the plate sealer, wash for 2 minutes at 45 ~ 25 ° C of Wash 1 (SSC, SDS) solution, wash it again with Wash 2 (SSC) solution for 2 minutes, and dry the chip slide. After fluorescence signal analysis using a confocal laser scanner (PerkinElmer Scane Array Express HT) (excitation 550nm, emission 570nm). The analysis results are shown in Table 4 below.

(3) Analysis of Virus Oligo Gene Chips Related to PMWS

The genetic map of the probe of the PMWS-associated virus oligo gene chip is shown in FIG. 2, and the result is read after polymerizing the amplified gene on the chip. First, check the control probes C1 (positive control) and C2 (negative control) to see if the hybridization is intact. If the reaction is intact, read as follows. Referring to Table 4 below, if any one of the probes 1 to 4 is positive, it is determined to be PRRSV North American positive (sample names 1, 2, 4, 5 and 6), and if any of 5 to 8 is positive, PRRSV European It is judged as positive (sample name 3). Among them, probes 1, 2, and 4 all react, 3 does not, or 1, 2, 3, and 4 all react, and if the reactivity is 4> 3, a PRRSV vaccine strain is determined (sample name 2). If probes 9 or 10 respond, it is determined to be PCV2 positive (sample names 7, 8, 9, and 11); if only probes 9, 10, and 11 respond, PCV2 genotype 1 (sample name 7); and if only probes 9, 10, 12 respond, PCV2 When only genotype 2 (sample name 8) and probes 10 and 11 react, it is determined as PCV2-genotype 3 (sample name 9). If any of the probes 13 and 14 respond, read PPV positive (sample names 10 and 11).

TABLE 4 Genotype and location of PMWS-associated virus genes identified by oligogene chips

Herein, according to the present invention, a probe that reacts specifically with a virus is synthesized to confirm positive or negative viral infection from a combination of reaction results with the probe, thereby enabling PRRSV vaccine strain classification and genotyping. In particular, vaccine specific classification probe is known as a technology difficult to distinguish because its specificity is SNP (Single Nucleotide Polymorphism) level, it can be accurately distinguished in the present invention.

As described above, the present invention can detect the genotype and detection of viral genes present in pig blood or tissues with high specificity, and the existing test method requires a single test to check the tests, which must be tested in several steps. Genetic diagnostic information of porcine circovirus type 2 (PCV2), porcine respiratory syndrome virus (PRRSV), and porcine parvovirus (PPV) can be obtained, enabling rapid and inexpensive testing.

In addition, unlike the test, which takes a lot of time by conducting various stages of tests with a conventional diagnostic system, the present invention can be quickly tested within about 4 hours from sampling to separation, amplification, and genetic chip testing. It provides a very useful inspection system.

Claims (15)

A DNA chip comprising at least one base sequence structure of the oligo gene probe of Table 1 having a target gene region as shown in Table 2 in the base sequence structure of the oligo gene probe. Table 1. Sequence Structure of Oligo Gene Probes

Among the bases is Y = C, T and is well known to those skilled in the art. C1 is positive control and C2 is negative control TABLE 2. Target gene regions and their reverse sequences in the probe.

Of the bases, R = A, G, Y = C, T, well known to those skilled in the art. Said C1 is positive control and said C2 is negative control. The method of claim 1, A DNA chip comprising a probe homologous to 10-mer or more of the target gene region in the base sequence structure. The method of claim 1, A DNA chip comprising a probe having an inverted base sequence of the target gene region described in Table 2 above, or comprising a homologous probe of 10-mer or more in the inverted base sequence. The method of claim 1, A DNA chip comprising a probe designed by a sequence in which the inversion base of the target gene region or the target gene region described in Table 2 is replaced with PNA (Peptide nucleic acid) or LNA (Locked nucleic acid). A DNA chip comprising a DNA chip reaction control probe made to react with a specific primer to which a fluorescent die is attached. The method of claim 5, DNA chip for checking whether the reaction conditions with the sample is correct with or without the reaction of the DAN chip reaction control probe. The method of claim 5, A DNA chip informing the position of the DNA probe and the reference of the other positive probe relative to the DNA chip reaction control probe. DNA chip that simultaneously or individually identifies PMWS-associated viruses PRRSV, PCV2, and PPV using guanine recognition DNA chip substrate. PMWS related virus PRRSV, PCV2, PPV gene test diagnostic kit, characterized in that the amplification means is each primer used for reverse transcription polymerase chain reaction in the complex reverse transcriptase chain reaction or complex polymerase chain reaction primer nucleotide sequence of Table 3 below. . Table 3. Complex Reverse Transcription Polymerase Chain Reaction Primer Sequence

Synthesis by attaching Cy3 fluorescent material to 5` of PR_NA-F, PR_EU-F, PC-F, PP-F primer Of the bases, R = A, G, W = A, T, K = G, T, Y = C, T, and are well known to those skilled in the art. The method of claim 9, PMWS related virus PRRSV, PCV2, PPV gene test diagnostic kit, characterized by attaching Cy3 to the 5` terminal position of the forward primer or reverse primer. The method of claim 10, In addition to Cy3, Cy5, biotin-binding material, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethyltamine (TMR), tetramethyltamine isocyanate (TMRITC), x-rhodamine And a PMWS-associated virus PRRSV, PCV2, and PPV genetic test diagnostic kit, characterized in that the attachment is selected from the group consisting of Texas red. Positive identification and genotyping of the PMWS-associated virus DNA chip, characterized in that the type and location of the probe of the oligobase chip is shown in FIG. Gene chip characterized by simultaneously testing the genotype and genotype of the vaccine strain of PRRSV virus. A gene chip characterized by examining the genotype of the PCV2 virus. In the genetic information test method of PMWS-related causative virus, Extracting RNA from pig serum or blood; Amplifying the extract using Multiplex RT-PCR (hereinafter referred to as 'MP RT-PCR') or Multiplex PCR (hereinafter referred to as 'MP PCR'); Raising the gene of each amplified virus and hybridizing to a gene chip; And Genetic information testing method of the PMWS-associated causal virus comprising the step of identifying the genetic information of the virus specifically bound in the hybridization reaction.

Images