KR20070118229A - The new use of recombinant adenovirus-p53 agent in treatment of tumor patients - Google Patents

Abstract

A recombined adenovirus p53 antagonizing the certain toxic side effects such as those caused by anti-tumor chemotherapy and radiotherapy. A single recombined adenovirus p53 can also enhance the body's function of tumor patient, including biochemical index, such as promote hemogram, liver function, kidney function and the like, and improve living quality, such as increase appetite, ameliorate mental status.

Description

THE NEW USE OF RECOMBINANT ADENOVIRUS-P53 AGENT IN TREATMENT OF TUMOR PATIENTS}

The present invention relates to a method of improving the quality of life of an individual suffering from a tumor and reducing the side effects caused by tumor therapy such as chemotherapy, radiotherapy and other types of tumor therapy applied to the individual.

Tumors are the leading cause of death in animals and humans. Typical forms of tumor treatment today include surgery, radiotherapy and chemotherapy. Despite advances in the field of tumor treatment, these known therapies each have serious side effects. Surgery, for example, impairs aesthetics of a patient or interferes with normal physical function. Chemotherapy or radiotherapy can cause acute debilitating symptoms in the patient, including nausea, vomiting, diarrhea, light intolerance, and hair loss. Side effects caused by these cytotoxic compounds often limit the number and dosages at which the compound can be administered.

Signs of these side effects can be demonstrated through biochemical and physiological tests such as leukocytes (WBC), hemoglobin (Hb), aspartate aminotransferase (AST), alanine aminotransferase (ALT). The results of the tests indicate that the biochemical and physiological parameters of the chemotherapy and radiotherapy patients reach lower levels than in the control patients who did not receive tumor treatment. Often, tumor patients suffer greatly from these side effects when receiving chemotherapy or radiotherapy. In some cases, the pain and pain arising from the side effects in the patient is much greater than the pain and pain of the cancer itself.

At present, many attempts have been made to reduce the serious side effects of these cancer therapies.

US Pat. No. 6,479,500 discloses the structure and effectiveness of chemicals that can reduce the side effects caused by anti-tumor agents. US 5,017,371 discloses the use of interferon in reducing toxic side effects associated with radiotherapy or chemotherapy.

US Pat. No. 6,462,017 discloses a method of using thymosin alpha in combination with chemotherapy to reduce the severity of side effects in tumor patients.

Therefore, it is clear that there is a great need to develop new effective methods for reducing the side effects of tumor therapy to improve the quality of life of tumor patients and to help them withstand the entire course of chemotherapy or radiotherapy.

Summary of the Invention

According to the present invention, a method of administering an effective amount of recombinant p53 adenovirus in combination with traditional tumor therapy can effectively reduce side effects of such patients when conventional treatments such as chemotherapy and radiotherapy are applied to tumor patients. Reduction of side effects will improve the quality of life of patients receiving chemotherapy or radiation therapy. Test results of biological, physiological and biochemical parameters can demonstrate improvement in patients.

According to the present invention, a method of administering only recombinant adenovirus p53 alone may also improve the quality of life of tumor patients. As a sign of such improvement, better appetite, better sleep, higher levels of energy, less pain, and desired weight gain can be observed in the tumor patient.

In order to further disclose the features, advantages, objects and other aspects of the present invention, the details of the above summary will be exemplified in conjunction with the drawings belonging to this part of the invention. However, these drawings are merely exemplary and, of course, are not intended to limit the scope of the present invention.

1A and 1B show the schematic construction of the recombinant p53 adenovirus of the present invention.

2 shows a flow chart of the production protocol of recombinant p53 adenovirus.

FIG. 3 shows agarose gel electrophoresis graphs of PCR amplification products of p53 gene from recombinant p53 adenovirus after generations of generation of generations using p53 cDNA as template and 5'CCACGACGGTGACACGCTTC and 5'CAAGCAAGGGTTCAAAGAC as primers, which Stability of the recombinant p53 adenovirus is illustrated. After PCR amplification of the p53 gene, 1400 pb of DNA fragments were obtained. Lane 1: DNA molecular weight standard marker; Lanes 2, 3 and 4: PCR amplification results of p53 cDNA.

4 shows Western blot results of recombinant p53 adenovirus, extracted from lysed cells transfected with recombinant p53 adenovirus 36 hours early. The transfected cells were human laryngeal cancer cells Hep-2, and non-small cell cancer cells H1299. Lane 1: protein molecular weight standard marker; Lanes 2 and 3: negative controls of Hep-2 cells and H1299 cells, respectively, wherein the cells were not all transfected with recombinant p53 adenovirus (Ad-p53); Lanes 4 and 5: Hep-2 cells and H1299 cells transfected with recombinant p53 adenovirus (Ad-p53), respectively.

5 shows a curve demonstrating the killing effect of recombinant p53 adenovirus on Hep-2 cells. Hep-2 cells were cultured on 6-well plates until their density reached 1 × 10 ⁶ / well. Ad-p53 was administered to transfect the cells at 100 MOI for different time periods (24, 48, 72 and 96 hours). Cells were stained with trypan blue and then the percentage of blue cells (dead cells) was counted.

6 shows a flow chart for a method of evaluating the effects of recombinant p53 adenovirus on tumor treatment and clinical observation.

In clinical trials, various cancers, such as head and neck squamous cell cancer, non-small cell cancer, liver cancer, lung cancer, thyroid cancer, cervical cancer, and the like have been treated by administering recombinant p53 adenovirus to the patient. Apart from its ability to inhibit tumors, recombinant p53 adenoviruses have also been found to reduce side effects caused by conventional chemotherapy and radiotherapy and improve the quality of life of tumor patients. In the following, first the construction of the recombinant p53 adenovirus and its clinical application are described. The recombinant p53 adenovirus selected in the embodiments is a commercially available product under the trade name Gendicine.

1. p53 and p53 mutations in cancer

p53 is currently recognized as a tumor suppressor gene (Montenarh, M., 1992). Elevated expression levels have been found in a number of cells transformed by several viruses, including chemical carcinogenesis, ultraviolet irradiation, and SV40 (monkey virus 40). The p53 gene has already been recorded as a common target of mutation inactivation in a wide variety of human tumors and is by far the most commonly mutated gene in human tumor cells (Mercer, 1992). p53 mutations are present in more than 50% of non-small cell lung cancers (hollestein et al., 1991).

The p53 gene encodes a phosphorylated protein with a 393-amino acid residue capable of binding a large T antigen and an E1B protein. Expression of p53 protein is found in normal tissues and cells, but at lower levels than in transformed cells or tumor cells. Interestingly, wild type p53 plays an important role in the regulation of cell growth and division. Overexpression of wild type p53 has been shown to inhibit growth in some tumor cell lines. Thus, p53 can act as a negative regulator of cell growth (Weinberg, 1991) and can indirectly inhibit unregulated growth by directly inhibiting unregulated cell growth or by activating underlying target genes. Thus, the absence or inactivation of wild type p53 may contribute to permanent transformation. However, some studies indicate that the presence of the mutant p53 may be required for full expression of the transgenic ability of the gene.

Wild type p53 is recognized as a very important growth regulator in many cell types because of its role in genetics and biochemical properties. Missense mutations are common in the p53 gene and are essential for the transgenic ability of the oncogene. Single gene changes caused by point mutations can produce carcinogenic p53. However, unlike other oncogenes, the p53 point mutation is known to exist in more than 30 unique codons and is a dominant mutation that can cause migration of the cell phenotype without accumulating into homozygous mutations. In addition, many of the dominant negative alleles seem to tolerate among organisms and pass on to the germ line. Various mutant alleles of p53 have been found with functional changes ranging from minimal dysfunction to remarkable (Weinberg, 1991).

Casey and colleagues reported that transfection of wild-type p53-encoded DNA into two human breast cancer cell lines restores growth inhibition regulation in these cells (Casey et al., 1991). Similar effects were also demonstrated for transfection of wild type p53, but no transfection of mutant p53 in human lung cancer cell lines (Takahashi, et al., 1992). The wild type p53 is dominant for the mutant gene and will specifically inhibit cell proliferation upon transfection of the cell with the mutant p53 gene. Normal expression of the transfected wild type p53 is observed in cells with endogenous p53 and does not affect the growth of such cells. Thus, such constructs according to the invention can be accommodated by normal cells without side effects.

Thus, it is possible to treat tumors associated with p53 mutations with wild type p53 to reduce the number of malignant cells. However, the above-mentioned studies never achieve this goal, at least for the reason that DNA transfection cannot be used to introduce DNA into tumor cells in a patient's body in vivo.

2. Gene Therapy Approach

Several experimental approaches to gene therapy have been proposed so far, but each has been shown to have specific drawbacks (Mulligan, 1993). In the basic transfection methods mentioned above, DNA fragments containing the gene of interest are introduced into the cell non-biologically, for example by physically or chemically penetrating the cell membrane. Thus, this approach is limited to the treatment of cells, such as lymphocytes, which can be temporarily removed from the body and can tolerate the cytotoxicity caused by the treatment. Proteins or liposomes combined with several lipids and amphoteric peptides can be used for transfection, but the gene integration efficiency is still very low, with one integration event per 1,000 to 100,000 cells, and the expression of the transfected gene is often several days in proliferating cells. Or a few weeks in non-proliferating cells. Thus DNA transfection is clearly not a suitable method for treating tumors.

The second approach uses the innate ability of the virus to enter the cell and introduces the target gene into the cell along with some of its own genetic material. Retroviruses deliver genes expected due to their ability to integrate their genes into host genomic DNA, carry large amounts of foreign genetic material, infect a wide range of species and cell types, and perform their production and packaging using packaging cell lines Considered as a vector. However, three major problems hinder the actual use of retroviruses. First, retroviral infectivity changes with the availability of the viral receptor on the target cell surface. Second, retroviruses merely integrate efficiently into replicating cells. Finally, retroviruses are difficult to concentrate and purify.

3. Composition of Adenovirus for Gene Therapy

Human adenovirus is a double stranded DNA virus with a genome size of approximately 36 kb (Tooza. 1981). As a model system for eukaryotic gene expression studies, adenoviruses have been extensively studied and well characterized, making these viruses attractive candidate systems for the development of gene delivery systems. Such viral groups are easy to grow and manipulate, and exhibit a broad host range both in vitro and in vivo. In cells infected by lysis, adenovirus can interfere with host protein synthesis, manipulate cell organs to synthesize large amounts of viral protein, and replicate abundant amounts of virus.

The El region of the adenovirus genome includes E1A and E1B genes that encode proteins that contribute to the transcriptional regulation of the viral genome as well as several genes of the host cell. The E2 site includes the E2A and E2B genes and their encoded protein products, such as DNA-binding proteins, DNA polymerases and terminal proteins (TP proteins) as the primers for replication contribute to viral replication. The E3 gene product is accompanied by immunodeficiency of adenoviruses and prevents host cells from being attacked and disrupted by cytotoxic T cells and thus plays an important role in virus survival and virus propagation. In summary, the action of the viral E protein (early protein) is associated with DNA replication, late gene expression, and the suspension of some action of the host cell. Terminal gene products include most virion capsid proteins, which are expressed only after replication of the adenovirus is substantially terminated and initiated by the major terminal promoter (MLP). MLP shows high transcription initiation efficiency during the end of adenovirus infection (Stratford-Perricaudet and Perricaudet. 1991a).

Since only a small portion of the viral genome is required for cis action (ie, for replication and packaging of adenoviruses) (Tooza, 1981), adenovirus derived vectors are used for substitution of large DNA fragments when produced in 293 cells. The insertion space can be provided. The ad5-transformed human embryonic kidney 293 cell line (Graham, et al., 1977) can provide trans functional elements for the replication and packaging of the adenovirus vector. Thus, the properties of adenoviruses make them good candidates for in vivo tumor gene therapy (Grunhaus and Horwitx, 1992).

Particular advantages of adenovirus systems for delivering foreign proteins to cells include the following: (i) The system has the ability to replace relatively large pieces of viral DNA with foreign DNA; (ii) the structure of the recombinant adenovirus is stable; (iii) it is safe to inject adenovirus into humans; And (iv) no known relationship between cancer or malignancy and adenovirus infection; (v) adenoviruses can be produced with high titers; And (vi) adenoviruses are highly infectious.

Compared to retroviral vectors, adenovirus vectors have high levels of external gene expression and adenovirus replication is independent of host gene replication. Since genes transformed at the E1 site of adenoviruses are easily deleted and do not affect the efficient expression of foreign genes, the risk of tumorigenesis from adenovirus vectors is considered negligible (Grunhaus & Horwitz, 1992).

In general, adenovirus gene delivery systems are recombinant adenoviruses that have been engineered by genetic engineering, which are incapable of replication by deletion of the El region of their genome and still retain infection performance. Relatively large foreign genes can be expressed when additional deletions are made in the adenovirus genome. For example, adenoviruses that have deleted both the E1 and E3 sites can carry up to 10 Kb of external DNA and can propagate to high titers in 293 cells (Stratford-Perricaudet and Perricaudet, 1991a). Surprisingly, continuous expression of foreign genes following adenovirus infection has also been reported.

Adenovirus mediated gene delivery has recently been evaluated as a means of mediating gene delivery into eukaryotic cells and experimental animals. For example, it has been shown that adenovirus vectors can be used to deliver normal OTC enzyme genes in the treatment of mice suffering from ornithine transcarbamylase (OTC) deficiency, a rare recessive gene disease. Unfortunately, expression of OTC was only achieved in 4 of 17 cases (Stratford-Perricaudet et al., 1991b). Thus, in most experimental mice the defects were only partially corrected and no physiological or phenotypic changes were induced. These results clearly provide little suggestion for the use of adenovirus vectors in tumor therapy.

Although the use of adenoviruses to transduce the genes of cystic fibrosis transmembrane and conductivity regulators (CFTR) into the rat lung epithelium for the treatment of cystic fibrosis is only partially successful, genes carried in the epithelium of the animal It was not possible to evaluate the biological activity of (Rosenfeld et al., 1992). Again, the study demonstrated that expression of CFTR protein in pulmonary airway cells showed no physiological effect.

These results demonstrate that adenovirus cannot modulate external expression sufficient to achieve physiological effects in infected cells, and therefore researchers do not suggest the use of the adenovirus system in tumor therapy. Furthermore, prior to the present invention, it was a common idea that p53 could not be incorporated into packaging cells used for the production of recombinant adenoviruses because they would be toxic to packaging cells. Since the initially expressed protein E1B of adenovirus binds to the p53 protein, it was thought that this is a further technical reason for not being able to bind the adenovirus vector and the p53 gene together.

4. Composition of Ad-p53 and Tumor Suppression

The present invention provides new and more effective tumor suppressors and vectors for tumor gene therapy. The recombinant virus takes advantage of the adenovirus vectors, such as high titers, broad target range, effective transduction, and non integration into target cells. Specifically, the present invention provides a replication-defective, helper virus-independent adenovirus expressing wild type p53 (Ad5RSV-p53) under the control of a Raus sarcoma virus promoter.

Regulatory functions on expression vectors are often provided from viruses when expression of foreign genes is required in mammalian cells. For example, commonly used promoters are derived from polyoma, adenovirus 2 and monkey virus 40 (SV40). The early and late promoters of the SV40 virus are particularly useful because both are easily obtained from fragments of the virus that also contain the origin of replication of the SV40 virus. Smaller or larger SV40 fragments may also be used, provided that approximately 250 bp sequences extend from the HindIII site towards the BglI site located in the origin of replication. The 250 pb sequence may be retained or deleted as needed. Moreover, it is also possible to use promoters or regulatory sequences commonly associated with the selected target gene, which is often preferred, provided that such regulatory sequences are compatible with the host cell system.

The origin of replication may be provided by an external source derived from SV40 or other sources (eg polyoma, adenovirus, herpes stomatitis virus VSV, bovine papilloma virus BPV), or by host cell chromosomal replication mechanisms. have. When integrating the vector into a host cell chromosome, the latter is often sufficient.

The design and construction of the recombinant p53 adenovirus is illustrated in FIG. 1. In this regard, improved protocols for the construction and identification of such recombinant adenoviruses have been developed. After identification, the p53 recombinant adenovirus was structurally confirmed by PCR analysis. After isolation and structural confirmation, the p53 adenovirus was used to infect human laryngeal cancer Hep2 cells and non-bovine lung cancer H1299 cells (with knocked out homologous p53 gene). Western blot results showed that the external p53 protein was expressed at high levels.

The studies disclosed herein show that p53 recombinant adenovirus has the properties of tumor suppression, which inhibition works by restoring p53 protein function in tumor cells. These results may support the use of Ad5RSV-p53 virions as therapeutic agents for tumor therapy.

As a new gene delivery system, recombinant adenovirus has many possible uses in the development of gene therapies and vaccines. The propagation of recombinant adenoviruses is therefore an important molecular biological tool. Existing methods of propagation of recombinant adenovirus include transfection of 293 cells mediated by phosphate calcium precipitation followed by subsequent plaque analysis on the transfected cells. The transfection efficiency associated with this method needs to be improved and its process needs to be simplified.

5. Improved Mitigation of Side Effects Caused by Chemotherapy and Radiotherapy

Treatment of tumors has been the focus of significant research and development efforts over the past two decades. Many approaches to tumor therapy have been studied. As a practical matter, tumor therapy uses several treatment methods, including surgical resection, radiotherapy, chemotherapy, bone marrow transplantation (for the treatment of some types of blood cancer, especially acute granulocytic leukemia), and traditional Chinese medicines. It includes. The particular protocol used to treat a given malignant tumor will vary depending on the nature, location and type of malignant tumor to be treated. Surgical resection is still the most preferred method for the treatment of tumors and is used as the main therapy for about 60% of tumors. However, surgical resection is often combined with radiation therapy and / or chemotherapy to complete the overall treatment protocol. If the malignant tumor is not local or its location is below the probability of successful removal or resection by surgical techniques, chemotherapy and radiotherapy are often combined.

Chemotherapy has been shown to effectively treat some types of cancers such as Hodgkin's disease, acute lymphocytes and granulocytic leukemia, testicular cancer, non-Hodgkin's lymphoma and the like. In other types of tumors, chemotherapy has been used effectively to reduce tumor size before surgery. Chemotherapy often involves the combination of chemotherapy agents. New protocols are being developed and are being tested by medical research groups.

Antitumor agents, however, are drugs that can damage normal tissue in addition to killing tumor cells. Despite extensive studies conducted to limit dosage levels and drug dosing schedules, chemotherapy often produces unpleasant and possibly dangerous side effects due to drug toxicity. Radiotherapy also creates similar problems. The most common for such side effects are nausea, vomiting, hair loss, and bone marrow reduction. Such side effects are usually, but not always, reversible. Some anticancer drugs can permanently damage the nervous system, heart, lungs, liver, kidneys, gonads or other organs. Some chemotherapeutic agents are themselves carcinogenic. Patients receiving radiation therapy or chemotherapy should also take prophylactic or preventive measures simultaneously to avoid life-threatening infections arising from immunosuppressed states caused by the chemotherapy.

Some treatment strategies have been developed to eliminate the side effects of radiotherapy and chemotherapy for tumors. For example, it may be possible to administer drugs that slightly relieve nausea, the administration of antibiotics or residence in a laminar flow ward may help fight the infection, and transfusion to increase the number of red blood cells and platelets. .

Chemotherapeutic agents can be broadly classified and can play an important role in the treatment of tumors in humans. Such chemotherapeutic agents include, but are not limited to, alkylating agents (e.g. nitrogen mustard), metabolites (e.g. pyrimidine homologues), radioisotopes (e.g. phosphorus and iodine), hormones (e.g. estrogens and Adrenocorticosteroids), miscellaneous (eg hydroxyurea) and natural products (eg pacilitaxel, vincaleucoblastine and antibiotics). Prior compounds are not therapeutic agents, but are widely accepted among physicians as being useful for the inhibition, alleviation, delay and control of malignant tumors. While these compounds are known to be effective and are generally used clinically as proliferation inhibitors, there are well recognized disadvantages associated with their administration as anticancer agents. The alkylating agent has a significant cytotoxic action and the drug's ability to interfere with mitosis and proliferation of normal cells can be fatal. The metabolic antagonists can lead to anorexia, gradual weight loss, depression and lethargy. Prolonged administration of metabolic antagonists can produce severe inhibition of the bone marrow. Both the alkylating agent and the metabolic antagonist generally have a suppressive effect on the immune system. Prolonged administration of natural products, such as vincaleucoblastine, can also produce myelosuppression. Hydroxyureas and other chemical derivatives can rapidly reduce the levels of adrenocorticosteroids and their metabolites. Administration of hormonal compounds or radioisotopes is also undesirable in view of damaging the immune system and thereby incapacitating the body's defense against common infections. In most cases, it may be desirable to use chemotherapeutic agents that are effective in inhibiting, delaying or suppressing malignant tumors while simultaneously stimulating and promoting the immune function of the patient.

Chemotherapeutic agents can be given in a single dose or several large doses, or more typically in small doses of one to four times a day and can last for weeks or months. There are many cytotoxic agents used to treat cancer, and their mechanism of action is generally poorly understood.

Apart from this mechanism, useful chemotherapeutic agents are known to damage and kill cells in both tumors and normal tissues. The successful use of chemotherapeutic agents in the treatment of tumors relies on their differential killing effect on tumor cells compared to the side effects of these agents on important normal tissues. Among these effects, killing of hematopoietic cells and leukocytes can cause infection. Acute and chronic bone marrow toxicity are also key factors limiting the use of chemotherapeutic agents in the treatment of tumors. These are all associated with a decrease in the number of such cells (eg pluripotent stem cells and other progenitor cells) caused by both the cytotoxic agent or the lethal effect of radiation on hematopoietic cells, which effect more mature bone marrow components. Depletion promotes the differentiation of stem cells by a feedback mechanism and thus reduces the amount of stem cells (US Pat. No. 5,595,973, incorporated herein by reference in its entirety). Stimulators and inhibitors of bone marrow dynamics play a prominent role in the induction of injury and repair patterns (Tubiana, et al., Radiothereapy and Oncology, 29: 1, 1993).

Prevention or protection from the side effects of chemotherapy will generate great benefits for tumor patients. However, many efforts to reduce these side effects have not been successful. For life-threatening side effects, efforts have been focused on changing the dosage and schedule. Other options such as granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage-CSF (GM-CSF), epithelial growth factor (EGF), interleukin 11, hematopoietic promoter, thrombopoietin, giant Nuclear cell development and growth factors, pixiecaine, stem cell factor, FLT-ligand as well as interleukin 1, 3, 6 and 7 have been used to increase the normal cell count in various tissues before starting chemotherapy ( Jimenez and Yunis, Cancer Research, 52: 413-415; 1992). The mechanism of protection by these factors, although not fully understood, seems most likely to increase the number of normal major target cells prior to chemotherapy and not to increase cell viability following chemotherapy.

Acute myelosuppression often occurs as a result of cytotoxic chemotherapy and is widely recognized as a dose limiting factor in tumor treatment (US Pat. No. 5,595,973). While other normal tissues may be adversely affected, bone marrow is particularly sensitive to antiproliferative-specific treatments such as chemotherapy or radiotherapy. For some tumor patients, hematopoietic cytotoxicity induced by chemotherapeutic agents often limits the chance of chemotherapy dose escalation. Repeated or high dose cycles of chemotherapy may contribute to severe stem cell depletion, leading to severe long-term hematopoietic cell dysfunction.

The methods disclosed herein are suitable for use in combination with chemotherapeutic agents. The chemotherapeutic agent includes any type of drug, including but not limited to cyclophosphamide, taxol, 5-fluorouracil, cisplatinum, methotrexate, cytosine arabinoside, mitomycin C, prednisone, binde Cine, carbaplatinum and vincristine. Cytotoxic agents, among others, may also be antiviral compounds capable of destroying proliferating cells. For a general discussion of cytotoxic agents used in chemotherapy, see Sathe, M. et al., Cancer Chemotherapeutic Agents: Handbook of Clinical Data (1978), incorporated herein by reference.

The method of the present invention is also particularly suitable for patients who require repeated or high doses of chemotherapy or radiotherapy. For some tumor patients, hematopoietic cytotoxicity induced by chemotherapeutic agents often limits the chance of chemotherapy dose escalation. Repeated or high dose cycles of chemotherapy may contribute to severe stem cell depletion, leading to severe long-term hematopoietic cell dysfunction and bone marrow depletion. The methods of the present invention provide reduced mortality and improved blood counts in combination with chemotherapy.

The active agent (referred to herein as the recombinant p53 adenovirus) may be any suitable route, such as but not limited to intratumoral local injection, intraperitoneal injection, intra bladder injection, intrabronchial dropping, hepatic arterial injection, and peripheral vein It can be administered by dropping or the like. All methods of administration are safe and effective. The currently recommended mode of administration is topical injection in the tumor. Vectors, adjuvants and excipients customary in the pharmaceutical art can be used in topical injection formulations.

The active agents can be formulated in solid form (granules, powders or suppositories, etc.) or liquid forms (solutions, suspensions or emulsions, etc.) and dissolved in various solutions, which must be sterile and contain sufficient peptide and are recommended. It is harmless to the application and must be very stable under these conditions, but can be degraded by strong acids or strong bases.

Dosage regimens for such active agents vary depending on a number of factors, such as the type of tumor, the age, weight, sex, general health of the patient, the severity of the patient, the route of administration and drug formulation, and the like.

Intratumoral topical injection is most preferred, with a dosage range of 1 x 10 ⁷ VP to 7 x 10 ¹³ VP each time (maximum tolerable dose is not determined). Currently, 1 x 10 ¹² VP each week is usually used for clinical trials. The dosage is sufficient for the formulation to produce the maximum therapeutic effect with the minimum dose of agonist. The regimen can minimize the cost of treatment and potential toxic side effects.

In the most preferred embodiment, a topical injection of 1 × 10 ¹² VP doses per week can be applied 72 hours prior to chemotherapy or radiotherapy. In another embodiment, the agent can be applied repeatedly by treatment of several procedures. It is desirable that the patient's blood count (white blood cells, platelets and neutrophils) be restored to a level suitable for the next chemotherapy treatment (as judged by the doctor) and the next procedure will begin immediately after completion of the preceding procedure.

In addition to the active ingredients, the pharmaceutical compositions may further contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into applicable formulations. A more detailed description of the manufacturing technique can be found in the latest edition of Remington's Pharmaceutical Sciences, Maack Publishing Co., Easton, Pa.

The following examples further illustrate and illustrate the invention, which should be construed as limiting the scope of the invention.

Example  1. Recombination p53 Adenovirus  Formulation, Zendicin  Produce

Recombinant p53 adenovirus was prepared and used in clinical trials. The trade name of the prepared adenovirus is "Zandicin". A detailed procedure for initiating the preparation of gendysine is disclosed in Chinese Patent No. ZL 02115228.4, the entire contents of which are incorporated herein by reference.

Human recombinant p53 adenovirus was constructed and prepared as described in FIGS. 1 and 2. Such a recombinant adenovirus was selected to introduce a shuttle vector containing the p53 gene and an adenovirus vector together into this coli and obtain a positive recombinant clone. The recombinant clones were amplified in 293 cells and, through several purification steps, clinical grade human recombinant p53 adenovirus was harvested. 3 shows the results of measurement of the structural stability of recombinant human p53 adenovirus. The results in FIG. 3 show that after several generations, the recombinant adenovirus maintained its structural stability. 4 shows Western blot results indicating that human recombinant p53 adenovirus can be highly expressed in laryngeal cancer cells Hep-2 and non-bovine lung cancer cells H1299. 5 is a graph showing the killing effect of the recombinant p53 adenovirus on Hep-2 cells. Cells were stained with trypan blue followed by counting the percentage of blue cells (dead cells) and the results are shown in FIG. 5.

Example  2

Substance: Recombinant human p53 adenovirus injection (zendycin) is provided by Shenzhen Sibiono Gene Tech Co., Shenzhen, China, Batch No., # S010731 and the drug is 1 x 10 ¹² Packaged in VP / each dose and each dose contained in a 2 ml saline bottle. There was one bottle in each box.

The clinical trial was designed as a multicenter, co-control, single agent, open label, randomized clinical trial.

The patient selection process was as follows: The patient signed a consent form to participate in the clinical trial. Pathological analysis confirmed that the patient actually suffered a head and neck tumor. The tumors are then classified according to TNM classification. Patients allowed for the trial had appropriate tumor lesions that could be easily observed and that topical drug injection was easy. The age of the patients ranged from 18 to 70 years and his life expectancy was over 3 months. Both male and female patients were allowed.

Exclusion criteria were selected as follows: patients with acute upper respiratory tract infection, or patients with uncontrolled fever resulting from such an infection were excluded. Also excluded were patients where the lesions observed were being treated with other topically administered drugs. Severe heart, liver, lung or kidney disease, patients prone to bleeding, pregnant or lactating female patients were also excluded.

During the trial, patients withdrawing to the following criteria were withdrawn: patients who could not withstand the high fever caused by the use of the test drug; Patients who should be discontinued due to unexpected onset of toxic side effects; And patient withdrawn from the trial for personal reasons. This clinical trial, with 155 patients, lasted from June 2001 to May 2003 in four hospitals.

The clinical trial protocol was designed as follows:

1. Groups of Gene Therapy in Combination with Radiotherapy

Every Friday, gendysine was injected at a dose of 10 ¹² VP in each injection inside the tumor. Three days after the injection, radiotherapy is performed on the patient. Radiation is performed at a dose of 70 Gy / 35 f for about 7-8 weeks using standard or intensity controlled three-dimensional conformal radiation therapy. After 5 weeks and cumulative administration of 40 Gy, the first cycle is completed. After a cumulative dose of 70 Gy of 8 weeks, the second cycle is completed. At week 12, treatment results are confirmed by CT scanning. Using WHO fidelity tumor objective assessment criteria, percent cancer reduction was calculated at time points corresponding to 40 Gy, 70 Gy, and time points of treatment outcome confirmation. Treatment results are classified into complete response (CR), partial response (PR), stable disease (SD), and progressive disease (PD).

2. Gene Therapy Groups in Combination with Chemotherapy

Zenidicin was injected intratumorally at a dose per week. The total treatment period is 8 weeks and 8 injections are performed. Chemotherapy commences three days after the injection of gendysin. 80 mg / m 2 of DDP (cis-platinum) was injected intravenously on day 1. From day 1 to day 5, 5-FU (5-fluorouracil) was continuously injected intravenously at a dose of 500 mg / m 2.

3. Clinical laboratory test:

A regular trial of a patient is started within one week of the patient's acceptance of the clinical trial and is performed weekly after the start of the clinical trial. Test items included physical examination, KPS scoring, complete blood test, complete urine test, and complete stool test. Every month, biochemical tests including blood urea nitrogen (BUN), creatinine (Cr), AST and ALT, EKG and chest X-rays are performed. Every week, the WHO classification criteria were used to measure and record the toxicity of gendisin in this test to assess acute and subacute toxicity for anticancer drugs. The categories are mild (I), moderate (II), severe (III), and life threatening degree (IV). According to the test results of the stage I clinical results, body temperature changes were particularly noticed.

4. Results Analysis, and Statistical Analysis

All statistical analyzes were performed using SPSS11.0 statistical software. The test was performed according to the ITT test method. A comparison of the size reduction of tumor lesions was performed using the t test. Treatment significance comparisons were performed using the Pearson Chi-Square test.

5. Effects on blood, urine, feces, and liver and kidney function.

The results are shown in Table 1.

Complete blood measurement and blood biochemistry of the GT / RT test group of 37 patients Item Before injection (A) 4 weeks (B) 8 weeks (C) P value (A-B) (A-C) WBC (10 ⁹ / L) 6.81 ± 2.10 5.48 ± 1.47 5.41 ± 1.58 0.003 ^▲ 0.002 ^▲ Hemoglobin (g / L) 134.05 ± 15.08 126.03 ± 14.73 127.28 ± 14.51 0.040 ^▲ 0.095 Plt (10 ⁹ / L) 250.49 ± 69.67 242.19 ± 86.74 250.58 ± 110.33 0.893 1.000 AST (U / L) 27.59 ± 13.70 25.51 ± 12.82 26.08 ± 11.16 0.701 0.829 ALT (U / L) 31.14 ± 29.39 27.84 ± 28.44 26.76 ± 27.06 0.835 0.734 BUN (mmol / L) 5.51 ± 1.12 4.83 ± 1.21 4.80 ± 1.66 0.046 ^▲ 0.110 Cr (mmol / L) 80.59 ± 12.37 78.64 ± 11.21 77.53 ± 11.41 0.698 0.429

(There is a difference between two comparison groups (P <0.05)).

The results in Table 1 indicate that both the complete blood measurement and the blood biochemical test are within the normal ranges when compared with the injection of gendysine and two weeks after the injection of gendysine. Prior to the gendysine injection, the ALT, AST, BUN and Cr values were normal and the values only slightly decreased after 2 weeks of the gendysine injection. Chest X-ray and EKG showed no difference before and after gendysin injection.

Example  3. Combined with chemotherapy for patients with liver cancer Zendicin  therapy

Human recombinant p53 adenovirus injection (zenidicin) was prepared as described in Example 1.

The clinical trial was designed as a multicenter, co-control, single agent, open label, randomized clinical trial.

The patient selection process was as follows: First, the patient signed a consent form to participate in the clinical trial. Pathological and histological examination confirmed that the patient had hepatocellular carcinoma (HCC). The criteria for evaluation of HCC satisfied Chinese standard protocols for the diagnosis and treatment of common malignancies. The tumor must have a suitable tumor lesion that can be easily observed and that can be injected locally by drug injection. The age of the patients ranged from 18 to 75 years and his life expectancy was over 3 months. Both male and female patients were allowed.

Exclusion criteria were selected as follows: patients with acute upper respiratory tract infection, or patients with uncontrolled fever resulting from such an infection were excluded. Also excluded were patients where the lesions observed were being treated with other topically administered drugs. Severe heart, liver, lung or kidney disease, patients prone to bleeding, pregnant or lactating female patients were also excluded.

The withdrawal criteria were as follows: patients who were unable to tolerate the high fever caused by the use of the test drug; Patients who should be discontinued due to unexpected onset of toxic side effects; And patients withdrawn from the trial for personal reasons along the way.

From March 2004 to July 2004, 35 cases existed in liver cancer clinical trials of gendisine gene therapy and chemotherapy combination therapy.

One). Treatment Protocols:

The clinical trial involved 75 male HCC patients and 51 males and 24 females. The HCC cancer patients were mid to late.

Two groups were set randomly.

In the first group of 40 patients, simple chemotherapy was performed using trans-catheter hepatic artery embolization (TACE). Using a conventional femoral artery puncture, the catheter was implanted into the abdominal artery or a conventional hepatic artery. Afterwards, upper mesenteric artery or diaphragm artery was used to measure tumor number, location, type, size, supply vessels, and arteriovenous fistula, and thus identify other supply arteries for liver cancer. Liver arteries using 5-gelatinyl (5-FU), adriamycin (ADM), mitomycin (MMC), cisplatin and hydroxycamptothecin (DDP / HCPT) using gelatinous spongy embolism to perform chemotherapy Injected into. Thereafter, the catheter was superselectively introduced into the blood supply branch of the hepatic artery of the tumor, and a fully emulsified mixture of 10 mg ADM and 10-30 ml of iodide oil was slowly injected into the liver under an X-ray monitor. TACE was injected every 4 weeks and treatment effect was evaluated after 2 injections.

Gene therapy in combination with TACE was performed in a second group of 35 patients (GT-TACE). 48-72 hours before the TACE, gendysine was injected using percutaneous intratumoral injection at various points of the tumor under the guidance of CT. Based on the size of the tumor, the dose was injected at about 1-4 x 10 ¹² VP each time once a week, 3 to 4 consecutive times. The TACE chemotherapy was administered as described above.

According to the WHO Fidelity Tumor Objective Evaluation Criteria, treatment results are classified into complete response (CR), partial response (PR), stable disease (SD), and progressive disease (PD).

2). Routine standard clinical trials.

A regular trial of a patient is started within one week of the patient's acceptance of the clinical trial and is performed weekly after the start of the clinical trial. Test items included a physical examination, Karnovsky performance score (KPS) scoring, a complete blood test, a complete urine test, and a complete stool test. Every month, biochemical tests including blood urea nitrogen (BUN), creatinine (Cr), AST and ALT, EKG and chest X-rays are performed. Every week, the WHO classification criteria were used to measure and record the toxicity of gendisin in this test to assess acute and subacute toxicity for anticancer drugs. The categories are mild (I), moderate (II), severe (III), and life threatening degree (IV). According to the test results of the stage I clinical results, body temperature changes were particularly noticed. The general condition of the patient is recorded using the KPS method.

3). Result analysis and statistical analysis

All data were analyzed using SPSS11.0 statistical software.

4). Impact on white blood cell count, symptoms and KPS score

The effect on white blood cells is shown in Table 2. Leukocyte count can be seen to be significantly reduced in the control group of simple TACE chemotherapy. The difference between the two groups was significant, p <0.05.

Reduction of white blood cell count (x 10 ⁹ / L) and number of cases (%) group Leukocyte Reduction Total number of reduction cases shown 4.0-3.0 3.0-2.0 2.0 or less GT-TACE 12 (25.0) 4 (8.3) 2 (4.2) 18 (37.5) TACE 8 (13.3) 20 (33.3) 11 (18.3) 39 (65.0)

Table 3 shows the results of symptomatic improvement of the patients. From Table 3, it can be seen that after a month of treatment, the GT-TACE group showed a strong symptom improvement. The difference between the two groups was significant, p <0.05.

Improvement of the patient after one month of treatment group Number of cases Fever Digestive reaction Reduced pain GT-TACE 35 25 (71.4) 16 (45.6) 30 (85.7) TACE 40 18 (45.0) 24 (60.0) 21 (52.5)

Table 4 shows the improvement of the patient in terms of his KPS score. From Table 4, it can be seen that after a month of treatment, the GT-TACE group of patients showed a significant improvement in terms of their KPS scores.

Changes in KPS Score After One Month of Treatment group case Increase 20 Increase 10 No change decrease Total increase GT-TACE 35 7 15 9 4 22 (53.3) TACE 40 9 10 8 13 19 (47.5)

The results of this Example resulted in patients with the gene therapy group (GT-TACE) in combination with chemotherapy improved in tumor size reduction, symptom improvement, leukocyte count and KPS scores in patients compared to chemotherapy only controls. To demonstrate. In addition, appetite and sleep of the patients were significantly improved in the GT-TACE group. These results suggest that when treating liver cancer with chemotherapy using human recombinant p53 adenovirus product (Gendysine), Gendysine can alleviate the side effects caused by chemotherapy alone and also affect the general and mental state of the patient. Indicates that it can be improved.

Example  4: in improving the quality of life of tumor patients Zendicin  Efficacy alone

The 40-year-old woman with advanced breast cancer on the left already had surgery. Surgical approaches include mastectomy and axillary lymph node dissection. After the surgery, 10 of 12 surgically removed lymph nodes were found to have cancer cell metastasis. Later, the patients were given a combination of 45 Gy / 25f / 5w dose level of radiation therapy and 9 cycles of cyclophosphamide + erucine + 5-fluorosil chemotherapy. However, six months after the combination therapy, metastasized tumors were found in several spinal regions, including the cervical, thoracic and lumbar vertebrae. Additional treatment of chemotherapy with taxotere, vinoralbine, and the new oral chemotherapeutic drug, geloda, was performed on the patient. During the rest of the chemotherapy the patient maintained bone stability using zometa. However, all of these treatments failed to achieve the desired therapeutic effect. By January 2004, the patients had increased levels of ALT and AST, and blood counts. The patient's physical condition began to worsen and began to feel pain, fatigue, weight loss, mental depression, etc., indicating that the patient's illness had progressed.

After failing to achieve effective effects by chemotherapy and radiotherapy in the hospital of the patient's failure, the patient was treated with gendysin therapy in the hospital. The patient then took the gendysine home and continued the therapy, reporting the patient's progress in reverse therapy. At 1 month after gendysin injection, CT and MRI tests suggested that tumors that advanced over the last 6 months were under inhibition. The patient believed this to be a promising sign (“I was very tired on the day of the injection. However, I felt better and more vigorous without any pain for several days before the next injection.” Three months after the treatment with Zendicin, MRI Scanning was performed, which showed the presence of fatosis in the lesions of thoracic vertebrae 11, 12 and lumbar spine 3. No progression of other metastases was observed The results of blood tests were normal and bilirubin levels were markedly high. 5 months after the treatment with gendysin, the patient went on vacation with his family, had no discomfort and had a good mental state.After 7 months of treatment with gendysin, MRI scanning results The tumor at the thoracic vertebrae 11 disappeared and no progression of other lesions was observed without a new lesion being observed. The ambiguity was not observed in the chest X-ray, and the number of blood cells reached a completely normal level The patient had no pain and had a good mental state After 9 months of treatment with gendysine, MRI scanning results showed no signs of tumor exacerbation Pulmonary X-ray results were good Blood cell count reached normal levels The patient felt no pain and had better awareness than before.

Example  5

A 60 year old woman was diagnosed with invasive pancreatic cancer with a 5 cm diameter tumor and was expected to have a life expectancy of only 1 year. She could not bear the side effects associated with chemotherapy, so she decided not to receive conventional chemotherapy. Instead, she was treated with Gendysine and 20 doses of intravenous Gendysine injections were performed for 8 weeks.

After gendysin treatment, CT scanning demonstrated that the tumor did not progress in her pancreas and her small liver damage had disappeared. After further observation, the lesions became stable, suspicious damage disappeared, and the swollen lymph nodes were found to contract.

conclusion

We have found that recombinant p53 adenovirus surprisingly has a unique effect upon injection into tumor patients. That is, when combined with chemotherapy or radiotherapy, this can alleviate the side effects caused by treating the tumor with radiation therapy or chemotherapy alone.

This finding is important because the general condition of these patients is significantly improved after injecting gendysin into tumor patients, especially late stage patients. For example, the psychological and mental states of these patients are better and their appetite is improved. This effect is considered to be due to the overall regulation of gendysine on the neuroendocrine immune system. Thus, gendysine can improve and enhance the function of various organs of a patient and improve the health of the patient as a whole.

Possible mechanisms are disclosed as follows:

Gendysine is a viral particle produced by genetic engineering. It can stimulate and regulate the nervous, endocrine and immune systems of the body to produce a series of neurological, hormonal and cellular factors. As can be seen from the above examples, one phenomenon experienced by a patient after administration of gendysine is an increase in body temperature, ie fever. This phenomenon may explain that gendysine may activate the patient's immune system. Through overall regulation of the neuro-endocrine-immune network, it improves the patient's immune capacity and effectively increases the ability of NK cells and CTL cells to kill tumor cells, thus improving the antitumor effect of humoral immunity and cellular immunity. Seems to be. Zendicin can also act to modulate the physiology of the patient, thus improving the overall health of the patient.

Although the invention has been disclosed in some detail for the purpose of illustrating and clarifying new discoveries of the therapeutic effects of gendisin, it will be apparent to those skilled in the art that some changes and modifications have been made. Accordingly, the above description and examples should not be construed as limiting the scope of the invention as defined by the appended claims.

Claims (19)

Use of a pharmaceutical composition comprising a therapeutically effective amount of recombinant p53 adenovirus and a pharmaceutically acceptable excipient in ameliorating side effects, such as, but not limited to, side effects caused by antitumor chemotherapy and radiotherapy. The use of claim 1, wherein the pharmaceutical composition is administered concurrently with chemotherapy. The method of claim 1, wherein a single dose of the pharmaceutical composition is administered prior to the administration of the chemotherapeutic agent. 4. Use according to claim 3, wherein a single dose of the pharmaceutical composition is administered the day before administration of the chemotherapeutic agent. 4. The use of claim 3, wherein a single dose of the pharmaceutical composition is administered on any of three days prior to chemotherapeutic administration. Use according to claim 1, wherein a single dose of the pharmaceutical composition is administered after administration of the chemotherapeutic agent. Use according to claim 6, wherein a single dose of the pharmaceutical composition is administered the day after administration of the chemotherapeutic agent. 7. The use of claim 6, wherein a single dose of the pharmaceutical composition is administered on any of three days after administration of the chemotherapeutic agent. The method of claim 1, wherein a single dose of the pharmaceutical composition is administered at any time during the chemotherapy treatment. The use of claim 1, wherein a single dose of the pharmaceutical composition is administered on a radiotherapy day. The use of claim 1, wherein a single dose of the pharmaceutical composition is administered prior to radiotherapy. The use of claim 11, wherein a single dose of the pharmaceutical composition is administered on any of 3 days prior to radiotherapy. The method of claim 1, wherein a single dose of the pharmaceutical composition is administered after radiotherapy. The use of claim 13, wherein a single dose of the pharmaceutical composition is administered on any of 3 days after radiotherapy. Use according to claim 1, wherein a single dose of the pharmaceutical composition is administered at any time during the radiotherapy treatment. Use according to claim 1, wherein the side effects include, but are not limited to, anorexia, insomnia, weakness, nausea, vomiting, diarrhea, photophobia and alopecia, and combinations thereof. Use of a pharmaceutical composition comprising a therapeutically effective amount of a recombinant p53 adenovirus and a pharmaceutically acceptable excipient in the manufacture of a medicament for improving the quality of life of a tumor patient. 18. The use of claim 17, wherein the pharmaceutical composition is administered in a single dose. 18. The use of claim 17, wherein the signs of improved quality of life include, but are not limited to, one of better appetite, weight gain, higher levels of energy, less pain and better sleep, and combinations thereof.

Images