KR100737286B1 - - - Recombinant Adeno-associated Virus Containing VEGFR Truncated cDNA and Gene Therapeutic Agent for Cancer Comprising the Same - Google Patents

Abstract

The present invention relates to gene therapy using truncated cDNA of VEGF receptor protein (VEGFR) and adeno-associated virus (AAV) system, and more particularly, rAAV vector containing truncated cDNA of VEGFR-1, VEGFR-2. rAAV vectors containing truncated cDNA and cancer-specific gene therapeutics containing the vectors.

Gene therapeutic agents according to the present invention can be effectively used to treat cancer at the genetic level by inhibiting the expression and function of VEGF involved in angiogenesis essential for tumor growth and metastasis, thereby reducing tumor growth.

rAAV, gene therapy, VEGF, VEGF receptor, adeno-associated virus

Description

Recombinant Adeno-associated Virus Containing VEGFR Truncated cDNA and Gene Therapeutic Agent for Cancer Comprising the Same}

1 is a genetic map of pAAV-TRhVEGFR-1 according to the present invention.

2 is a genetic map of pAAV-TRhVEGFR-2 according to the present invention.

Figure 3a shows the results of analyzing the wound healing effect of rAAV-TRhVEGF-1 and / or rAAV-TRhVEGF-2 according to the present invention, Figure 3b is rAAV-TRhVEGF-1 and / or rAAV-TRhVEGF according to the present invention Micrograph showing confirmed wound healing effect of -2.

4 is a genetic map of rAAV-AShVEGF-A.

5 shows tumor volume change in nude mice intraperitoneally injected with rAAV vectors according to the present invention.

Field of invention

The present invention relates to gene therapy using truncated cDNA of VEGF receptor protein (VEGFR) and adeno-associated virus (AAV) system, and more particularly, rAAV vector containing truncated cDNA of VEGFR-1, VEGFR-2. rAAV vectors containing truncated cDNA and cancer-specific gene therapeutics containing the vectors.

Background of the Invention

The mortality rate from cancer is increasing year by year, both at home and abroad. Cancer is one of the leading causes of death in the world, along with infectious and cardiovascular diseases. According to the World Health Report of the World Health Organization (WHO), 7,121,000 people, 12.5% of all deaths in 2004, died of cancer and cancer populations in the next 25 years due to changes in eating habits, the environment and life expectancy. Is expected to increase to about 30 million people annually, with 20 million people dying from cancer.

Currently, the methods used for the treatment of cancer are largely surgical surgery, radiation treatment and drug treatment, these methods are used independently for the treatment of cancer or two or more methods are used in combination. In general, surgical procedures can be applied at various stages of cancer. Early stage cancers can usually be treated by surgical surgery, but if the cancer is advanced or metastasized, it is difficult to perform surgery alone. Radiation therapy treats cancer by irradiating the cancer cells with X-rays or γ-rays from external radiation or radioactive substances administered into the body. Drug therapy is a method of destroying or inhibiting DNA or related enzymes necessary for the proliferation of cancer cells by administering oral or injection anticancer drugs. The advantage of pharmacotherapy over other methods is that the drug can reach any cancer in any part of the body and treat the metastasized cancer. Drug therapy is currently used as a standard therapy for the treatment of metastatic cancer. Of course, metastatic cancer cannot be cured by pharmacotherapy, but it plays an important role in prolonging lifespan by alleviating symptoms. However, chemotherapeutic agents that are the mainstay of such drug therapy have problems such as side effects and anticancer drug resistance.

However, thanks to remarkable developments in the life sciences, biotherapeutics are growing rapidly. Biotherapeutics are the therapeutic basis for preventing cancer progression by weakening the activity of cancer cells by restoring or increasing the body's natural immune function. Cancer cells can be effectively killed when the body's immune system is functioning, but otherwise cancer cells can easily proliferate or other pathogens can easily attack. It may be used with other therapies such as surgical surgery, radiotherapy, chemotherapy and the like to compensate for the above disadvantages of biotherapeutics.

Biotherapeutics currently of interest in the life sciences include antisense anticancer agents and angiogenesis inhibitors. Antisense anticancer agents use DNA fragments capable of complementarily binding to specific mRNAs of cancer cells, and induce cancer cell death by inhibiting the processing of mRNA or expression of proteins. As a result of the Human Genome Project, over 30,000 gene sequences were read and over 100,000 mRNA sequences were available. As a result, a large amount of information about mRNA candidate groups associated with cancer cells is secured, and antisense anticancer agents for genes related to signaling systems, apoptosis and cell proliferation are screened for clinical trials.

Tumor growth is only possible with the creation of new blood vessels that provide the oxygen and nutrients needed for this. In general, as cancer cells proliferate, the inside of the tumor becomes hypoxic and the tissues become necrotic. In addition, the hypoxia worsens because blood vessels are destroyed by the pressure of the tumor itself. To overcome this hypoxia, tumors express factors related to neovascularization (VEGF, bFGF, IL-8, PDGF, PD-EGF, etc.) to promote neovascularization. In other words, neovascularization is an essential process for tumor growth.

Neovascularization inhibitors aim to treat cancer by interfering with neovascularization of such tumors and inhibiting tumor growth. Direct neovascularization inhibitors interfere with the proliferation and migration of vascular endothelial cells or inhibit neovascular production by inhibiting the response to neovascular generating factors. Direct neovascularization inhibitors have the advantage of less inducing acquired drug resistance. Indirect neovascularization inhibitors inhibit neovascularization by inhibiting protein expression in tumors that activate neovascularization or by blocking binding between the tumor protein and vascular endothelial cell surface receptors.

As described above, when looking at the changes in the field of treatment, it can be seen that the artificial chemicals are changing from using natural in vivo materials. In particular, as genome research projects in various fields progress, genes that act as etiologies for various diseases are being discovered. In order to link these findings with clinical treatment or preventive effects, researches on gene transfer technology that normalizes function or activates therapeutic function by introducing genes for correcting lost or modified genes in the body, In other words, research is being actively conducted in the field of gene therapy. The field of gene therapy has been rapidly increasing in recent years with a lot of attention and research.

Gene therapy is a method of treating diseases by gene transfer and expression. Unlike drug therapy, gene therapy is a method of correcting genetic defects targeting a specific gene with a disorder. The ultimate goal of gene therapy is to genetically modify living cells to obtain a beneficial therapeutic effect. These therapies have the advantages of accurate delivery of the gene to the disease site, complete degradation in vivo, absence of toxic and immunogenic antigens, and long-term stable expression of the gene, thus providing the best possible treatment for the disease. It is in the spotlight as a treatment.

The main research field of gene therapy is to introduce genes that have a therapeutic effect on specific diseases, enhance resistance of normal cells to show resistance to anticancer drugs, or replace modified or missing genes in various genetic diseases. Can be summarized.

Gene therapy is largely divided into in vivo and in vitro . In vivo gene therapy involves injecting therapeutic genes directly into the body, and in vitro gene therapy primarily involves culturing a target cell in vitro, introducing the gene into these cells, and then regenerating the genetically modified cells. It is injected into the body. Currently, gene therapy research uses in vitro gene therapy rather than in vivo gene therapy.

Gene delivery technology is largely a viral vector-based transfer method, a non-viral delivery method using synthetic phospholipids or synthetic cationic polymers, and transient electrical stimulation on cell membranes. The present invention can be classified into physical methods such as electroporation to introduce genes.

Among the gene transfer techniques, the method using a viral transporter is preferred for gene therapy because the transfer of genes can be efficiently carried out as a vector lacking the replication ability of some or all of the genes replaced with therapeutic genes. have. Viruses used as viral transporters or viral vectors include RNA viral vectors (retroviral vectors, lentivirus vectors, etc.) and DNA viral vectors (adenovirus vectors, adeno-associated virus vectors, etc.), as well as herpes simplex virus vectors. (herpes simplex viral vector) and alpha viral vector. Particularly active studies are retroviruses and adenoviruses.

The characteristics of retroviruses that integrate into the genome of host cells are harmless to the human body, but they can inhibit the function of normal cells during integration, infect various cells, easily proliferate, and range from 1 to 7 kb. Is able to accept the external genes of the genes and to generate replication-deficient viruses. However, it is difficult to infect cells after mitosis, it is difficult to transfer genes in vivo , and somatic cell tissues must be proliferated in vitro at all times. Retroviruses can also be integrated into the proto-oncogene, which is a risk of mutations and can also kill cells.

Adenoviruses, on the other hand, have a number of advantages as cloning vectors, which can be replicated in the nucleus of a medium size, are clinically non-toxic, and stable even when external genes are inserted. Eukaryotes can be transformed without rearrangement or loss of genes, and are expressed at stable and high levels even when integrated into host cell chromosomes. Good host cells for adenoviruses are the cells responsible for human hematopoiesis, lymph, and myeloma. However, because it is linear DNA, it is difficult to proliferate, it is not easy to recover the infected virus, and the infection rate of the virus is low. In addition, the expression of the delivered gene is greatest after 1 to 2 weeks, and in some cells, expression is maintained for only 3 to 4 weeks. Also problematic is the high immunogenicity.

Adeno-associated virus (AAV) has recently been preferred because it can complement the above problems and has many advantages as a gene therapy agent. AAV is a single-stranded provirus, which requires an auxiliary virus to replicate, and the AAV genome is 4,680 bp, which can be inserted into a specific region of chromosome 19 of an infected cell. Transgene (trans -gene) is inserted in the plasmid DNA (plasmid DNA) is connected by two inverted terminal repeats of 145bp (inverted terminal repeat, ITR) sequence and partial signal sequence (signal sequence) part, respectively. Transfection with other plasmid DNA expressing the AAV rep portion and the cap portion is added and adenovirus is added as a secondary virus. AAV has a wide range of host cells that deliver genes, fewer immune side effects when repeated administration, and long gene expression periods. Moreover, it is safe for the AAV genome to integrate into the chromosome of the host cell and does not modify or rearrange the gene expression of the host.

Since 1994, AAV vectors containing CFTR genes have been approved by the NIH for the treatment of cystic fibrosis, and have been used for clinical treatment of various diseases. AAV vectors containing a factor IX gene, which is a coagulation factor, are used for the treatment of hemophilia B (hemophilia B), and development of a hemophilia A (hemophilia A) therapeutic agent using the AAV vector is in progress. In addition, AAV vectors containing various types of anticancer genes have been certified for use as tumor vaccines.

Gene therapy with VEGF can be exemplified by the recombinant defective adenovirus (Korean patent application: 10-2001-7013633) comprising a nucleic acid encoding an angiogenic factor to treat pulmonary circulatory boost, but the therapy is a VEGF sense base. Because the sequence is used, it can be used only for the treatment of ischemic diseases, and cannot be used for the treatment of neovascularization diseases, especially cancer. Furthermore, adenoviruses are not suitable for therapeutic use because they have high immunogenicity, low infectivity to host cells, and short expression periods.

Although there have been many studies on polypeptides for treating cancer, most of the substances belong to chemotherapeutic agents. In addition, although researches on polynucleotides have been continuously conducted, the results are insufficient in connection with a method of efficiently moving in vivo through a viral vector or the like.

On the other hand, the present inventors found that rAAV-AShVEGF-A vector containing antisense cDNA of VEGF-A (KR 10-2004-54043), rAAV-AShVEGF- containing antisense cDNA of VEGF-A, VEGF-B and VEGF-C. ABC vector (PCT / KR2005 / 002435) has been found to be effective as a gene therapy for cancer and has been patented. In addition, rAAV-AShVEGF-A vector containing antisense cDNA of VEGF-A, rAAV-TShVEGFR-1 vector containing VEGFR-1 truncated soluble cDNA and rAAV-TShVEGFR-2 vector containing VEGFR-2 truncated soluble cDNA Patents have also been filed for gene therapy of cancer containing (KR 10-2005-67661).

The present inventors have made diligent efforts to develop more efficient gene therapy of cancer, and have constructed rAAV-TRhVEGFR-1 and rAAV-TRhVEGFR-2 vectors containing VEGFR truncated cDNA, and confirmed that the vectors inhibit VEGF function. In addition, it was confirmed that the tumor suppression effect is excellent in vivo to complete the present invention.

An object of the present invention is to provide an rAAV vector containing VEGFR-1 truncated cDNA for gene therapy and an rAAV vector containing VEGFR-2 truncated cDNA.

It is another object of the present invention to provide a cancer-specific gene therapy comprising the rAAV vector containing the VEGFR-1 truncated cDNA and / or the rAAV vector containing the VEGFR-2 truncated cDNA.

In order to achieve the above object, the present invention comprises the steps of (a) transfecting an animal cell line with a pAAV vector, AAV rep-cap plasmid DNA and adenovirus helper plasmid containing truncated cDNA of VEGFR-1; (b) culturing the transfected animal cell line; And (c) crushing the cultured cell line, and then separating and purifying the recombinant rAAV particles to provide an rAAV vector containing truncated cDNA of VEGFR-1.

The present invention also comprises the steps of (a) transfecting an animal cell line with a pAAV vector containing a truncated cDNA of VEGFR-2, AAV rep-cap plasmid DNA and an adenovirus helper plasmid; (b) culturing the transfected animal cell line; And (c) crushing the cultured cell line, and then separating and purifying the recombinant rAAV particles to provide an rAAV vector containing truncated cDNA of VEGFR-2.

The present invention also provides a cancer-specific gene therapy comprising the rAAV vector containing the truncated cDNA of VEGFR-1 and the rAAV vector containing the truncated cDNA of VEGFR-2.

In the present invention, the truncated cDNA of VEGFR-1 and the truncated cDNA of VEGFR-2 may be characterized by having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 4, respectively. The gene therapy agent according to the present invention may be characterized by specificity for colorectal cancer, bladder cancer and lung cancer.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

Example 1 Cloning of pAAV Plasmids Containing Angiogenesis Inhibitory Genes

(1) Construction of pAAV-TRhVEGFR-1

CDNA was synthesized by extracting RNA from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells, and using the following TRhVEGFR-1 F1 and TRhVEGFR-1 R1 primers, 2,427bp truncated human VEGFR- by RT-PCR method. 1 receptor cDNA (SEQ ID NO: 1) was amplified. The amplified fragment with restriction enzymes Kpn I and Xho I by treatment with, by the ligation pAAV-FIX cis plasmid DNA (US6,093,292) and Lai cut with the same restriction enzymes, to prepare a pAAV-TRhVEGFR-1 (Fig. 1).

TRhVEGFR-1 F1 (SEQ ID NO: 2):

AA GGTACCGCCACC ATGGTCAGCTACTGGGACA

   Kpn I Kozak

 TRhVEGFR-1 R1 (SEQ ID NO: 3):

CC CTCGAGCTA CTGCTCATCCAAAGGAACTTCA (SEQ ID NO: 3)

   Xho I stop codon

(2) Construction of pAAV-TRhVEGFR-2

RNA was extracted from cancer cell line LCSC # 1 cells (WO 02/061069) and cDNA was synthesized, and 2430 bp truncated human VEGFR-2 receptor by RT-PCR method using the following TRhVEGFR-2 F1 and TRhVEGFR-2 R1 primers cDNA (SEQ ID NO: 4) was amplified. The amplified fragment with restriction enzymes Kpn I and Xho I by treatment with, to the ligated DNA and plasmid pAAV-FIX cis Lai cut with the same restriction enzymes, to prepare the pAAV-TRhVEGFR-2 (Fig. 2).

TRhVEGFR-2 F1 (SEQ ID NO: 5):

GG GGTACCGCCACC ATGGAGAGCAAGGTGCT

   Kpn I Kozak

TRhVEGFR-2 R1 (SEQ ID NO: 6):

CC CTCGAGCTA TTCATCTGGATCCATGAC

          Xho I stop codon

Example 2: Construction of rAAV vector used as an angiogenesis inhibitor

Recombinant to be used in gene therapy AAV (rAAV-TRhVEGFR-1) to produce a vector in addition to the pAAV-TRhVEGFR-1 plasmid DNA prepared in Example 1 AAV rep portion and the AAV rep-cap plasmid expressing the cap portion DNA (pAAV -RC plasmid, Stratagene Co., USA) and adenovirus helper plasmids (pHelper plasmid, Stratagene Co., USA) are required. All three kinds of plasmid DNA (pAAV-TRhVEGFR-1, pAAV-RC and pHelper) were transfected into HEK293 (human embryonic kidney 293; ATCC CRL-1573) cells, and then cultured for 96 hours, followed by HEK293 cells. Gather and sonicate, and recombine the recombinant AAV (rAAV) particles three times with CsCl density gradient centrifugation to collect the portions having a RI (Refractive Index) of 1.37-1.41 g / ml and separate them purely to obtain rAAV-TRhVEGFR-1. It was.

rAAV-TRhVEGFR-2 was obtained by the above method using pAAV-TRhVEGFR-2 instead of pAAV-TRhVEGFR-1.

Particle titration of the obtained rAAV-TRhVEGFR-1 and rAAV-TRhVEGFR-2 was carried out by PCR primers of the CMV promoter site [CMV F1: 5'-GGG CGT GGA TAG CGG TTT GAC TC-3 '(SEQ ID NO: 7) , CMV R1: 5'-CGG GGC GGG GTT ATT ACG ACA TT-3 '(SEQ ID NO: 8)] was prepared and titrated by Quantitative PCR. At this time, each pAAV plasmid DNA having a known concentration was used as a standard, and the recombinant rAAV vector produced and separated by the above method was found to have a rAAV particle titer of 10 ¹² to 10 ¹³ viral particles / ml.

Example 3 Wound Healing Assay of rAAV Vector of the Present Invention

HUVEC cells cultured in complete medium (EGM-2 BulletKit, Cat # CC-3162, Cambrex Bio Science Walkersville, Inc., USA) have 2 × 10 ⁵ MOIs of rAAV-TRhVEGFR-1 and rAAV-TRhVEGFR-2, respectively. Alternatively, the cells were treated together for 24 hours, and after 48 hours, the plate where the cells were grown was scraped with a cell scraper to make a wound. Wounded plates were washed twice using EBM-2 (Cat # CC-3156, Cambrex Bio Science Walkersville, Inc., USA) + 1% FBS] to remove fallen cells. The plate was treated with VEGF protein (Calbiochem, Cat. # 676472) to 10ng / ml, and 24 hours later, the migrated cells were photographed and analyzed.

As a result, as shown in Table 1, FIGS. 3A and 3B, the rAAV-TRhVEGFR-1 and / or rAAV-TRhVEGFR-2 treated groups, compared with the untreated group and the VEGF protein-treated group, were transferred. The number of cells was markedly low.

This means that the treatment of rAAV-TRhVEGFR-1 and / or rAAV-TRhVEGFR-2 inhibits the function of VEGF, thus delaying wound healing. From these results, the rAAV-TRhVEGFR-1 vector and the rAAV-TRhVEGFR-2 vector of the present invention can inhibit VEGF from moving vascular endothelial cells to produce blood vessels, thereby exhibiting an anticancer effect by preventing tumor proliferation. I could confirm it.

Wound Healing Delay Effect by rAAV Vector Treatment of the Present Invention VEGF protein (10ng / ml)  -  +  +  +  +  + rAAV - - rAAV-EGFP rAAV-TRhVEGFR-1 rAAV-TRhVEGFR-2 rAAV- TRhVEGFR-1 + rAAV- TRhVEGFR-2 Migrated cells 150.2 ± 7.95 217.2 ± 21.70 195.8 ± 19.27 113.4 ± 17.64 84.33 ± 11.31 75.33 ± 6.98

Example 4: Analysis of anticancer effect using rAAV vector of the present invention (Xenograft analysis)

In this example, the anticancer effect of [rAAV-TRhVEGFR-1 + rAAV-TRhVEGFR-2], which was demonstrated in the wound healing migration assay of Example 3, was investigated in vivo .

First, 5 x 10 ⁶ NCI-H460 human lung cancer cell lines (ATCC HTB-177) were injected into BABL / c nude mice (BABL / c nu / nu mouse, Central Laboratory Animal, Japan SLC, Inc.) by subcutaneous injection method. The tumor model was made by injection.

The tumor volume of the tumor cells by BABL / c nude mice injected with early to ^{70~80 mm 3 10 11 ~10 12 viral} particles / objects in the rAAV vector (rAAV-AShVEGF-A and rAAV-TRhVEGFR-1 + rAAV- TRhVEGFR- 2) was transduced by tail vein injection method. For three weeks after transduction, the general symptoms (normal state, motility, appearance, autonomic nerves and death) of the animals were observed and weighed, and tumors were measured using an electronic caliper (Absolute digimatic, Mitutoyo Corp., Japan). Volume was measured.

RAAV-AShVEGF-A vector (Fig. 4) used as a control in this Example was prepared by the following method. RNA was extracted from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells to synthesize cDNA, and 429 bp human VEGF-A isoform antisense cDNA (1025-1453) by RT-PCR method using the following AShVEGF-A primer. Position). The amplified fragment with restriction enzymes Kpn I and Xho I by treatment with, to the ligated DNA and plasmid pAAV-FIX cis Lai cut with the same restriction enzymes, to prepare the pAAV-AShVEGF-A.

AShVEGF-A F2 (SEQ ID NO: 9): GG GGTACC GTCTTGCTCTATCTTTC

Kpn I

AShVEGF-A R1 (SEQ ID NO: 10): CC CTCGAG GGCCTCCGAAACCATGAACT

Xho I

Meanwhile, xenograft experiments were performed with taxol (paclitaxel; Cat # T1912, Sigma, USA), which is a widely used anticancer agent, as a control. When the tumor volume of BABL / c nude mice injected with cancer cells reached 70-80 mm ³ , 200 μg / mouse dose was intraperitoneally administered, and the same dose was administered once a week during the test period. Animal observation, body weight and tumor volume measurements were performed in the same manner as the other test groups. Taxol (paclitaxel) was dissolved in DMSO at a concentration of 50 mg / ml, and then diluted to 1 mg / ml with HEPES buffer before administration, and 0.2 ml (200 μg / mouse dose) was injected into each mouse by intraperitoneal administration. .

Body weights of all animals were measured immediately before administration and at 3 days intervals after the administration of test substance, and showed low weight gain rate. There was no correlation between cancer treatment effect and weight change rate of test animals.

On the other hand, the tumor volume was measured for three weeks using a Vernier calipers every three days, as shown in Figure 5, compared to the rAAV-AShVEGF-A administration group and taxol administration group, the gene according to the present invention The therapeutic agent [rAAV-TRhVEGFR-1 + rAAV-TRhVEGFR-2] administration group showed an excellent tumor suppression effect.

Having described the specific parts of the present invention in detail, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be.

As described in detail above, the present invention has the effect of providing a rAAV vector containing truncated cDNA of VEGFR-1 or truncated cDNA of VEGFR-2 for gene therapy. The present invention also has the effect of providing a cancer-specific gene therapy comprising a rAAV vector containing a truncated cDNA of VEGFR-1 and / or a rAAV vector containing a truncated cDNA of VEGFR-2. In accordance with the present invention, gene therapeutic agents can be effectively used to treat cancer at the genetic level by inhibiting the expression and function of VEGF involved in angiogenesis essential for tumor proliferation and metastasis, thereby reducing tumor growth.

Attach sequence list electronic file

Claims (5)

delete Recombinant adeno-associated virus (rAAV) vector prepared by the following steps and containing a truncated cDNA of nucleotide sequence VEGFR-1 of SEQ ID NO: (a) Expression of a plasmid DNA (pAAV) vector for recombination of adeno-associated virus containing a truncated cDNA of nucleotide sequence VEGFR-1 of SEQ ID NO: 1, a protein and capsid involved in adeno-associated virus genome replication Transfecting the animal cell line with an adeno-associated virus rep-cap (AAV rep-cap) plasmid DNA and an adenovirus helper plasmid; (b) culturing the transfected animal cell line; And (c) disrupting the cultured cell line, and then separating and purifying recombinant adeno-associated virus (rAAV) particles. delete Recombinant adeno-associated virus (rAAV) vector containing a truncated cDNA of VEGFR-2 having the nucleotide sequence of SEQ ID NO: 4 prepared by the following steps: (a) Plasmid DNA (pAAV) vector for recombination of adeno-associated virus containing a truncated cDNA of VEGFR-2 having the nucleotide sequence of SEQ ID NO: 4, a protein and capsid involved in adeno-associated virus genome replication Transfecting the adeno-associated virus rep-cap (AAV rep-cap) plasmid DNA and adenovirus helper plasmid expressing the animal cell line; (b) culturing the transfected animal cell line; And (c) disrupting the cultured cell line, and then separating and purifying recombinant adeno-associated virus (rAAV) particles. A cancer-specific gene therapy comprising the recombinant adeno-associated virus (rAAV) vector of claim 2 and the recombinant adeno-associated virus (rAAV) vector of claim 4.

Images