RU2410434C2 - NOVEL APPLICATION OF RECOMBINANT ADENOVIRUS p53 TO TREAT CANCER PATIENTS - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: invention concerns biotechnology and health care. Recombinant adenovirus p53 is capable of lowering side effects of the type caused by anti-tumour chemotherapy and radio-therapy. In cancer patients, recombinant adenovirus p53 can restore operation of organs, including blood analysis, liver functioning, kidney functioning etc in order to improve the quality of life of patients, for example improvement of appetite, mental status and the like.

EFFECT: invention can be used in medicine.

19 cl, 7 dwg, 4 tbl, 5 ex

Description

The scope of the present invention

The present invention relates to methods for improving the quality of life of subjects suffering from cancer, as well as reducing side effects caused by antitumor therapy, such as chemotherapy, radiotherapy, and other types of therapy that these subjects are exposed to.

BACKGROUND OF THE INVENTION

Cancer is the leading cause of death in animals and humans. Standard types of modern antitumor treatments include surgery, radiotherapy and chemotherapy. Despite advances in cancer treatment, each treatment has serious side effects. For example, surgery disfigures the patient or disrupts the normal functioning of the body. Chemotherapy or radiotherapy can cause the patient to worsen symptoms, such as nausea, diarrhea, hypersensitivity to light, hair loss, etc. Side effects of these cytotoxic compounds often limit the frequency and dosage at which they can be used.

In biochemical and physiological analyzes, indicators of these side effects can be white blood cells, hemoglobin, aspartate aminotransferase, alanine aminotransferase. The results of these analyzes show that the biochemical and physiological parameters of patients receiving chemotherapy and radiotherapy reach the lower limit of similar parameters for control patients who did not receive antitumor therapy. Often, cancer patients are severely affected by the side effects of chemotherapy or radiation therapy. In some cases, the pain and suffering of the patient is caused by these side effects even more than the cancer itself.

Numerous attempts have been made to reduce the serious side effects of antitumor treatment.

US Patent No. 6,479,500 discloses the structure and effectiveness of a chemical that can reduce side effects caused by an antitumor agent.

US patent No. 5,017,371 describes the use of interferon to reduce toxic side effects associated with radiation therapy or chemotherapy.

US Pat. No. 6,462,017 describes methods for reducing the severity of side effects in cancer patients by using α-thymosin for chemotherapy. Thus, it is obvious that there is a great need to develop new and effective ways to reduce the side effects of antitumor treatment in order to improve the quality of life of cancer patients and help them withstand the full course of chemotherapy or radiation therapy.

Summary of the present invention

According to the present invention, a method for administering an effective amount of p53 adenovirus recombinant in combination with conventional antitumor treatment can effectively reduce the side effects of antitumor treatment (such as chemotherapy and radiotherapy) in patients receiving it. The weakening of side effects should improve the quality of life of such patients. The results of biological, physiological and biochemical analyzes can prove this improvement.

According to the present invention, the method of administering only p53 adenovirus recombinant is able to improve the quality of life of cancer patients. Cancer patients can detect this improvement by improving appetite and sleep, greater energy, less pain and the necessary weight gain.

Brief Description of the Drawings

To further describe the characteristics, advantages, objectives and other aspects of the present invention, the details of the above summary will be illustrated by the accompanying drawings included in the present invention. However, it should be understood that these drawings are illustrative only and are not intended to limit the scope of the present invention.

Figure 1 schematically represents a process for constructing the p53 adenovirus recombinant of the present invention.

Figure 2 is a flow diagram of the protocols for the preparation of recombinant p53 adenovirus.

Figure 3 presents the results of agarose gel electrophoresis of the product of PCR amplification of the gene form p53. P53 cDNA was used as template, and 5'CCACGACGGTGACACGCTTC and 5'CAAGCAAGGGTTCAAAGAC as primers, which illustrates the stability of p53 adenovirus recombinant. A DNA fragment containing 1400 nucleotide pairs was obtained by PCR amplification of the p53 gene. Lane 1: standard DNA molecular weight markers; lanes 2,3,4: the results of PCR amplification of p53 cDNA.

Figure 4 presents the results of Western blotting of the recombinant p53 adenovirus, extracted 36 hours previously from lysed cells that underwent transfection with the recombinant p53 adenovirus. The transfected cells were the human laryngeal cancer cells Hep-2, as well as the small cancer cells H1299. Lane 1: standard protein molecular weight markers; lanes 2 and 3: negative control of Hep-2 and H1299 cells, respectively, which were not transfected with p53 adenovirus recombinant (Ad-p53); lanes 4 and 5: Hep-2 and H1299 cells, respectively, which were transfected with p53 adenovirus recombinant (Ad-p53).

5 is a curve showing the effect of cytolysis of p53 adenovirus recombinant on Hep-2 cells. Hep-2 cells were cultured on 6-cell plates until they reached a density of 1 × 10 ⁶ per cell. In order to transfect these cells at different time points (24, 48, 72 and 96 hours), Ad-p53 was administered; the multiplicity of infection was 100. The cells were stained with trypan blue and then the percentage of blue (dead) cells was counted.

6 shows a clinical observation scheme for the effects of the p53 adenovirus recombinant on antitumor treatment and methods for evaluating this effect.

Detailed description of the present invention

In clinical trials, adenovirus p53 recombinant was administered to patients with tumors of various types (such as squamous cancer of the head and neck, small cancer cells, lung cancer, thyroid cancer, ovarian cancer, etc.). Regardless of its ability to suppress cancer, it was found that the p53 adenovirus recombinant can also reduce the side effects caused by traditional chemotherapy and radiation therapy, as well as improve the quality of life of cancer patients. Next, we describe the structure of the recombinant p53 adenovirus and its clinical use. The p53 adenovirus recombinant selected is a commercially available product under the brand name Gendicine.

1. p53 and p53 mutations in cancer

Currently, p53 is recognized as a cancer suppressor gene (Montenarh, M., 1992). An increased level of expression was found in many cells transformed by chemical carcinogenesis, UV radiation, and also some viruses, including SV40. The p53 gene is a private target for mutational inactivation of various forms of human cancer, and there are already reports of it as the gene most mutating in human cancer cells (Mercer, 1992). The p53 mutation occurs in more than 50% of non-small lung cancer cells (Hollestein et al., 1991).

The p53 gene encodes a phosphorylated protein with 293 amino acid residues that can bind the large T-antigen and E1B protein. The expression of p53 protein is found in healthy tissues and cells, but in them it is lower than in transformed cells or in cancer cells. Interestingly, p53 non-mutant type plays an important role in the regulation of cell growth and division. On some cancer cell lines, overexpression of the p53 non-mutant type has demonstrated an effect that inhibits their proliferation. Thus, p53 can act as a negative regulator of cell growth (Weinberg, 1991) and can directly inhibit uncontrolled cell growth or suppress it indirectly by activating target genes located below the selected site. Thus, the absence of non-mutant p53 or its inactivation can contribute to continuous transformation. However, some studies have shown that the presence of mutant p53 may be necessary for the full expression of the transforming ability of the gene.

Non-mutant p53 is defined as a very important growth regulator in many types of cells due to the role of its genetic and biochemical characteristics. For the p53 gene, mutations with a change in meaning are common, and they are important for the transforming ability of the oncogen. A single genetic change driven by a point mutation can create carcinogenic p53. However, unlike other oncogenes, p53 point mutations occur in at least 30 codons, and they are dominant mutations that can shift the cell phenotype without integration into homozygous mutations. In addition, it turned out that many of these dominant negative alleles are tolerant to the body and transferred to the germ line of cells. Various mutant p53 alleles with functional changes from minimally dysfunctional to dominant were found (Weinberg, 1991).

Casey and colleagues reported that transfection of DNA encoding the non-mutant p53 type into two breast cancer cell lines restored growth inhibition in such cells (Casey et al., 1991). A similar effect has been demonstrated on transfection of the non-mutant type p53 into human laryngeal cancer cell lines (Takahashi, et al., 1992). The non-mutant type p53 was found to dominate the mutant gene, and when transfected into cells with the mutant gene p53, it should specifically inhibit cell proliferation. In cells with endogenous p53, normal expression of the transfected non-mutant type p53 was observed, and there was no effect on the growth of such cells. Thus, according to the present invention, such constructs can be used by healthy cells without side effects.

Therefore, cancer associated with the p53 mutation can be treated using the non-mutant type p53 in order to reduce the number of malignant cells. However, the above studies are far from achieving this goal, at least because DNA transfection cannot be used to introduce DNA into a patient’s cancer cells in vivo.

2. The method of gene therapy

To date, several experimental approaches to gene therapy have been proposed. However, it turned out that each of them had certain disadvantages (Milligan, 1993). In the above-mentioned basic transfection method, a DNA fragment containing the gene of interest was introduced into the cell in a non-biological way, for example, by penetrating through the cell membrane physically or chemically. Therefore, this approach is limited to the treatment of cells such as lymphocytes, which can be temporarily excreted from the body and able to be tolerant to the cytotoxicity caused by this treatment. Liposomes or proteins fused with certain lipids and amphophilic peptides can be used for transfection, however, the efficiency of gene integration remains very low, amounting to about one integration per 1000-100000 cells, and the expression of genes transfected is often limited to days (in rapidly growing cells) or weeks (in cells that do not grow rapidly). Obviously, DNA transfection is not a method suitable for treating cancer.

The second approach uses the natural ability of viruses entering the cell and introducing the target gene into it along with a certain amount of their own genetic material. The retrovirus, due to the ability to integrate its genes into the DNA of the host genome, transferring a large amount of foreign gene material, infects a wide range of species and cells and uses the packaging of cell lines to produce and package them; it is considered as a delivery vector of the expected gene. However, the practical use of a retrovirus is hindered by three problems. First, retroviral infectivity depends on the availability of viral receptors on the surface of target cells. Secondly, retroviruses integrate efficiently only into auto-reproducing cells. And, in conclusion, it is difficult to concentrate and purify retroviruses.

3. Construction of adenovirus for gene therapy

Human adenovirus is a DNA double helix virus; its genome size is approximately 36 kb (Tooza, 1981). Adenoviruses have been widely used and are satisfactorily described as a model for studying the expression of a eukaryotic gene; this makes them an attractive candidate for developing a gene transfer system. This group of viruses is easy to grow and easy to manipulate, they have a wide range of hosts in vivo and in vitro. In lytically infected cells, adenoviruses are able to turn off the synthesis of the "host" protein, while directing the cellular mechanism to the synthesis of large quantities of viral protein and replicating copious amounts of the virus.

The E1 region of the adenoviral genome contains the E1A and E1B genes, which encode proteins capable of transcription of the regulation of the viral genome, as well as several genes of the host cells. The E2 region contains the E2A and E2B genes and encoded protein products (such as a DNA binding protein), DNA polymerase and terminal proteins as replication primers capable of replicating the virus. The products of the EZ gene contain an immune release of adenoviruses and prevent the attack of the host cells by cytotoxic T cells and the resulting destruction; therefore, they play an important role in the survival of the virus and its spread. As a result, the functions of various E proteins are associated with DNA replication, late gene expression, and the shutdown of some functions of the host cells. Late gene expression products include most capsid protein virions, which undergo expression only after adenovirus replication is substantially complete and primed by the MLP promoter. MLP has been shown to be highly effective at initiating transcription in the late phase of adenovirus infection (Stratford-Perricaudet and Perricaudet, 199la).

Since cis activation requires only a small part of the viral genome (Tooza, 1981), vectors derived from adenovirus can offer an insertion space to replace large fragments of DNA produced in 293 cells. A line of 293 human embryonic kidney cells that underwent Ad5 transformation (Graham et al., 1977) is able to provide trans-activating elements for the replication and packaging of adenoviral vectors. Therefore, the characteristics of adenovirus make it a good candidate for gene therapy of tumors in vivo (Grunhaus and Horwitx, 1992).

Particular advantages of the adenovirus system in delivering foreign proteins to the cell are that: (i) it has the ability to replace relatively large sections of viral DNA of foreign DNA; (ii) the structure of the recombinant adenovirus is stable; iii) it is safe for injection of adenovirus to humans; (iv) there is no information on the interaction of adenovirus infection with cancer or malignant neoplasms; (v) the production of adenovirus with high titers is possible; (vi) adenovirus is highly infectious.

The adenovirus vector has a higher level of exogenous expression than the retrovirus vector, and the replication of the adenovirus is independent of the replication of the host gene. Since the transformed genes of the E1 region of adenovirus can be easily destroyed and do not have any effect on the efficient expression of exogenous genes, it is assumed that the oncogenic risk of the adenovirus vector is negligible (Grunhaus and Horwitx, 1992).

Typically, the adenovirus gene transfer system is a recombinant adenovirus constructed by genetic engineering and brought into a replication-competent state by deletion of the E1 region of its genome, while still maintaining its competence for infections. When further deletions occurred in the adenovirus genome, expression of relatively large exogenous genes can be performed. For example, adenoviruses with a deletion in both the E1 region and the EZ region are capable of transferring up to 10 kb of exogenous DNA and can be cultured to high titers in 293 cells (Stratford-Perricaudet and Perricaudet. 199la). Surprisingly stable expression of exogenous genes after adenovirus infection has also been reported.

Adenovirus-mediated gene transfer has recently been evaluated as a means of mediating gene transfer in eukaryotic cells and in laboratory animals. For example, it was found that in the treatment of mice suffering from ornithine transcarbamylase (OTC) deficiency (a disease that is a rare recessive genetic disorder), the adenovirus vector can be used to deliver the normal OTC enzyme gene. Unfortunately, OTC reached its goal in only 4 cases out of 17 (Stratford-Perricaudet and Perricaudet. 199la). Consequently, in most laboratory animals this defect was only partially corrected and did not lead to any physiological or phenotypic changes. These results, obviously, slightly stimulate the use of adenovirus vectors in the treatment of tumors.

Studies on the use of adenovirus to transform the gene for cystic fibrous transmembrane conductivity (CFTR) of rat lung epithelium for the treatment of cystic fibrosis were only partially successful, but it was not possible to evaluate the biological activity of the gene transferred to animal epithelium (Rosenfeld et al., 1992) . These studies again showed that expression of the CFTR protein in lung airway cells did not produce any physiological effect.

These results do not show that adenovirus is able to direct sufficient endogenous expression to infected cells in order to achieve a physiological effect; and therefore, researchers do not intend to use adenovirus systems in antitumor therapy. In addition, prior to the present invention, it was generally agreed that p53 might not be included in the packaging of the cell used in the production of recombinant adenovirus, as it would be toxic to these cells. Since the adenovirus E1 protein that has passed earlier expression binds to the p53 protein, it was assumed that there should be a technical reason why the adenovirus vector and the p53 gene cannot be combined.

4. Construction of Ad-p53 and tumor suppression

The present invention provides a new and more effective tumor suppressor, as well as a vector for tumor gene therapy. This recombinant virus takes advantage of adenoviral vectors, such as a high titer, a wide range of targets, efficient transduction, and non-inclusion in target cells. In particular, the present invention provides an independent helper cell of adenovirus with defective replication, which expresses the non-mutant type p53 (Ad5SV-p53), the process is under the control of Rous sarcoma virus (Rous Sarcoma Virus) as a promoter.

The regulatory functions of expression vectors are often obtained from viruses if expression of exogenous genes into mammalian cells is required. For example, standard promoters are derived from polyoma, adenovirus 2, and monkey virus (SV-40). It is also possible to use smaller or larger fragments of the SV-40 virus, provided that they contain a sequence of approximately 250 nucleotide bases from the HindIII site towards the BgII site located in the original replication. These 250 nucleotide bases can be stored or destroyed if necessary. In addition, it is also possible and often desirable to use a promoter or control sequences, usually associated with the selected target gene, provided that such control sequences are compatible with the host cell system.

Initial replication can be provided from an exogenous source obtained from SV40 or other sources (e.g., polyoma, adenovirus, herpetic stomatitis virus VSV, bovine papilloma virus BPV), or obtained using the chromosomal replication mechanism of the host cell. If the vector integrates into the chromosome of the host cell, then this is often significant.

Figure 1 shows the recombinant p53 adenovirus. In this regard, an improved protocol for the construction and identification of such a recombinant adenovirus has been developed. After identification, the structure of the recombinant p53 adenovirus was confirmed by PCR. After isolation and confirmation of its structure, p53 adenovirus was used to infect Hep2 laryngeal cancer cells and small lung cancer cells H1299, which have a knocked out homologous p53 gene. West blot results showed that exogenous p53 protein is highly expressed.

The studies described here show that recombinant p53 adenovirus has the properties of a tumor suppressor, which are manifested in the restoration of p53 function in tumor cells. These results may support the use of Ad5RSV-p53 virion as a therapeutic agent in antitumor therapy.

As a new gene transfer system, recombinant adenovirus has a large number of potential applications in gene therapy, as well as in the development of vaccines. Therefore, the propagation of recombinant adenovirus is an important means of molecular biology. Modern methods of propagation of recombinant adenovirus include transfection of 293 cells, mediated by precipitation of calcium phosphate, followed by plaque analysis on transfected cells. Transfection, effectively associated with this method, needs to be improved, and its technique requires simplification.

5. Improved protocol for reducing side effects caused by chemotherapy and radiotherapy

Substantial research has been done in the field of tumor treatment over the past 20 years. Numerous approaches to the treatment of tumors have been developed. As practical methods, they include the use of many methods, including surgery, radiotherapy, chemotherapy, bone marrow transplantation (for treating patients with certain types of hematological malignancies, in particular acute granulocytic leukemia), traditional Chinese herbal medicine, etc. The protocol used to treat a particular type of cancer depends on its nature, location, and type of disease. For the treatment of neoplasms, surgery remains the most preferred method of treatment, and it is used as the main form of therapy for almost 60% of tumors. However, for complete implementation of the treatment protocol, surgical excision is often combined with radiation therapy and / or chemotherapy. If the malignant neoplasm is not localized, or if its localization reduces the possibility of successful surgical removal or excision, then a combination of chemotherapy and radiotherapy is often used.

Chemotherapy has been shown to be effective in treating certain types of cancer, including Hodgkin's disease, acute leukocyte and granulocytic leukemia, testicular cancer, lymphomas other than Hodgkin's lymphoma, and the like. For other types of tumors, chemotherapy was effectively used before surgery to reduce the size of the tumors. With chemotherapy, a combination of chemotherapeutic agents is often used. The medical community is continuously developing and testing new treatment protocols.

However, antitumor agents are drugs that, in addition to destroying cancerous tumors, can harm healthy tissues. Even with intensive studies to determine the dosage and schedule for administering drugs, chemotherapy often leads to unpleasant, and sometimes dangerous, side effects caused by the toxicity of the drugs. Similar problems arise with radiation therapy. The most common side effects are nausea, loss of appetite, alopecia, and suppression of bone marrow activity. Usually, but not always, such side effects are reversible. Some anticancer drugs can permanently be harmful to the nervous system, heart, lungs, liver, kidneys, genital glands, and other organs. Some of the chemotherapeutic agents are carcinogenic in themselves. Patients receiving radiotherapy or chemotherapy may also take prophylactic agents or agents designed to prevent life-threatening infections resulting from the immunosuppressive state caused by antitumor therapy.

Several treatment strategies have been developed to neutralize the side effects of radiotherapy and chemotherapy. For example, some medications can be used to reduce nausea, antibiotics or being in laminar atmospheres can help fight infections, transfusion can be performed to increase the number of hemocytes and platelets, etc.

A broad classification of chemotherapeutic agents that play an important role in the treatment of neoplasms in humans is possible. Such chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites (e.g. pyrimidine analogs), radioactive isotopes (e.g. phosphorus and iodine), hormones (estrogens and adenocorticosteroids), mixed products (e.g. hydroxyurea) and natural products (e.g. , paclitaxel, vincaleucoblastin and antibiotics). Despite the fact that these funds are not therapeutic, however, in medicine they are recognized as useful for the suppression, masking, inhibition and control of malignant neoplasms. Since it was found that these compounds are effective, and they usually find clinical use as agents that prevent proliferation, the disadvantages associated with their introduction as antitumor agents are well recognized. Alkylating agents have a noticeable cytotoxic effect, and the ability of these drugs to inhibit mitosis and proliferation of healthy cells can be a lethal factor. Antimetabolites can lead to anorexia, progressive weight loss, depression, and coma. Prolonged administration of antimetabolites can lead to serious suppression of bone marrow function. Both alkylating agents and antimetabolites usually have a depressing effect on the immune system. Prolonged use of natural products can also cause bone marrow suppression. Hydroxyurea and other chemical derivatives can lead to rapid recovery of adenocorticosteroids and their metabolites. The introduction of hormonal compounds or radioactive isotopes is also undesirable from the point of view of harming the immune system, and therefore, depriving the body of the ability to withstand common infections. In most cases, it would be preferable to use chemotherapeutic agents that would be effective in controlling, delaying or suppressing malignant neoplasms, while simultaneously stimulating the patient's immune system and assisting it.

Chemotherapy agents can be given either in the form of a single dose, or in the form of several large doses, or, more often, they can be given in small doses 1-4 times a day and continue for up to several weeks or months. Many cytotoxic drugs are used to treat cancer, but their mechanism of action is usually not very clear.

Regardless of the mechanism of known chemotherapeutic agents, it is known that they damage and destroy cells of both tumor and healthy tissues. The success of the use of chemotherapeutic agents in the treatment of neoplasms depends on the differential destruction of the tumor cells by the indicated agent compared with its side effects on healthy tissues. Destruction of hepatocytes and lymphocytes can cause infection. Acute and chronic bone marrow destruction toxicity are also major factors limiting the use of chemotherapeutic agents in the treatment of tumors. Both of them are associated with a reduction in the number of hematopoietic cells caused by the destruction of these cells by cytotoxic agents or radiation. Such effects lead to the depletion of bone marrow components, while contributing to the differentiation of stem cells by the reverse mechanism and thereby reducing their total number (US patent No. 5,595,973). Bone marrow kinetics stimulants and inhibitors play an important role in inducing destruction and repair processes (Tubiana et al., Radiotherapy and Oncology, 29: 1,1993).

Preventing or protecting against side effects of chemotherapy has been a great success for cancer patients. However, numerous attempts to reduce these side effects have not been successful. In relation to life-threatening side effects, efforts have been concentrated on reducing the dose and schedule of administration. In order to increase the number of healthy cells, other possibilities become available before starting chemotherapy treatment, such as the use of colony-stimulating granulocyte factor (G-CSF), macrophage-granulocyte growth factor-CSF (GM-CSF), epidermal growth factor (EGF), interleukin 11, erythropoietin , thrombopoietin, reproduction and growth factor of megakaryocytes, stem cell growth factor, FLT ligand, as well as interleukins 1,3,6 and 7 (Jimenez and Yunis, Cancer Research, 52: 413-415; 1992). The protection mechanisms using these factors are not yet fully understood, but they are most likely associated with an increase in the number of healthy target cells before chemotherapy, but not with an increase in cell viability after chemotherapy.

With antitumor treatment, often due to cytotoxic chemotherapy, acute myelosuppression is observed, and it is defined as a factor limiting the dose of such treatment (US Patent No. 5,595,973). Although adverse effects can also be exerted on healthy tissues, the bone marrow is particularly sensitive to specific treatments (such as chemotherapy and radiotherapy) that counteract proliferation. For some cancer patients, the toxicity of hematopoiesis caused by chemotherapeutic agents often limits the possibility of increasing the doses of chemotherapy. Repeated cycles of chemotherapy or its high doses may be responsible for severe depletion of stem cells, leading to prolonged hypofunction of hematopoiesis and rarefaction of bone marrow.

The methods disclosed in the present invention are suitable for use with chemotherapeutic agents. These agents can be any drug, including, but not limited to, cyclophosphamide, taxol, 5-fluorouracil, cisplatin, methotrexate, cytosine arabinoside, mitomycin C, prednisone, vindestine, carbaplatin and vincristine. A cytotoxic agent may also be an antimicrobial agent that can destroy overgrown cells. A discussion of cytotoxic agents used in chemotherapy is contained in Sathe, M., et al., Cancer Chemotherapeutic Agents: Handbook of Clinical Data (1978).

The methods of the present invention are also particularly suitable for those patients who require repeated or high doses of chemotherapy or radiotherapy. For some cancer patients, toxicity due to chemotherapeutic agents often limits the possibility of increasing doses of chemotherapy. Repeated cycles of chemotherapy or its high doses may be responsible for severe depletion of stem cells, leading to prolonged hypofunction of hematopoiesis and rarefaction of bone marrow. The methods of the present invention in combination with use together with chemotherapy provide a reduction in mortality as well as an increase in the number of hemocytes.

The active drug can be administered by any convenient means, including (but not limited to) local intratumoral injection, intraperitoneal injection, intracavitary infusion, intrabronchial installation, injection into the hepatic artery, installation into the peripheral vein, etc. All routes of administration are safe and effective. The currently recommended route of administration is local intratumoral injection. As part of this injection, standard vectors, pharmaceutical diluents and excipients can be used.

The active preparation can be prepared in the form of a solid form (granules, powders or suppositories, etc.) or a liquid form (solution, suspension or emulsion, etc.), and it can be dissolved in various solutions, which must be aseptic and contain a sufficient number of peptides, be harmless to the recommended applications, be highly stable under these conditions, but can be destroyed by the action of strong acids or bases.

Dosages of the active drug depend on many factors, such as the type of tumor, age, weight, gender and general health of the subject, the degree of his disease, the method of administration of the drug and its composition.

Most preferred is a local intratumoral injection in a dosage of 1 × 10 ⁷ VP to 7 × 10 ⁷ VP (maximum tolerated dose not determined). Currently, in clinical experiments, the commonly used weekly dose is 1 × 10 ¹² VP. This dosage is sufficient to ensure that the drug has the maximum therapeutic effect with a minimum dose of the agonist. Such a regimen can minimize the cost of treatment and potential side effects.

In most preferred embodiments, a local injection with a weekly dose of 1 × 10 ¹² VP can be administered 72 hours before chemotherapy or radiotherapy. In other embodiments, the drug can be reused in multiple courses of treatment. Preferably, blood elements (leukocytes, platelets and neutrophils) are restored to the level necessary for the next chemotherapeutic course of treatment, and that the next course begins immediately after the previous one.

In addition to the active ingredients, the pharmaceutical composition may also contain pharmaceutically acceptable carriers, including excipients and excipients, which facilitate the incorporation of the active compounds into the applicable formulation. Other details of the preparation technique can be found in the most recent edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa).

The following examples describe and illustrate the present invention in more detail, but should not be construed as limiting the scope of the present invention.

Examples

Example 1. Obtaining gendicin (Gendicine) - a recombinant preparation of adenovirus p53

A p53 adenovirus recombinant was prepared, which was used in clinical trials. Its trade name is Gendicine. A detailed description of the preparation of this drug is made in China patent No. ZL 02115228.4, its full contents are given here by reference.

The p53 human adenovirus recombinant was designed and prepared as described in FIG. 1 and FIG. 2. An adenovirus vector and a shuttle vector containing the p53 gene were co-introduced into E. coli; to obtain positive recombinant clones, a recombinant adenovirus was selected. Recombinant clones were amplified in 293 cells, and after numerous purification steps recombinant clinically pure human p53 adenovirus was collected. Figure 3 shows the results of determining the structural stability of recombinant human p53 adenovirus. This figure shows that the structural stability of the indicated recombinant adenovirus persisted after a large number of generations.

Figure 4 presents the results of Western blotting of the recombinant p53 adenovirus, according to which the indicated recombinant can be subjected to a high degree of expression in the cancer cells of the human larynx Hep-2, as well as the small cancer cells H1299. Figure 5 shows the effect of the destruction of the recombinant p53 adenovirus on Hep-2 cells. The cells were stained with trypan blue, and then the percentage of blue (dead) cells was counted; the results are shown in FIG.

Example 2

Material: Recombinant human adenovirus p53 Gendicine (Injection) was obtained from Shenzhen Sibiono Gene Tech Co, Shenzhen, China, lot No. S010731. The drug was packaged in 1 × 10 ¹² VP / dose, and each dose was contained in 2 ml saline tubes. Each box contained one tube.

Clinical trials were randomized trials under concomitant control using only one agent and an open label.

The procedure for selecting a patient was as follows: The patient signs a consent to participate in clinical trials. Pathological analysis confirmed the presence of neck and head tumors in patients, and then the tumor was classified according to the TNM system. Patients with measurable tumors that could be monitored and who were available for local injection of drugs were allowed to participate in the trial. Patients ranged in age from 18 to 70 years, and their life expectancy was at least 3 months. Both women and men could participate in the trials.

The following criterion for exclusion of patients from trials was selected. Patients with an acute respiratory infection or patients with uncontrolled fever as a result of such an infection were excluded. Patients in whom the observed lesions were treated with another topical preparation were also excluded. Patients with serious diseases of the heart, liver, lungs or kidneys, patients with a tendency to hemarrhage, pregnant women or nursing mothers were also excluded.

During the trials, patients who met the following standards were excluded: patients who did not withstand severe fever from using the tested drugs; patients who were required to suspend trials due to unexpected toxic side effects; and patients excluded from the trial for personal reasons. Clinical trials continued in four clinics from June 2001 to May 2003. In total, 155 subjects participated in them.

The clinical protocol was as follows.

1. The group that received gene therapy with radiotherapy

Every Friday, a Gendicine injection was performed inside the tumor, the dose was 10 ¹² VP / injection. 3 days after the injection, the patient was given a radiotherapy session. Irradiation was carried out using standard 3-dimensional conformational therapy at a dosage of 70Gy / 35 f for approximately 7-8 weeks. The first cycle was completed after 5 weeks and a cumulative dose of 40 Gy. The second cycle was completed after 8 weeks and a cumulative dose of 70 Gy. At week 12, therapeutic results were confirmed by computed tomography. According to WHO standards, for the objective assessment of solid tumors, the tumor suppression rate (%) was calculated at points corresponding to 40 Gy, 70 Gy, as well as the time of confirmation of therapeutic results. The results were classified as complete response (CR), partial response (PR), stable disease state (SD) and progressive disease state (PD).

2. The group receiving gene therapy combined with chemotherapy

Gendicine was injected into the tumor with a single dose once a week. The full course of treatment was 8 weeks and 8 injections were made. Chemotherapy started 3 days after injection. On the first day, an intravenous injection of DDP (cisplatin) was performed at a dose of 80 mg / m ² . From the first to the fifth day, 5-fluorouracil (5-Fluororacil) was continuously administered intravenously at a dose of 500 mg / m ² .

3. Clinical laboratory analysis

Regular testing of patients began in the first week after the subject was included in clinical trials and then conducted weekly during the trial. Testing included physical examination, KPS status, a complete blood count, a complete urinalysis, and a complete bowel movement test. Biochemical analysis was performed every month, including total blood nitrogen (BUN), creatinine (Cr), ACT, and ALT; performed ECG (EKG) and chest x-ray. The determination and registration of the toxicity of gendicin in these tests was carried out every week according to the WHO standard in order to assess the acute and pseudo-acute toxicity of anticancer drugs. The following toxicity categories were identified: mild (I), moderate (II), serious (III) and life-threatening (IV). In phase I of clinical trials, changes in body temperature were especially noted.

4. Results of analyzes and statistical analysis

Statistical analysis was performed using SPSS 11.0 software. Tests were carried out according to the ITT method. Comparison of the reduction in the size of the tumor lesion was performed according to the t-test. A Chi-square test was used to compare therapeutic significance.

5. Effect on blood, urine, bowel movements, as well as on the liver and kidneys

The results are shown in table 1.

Table 1 Complete blood count and blood biochemistry for a group of 37 subjects treated with gene therapy / radiotherapy Indicator Before injection (A) 4 weeks (B) 8 weeks (s) P (A-B) Value (A-C) White blood cells (10 ⁹ / L) 6.81 ± 2.10 5.48 ± 1.47 5.41 ± 1.58 0.003 * 0.002 * Hemoglobin (g / l) 134.05 ± 15.08 126.03 ± 14.73 127.28 ± 14.51 0,040 * 0,095 Platelets (10 ⁹ / L) 250.49 ± 69.67 242.19 ± 86.74 250.58 ± 110.33 0.893 1,000

ACT (units / l) 27.59 ± 13.70 25.5U12.82 26.08 ± 11.16 0.701 0.829 ALT (units / l) 31.14 ± 29.39 27.84 ± 28.44 26.76 ± 27.06 0.835 0.734 Nitrogen (nmol / L) 5.51 ± 1.12 4.83 ± 1.21 4.80 ± 1.66 0.046 * 0,110 Creatinine (nmol / L) 80.59 ± 12.37 78.64 ± 11.21 77.53 ± 11.41 0.698 0.429 * shows the existence of a difference between the two compared groups (P <0.05)

The results shown in table 1 demonstrate that the indicators of the general analysis of blood and blood biochemistry obtained before the injection of gendicin and 2 weeks after its injection are in the standard range. Prior to the injection of gendicin, the values of ALT, ACT, blood nitrogen and creatinine were normal, and 2 weeks after its injection, these values only slightly decreased. ECG and chest x-ray data did not reveal any changes after the injection of gendicin.

Example 3. Treatment with genicin in combination with chemotherapy for a patient with liver cancer

Injections of recombinant human p53 adenovirus were obtained as described in example 1.

Clinical trials were randomized trials under concomitant control using only one agent and an open label.

Patient selection standards were as follows: first, patients sign a consent to participate in clinical trials. Pathological and histological analysis confirmed the presence of hepatocellular carcinoma (HCC) in patients. Carcinoma was assessed using standard Chinese protocols for the diagnosis and treatment of malignant neoplasms. Neoplasms should be measurable, they should be easy to observe, and they should be accessible for local injection of drugs. Patients ranged in age from 18 to 75 years, and their life expectancy was at least 3 months. Both women and men could participate in the trials.

The following criterion for exclusion of patients from trials was selected. Patients with acute respiratory infections of the upper respiratory tract, or patients with uncontrolled fever as a result of such an infection, were excluded. Patients in whom the observed lesions were treated with another topical preparation were also excluded. Patients with serious diseases of the heart, liver, lungs or kidneys, patients with a tendency to hemarrhage, pregnant women or nursing mothers were also excluded.

During the tests, patients who met the following standards were excluded: patients who did not withstand severe fever from using the tested drugs; patients who were required to suspend trials due to unexpected toxic side effects; and patients excluded from the trial for personal reasons.

From March 2004 to July 2004, there were 35 cases of liver cancer when treated with genicin in combination with chemotherapy.

1. Therapeutic protocols

These clinical trials involved 75 patients with hepatocellular carcinoma, of which 51 men and 24 women with stages of the disease from moderate to late.

2 groups were left at random.

In the first group, 40 patients underwent chemotherapy using transcatheter hemoembolism chemoembolization (TACE). Using a puncture of the femoral artery, a catheter was implanted in the femoral or hepatic artery. Subsequently, in order to determine the number of neoplasms, their location, type, size, supplying blood vessels and arteriovenous fistulas, a photograph of the superior mesenteric artery or diaphragmatic artery was used; thus, other arteries that feed liver cancer were detected. Using blood vessel blockage with a gelatin sponge, 5-fluorouracil, adriamycin, mitomycin, cisplatin and hydroxycamphotecin were injected into the hepatic artery, the manipulation was carried out to conduct chemotherapy. After that, a catheter was introduced into the branches of the blood supply in the hepatic artery and a completely emulsified mixture containing 10 mg of adriamycin and 10-30 ml of iodized oil was slowly injected into the liver, the process was carried out under x-ray control. TACE injection was performed every 4 weeks, and after two injections the therapeutic effect was evaluated.

The second group of 35 patients received gene therapy in combination with TACE (GT-TACE). 48-72 hours before TACE, under the control of computed tomography, a subcutaneous intratumoral injection of genicin was given, and injection was performed at numerous neoplasms. Depending on the size of the tumor, each dosage was approximately 1-4 × 10 ¹² VP, the process was carried out once a week, making 3-4 injections sequentially. TACE chemotherapy was carried out as described above.

According to WHO standards for an objective assessment of solid tumors, the results were classified as a complete response (CR), partial response (PR), stable disease state (SD) and progressive disease state (PD).

2. Standard clinical testing

Regular testing of patients began in the first week after the subject was included in clinical trials and then conducted weekly during the trial. Testing included physical examination, KPS status, a complete blood count, a complete urinalysis, and a complete bowel movement test. Biochemical analysis was performed every month, including total blood nitrogen (BUN), creatinine (Cr), ACT, and ALT; performed ECG (EKG) and chest x-ray. The determination and registration of the toxicity of gendicin in these tests was carried out every week according to the WHO standard in order to assess the acute and pseudo-acute toxicity of anticancer drugs. The following toxicity categories were identified: mild (I), moderate (II), serious (III) and life-threatening (IV). In phase I of clinical trials, changes in body temperature were especially noted. The general condition of the patients was evaluated using the KPS methodology.

3. Results of analyzes and statistical analysis

Statistical analysis was performed using SPSS 11.0 software.

4. Effect on white blood cell count, symptoms, and KPS score

Table 2 shows the effect on white blood cells. You can see that with TACE chemotherapy, the number of leukocytes is significantly reduced. The difference between the two groups was significant, p <0.05.

table 2 Reduction in the number of leukocytes (× 10 ⁹ / l) and the number of cases (%) Groups The degree of reduction in the number of leukocytes The total number of cases showing a reduction 4.0-3.0 3.0-2.0 2.0 or lower GT-TACE 12 (25.0) 4 (8.3) 2 (4,2) 18 (37.5) Tase 8 (13.3) 20 (33.3) 11 (18.3) 39 (65.0)

Table 3 shows the results of improving patient symptoms. From this table it can be seen that in the GT-TACE group, after a monthly course of treatment, a sharp improvement in symptoms was observed. The difference between the two groups was significant, p <0.05.

Table 3 Improving the condition of patients after 1 month of treatment Groups Number of cases Fever Digestive tract Pain relief GT-TACE 35 25 (71.4) 16 (45.6) 30 (85.7) Tase 40 18 (45.0) 24 (60.0) 21 (52.5)

Table 4 shows the improvement in the condition of patients according to the KPS scale. From this table it can be seen that in the group of GT-TACE patients, after a monthly course of treatment, a significant improvement on the KPS scale was noted.

The results of this example show that patients from the group in which gene therapy was combined with chemotherapy (GT-TACE) showed a stronger improvement compared to the control group (receiving only chemotherapy), regarding reduction of tumor size, weakening of symptoms, and changes in the number of leukocytes and parameters on the KPS scale. In addition, appetite and sleep improved mainly in the GT-TACE group. The results show that if the product of the recombinant human p53 adenovirus (gendicin) was used to treat liver cancer with chemotherapy, gendicin can weaken the side effects of chemotherapy, as well as improve the general condition and mental status of patients.

Example 4. The effectiveness of gendicin in improving the quality of life of cancer patients

A 40-year-old woman with advanced left breast cancer was subjected to surgery. The procedure included mastectomy and excision of auxiliary lymphoid nodes. After surgery, it was found that 10 out of 12 surgically removed sites had metastatic cells. Later, the patient received radiotherapy at a dose of 45 Gy / 25f75w, as well as 9 cycles of chemotherapy (cyclophosphamide + erubicin + 5-fluorouracil). However, 6 months after combination therapy, metastatic tumor was detected in numerous areas of the spine, including the cervical vertebra, thoracic vertebra and lumbar vertebra. The patient underwent additional therapy (taxotere, vinralbine, as well as the new drug xeloda in oral form). In the interval between chemotherapy courses, in order to maintain the patient’s bone tissue, she was given a zometa preparation. However, the desired therapeutic effect with the help of all the above actions was not achieved. By January 2004, the patient had an increase in ALT, ACT, and white blood cell count. Her physical condition began to deteriorate, she began to feel aches, fatigue, weight loss, mental depression, etc .; all this indicated that her condition was progressing.

After failure to achieve effective treatment with chemotherapy and radiotherapy in the hospital, the patient was given one course of therapy with genicin. Then the patient was sent home to continue treatment with genicin. 1 month after the injection of genicin, the results of computed tomography and magnetic resonance imaging suggested that the state of the tumor had improved over the past 6 months. This was a promising sign for the patient. “I felt very tired on the day of the injection. However, before the next injection, I felt better and more energetic, and did not feel any pain. " After 3 months of treatment with gendicin, the results of the magnetic resonance method showed the presence of steatosis in injuries of the thoracic vertebra 11 and 12 and lumbar vertebra 3. In other metastases, no improvement was observed. Blood test results were normal, and bilirubin levels were markedly high. The patient no longer felt a return of pain and had a good appetite. 5 months after the course of treatment with genicinum, the patient was resting with her family, she did not feel any discomfort and had a good mental status. 7 months after the course of treatment with hendicin, the results of the magnetic resonance method suggested the disappearance of the tumor in the thoracic vertebra 11, other injuries did not change, but no new ones appeared. There was no clouding on the chest x-ray. The blood test reached an almost normal level. The patient did not experience pain and had a good mental status. 9 months after the course of treatment with genicin, no signs of deterioration of the tumor (according to magnetic resonance data) were noted. Radiography of the lungs was good. A blood test has become normal. The patient did not experience pain and felt better than before.

Example 5

An invasive pancreatic cancer was diagnosed in a 60-year-old woman, the tumor diameter was 5 cm, and the life expectancy was only 1 year. The woman decided not to take standard chemotherapy because she could not bear the side effects associated with chemotherapy. The patient was subjected to treatment with genicin, for 8 weeks by intravenous injection she received 20 doses of the drug.

After treatment with genicin, the results of a computer scan confirmed that the patient’s tumor in the pancreas did not increase, and minor damage to the liver disappeared. After further observations, it was found that the lesions became stable, the suspicious lesions disappeared, and the swollen lymph nodes contracted.

Conclusion

We found that injection of recombinant p53 adenovirus recombinant into cancer patients had a unique unexpected effect. It consists in the fact that when combined with chemotherapy or radiotherapy, the indicated recombinant is able to attenuate side effects caused by treating a tumor with chemotherapy or radiotherapy alone.

This discovery is important, because after the injection of genicin, the general condition of cancer patients, especially in the late stage of the disease, has improved significantly. For example, their physiological and mental status has significantly improved, their appetite has also become better. We postulate that this effect occurs due to the global regulation of the nervous, endocrine and immune systems. Thus, gendicin is able to improve and strengthen the functions of various organs of patients, as well as improve overall health.

The following describes a possible mechanism of action.

Gendicin is a viral particle obtained by genetic engineering. It can stimulate and modulate the body’s nervous system, endocrine and immune systems to produce a series of nerve factors, hormones and cellular factors. As can be seen from the above examples, one of the phenomena experienced by patients after the administration of gendicin is an increase in body temperature, in other words, fever. This phenomenon can be explained so that gendicin is able to activate the patient’s immune system. It turned out that due to the comprehensive regulation of the patient’s nervous, endocrine and immune systems, the immune forces are improved, and the ability of killer cells and T cells to destroy cancer cells is effectively increased; Thus, the antitumor effect of humoral and cellular immunity is increased. Gendicin can also act by regulating the physiological functions of the patient and thereby improving his overall health.

Despite the fact that the present invention has been described above in some detail with the help of illustrations and examples designed to explain the new manifestations of the therapeutic effect of gendicin, people skilled in this technology should understand the practical application of various changes and modifications. Therefore, the above description and examples should not be construed as limiting the scope of the present invention; it is defined by the following claims.

Claims (19)

1. A method of reducing side effects, including, but not limited to, side effects caused by antitumor chemotherapy and radiotherapy, which is to administer to a patient in need of such a reduction in side effects a pharmaceutical composition containing a treatment amount of p53 adenovirus recombinant and a pharmaceutically acceptable excipient. 2. The method according to claim 1, characterized in that the pharmaceutical composition is administered simultaneously with chemotherapy. 3. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered before the introduction of chemotherapeutic agents. 4. The method according to claim 3, characterized in that a single dose of the specified pharmaceutical composition is administered on the day immediately before the day of administration of chemotherapeutic agents. 5. The method according to claim 3, characterized in that a single dose of the specified pharmaceutical composition is administered on any of three days before the day of administration of chemotherapeutic agents. 6. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered after administration of chemotherapeutic agents. 7. The method according to claim 6, characterized in that a single dose of the specified pharmaceutical composition is administered on the day immediately after the day of administration of chemotherapeutic agents. 8. The method according to claim 6, characterized in that a single dose of the specified pharmaceutical composition is administered on any of three days after the day of administration of chemotherapeutic agents. 9. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered at any time during the chemotherapeutic treatment cycle. 10. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered on the day of radiotherapy. 11. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered before radiotherapy. 12. The method according to claim 11, characterized in that a single dose of the specified pharmaceutical composition is administered on any of the three days before radiotherapy. 13. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered after radiotherapy. 14. The method according to item 13, wherein the single dose of the pharmaceutical composition is administered on any of the three days after radiotherapy. 15. The method according to claim 1, characterized in that a single dose of the specified pharmaceutical composition is administered at any time of the cycle of radiotherapy treatment. 16. The method according to 1, characterized in that said side effects include, but are not limited to one of the following effects: loss of appetite, insomnia, weakness, nausea, urges to nausea, diarrhea, photophobia and alopecia, or also a combination thereof. 17. A method for improving the quality of life of patients with tumor diseases, comprising administering to said patients a pharmaceutical composition comprising a p53 adenovirus recombinant and a pharmaceutically acceptable carrier that is effective for treatment. 18. The method according to 17, characterized in that the pharmaceutical composition is administered in a single dose. 19. The method according to 17, characterized in that the indicator of improving the quality of life includes, but is not limited to one of the following indicators: improved appetite, weight gain, greater energy, less pain and better falling asleep, or a combination thereof.

Images