KR20030036580A - Biological methods for producing indigo and indirubin by the recombinant E. coli cells harboring a novel oxygenase - Google Patents

Abstract

PURPOSE: Biological methods for producing indigo and indirubin by a recombinant E. coli harboring a novel oxygenase gene are provided, in which indigo and indirubin can be produced by a microorganism without using organic solvents causing environmental pollution. CONSTITUTION: The oxygenase gene isolated from Methylophaga thalassica SK1(KCTC-10323BP) has the nucleotide sequence of SEQ ID NO: 1. The oxygenase expressed by the oxygenase gene of SEQ ID NO: 1 has the amino acid sequence of SEQ ID NO: 2. The method for producing indigo and indirubin comprises isolating and amplifying the oxygenase gene of SEQ ID NO: 1; cloning the oxygenase gene into a vector; transforming E. coli with the recombinant vector containing the oxygenase gene; and culturing the transformed E. coli in a medium containing tryptophane, so that indol derived from tryptophane is converted indol oxide by the oxygenase, wherein indigo is produced by dimerization of indol oxide(indoxyl) and indirubin is produced by combination of indoxyl with isatin; and the recombinant E. coli is cultured in a medium containing 5 to 15 mM of tryptophane, 0.5 to 1.5% of NaCl and 0.2 to 0.8% of yeast extract under the aeration rate of 0.5 to 2.0 vvm.

Description

Biological methods for producing indigo and indirubin by the recombinant E. coli cells harboring a novel oxygenase}

The present invention relates to a recombinant Escherichia coli containing a novel oxygenase gene and a method for biological production of indigo and indirubin using the same. More specifically, the wave Tallahassee Brassica (Methylophaga thalassica) SK1 (Accession No: KCTC-10323BP) methyl which was a novel oxygenates amplify the tyrosinase gene isolated from the insert to the vector and transformed into the E. coli Recombinant E. coli and The present invention relates to a biological production method in which the transformed E. coli is cultured in a tryptophan-containing medium and converted to indigo and / or indirubin to produce tryptophan using oxygenase activity.

Indigo is one of the world's best known textile dyes and is used in the production of cotton or wool. Jeans, worn by men and women around the world, are produced by dyeing fabric denim with indigo dyes. Indigo is commonly used to dye cotton or wool blue as well as jeans. The dye was originally isolated from Polygonum tinctorium , an indigo plant, but has been chemically synthesized by Bayer in 1882 and is now in mass production.

These synthetic dyes pollute the environment by releasing potential toxic substances from the production to the final disposal, which is expensive. Highly toxic chemicals are used as raw materials, and byproducts have to go through several stages of threat to producers and the environment. However, the production of natural indigo by microorganisms can compensate for this problem and can express the color as it is. In the latter case, simple processes such as fermentation, cell separation, and purification are required. In the process, water and harmless raw materials are used instead of toxic organic solvents, and natural biomass and carbon dioxide are left in place of highly toxic industrial wastes.

The production of indigo by microorganisms was reported by Gray in 1928. It has since been reported by many inventors that indigo is produced in microorganisms (Yen et al . 1991, Eaton and Champman 1995, O'Connor et al . 1997, O'Connor and Hartmans 1998, Doukyu et al . 1998, 2002 ). Enzymes involved in indigo production generally consist of one or more. Generally, related enzymes include monooxygenase and dioxygenase, and the gene containing each enzyme is introduced into Escherichia coli to indigo in glucose or nutrient medium. Production (Ensley et al . 1983, Hart et al . 1992, Murdock et al . 1993, Kim et al . 1997, Bhushan et al . 2000, Drewlo et al . 2001).

It was to mono-oxy of microbial and animal origin express tyrosinase and dioxane Shigeru tyrosinase gene in E. coli and Pseudomonas (Pseudomonas) Although the indigo produced experiment, generating the largest number of indigo of these experiments naphthalene dioxane Shigeru tyrosinase (dinaphthalene dioxygenase) (9 Dog gene), indigo was converted from glucose to a concentration of 135 mg / l. However, the production of indigo by microorganisms has not yet produced an amount that can replace chemical synthesis. The team currently leading the experiment to replace chemical synthetic pigments is Genencor International Co. However, this group also does not get enough indigo from microorganisms to replace chemical synthetic pigments. However, genetically engineered bacteria produce a large amount of the world's popular dark blue pigments, and have also performed various experiments to remove impurities including red color during dyeing.

Methyltrophic bacteria refer to a group of bacteria that use a reduced single carbon such as methane or methanol as an energy and carbon source. The parasitic marine methyltropic bacteria Methylophaga sp. The gene producing blue pigment in SK1 was introduced into E. coli . Flavin-containing monooxygenase (FMO), which was able to obtain high activity and a large amount of indigo in indigo production, is a type of flavo protein that oxidizes substances or amines containing heteroatoms .

The production of indigo converts tryptophan in the medium into indole by tryptophanase originally possessed by E. coli host cells. Tryptophan is ideal for converting to indigo. This is because tryptophan already has a ring structure in the center of the indigo molecule. After a slight chemical change, tryptophan is converted to indole. The indole thus converted is converted to indole oxide by FMO expressed by the cloned DNA. After the indole oxide is produced indokyl (indoxyl) by a natural reaction, indigo production is finally produced through oxidative dimerizaton (dimerizaton).

The technical problem to be achieved in the present invention is to clone the indigo and indirubin generating genes that can be industrialized into E. coli to produce transformed Escherichia coli, and to culture the transformed Escherichia coli in tryptophan-containing medium through a large amount of indigo and tryptophan conversion It is to develop the optimal condition for the production of indirubin biologically and to develop the method to maximize the yield.

Figure 1 shows the assembly method of the plasmid pBlue 2.2 of the present invention.

2 shows (A) the flavin-containing monooxygenase gene on pBlue 1.7 was located downstream of lacZ (p lac ) in pUC19. (B) SDS-polyacrylamide gel electrophoresis of bacterial flavin-containing monooxygenase expressed from E. coli.

Figure 3 shows the UV-visible light spectrum of blue pigment produced by E. coli containing the flavin-containing monooxygenase gene of the present invention.

Figure 4 shows the production of indigo by recombinant E. coli DH5α strain containing a large plasmid of the present invention. 1 ml of culture fluid was obtained at various time intervals and extracted with DMF. The absorbance of the DMF solution was measured at a wavelength of 610 nm. During fermentation, various amounts of indigo were generated from pBlue 2.2 (▼) in LB-ampicillin medium, pBlue 2.0 (•) in tryptophan medium and pBlue 1.9 (■) contained cells in tryptophan medium, respectively.

Figure 5 shows a subcloning schematic of the 2.0 kb PCR product of the present invention.

Figure 6 shows a comparison of indigo formation by the release of the promoter region of the fmo gene in the recombinant E. coli DH5α strain of the present invention.

Figure 7 shows the production of indigo by the release of the promoter region of the fmo gene in the recombinant E. coli DH5α strain of the present invention. Different amounts of indigo were generated from pBlue 1.7 (•), pBlue 1.8 (○) and pBlue 1.6 (▼) inclusion cells in tryptophan medium, respectively.

8 is pBlue 1.9. The production of indirubin of the recombinant recombinant E. coli DH5α strain is shown.

An object of the present invention is a wave Tallahassee Brassica (Methylophaga thalassica) SK1 (Accession No: KCTC-10323BP) of methyl to it oxy having the DNA base sequence of the isolated sequences from the No. 1 provides the tyrosinase gene.

The present invention also provides an oxygenase enzyme having an amino acid sequence of SEQ ID NO: 2 expressed by the oxygenase gene.

Meanwhile, the present invention isolates and amplifies the oxygenase gene of SEQ ID NO: 1, inserts it into a vector, and inserts and transforms the recombinant E. coli transformed into E. coli in a medium containing tryptophan, thereby inducing indole derived from tryptophan to oxygenase activity. It is to provide a method for producing indigo and / or indirubin by converting to indole oxide using.

In addition, after culturing the recombinant Escherichia coli, indole derived from tryptophan is prepared using oxygenase activity, and the indole is prepared when the indole is dimerized. When combined, it is characterized in that it is made of indirubin.

In addition, the culture is characterized in that the culture by injecting oxygen with aeration of 0.5 to 2.0 vvm in a medium containing 5-15 mM tryptophan, 0.5-1.5% NaCl and 0.2-0.8% yeast extract.

Hereinafter, the present invention will be described in more detail.

Isolation of Oxygenase Gene Clones

Holistic recombinant DNA techniques are described in Sambrook et al. (1989) using the method. The use of reagents and restriction enzymes was carried out according to the method recommended by the manufacturer.

Methylophaga sp. The chromosomal DNA isolation of SK1 was prepared using Goldberg and Ohman (1984). Methylophaga sp. Was added to 50 ml of basic salt medium in 1% methanol solution . After incubating the SK1 strain (Accession No .: KCTC-10323BP) to the exponential growth phase, the cells were collected by centrifugation (10,000 × g, 15 minutes, 4 ° C), and the cells were washed twice with sterile water and 10 ml of solution I ( 50 mM glucose, 10 mM, EDTA, 25 mM Tris-HCl, pH 8.0). 1 ml of lysozyme solution (50 mg / ml), 0.5 ml RNase (2 mg / ml) and 0.1 ml protease K (50 mg / ml) were added and left at 37 ° C. for 1 hour, followed by 0.6 ml of 10% SDS solution was added and left at 37 ° C for 1 hour. After adding 1 ml of mercaptoethanol to the reaction solution, 3M sodium acetate solution (pH 5.2) corresponding to 0.5 times of the reaction solution was added thereto, and the reaction solution was treated with the same amount of chloroform. Thereafter, the supernatant was collected by centrifugation at 15,000 × g for 30 minutes. After adding isopropanol corresponding to 0.6 times of the supernatant thus obtained, the coagulated chromosomal DNA was recovered, washed with 70% ethanol, and dried. The dried chromosomal DNA was dissolved in 3 ml of TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and used for the experiment.

Genome Library Fabrication

Genomic DNA libraries were constructed using the pUC19 vector. After chromosomal DNA was completely digested with restriction enzyme Hind III, pUC19 cut with Hind III was ligated overnight at 16 ° C with a DNA concentration of 3: 1. The ligated mixture was introduced into host E. coli DH5α.

Transformation

Appropriate amount of recombinant DNA was mixed with E. coli DH5α competent cells and left for 30 minutes on ice, then subjected to heat shock at 42 ° C. for 45 seconds, and then left for 2 minutes in ice. 900 μl LB liquid medium was added thereto, followed by incubation at 37 ° C. for 1 hour, and then centrifuged to remove 900 μl of supernatant. After resuspension, the plate was plated in LB medium containing ampicillin antibiotics and incubated at 37 ° C.

Plasmid Isolation

Plasmids were isolated from Escherichia coli by alkaline lysis. 1 ml of the bacterial culture solution was placed in an Eppendorf tube and centrifuged to remove the supernatant. The precipitate was suspended in 100 μl of Solution I with 2 mg / ml lysozyme dissolved. Solution I used 25 mM Tris-HCl buffer (pH 8.0) containing 50 mM glucose and 10 mM EDTA. After the suspension was allowed to stand at 37 ° C. for 20 minutes, 200 μl of freshly prepared solution II (0.2N NaOH and 1% SDS mixed solution) was added thereto, and the mixture was shaken three or four times and mixed for 5 minutes. 150 μl of Solution III (60 mL of 5M potassium acetate, 11.5 mL of glacial acetic acid, 28.5 mL of distilled water) was added to the reaction solution, followed by mixing and standing for 5 minutes in ice. Then 50 μl of chloroform was added and stirred. The mixed solution was centrifuged at 15,000 × g for 5 minutes at 4 ° C. to obtain a supernatant. After adding ethanol corresponding to twice the supernatant, the supernatant was removed by centrifugation at 4 ° C. for 5 minutes at 15,000 × g , and 70% ethanol was added thereto. The supernatant was removed by centrifugation and the precipitate was dried at 65 ° C. for 5 minutes. 1 μl of DNase-free pancreatic RNase (20 μg / ml) and 50 μl of TE buffer were added to dissolve the precipitate and used for the experiment.

Blue pigment separation and characterization

E. coli DH5α containing the gene producing blue pigment was incubated for 16 hours at 37 ° C. in 100 ml LB. The culture solution was centrifuged at 10,000 x g for 1 minute to obtain ultramarine pellets. The ultramarine blue pellet was washed twice with distilled water and then resuspended with 10 ml of N, N-dimethylformamide (DMF, Sigma). Thereafter, sonication was performed using a microprobe. After centrifugation at 10,000 x g for 1 minute, the supernatant was obtained and used for indigo analysis. The absorption wavelength of indigo was measured using an Ultrospec 2000 spectrophotometer (Amersham Bioscience). At this time, the wavelength range was measured as 300 to 700nm. In thin layer chromatography, a dye dissolved in DMF and a chemical synthetic indigo used as a control were spotted on a silica gel TLC plate (Merck), and then a solution having a methanol-acetone mixing ratio of 50:50 (v / v) was used as a solvent. Analyzed using.

Purification and Analysis of Blue Pigments by HPLC

The blue pigment was separated by HPLC (delta prep 4000, Waters) using a prep-nova-pak HR C18 column (25 × 100 mm). A mixed solution of 30% H ₂ O and 70% methanol was separated as a mobile phase by flowing at a rate of 15 mL / min. The separated material was analyzed by obtaining the maximum absorption wavelength using photodiode analysis (PDI) of HPLC. Mass separation purification of indigo and indirubin was performed on an open column using Merck's LiChroprep RP-18 resin. A solution of 30% H ₂ O and 70% ethanol was flowed at a rate of 3 ml / min as a mobile phase, and each was separated and purified to be used for MALDI-TOF and NMR measurements.

Fermentation condition

All indigo fermentation experiments were carried out in batch culture using a 5 L fermentation bath of KoBioTech (Model: KF-5L). To compare indigo production by strain in medium containing 10 mM tryptophan, 1% NaCl, and 0.5% yeast extract, inoculated with E. coli DH5α, JM109 and BL21 (DE3) spawns containing 5% of indigo genes, respectively. Indigo production capacity of was measured. At this time, the amount of dissolved oxygen was maximized to produce indigo well, and the pH was fixed at 7.0 and then cultured at 37 ° C.

Indigo production measurement

In order to measure the amount of indigo produced over time, 1 ml of the sample was centrifuged at 10,000 x g for each hour to remove the supernatant, and then 1 ml of DMF was added to resuspend. Samples suspended in DMF were sonicated using a microprobe. After removing the cell debris by centrifugation at 10,000 × g , the amount of indigo was measured by measuring the supernatant at 610 nm, the maximum absorption wavelength. Indigo standard curves were measured after the chemical synthetic indigo was dissolved in DMF.

Fermentation condition

All indigo fermentation experiments were carried out in batch culture using a 5 L fermentation bath of KoBioTech (Model: KF-5L). In order to compare the indigo production by strain in a medium containing 10 mM tryptophan, 1% NaCl, and 0.5% yeast extract, 5% of E. coli DH5α, JM109 and BL21 (DE3) spawns containing indigo-generating genes were inoculated, respectively. Indigo production capacity was measured. At this time, the amount of dissolved oxygen was maximized to produce indigo well, and the pH was fixed at 7.0 and then cultured at 37 ° C.

Hereinafter, the present invention will be described in more detail with reference to Examples.

Example 1 Cloning and Expression of FMO Gene

Analysis of Blue Pigment Clones

Methylophaga sp. Clones producing blue pigments were isolated from the genomic library of SK1 (Accession No .: KCTC-10323BP). Blue colonies producing a large amount of blue pigment were observed by aerobic incubation for 24 hours in LB medium. From the blue colony, pBlue 2.2, a plasmid hybridized with a 2.2 kb Hind III fragment, was obtained (FIG. 1).

pBlue was cut and treated with Sac I and Hind III restriction enzymes to obtain 1.8 kb fragments, which were subcloned into the Sac I and Hind III sites of the pUC19 vector. A 1.8 kb Sac I / Hind III fragment produced blue pigment. However, Hind III / EcoR I and Sac I / Sal I fragments did not produce blue pigment . Subcloning experiments that produce these blue pigments have found a reliable open reading frame (ORF). Methylophaga s p. The sequence of SEQ ID NO: 1, which is a nucleotide sequence of a fragment of SK1 DNA cloned, was confirmed. Of the total 2215 bp of nucleotide sequences, 1371 bp constituted the ORF of the gene forming blue pigment. The sequence was analyzed by NCBI's Blast search program (Altschul et al ., 1990) and Gene runner, and the ORF encoded flavin-containing monooxygenase (FMO).

Expression of the FMO Gene

The FMO gene contains the fmo promoter region, and the FMO gene is expressed by plac . In this experiment, indigo was generated by using the FMO gene encoded in the cloned DNA. This method can more easily obtain a large amount of indigo than producing indigo from glucose, and does not require expensive IPTG as an inducer (FIG. 2).

Example 2 Characterization of Blue Pigment

Extraction of Blue Pigments

The blue pigment mixed with E. coli was removed from the culture medium using a pore size 5 μm Gelman filter to remove the media components and impurities. After adding distilled water, ultrasonication was performed to completely remove the medium component, other water-soluble substances, and remaining substances, and dried the same to be used in the next experiment. A small amount of red color was extracted from the blue pigment in methanol solvent, and a large amount of blue substance was extracted from sulfuric acid, DMF and DMSO. DMF and DMSO were added to the completely dehydrated blue pigment, and then analyzed for the blue pigment using a spectrophotometer (Ultrospec 2000, Amersham Biosciences). Highest.

Characteristics of blue pigment

Blue pigment was analyzed by silica gel thin layer chromatography using chemical synthetic indigo (Fluka) as a control. Pigments produced from E. coli were separated into pink, which is a major spot (R _f = 0.88) and a minor spot (R _f = 0.80) (FIG. 3). As a result, blue pigment, the main pigment produced from recombinant DNA molecules, was assumed to be indigo, and red pigment was indirubin, an isomer of indigo.

Therefore, the following experiment was carried out for more detailed characterization of these materials. 2 g of the extracted blue pigment was dissolved in 5 ml of DMSO, and each material was separated and purified through a C-18 column. At this time, the ratio of methanol and distilled water was 7: 3, and the flow rate was flowed at a rate of 1 ml / min, and the blue and red fractions were separated and purified, respectively, to measure the molecular weight. As a result of measuring the molecular weight by MALDI-TOF, the indigo produced from the chemical synthesis indigo and Escherichia coli was measured to have a molecular weight of 262, and the red portion also measured a molecular weight of 262. NMR and molecular weight measurements showed blue as indigo and red as indirubin.

Flavin-containing monooxygenase (FMO) is found in most mammals, including humans, and is an enzyme that binds to membranes and participates in bioforeign metabolism. FMOs are known to catalyze the oxidation of a variety of substances, including compounds containing nitrogen, sulfur and phosphorus, which are soft nucleophiles. Recently, FMOs found in yeast are involved in protein folding in endoplasmic reticulum, and FMOs in plants are reported to be involved in auxin biosynthesis (Jung-Keun Suh, et al ). In this experiment, the FMO encoded in the cloned DNA oxidizes indole into indole oxide and finally seems to be involved in indigo formation.

Example 3 Indigo and Indirubin Production Using Recombinant Escherichia Coli

Indigo production

All produced indigo was measured at 610 nm using a UV-Visible Spectrophotometer. DMF was added to the indigo, which had been completely drained, and crushed so that the indigo was completely dissolved several times using a sonicator. The prepared sample was measured at 610 nm to quantify the indigo amount.

In this experiment, indigo production experiments were performed using the E. coli metabolism. E. coli tryptopanase was used to convert from tryptophan to indole, and the indigo was generated by the FMO encoded in the cloned DNA. This method makes it easier to obtain large amounts of indigo than to produce indigo from glucose and does not require expensive IPTG as an inducer.

① Composition of medium

In order to find a medium suitable for indigo formation, a few amino acids having a ring structure were included in the medium, and indigo production was measured. Indigo formation experiments were performed by adding trypsin, phenylalanine, and tryptophan to a medium containing 0.1%, yeast extract 0.5%, and 1% NaCl, respectively. Indigo was produced in trypsin medium and phenylalanine medium, but the amount was insignificant, and dark blue indigo was produced in tryptophan medium, which was then carried out using tryptophan medium. It was observed that the indigo production efficiency was lowered in the medium to which tryptophan was added in excess. It is believed that after a certain concentration of indigo is produced, indigo formation is slowed due to the metabolic action of E. coli. The concentration of tryptophan with high efficiency in indigo formation was 10 mM and indigo formation efficiency was lowered at higher concentrations. The concentration of NaCl or yeast extract did not significantly affect indigo formation, but indigo formation was delayed when tested at lower concentrations. Using incubation medium containing 10 mM tryptophan, 1% NaCl, 0.5% yeast extract was able to produce more than four times more indigo than using LB medium when producing indigo.

② pH

As indigo was produced, the pH in the medium gradually changed to basic. The pH changed to a maximum of 8.4 after 12 hours and no indigo formed above that. In addition, when the pH of the medium was lowered, the indigo was changed to colorless, so that the exact amount of production could not be measured. Therefore, in all experiments, the experiment was performed by fixing the pH to 7.0 using a fermentor.

③ temperature

In a strain having a promoter region of 400bp or more, a large amount of indigo could be obtained at the shortest time at 37 ° C. On the other hand, indigo was not produced in the strain having a promoter length of less than 300bp at the same temperature, but indigo was produced when incubated at 30 ° C. It is judged that indigo was not produced because the FMO required to produce indigo was very unstable at temperature upon expression of a large amount.

④ Selection of host E. coli

Indigo production experiments were performed using E. coli DH5α, JM101, JM109, BL21 (DE3) Escherichia coli to confirm the indigo production according to the host. In the case of pBlue 2.2, pBlue 2.0, and pBlue 1.9 having a promoter region of 400 bp or more, BL21 (DE3) produced more indigo compared to other hosts (FIG. 4). However, more indigo was produced in DH5α for pBlue 1.8, pBlue 1.7, and pBlue 1.6 with a promoter region of less than 300 bp, and no indigo was produced for BL21 (DE3).

⑤ Effect of dissolved oxygen

Indigo production was not compulsorily injected with indigo when indigo was produced similarly in both tryptophan medium and LB medium. However, it was confirmed that indigo production was increased when the oxygen was forced to aeration to increase the oxygen concentration in the medium.

⑥ Effect of promoter length

In order to determine the length of the promoter region that influences indigo production, several higher nucleotide sequences were used in the experiment using the promoter deletion method. Indigo production was measured by decreasing the length of the promoter region by 100 bp. Primers according to the length of each promoter were prepared using pBlue 2.2 as a template and subjected to PCR. The primers used are shown in Table 1. The formed PCR product was then subcloned into pBluescript SK (+) to perform indigo production experiments (FIG. 5). Indigo production increased as the promoter region became smaller and the maximum production was pBlue 1.7 with a 300bp promoter region (FIG. 6). Indigo fermentation experiments were carried out in batch culture using a 5 L fermentation bath manufactured by KoBioTech (Model: KF-5L). Indigo production was measured in a medium containing 10 mM tryptophan, 1% NaCl, 0.5% yeast extract. At this time, the amount of dissolved oxygen was maximized to produce indigo well, and the pH was fixed at 7.0 and then cultured at 37 ° C. (FIG. 7).

Primer Sequences Used for Subcloning sense pBlue 2.0 5'-ATA GAGCTC TGCGTTGGTGTGAAATGCG-3'pBlue 1.8 5'-ATA GAGCTC ATCACCGGTTACATCGCAGA-3'pBlue 1.7 5'-ATA GAGCTC ACATTTTCACCGTTTAATAT-3'pBlue 1.6 5'-ATA GAGCTC AACAAGTAATAACAACCTCT AGAACTAAGAGAGAGAGAGAGAG -3 ' Antisense 5-TAT GGTACC CTAGAGTCGACCTGCAGGCA-3.

Many groups are working on the production of dark blue blue pigment, which is gaining popularity worldwide. Instead of environmental pollutants produced during chemical production, bacteria that emit harmless substances to humans are used to express eco-friendly and natural colors. Based on the above results, in this experiment, the indigo production experiment was performed by forcibly injecting air while culturing at 30 ° C. in tryptophan medium using pBlue 1.7 which produced the most indigo. Doukyu's team in Japan, one of the leading groups in indigo production, reported that Acinetobacter sp. ST-550 strain is used to produce indigo through a two-phase fermentation process. Studies using the two-phase fermentation method produced up to 292 mg / l indigo. Another Murdock team leading the production of blue pigments produced 130 mg / l of indigo from Glocos medium using recombinant strains (Table 2). The method of producing indigo from glucose medium has the attractiveness of producing high value-added indigo using a cheap substrate called glocos, but the disadvantage of having to go through several steps in the production process and the need of IPTG as an inducer. This is inefficient in indigo production compared to the production using tryptophan. In this experiment, 5l fermenter is used to produce indigo by batch culture method. Cloned FMO allowed simple conversion from tryptophan to indigo without going through several steps. The most indigo-producing strain was pBlue 1.7, which produced 820 mg / l indigo when aerobicly cultured at 30 ° C. Indigo produced up to 1.2 g / l when tryptophan was in excess (20 mM), but conversion efficiency was remarkably decreased.

Comparison of Indigo Generation Conditions with Other Studies The present invention Doukyu et al. ⁸⁾ Murdock et al. ²⁰⁾ Amount of indigo (Mg / l) 820 mg / l 292 mg / l 135 mg / l gene Flavin-containing monooxygenase Unknown Naphthalene Dioxygenase Raw material Recombinant E. coli Acinetobacter sp. ST-550 Recombinant E. coli badge Tryptophan badge Composite badge Glucose medium comment Simple single gene, no inducer required Unknown 2 phases (water / organic solvent) 9 genes IPTG request

Indirubin production

Recent studies have shown that indirubin, a component of the Chinese traditional medicine tangui, which has been used for over 4000 years, has a therapeutic effect on leukemia (Ralph Hoessel et al, 1999). Indirubin and its derivatives have been shown to inhibit the activity of cyclin-dependent kinase (CDK), an enzyme involved in cell division. Because cancer occurs when the mechanism of regulating cell division weakens and shows abnormal growth, a substance that stops cell division may be used as an anticancer agent, and may be used to treat Alzheimer's disease or neurodegenerative disease. Known. In the indigo production experiment carried out in the present invention was able to purify the red pigment in the extract separation experiment using TLC and HPLC, the analysis results proved to be indirubin isomer of indigo. Indirubin production experiments were performed in the same manner as the indigo production method, and indirubin production from E. coli is generated by the combination of isatin and a doxyl chamber, as shown in FIG. 1. Materials containing indigo, indirubin and other compounds were separated on a prep-nova-pak HR C18 column (25 × 100 mm). A mixed solution of 30% H ₂ O and 70% methanol was flowed at a rate of 15 ml / min as a mobile phase and separated. Separated indirubin production was quantified by measuring the absorbance at 540nm (Fig. 8). Indirubin production increased with increasing indigo production. Indirubin produced 35 mg / l when tested using pBlue 1.9.

The effect of the present invention is to clone the indigo and indirubin generating genes that can be industrialized into Escherichia coli to produce transformed Escherichia coli, and to culture the transformed Escherichia coli in tryptophan-containing medium, a large amount of indigo and indirubin through tryptophan conversion It was to develop the optimal conditions for biological production and to maximize the yield.

Claims (5)

Methyl wave Tallahassee Brassica (Methylophaga thalassica) SK1 (Accession No: KCTC-10323BP) of the SEQ ID NO: 1 to remove it from the DNA base sequence oxygenates recombinase gene having a Oxygenase enzyme having the amino acid sequence of SEQ ID NO: 2 expressed by the oxygenase gene of claim 1 Recombinant Escherichia coli transformed by amplifying the oxygenase gene of SEQ ID NO. Process for conversion to indigo and / or indirubin The indole is prepared by culturing the recombinant E. coli and indole derived from tryptophan using oxygenase activity. Method characterized in that it is made of indirubin when combined with the generated isatin The method of claim 3, wherein the culture is performed by injecting oxygen with aeration of 0.5 to 2.0 vvm in a medium containing 5 to 15 mM tryptophan, 0.5 to 1.5% NaCl, and 0.2 to 0.8% yeast extract.