KR20030023243A - Compositions having Anti-cancer Activities - Google Patents

Abstract

PURPOSE: A composition containing an extract of 29 kinds of Chinese herbal medicine is provided which has excellent effects on inhibiting lung cancer metastasis of B16-BL6 and angiogenesis and improving immunoactivity. The anticancer activity is inhibition of cancer cell toxicity or DNA topoisomerase I. CONSTITUTION: The composition contains, by weight, 3 to 13% Portulaceae Herba, 3 to 13% Oldenlandiae diffusae Herba, 3 to 13% Ginseng Radix, 3 to 13% Astragali Radix, 1 to 10% Sanguisorbae, 1 to 10% Radix Paeoniae Radix, 1 to 10% Sepiae Os, 1 to 10% Ostreae Concha, 1 to 10% Poria, 1 to 10% Longanae Arillus, 1 to 10% Poria, 0.5 to 8% Pinelliae Rhizoma, 0.5 to 8% Aurantii Nobilis Pericarpium, 0.5 to 8% Hordei Fructus, 0.5 to 8% Atractylodis Rhizoma, 0.5 to 8% Gastrodiae Rhizoma, 0.1 to 6% Atractylodis Rhizoma, 0.1 to 6% Massa Medicata Fermentata, 0.1 to 6% Alismatis Rhizoma, 0.1 to 6% Trogopterorum Faeces, 0.1 to 6% olibanum, 0.1 to 6% Myrrha, 0.1 to 6% Corydalis Tuber, 0.1 to 6% Tsaoko Fructus, 0.1 to 6% Sparganii Rhizoma, 0.1 to 6% Zedoariae Rhizoma, 0.1 to 6% Zingiberis Rhizoma, 0.1 to 6% Phellodendri Cortex and 0.5 to 8% Zingiberis Rhizoma.

Description

Compositions having anti-cancer and anti-cancer metastasis effects

The present invention relates to a composition having an anti-cancer and cancer metastasis inhibiting effect, more specifically, 3-13% by weight of halal bran, 3-13% by weight of white chlorosis, 3-13% by weight, ginseng 3-13% by weight , 1-10% by weight, grenades 1-10% by weight, 1-10% by weight of seaweed, 1-10% by weight, 1-10% by weight of Baeksin, 1-10% by weight of Longan, 1-10% by weight of Baekbok 0.5-8% by weight, dermis 0.5-8% by weight, malt 0.5-8% by weight, creation 0.5-8% by weight, 0.5-8% by weight, 0.1-6% by weight, new country 0.1-6% by weight, 0.1-6% by weight, 0.1-6% by weight, Oyster 0.1-6% by weight, myrrh 0.1-6% by weight, Corydalis 0.1-6% by weight, excess 0.1-6% by weight, Samseong 0.1-6% by weight The invention relates to a composition having an anticancer and cancer metastasis inhibiting effect, comprising 0.1-6% by weight, 0.1-6% by weight, 0.1-6% by weight of white and yellow, and ginger.

Cancer is the number one cause and cause of death worldwide, and overcoming cancer is progressing globally but has not yet achieved remarkable results.

In Western medicine, chemotherapy, radiation therapy, surgical therapy, and immunotherapy are being carried out. There are many disadvantages that cause side effects such as inflammatory reactions and body breakdown. Recently, research has been conducted on the development of anti-cancer drugs without side effects in Chinese medicine.

Cancer treatment in oriental medicine includes dry birch (健脾 益氣), Yangshuo consonant (養血 滋陰), Yangin Saengjin (養陰 生 津), Bosin Ontang (補腎 溫陽), Kunbi Ixin (健脾 益腎), etc. The law of injustice, deciduous detoxification, vigorous fiery fish, conversational fish, and ectosan species, It is summarized as an indefinite unlawful law which combines injustice and a law of innocence. Among the cheating methods, dry fertilization is a method that can be used for digestive disorders such as anorexia, nausea, vomiting, vomiting, diarrhea and abdominal swelling, which are often seen when using cancer symptoms, chemotherapy, or chemotherapy. , Sagunja-tang (육군 君子 湯), Army Jatang (六 君子 湯), Bojungikgi-tang (탕 中 益氣 湯), etc., are effective in improving the side effects of cancer treatment or chemotherapy and radiation therapy. It has also been reported to be useful for digestive, liver and lung cancers.

Representative of dry non-cooking, Bokryeong Baekchul (蔘 ?? 白 朮 散) is a prescription that has been frequently used for the symptoms caused by unfortunate disability (주로 化 障碍) mainly due to the deprivation.

Therefore, the inventors of the present invention experimentally conducted anti-cancer and anticancer activity of Baeksunyoungsan with the addition of Baekseolsaengcho, Seonhakcho and Seongchocho to Bokryeong Baekchulsan (蔘 ?? 白 朮 散). To demonstrate, anti-tumor activity such as cytotoxity effect and DNA topoisomerase I inhibition by subfraction of water extract, hexane, butanol, ethyl acetate, ethyl ether fraction and fractions that were effective during screening , Cell adhesion analysis, cell invasion analysis, tube formation of ECV304 cells, BCE proliferation, inhibition of angiogenesis through CAM analysis, inhibition of mRNA expression of various proteolytic enzymes such as MMP-2, TIMP, uPA, B16BL6 We report here on the results of lung cancer metastasis evaluation.

The present invention solves the above-mentioned problems, and the object of the present invention is to provide a therapeutic agent that exhibits an anticancer effect without side effects.

1 is a diagram showing the B16BL6 melanoma cytotoxic effect of SAKT.

Figure 2 shows the inhibitory effect of SAKT subfraction on topoamizomerase I. Lane 1 is supercoiled DNA only, lane 2 is supercoiled DNA and 0.5 units of enzyme, lane 3 is supercoiled DNA and 0.5 units of enzyme and CAMPOTOTECIN, lane 4 is supercoiled DNA and 0.5 units of enzyme, SAKT 10ug / ml, lane 5 is supercoiled DNA and 0.5 units of enzyme and SAKT 100ug / ml, lane 6 is supercoiled DNA and 0.5 units of enzyme and SAKT 500ug / ml, lane 7 is supercoiled DNA and 0.5 Units of enzyme and SAKT 1 mg / ml were treated.

Figure 3 is a photograph showing the expression of mRNA in SK-mel-2 by SAKT. In the picture, 1 is a control, 2 is SAKT 10ug / ml, 3 is SAKT 100ug / ml, 4 is SAKT 500ug / ml, 5 is SAKT 1mg / ml.

Figure 4 is a figure quantifying the expression of mRNA in SK-mel-2 by SAKT.

Figure 5 shows the inhibition of BCE cell proliferation by SAKT.

Figure 6 is a photograph taken in vitro tube formation assay. In the photograph, A, B, C, D, and E are photographs treated with 0, 10 ug / ml, 100 ug / ml, 500 ug / ml, and 10 mg / ml SAKT concentrations, respectively.

Figure 7 shows the inhibitory effect of SAKT on lung metastasis of B16-BL6 cancer cells injected into C57BL / 6 microvenous veins.

8 is a lung photograph of B16-BL6 melanoma in C57BL / 6 mice.

9 shows the effect of SAKT on immune cells.

10 is a diagram showing the immune activity enhancing efficacy of SAKT.

In order to achieve the above object, the present invention is 3-13% by weight of halal bran, 3-13% by weight of baekrye-saulcho, 3-13% by weight of ginseng, 3-13% by weight of astragalus, 1-10% by weight of grenades, Baekjak 1-10% by weight, Haechocho 1-10% by weight, 1-10% by weight, 1-10% by weight of Baeksin, 1-10% by weight of longan, 1-10% by weight of Baekbokyeong, 0.5-8% by weight, dermis 0.5 -8% by weight, malt 0.5-8% by weight, creation 0.5-8% by weight, Chunma 0.5-8% by weight, 0.1-6% by weight, 0.1-6% by new country, 0.1-6% by weight of tavern, 0.1- 6% by weight, frankincense 0.1-6% by weight, myrrh 0.1-6% by weight, corydalis 0.1-6% by weight, excess 0.1-6% by weight, samsung 0.1-6% by weight, 0.1-6% by weight, health 0.1-6 It provides a composition having an anticancer and cancer metastasis inhibiting effect, including by weight, 0.1-6% by weight, and 0.5-8% by ginger. Less than the lower limit of the ingredient ratio of each drug, there is no anti-cancer effect, and in the range above the upper limit, side effects such as gastrointestinal disorder, headache, symptom, dry mouth and cardiac bug may occur.

In the present invention, the anticancer activity means cancer cytotoxicity or DNA topoisomerase I inhibition, apoptosis, DNA ladder assay, Annexin-V staining method, and cancer metastasis inhibitory effect, cell adhesion inhibition, cell penetration inhibition, and neovascularization. Inhibition, protease expression inhibition, lung metastasis inhibition.

Hereinafter, the present invention will be described in detail through non-limiting examples.

Among the reagents used in the present invention, RPMI 1640, fetal bovine serum (FBS), dulbecco's phosphate buffered saline, Hank balanced salt solution (HBSS), glycerol, bromophenol blue, tris base, Boric acid, agarose, sodium dodecyl sulfate (SDS), trypsin-EDTA, 3- [4,5-dimethyl-thiazol-2-yl] -2,5-diphenyl-tetrazoliumbromide (MTT), penicillin Streptomycin, sodium oxalate, frmaldehyde, lysophosphadiic acid, trypan blue, phenol red, sodium azide and isopropanol are sigma products, methgel is Collaborative Research product, hexane, ethyl acetate, butanol, ether is Merck Products, Sodium Bicarbonate is Gibco product, Acetic acid is Glicial product, DNA Topo isomerase I, pBR322 DNA is Takara product, Fertilized egg is Pulmuone yarn product, Intralipose is Green cross product, Tissue culture cover slip is Nunc company Each product was used

The instrument was a CO ₂ incubator (Vision Scientific Co., Model VS-9108 MS), cleanbench (Vision Scientific Co., KMC-14001), centrifuge (Beckman Co., GS-6R), inverted microscope (Nikon Co. , Japan), bright microscope (UFX-DX, Nikon), linear accelerator (Varian Co, USA), ELISA-reader (Emax, USA), FACScan (Becton dickinson, USA), rotary vacuum distiller (Buchi 461 ), Autocrab (Hirayama, Japan), micro-pipette (Gilson, USA), autosteel WG25 (Japan), titer plate shaker (Labline Inst., USA), culture flask (Falcon 3024), multiwell plate (96 -Well, Falcon), conical tube, disposable pipette (5ml, 10ml, 25ml, Falcon), camera (601S, Nikon), syringe filter (0.22 μm, Falcon) and the like were used.

Example 1 Preparation of the Compositions and Extracts of the Invention

1) Composition

The medicinal herbs used in the present invention were used by Soam Geodam Ikgi-tang (消 癌 去痰 益氣 湯, hereinafter referred to as "SAKT") purchased from the Oriental Medical Hospital affiliated with Kyung Hee University and selected, the composition of the prescription is shown in Table 1.

[Table 1] Composition of Soam Geodam Ikgi-tang (SAKT) prescription

Chinese medicine Herbal medicine name (生 藥 名) Capacity (g) Ring Protulacae Herba 20 Baekhwasasulcho (白花蛇舌草) Oldenlandiae diffusae Herba 20 Ginseng Ginseng radix 20 Astragalus Astragali radix 20 Jitantan Sanguisrbae radix 12 Earl Paeoniae radix 12 Haechocho Sepiae os 12 Shame Ostreae concha 12 Avenger Poria 12 Longan meat Longanae arillus 12 Baikyeongryeong Poria 12 Half Pinelliae Rhizoma 6 Dermis Citri pericapium 6 malt Hordei Fructus 6 Creation Atradylodis Rhizoma 6 Cheonma Gastrodiae Rhizoma 6 Whiteness Atradylodis Rhizoma 4 New kingdom Massa medicata fermentata 4 Taxi Alismatis Rhizoma 4 Oryeongji (五 靈脂) Trogopterorum Faeces 4 frankincense Olbanum 4 Myrrh Myrrha 4 Hyunho Color Corydalis tuber 4 Excess Tsaoko Fructus 4 Samnung Sparganii Rhizoma 4 Discharge Zedoariae Rhizoma 4 Health Zingiberis Rhizoma 2 Yellow Baek Phellodnedri Cortex One ginger Zingiberis Rhizoma 6 Total quantity 243

The composition of the present invention is 3-13% by weight of rye lotus, 3-13% by weight, white ginseng 3-13%, ginseng 3-13% by weight, grease 1-10% by weight, Baekjak 1 -10% by weight, Haechocho 1-10% by weight, 1-10% by weight, 1-10% by weight of Baeksin, 1-10% by weight of longan, 1-10% by weight of Baekbokyeong, 0.5-8% by weight, dermis 0.5- 8% by weight, malt 0.5-8% by weight, 0.5-8% by weight, 0.5-8% by weight, 0.1-6% by weight, 0.1-6% by new country, 0.1-6% by taxi, 0.1-6% % By weight, frankincense 0.1-6% by weight, myrrh 0.1-6% by weight, corydalis 0.1-6% by weight, excess 0.1-6% by weight, samsung 0.1-6% by weight, 0.1-6% by weight, health 0.1-6% by weight %, Yellowish white 0.1-6% by weight, ginger 0.5-8%.

2) Preparation of Water Extract

Each of 165.68 g of SAKT was put together with 2,000 ml of distilled water in a 3,000 ml round flask, attached with a cooler, heated for 2 hours, and the filtrate was concentrated under reduced pressure in a rotary vacuum distiller (Buchi 461). The mixture was left for 24 hours in a deep freezer (Sanyo, Japan) and lyophilized for 12 hours with a freeze dryer (Eyela, Japan) to obtain 52.5 g of a powder, which was used as a sample solution. In animal experiments, the solution was dissolved in physiological saline, and in cytotoxicity experiments, dissolved in RPMI 1640 free medium and filtered through a syringe filter (0.22 μm, Falcon).

Example 2: Cytotoxic effect test on B16BL6 melanoma cells

Cells used in the present invention are SK-MEL-2 (ATCC HTB 77), SK-OV-3 (ATCC HTB 77), B16-BL6 (ATCC CRC 6322) and A549 (ATCC CCL 185), BCE, ECV304 and the like. . The culture medium consisted of a bag of fisher`s powder (GIBCO) (1 l, 10.5 g), 100 ml of horse serum (GIBCO), 1.125 g of NAHCO ₃ , 100,000 units of penicillin, and 100 mg of streptomycin in tertiary distilled water. Cell A549 cells and melanoma cancer cell line B16-BL6 were packed with RPMI 1640 powder (GIBCO) containing l-glutamine in tertiary distilled water (1 l, 10.4 g), fetal bovine serum (FBS, Flow Laboatories inc., Mclean, VA) 100 ml, ₂ g of NAHCO ₃ and 100,000 units of penicillin, and 100 mg of streptomycin were dissolved, and the pH was adjusted to 7.2 with 0.1 N hydrochloric acid to make 1 l of the whole, followed by bacterial filtration. It was used, storing at (4-6 degreeC).

In addition, cytotoxicity was measured for the cytotoxicity of the SAKT water extract and KSRBS water extract solvent fraction using MTT. Cancer cells such as SK-OV-3, SK-MEL-2, HT1080, and A549 were incubated in DMEM, RPMI 1640 with 10% FBS, 5% CO ₂ , and 37 ° C. incubator. After incubating the cells for 48 hours, cells were separated from the culture vessel using trypsin-EDTA, harvested, and then divided into 96 well plates at 1 × 10 ⁴ cells / well. The divided cells were incubated for 24 hours in a CO ₂ incubator, attached to the bottom surface, discarded all the culture medium, and 100 μl of RPMI 1640 medium without FBS was dispensed and then treated with various concentrations of samples. However, the sample was filtered through a 0.22㎛ filter before addition to maintain the sterile state of the experiment and was treated by 3 wells for each concentration. After incubation with the drug for 24 hours, 20 μl of MTT (6 mg / ml) was added and incubated for 4 hours. The stained 96-well plates were washed well with tap water, then shaken and dried and the absorbance was measured at 540 nm using a microplate reader. The cytotoxicity of the test samples was determined as follows.

% Cytotoxicity = x 100 (%)

Here, the control group was determined as the absorbance at 540 nm of the wells in which only the growth medium was added instead of the test sample.

the results are as follow.

The effect of SAKT on cytotoxicity against B16-BL6 melanoma was investigated. The result was concentration-dependent cytotoxicity. However, the IC ₅₀ value is about 1,500 µg / ml, which is very high. In fact, the SAKT concentration in the in vivo condition is considered to be much lower, so there is no effective cytotoxicity.

Example 3: DNA Topoisomerase I Enzyme Inhibitory Effect

Topo-Izomerase I Relase Assay is an electrophoretic confirmation of the Rex form of the Plasmid DNA resulting from the activity of the Topo-Izomerase raises the DNA of the Rex form and the supercoiled form. This method is to measure the DNA topoisomerase I inhibitory effect by observing the difference in the development distance according to the molecular form of.

The DNA used in this experiment action Topo child's Murray Ⅰ from calf Im mousse (thymus), pBR 322 DNA Lee rekse Orientation to determine the topology child's Joe Murray Ⅰ inhibition IC ₅₀ values to be derived from E.coli C 600 Assays were conducted. Topo-I activity was measured by Liu and Miller's method. That is, 50mM MgCl ₂ , 0.5mM dithiothreitol, 5mM spermidine, 0.01% bovine serum album, 0.5µg pBR 322 DNA and enzyme (1 unit) were added to make the total reaction solution 20µl as a control. 20 µl of the total reaction solution was used as a test group, and these were incubated at 37 ° C for 30 minutes. The reaction was terminated by the addition of 5 μl of a solution containing 2% sodium dodecyl sulfate (SDS), 20% glycerol and 0.05% bromophenol blue, followed by TBE running buffer (50 mM Tris base, 50 mM boric acid, 2.5 mM). After electrophoresis on 1% agarose gel equilibrated with EDTA), the agarose gel was stained for 1 hour in 0.5 µg / ml ethidium bromide solution, photographed under UV light, and the active band was measured using a scanner. . One unit of Topo-I refers to the amount of enzyme that catalyzes 100% Rerex of supercoiled pBR 322 DNA when reacted for 30 minutes at 37 ° C.

the results are as follow.

Inhibition of topoisomerase I using pBR322 plasmid DNA and topoisomerase Ⅰ resulted in weak inhibition of topoisomerase at concentrations from 10 ug / ml to 1 mg / ml.

Example 4 Measurement of Metalloproteinase Expression by RT-PCR Method

In order for tumor cells to leave the site and metastasize to other organs, the process of breaking down and passing the cytoplasm is essential. At this time, the cells secrete protease that degrades the cytoplasm. By inhibiting such proteolytic enzymes can inhibit the metastasis of tumor cells. In order to measure the amount of such protein can be predicted by measuring the amount of RNA precursor protein. After harvesting cells treated with samples, RNA was isolated using a trizol reagent and quantified using a spectrometer. CDNA synthesis from the isolated total RNA was performed by PCR using 42 μl of M-MLV 200 U, 2 μl of dNTP mix, 40 units of RNase, 2 μg of sample, 1 μl of oligo (T) primer and DEPC-water, followed by PCR. CDNA was synthesize | combined under the conditions for 1 hour and 75 degreeC 30 minutes. The primers were prepared to measure metalloprotease MMP, TIMP, uPA from the synthesized cDNA.

TABLE 2 Primer sequences for measuring metalloprotease activity

primer Standing column MMP2 up 5 'ACCTGGATGCCGTCGTGGAC 3' MMP2 down 5 'TGTGGCAGCACCAGGGCAGC 3' TIMP1 up 5 'TGCACCTGTGTCCCACCCCACCCACAGACG 3' TIMP1 down 5 'GGCTATCTGGGACCGCAGGGACTGCCAGGT 3' TIMP2 up 5 'TGCAGCTGCTCCCCGGTGCAC 3' TIMP2 down 5 'TTATGGGTCCTCGATGTCGAG 3' uPA up 5 'CTGCCTGCCCTGGAACTCTG 3' uPA down 5 'CCTTGCGTGTTGGAGTTAAG 3'

PCR was performed to measure the amount of each gene expression. 0.125 μl of Taq polymerase, 2.5 μl of 10 × PCR buffer, 2 μl of dNTP, primed up, down, sample, 25 μl with distilled water, followed by 92 ° C. for 30 seconds, 58 ° C. (TIMP) -60 ° C. (MMP, GAPDH, uPA) 30 sec, 72 ° C. 1 min 30 sec. PCR was carried out for 30 times. PCR products were separated by electrophoresis in 1.5% agarose, observed under UV and quantified.

the results are as follow.

Total RNA was isolated from SAKT-treated cells to synthesize cDNA, and the expression levels of MMP2, TIMP1, TIMP2, and uPA were analyzed and quantified by PCR.

Several proteolytic enzymes are needed for cancer cells to break down cell epilepsy and to spread from the primary to other tissues. These degrading enzymes (MMP2, uPA) are in balance with other enzymes that inhibit it (TIMP1, TIMP2). SAKT treatment was performed on SK-Mel-2 cells, and the expression level of each gene was measured. In the case of 10 ug / ml, the inhibitory activity was about 60%. In the case of TIMP1, it showed a tendency to increase in contrast to MMP2 and showed an increase of about 60% at a concentration of 10 ug / ml. At concentrations above 100 ug / ml, an increase in the amount of MMP2 or uPA was observed. The amount of TIMP1,2 was similar to that of 10 ug / ml. This result suggests that SAKT is a crude extract, which results in an increase in MMP2 at high concentrations, which leads to an increase in MMP2, but effectively decreases MMP2 expression at low concentrations expected to act in vivo.

Example 5 Angiogenesis Inhibition

1) BCE Growth Assay

PBSDP dissolved 1.5% gelatin in a 24-well culture plate and stored in the refrigerator.

Before the experiment, the 24-well culture plate was left at room temperature, and when the gelatin was dissolved, the gelatin was removed and washed once with PBS.

Bovine Capillary Endothelial (BCE) cells were cultured in DMEM medium with 10% calf serum containing 3 ng / ml bFGF, and assayed BCE cells were suspended in DMEM medium with 10% calf serum at 2.5 × 10 μL / ml. . Put the cells 1.25 × 10500 / 500μl per well and incubate for 24 hours in 37 ℃, 5% CO₂ incubator. Subsequently, each sample is treated with 0.25 ml of 5% calf serum, and then incubated for 20 minutes. The final volume of 0.5 ml of DMEM medium with bFGF (1 ng / ml) and 5% calf serum calculated in each well's medium was incubated for 72 hours. Cells suspended in trypsin-EDTA (0.05% trypsin, 0.53 mM EDTA.4Na) were counted after trypan blue staining.

the results are as follow.

Bovine capillary endothelial (BCE) cell proliferation assays were performed in vitro to investigate the effects of SAKT on angiogenesis. As a result, it was observed that SAKT concentration-dependently inhibited the proliferation of BCE cells. In particular, the concentration of SAKT 500 ug / ml was more inhibited than BCE cell growth without bFGF treatment.

2) Tube Formation Assay

In the case of vascular endothelial cells in vitro , if a certain amount of conditions are matched to form a blood vessel, by inhibiting it can inhibit the proliferation of tumor cells. 200 μl of matrigel was dispensed into a 24-well plate and left at 37 ° C. for 30 minutes. After confirming that all Matrigel gelled, samples of various concentrations were diluted in 500 μl DMEM medium and dispensed into each well and left at 37 ° C. for 1 hour. After culturing ECV304 cells, a type of vascular endothelial cells, in DMEM medium, the cells were harvested, dispensed into 4 × 10 ⁴ cells / well in a plate treated with medicinal herbs, incubated for 10 hours in a 37 ° C cell incubator, and phased under a phase contrast microscope. Observed.

the results are as follow.

In vitro tube formation assays were performed to investigate the effects of SAKT on angiogenesis. As a result, it was observed that SAKT concentration-dependently inhibited tube formation. In particular, tube formation was completely inhibited at a concentration of 100 µg / ml or more.

Example 6: Inhibition of Lung Cancer Metastasis of B16-BL6

For lung coronization assay, B16-BL6 lung cancer cells passaged in vitro were used for the experiment. That is, these passaged cells were separated from the adherent surface with trypsin-EDTA solution for use in the experiment, and the cell suspension was prepared so that the cell number was 2 × 10 ⁴ cells / ml with HBSS solution. C18BL / 6 (18-20 g) was injected with 0.2 ml of cell suspension. The sample solution was orally administered using zonde daily for 10 days while dissolving 10 mg / 20 g / day sample in physiological saline once daily from 24 hours after transplanting B16-BL6 cancer cells. Cancer cells colonized after lung transplantation 21 days later and then opened to calculate lungs.

the results are as follow.

On day 14, the B16-BL6 melanoma carcinoma was injected into the vein and the number of colonies was 191 ± 71 in the control group, and 84 ± 21 in the SAKT 50 mg / mouse / 2 day group and 68 ± 14 in the SAKT 100 mg group. Lung metastasis inhibition effect was observed, and the inhibition rate was 56% and 65%, respectively. And no toxicity of SAKT to animals was observed.

Example 7: Immune Activity Enhancement Efficacy Experiment

1) Cyclophosphamide induced side effects and sample administration

ICR mice (male, 25 g) were used as experimental animals and cyclophosphamide 200mg / kg was injected subcutaneously to induce side effects of the mice. SAKT was used as an experimental group to induce the inhibitory activity of the anticancer drug side effects, and 50 mg, 10 mg and 2 mg were administered orally per mouse, respectively. Samples were administered 7 days, 5 days, 3 days 1 day prior to the administration of the anticancer agent, and the samples were administered on the 1st, 3rd, and 5th days, respectively, after the anticancer agent was administered, and the mice were sacrificed on the 6th day. In addition, in order to observe the activity on the mice by each sample, a sample alone group was made and each sample was administered only. As a control group, mice administered only with PBS in which samples were dissolved were used, and 10 mice were used in each group.

2) Effects on Liver and Renal Toxicity

Liver weight was measured from the mice used in the experiment after the end of the experiment, and the effect on the liver toxicity and nephrotoxicity was investigated using the separated blood. Hepatotoxicity was measured by blood GOT and GTP. GOT activity was measured using a reagent for measuring serum transaminase using Reitman-Frankel method (Iatron, Japan), and GPT activity was measured using a reagent for measuring serum transaminase using Reitman-Frankel method (Iatron, Japan). Renal toxicity was measured by the concentrations of BUN and CRE in the blood. Blood BUN content was measured by urease indophenol method and CRE content was measured by colorimetric method using Jaffe's response.

the results are as follow.

As a result, CPX showed abnormalities in the function of the kidneys, and the BUN level was higher than that of normal mice. In addition, SAKT alone administration of 50 mg to 2 mg of the drug control group did not show a significant difference compared to the normal group. In the SAKT and CPX-administered groups, BUN levels were significantly lower than those of CPX alone administration, as shown in the results. Therefore, SAKT was thought to have an inhibitory effect on the nephrotoxicity of CPX (Table 3).

TABLE 3 Effect of SAKT on APT, ALT, CRE and BUN in Serum Injected with CPX

kidney liver BUN CRE AST ALT normal 14.4 ± 1.5 0.4 ± 0.1 151 ± 35 59 ± 3 CPX 30.0 ± 2.8 0.5 ± 0.1 197 ± 12 42 ± 4 2mg SAKT 22.8 ± 1.1 0.4 ± 0.2 176 ± 18 47 ± 3 2mg SAKT + CPX 18.8 ± 1.6 0.5 ± 0.1 208 ± 25 49 ± 6 10mg SAKT 11.5 ± 0.5 0.4 ± 0.1 202 ± 27 48 ± 3 10mg SAKT + CPX 24.8 ± 3.1 0.5 ± 0.1 158 ± 19 48 ± 2 50mg SAKT 25.8 ± 2.1 0.5 ± 0.1 130 ± 18 53 ± 5 50mg SAKT + CPX 22.7 ± 2.7 0.5 ± 0.1 187 ± 22 58 ± 7

3) Lymphocyte proliferation assay

After completion of the experiment, the spleen was taken from the mice used in the experiment and weighed. After that, the spleen was crushed into mono cells and cultured with mitogen in vito to investigate the reactivity of splenocytes by mitogen. Briefly the experimentation was added to adjusted to 2 X 10 ^5/100 placed so that ㎕ Con-A and the final concentration of 5 ㎍ / ml of each Mai tojen LPS in each well of a 96 well plate for each group of splenocytes, and Incubated for 72 hours. Reactivity of each mitogen was determined by adding MTT solution 6 hours before the end of the culture, dissolving the formed forazan in DMSO solution and measuring the absorbance at 570 nm.

4) FACS analysis

After completion of the experiment, spleens are taken from the mice used in the experiment, and lymphocytes are sterilized sterilized using a homogenizer and fluorescent stained. In summary, fluorescence staining, the spleen leukocyte suspension was adjusted to 5 × 10 ⁶ cells / well in a FACS tube (Becton Dikinson, USA), followed by vortexing with 0.3 ml of staining buffer and centrifugation (1300 rpm, 5 min). For FACS analysis, add 100 μl of the primary antibody-FITC solution for each cell, vortex, and react on ice for 40 minutes. After completion of the reaction, washed three times with PBS, and analyzed by FACScan. Analysis of the results was carried out on the whole plot of splenocytes and small lymphocyte regions and lymphocytes on a dot plot using dual parameters of forward scatter (FSC) and side scatter (SSC). The last region is divided and the percentage of B cells, CD4 ⁺ , T cells, and Mac-1 ⁺ cells is calculated.

The results are as follows. FACS analysis was performed to measure the change of the splenocyte morphology by administration of SAKT. As a result, the B / T ratio of the normal group was 1.3, the SAKT 50 mg group was 1.99, the 10 mg group was 1.57, and the 2 mg group was 1.3. Therefore, the administration of SAKT mainly resulted in the activation of T-cells, the activity tended to be concentration-dependent, and the administration of 2 mg did not have a direct effect on the immune cells. In addition, the ratio of CD4 / CD8 was 2.02 in the normal control group, 1.15 in the 50 mg group, 1.45 in the 10 mg group, and 1.45 in the 2 mg group, and 1.9 in the 2 mg group. In the case of administration of 10 mg or more, the results mainly activate the cytotoxic T-lymphocytes of the CD8 type. Based on these results, SAKT examined the optimal concentration for activating immune cells in mice compared with lymphocyte results.

As another experiment, FACS analysis was performed using splenocytes after injection of each sample in the experiment of overcoming CPX side effects of SAKT. The B / T ratio of the normal group was 1.3, CPX (200 mg / kg) group was 2.28, SAKT 50 mg group was 1.83, 10 mg group was 1.29, 2 mg group was 1.27. Indicated. However, the proportion of T- and B-cells in the CPX-treated group was 12.04 and 27.48, the total ratio of both cells was 39.53%, and 35.88 and 46.8% of normal cells were 82.68%. And inducing significant damage to T-cells. The SAKT 50 mg treatment group was 22.02 and 40.34, totaling 62.36%. In addition, the total ratios of B- and T-cells of the 10 mg and 2 mg treatments were 68.82 and 60.74%, respectively, indicating that SAKT did not completely restore immune cells damaged by CPX, but partially recovered. Results with 10 mg administration showed the best activity.

As described in the above configuration, the composition of the present invention has excellent effects such as inhibiting lung cancer metastasis of B16-BL6, inhibiting angiogenesis essential for cancer growth and metastasis, and enhancing immune activity.

Claims (3)

3-13% by weight of halum, 3-13% by weight of white chlorosis, 3-13% by weight of ginseng, 3-13% by weight of astragalus, 1-10% by weight of petroleum grease, 1-10% by weight of Baekjak, 1-10% by weight of Haepyo %, Shaping 1-10% by weight, 1-10% by weight of Baeksin, 1-10% by weight of longan, 1-10% by weight of Baeknyeong, 0.5-8% by weight, dermis 0.5-8% by weight, malt 0.5-8% by weight , Creation 0.5-8% by weight, 0.5-8% by weight, 0.1-6% by weight, 0.1-6% by new country, 0.1-6% by weight, Tajik 0.1-6% by weight, frankincense 0.1-6% by weight, Myrrh 0.1-6% by weight, Corydalis 0.1-6% by weight, more than 0.1-6% by weight, Sanyo 0.1-6% by weight, 0.1-6% by weight, 0.1-6% by weight, 0.1-6% by white yellow, and Anti-cancer and cancer metastasis inhibiting composition comprising 0.5-8% ginger. The method of claim 1, The anticancer activity is a composition having an anticancer and cancer metastasis inhibiting effect, characterized in that the cancer cytotoxicity or DNA Topoisomerase I inhibition. The method of claim 1, The cancer metastasis inhibitory effect is anti-cancer and cancer metastasis inhibiting composition, characterized in that the cell adhesion inhibition, cell penetration inhibition, neovascularization inhibition, protease expression inhibition.