KR20010052076A - Expression of genes in hematopoietic stem cells in ischaemic conditions - Google Patents

Abstract

The present invention relates to modified hematopoietic stem cells (MHSC). The MHSC contains at least one specific nucleotide sequence (NOI) that can be expressed, each NOI being in practice associated with one or more ischaemia like response elements (ILREs).

Description

Expression of genes in hematopoietic stem cells in ischaemic conditions

〈110〉 Oxford Biomedica (UK) Limited

〈120〉 Expression of genes in hematopoietic stem cells in ischaemic cond

itions

<130> FP-1108

<150> GB 9720216.2

<151> 1997-09-23

<150> GB 9720465.5

<151> 1997-09-25

〈160〉 28

〈170〉 KOPATIN 1.5

〈210〉 1

<211> 26

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 1

gggccctacg tgctgtctca cacagc 26

〈210〉 2

<211> 37

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 2

acgctgagtg cgtgcgggac tcggagtacg tgacgga 37

〈210〉 3

<211> 28

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 3

cggacgtgct ggcgtggcac gtcctctc 28

〈210〉 4

<211> 242

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 4

ctagctgtca cgtcctgcac gacactagat gtcacgtcct gcacgacact agatgtcacg 60

tcctgcacga ctctagcccg ggctcgagat ctgcgatctg catctcaatt agtcagcaac 120

catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc 180

tccgccccat cgctgactaa ttttttttat ttatgcagag gccgaggccg cctcggcctc 240

tg 242

<210> 5

<211> 223

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 5

gatctgaggg ccggacgtgg ggccccagag cgacgctgag tgcgtgcggg actcggagta 60

cgtgacggag ccccggatct gcatctcaat tagtcagcaa ccatagtccc gcccctaact 120

ccgcccatcc cgcccctaac tccgcccagt tccgcccatt ctccgcccca tcgctgacta 180

atttttttta tttatgcaga ggccgaggcc gcctcggcct ctg 223

〈210〉 6

<211> 298

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 6

gatctgaggg ccggacgtgg ggccccagag cgacgctgag tgcgtgcggg actcggagta 60

cgtgacggag ccccggatct gagggccgga cgtggggccc cagagcgacg ctgagtgcgt 120

gcgggactcg gagtacgtga cggagccccg gatctgcatc tcaattagtc agcaaccata 180

gtcccgcccc taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg 240

ccccatcgct gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctg 298

〈210〉 7

<211> 267

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 7

gatctgccct acgtgctgtc tcacacagcc tggccctacg tgctgtctca cacagcctgg 60

atctgcccta cgtgctgtct cacacagcct ggccctacgt gctgtctcac acagcctggg 120

atctgcatct caattagtca gcaaccatag tcccgcccct aactccgccc atcccgcccc 180

taactccgcc cagttccgcc cattctccgc cccatcgctg actaattttt tttatttatg 240

cagaggccga ggccgcctcg gcctctg 267

<210> 8

<211> 204

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 8

gatctctaca cgtgggttcc cgcacgtccg ctgggctccc actctgacgt cagcgggatc 60

tgcatctcaa ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa 120

ctccgcccag ttccgcccat tctccgcccc atcgctgact aatttttttt atttatgcag 180

aggccgaggc cgcctcggcc tctg 204

〈210〉 9

<211> 259

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 9

gatctctaca cgtgggttcc cgcacgtccg ctgggctccc actctgacgt cagcggatct 60

ctacacgtgg gttcccgcac gtccgctggg ctcccactct gacgtcagcg ggatctgcat 120

ctcaattagt cagcaaccat agtcccgccc ctaactccgc ccatcccgcc cctaactccg 180

cccagttccg cccattctcc gccccatcgc tgactaattt tttttattta tgcagaggcc 240

gaggccgcct cggcctctg 259

<210> 10

<211> 245

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 10

gctagagtcg tgcaggacgt gacatctagt gtcgtgcagg acgtgacatc tagtgtcgtg 60

caggacgtga cagctagcat tccatcacgt ggcccgagag aagcatccgg agtactacaa 120

ggactgctga cagcgagatt tctacaaggg actttccgct ggggactttc cagggaggtg 180

tggcctgggc gggactgggg agtggcgagc cctcagatgc tgcatataag cagctgcttt 240

tgccc 245

<210> 11

<211> 269

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 11

gctagagtcg tgcaggacgt gacatctagt gtcgtgcagg acgtgacatc tagtgtcgtg 60

caggacgtga cagctagcat tccatcacgt ggcccgagag aagcatccgg agtactacaa 120

ggactgctga cagcgagatt tctacaaggg actttccgct ggggactttc cagggaggtg 180

tggcctgggc gggactgggg agtggcaagt gaaagtgaaa gtgaaagtga gagccctcag 240

atgctgcata taagcagctg cttttgccc 269

<210> 12

<211> 26

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 12

gggccctacg tgctgcctcg catggc 26

〈210〉 13

<211> 243

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

〈400〉 13

gctagagtcg tgcaggacgt gacatctagt gtcgtgcagg acgtgacatc tagtgtcgtg 60

caggacgtga cagctagccc gggctcgaga tctgcgatct gcatctcaat tagtcagcaa 120

ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 180

ctccgcccca tcgctgacta atttttttta tttatgcaga ggccgaggcc gcctcggcct 240

ctg 243

〈210〉 14

<211> 229

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 14

agctagccta gcgtcgtgca ggacgtgaca tctagtgtcg tgcaggacgt gacatctagt 60

gtcgtgcagg acgtgacatc tagagaacca tcagatgttt ccagggtgcc ccaaggacct 120

gaaatgaccc tgtgccttat ttgaactaac caatcagttc gcttctcgct tctgttcgcg 180

cgcttctgct ccccgagctc aataaaagag cccacaaccc ctcactcgg 229

<210> 15

<211> 225

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 15

aagctagctg tcacgtcctg cacgacacta gatgtcacgt cctgcacgac actagatgtc 60

acgtcctgca cgactctaga gaaccatcag atgtttccag ggtgccccaa ggacctgaaa 120

tgaccctgtg ccttatttga actaaccaat cagttcgctt ctcgcttctg ttcgcgcgct 180

tctgctcccc gagctcaata aaagagccca caacccctca ctcgg 225

<210> 16

<211> 136

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 16

agcttcctgc cccagactgc gacccctccc tcttgggttc aaggctttgt tttcttctta 60

aagacccaag atttccaaac tctgtggttg ccttgcctag ctaaaagggg aagaagagga 120

tcagcccaag gaggac 136

〈210〉 17

<211> 30

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

〈400〉 17

caagtgaaag tgaaagtgaa agtgagagcc 30

〈210〉 18

<211> 37

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

〈400〉 18

atcgctcgag ctgcagggcc gcactagagg aattcgc 37

〈210〉 19

<211> 36

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

〈400〉 19

ggttgtggcc catggtatca tcgtgttttt caaagg 36

<210> 20

<211> 24

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 20

cgcgtcgtgc aggacgtgac aaat 24

〈210〉 21

<211> 30

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 21

ccagcggacg tgcgggaacc cacgtgtagg 30

〈210〉 22

<211> 26

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 22

tccacaggcg tgccgtctga cacgca 26

<210> 23

<211> 35

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 23

ccacagtgca tacgtgggct ccaacaggtc ctctt 35

<210> 24

<211> 24

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 24

acagtgcata cgtgggcttc caca 24

<210> 25

<211> 19

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 25

actacgtgct gcctagggg 19

<210> 26

<211> 26

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 26

cccctcggac gtgactcgga ccacat 26

<210> 27

<211> 144

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 27

ctagctgtca cgtcctgcac gacactagat gtcacgtcct gcgacagtgc aggacgtgct 60

gtgatctaca gtgcaggacg aggacactag atgtcacgtc ctgcacgact tgctgtgatc 120

tacagtgcag gacgtgctga gatc 144

<210> 28

<211> 144

<212> DNA

〈213〉 Artificial Sequence

〈220〉

223 Description of Artificial Sequence: synthetic oligonucleotide

<400> 28

ctagctgtcc attcctgcac gacactagat gtccattcct gcgacaggta aggacgtgct 60

gtgatctaca ggtaaggacg acgacactag atgtccattc ctgcacgact tgctgtgatc 120

tacaggtaag gacgtgctga gatc 144

Gene transfer involves the delivery of target cells, such as HSCs, of expression cassettes linking one or more NOIs with sequences that regulate their expression. This can be done ex vivo in a procedure where the cassette can be transferred to the cells in the laboratory and the modified cells can be administered as a recipient. In addition, gene transfer can be effected in vivo by a procedure in which the expression cassette is directly transferred to cells in an individual. In this method, the transfer process is generally facilitated by a vector that helps to transport the cassette to the appropriate intracellular site.

The expression of the therapeutic gene at the target site can be regulated by factors of the promoter and enhancer. Promoters and enhancers consist of alignments of short DNA sequences that specifically interact with cellular proteins involved in transcription. Elements of promoters and enhancers have been separated from sources of eukaryotic organisms of various species, including yeasts, insects, mammalian cells and viruses. The choice of this unique promoter and enhancer depends on the cell type being used for the important expression of the protein / gene.

Promoters will function in various tissue types and in several other species of organs but their function may be limited in specific species and / or specific breakfasts. The promoter / enhancer may have a broad host range (such as SV40, human CMV) or it may function as a limited subset of cell types. More specifically, the promoter may be constitutively active or it may be in some substrate (e.g. tissue specific element), under certain conditions (e.g. hypoxia or presence of an enhancement element) or in an organism (e.g. fetus). May be selectively activated by any developmental stage of activity). Bone marrow is a typical source of HSCs for transformation, and recent studies have suggested that peripheral blood stem cells or cord blood cells may be similarly superior or superior to target cells (Cassel et al. 1993 Exp Hematol 21: 585-591; Bregni et al 1992 Blood 80: 1418-1422; Lu et al 1993 J Exp Med 178: 2089-2096).

More recently, potent stem cells have been obtained from cloned embryos by nuclear transfer from fetal bovine fibroblasts. Human embryonic stem cell lines may also be used, and the inventors are likely to be induced by differentiated cells that have treated specific diseases by gene therapy and / or transplantation to serve as an unlimited source of in vitro experiments. I think there will be.

Enrichment of pretransduction of HSCs, for example via positive selection with antibodies such as CD34 ⁺ or negative selection with lineage specific antibodies, has also been studied. Although it appears that there is not much impact on transduction efficiency, this will require much more practical volumes for ex vivo manipulation and transduction (Hughes et al 1992 ibid; Berenson et al. 1988 J Clin Invest 81: 951-955.

The low efficiency of HSCs metastasis may be due to lack of cell cycling and integration, or due to the lack of virus receptor density.

In an attempt to overcome this problem, viral vectors with specific positions have been used as targets in various stages. This may include (i) modifying a retroviral vector with an envelope protein; (Ii) use of promoters / enhancers for restriction of expression for specific positions; And (iii) supply of a vector with ligand specificity for a receptor on a target cell.

For example, recombinant retroviral vectors with the ability of target human cell expressing c-Kit receptors via ligand-receptor interactions were designed (Yajima et al 1998 Human Gen Ther 10: 779-787). The ecotropic (Moloney murine leukemia virus) envelope protein was modified by insertion of a sequence encoding the N-terminal 161 amino acid of the murine stem cell factor (mSCF). It was suggested that this vector could demonstrate its use for target cell expression c-Kit on the surface.

Furthermore, in the examples, other researchers have found that in vitro cancer cells can be selectively transduced by retroviral vectors displaying stem cell factors as part of the chimeric envelope glycoprotein, while HSCs are enveloped. It has been shown that it can be selectively transduced by retroviral vectors displaying epidermal growth fact (EGF) as part of the epidermis.

HSCs were also transduced with viral vectors associated with vesicular stomatitis G (VSV-G). According to PCT publication WO9609400, CD34 ⁺ Thy-1 + flowable blood cells are VSV-G pseudotyped retroviruses when compared to the transduction efficiency of CD34 ⁺ adult bone marrow cells and customary amphotropic vectors. It was introduced by the vector with surprisingly high efficiency.

Increased ability to detect individuals in populations with an increased risk of moderately differentiated cancers of genetic make-up may be prepared to prevent prophylaxis, especially for those at risk from these contractile diseases. It means that it is necessary. Means similar to individuals in genetically pre-disposed populations exposed to plasmodium parasites that cause coronary heart disease or rheumatoid arthritis or cerebral malaria, This means that it is necessary to prepare for the prevention of diseases, especially those at risk.

In particular, increased understanding of the molecular genetics of cancer has led to the development of a variety of new therapies for cancer. Gene-based therapies tested in current clinical trials are known to include: i) tumor suppressor gene replacement or inactivation of oncogenes, ii) activity or enhancement of anti-tumor immune mechanisms. Expression of cytokines / vaccines, iii) enhancement of drug sensitivity (eg transport or activity of pro-drugs), iii) drugs for bone marrow protection from high doses of chemotherapy Resistance and iii) inhibitors of tumor angiogenesis (Roth and Cristiano 1997 J Natl Cancer Inst 89:21; Jaggar and Bicknell R 1997 In: 'Tumour Angiogenesis' Eds.Bicknell, Lewis and Ferarra pp357-372.Oxford University Press , Oxford.UK), including ex vivo or in vivo experiments using liposomal vectors or viruses that transfer genes to tumors.

Until recently, the target of expression of specific therapeutic genes, such as solid tumors, was unclear. For example, recombinant viral vectors associated with therapeutic genes have targeted particular cell types by insertion of ligands / antibodies into viral capsids. This approach requires the expression of tumor-antigens (as well as tissues) which are specific antigens by malignant cells. However, some treatments limit their use in particular patient groups and tumor types that are shown to be expressed in selected tumor antigens. In either, naked or virus-integrated DNA can be injected directly into the tumor for maximal delivery of tumor location and specificity of expression. Although this approach may encounter limited outcomes for external tumors (eg lung or melanoma damage, etc.), will be able to trust the exact location of the tumor, tumor mass or secondary topical treatment or distant metastatic deposits DNA uptake by (metastatic deposits) may not be complete.

Recently, alternative approaches for tumor target therapeutic gene expression have been developed (Dachs et al 1997 Nature Med 5: 515). This abnormal physiological utility is present in almost all solid tumors and is used in tumor-specific conditions of strict ischemia, without considering their origin or location, which is any other gene that regulates the expression of the genes of the isoform. It appears to have an effect on the specific enhancer region of (Dachs et al 1997 ibid; British Patent Application No. 9701975.6).

Aggressive tumors usually grow faster than endothelial cells, which in part produce other blood vessels of the tumor cells, and thus insufficient blood supply because tissue is destroyed by the supply of partially formed blood vessels (Vaupel 1993 In 'Drug Resistance in Oncology' pp.53-85.Ed. Techer BA Marel Dekker, New York). Including all of these areas, ischemia and malnutrition, these results lead to both a decrease in oxygen pressure (hypoxia) and glucose. The oxygen electrode measurement of tumors shows an important rate of reading below 2.5 mmHg (normal tissue range is 24 to 66 mmHg). In addition, hypoxia cells were significantly less sensitive in radiotherapy and chemotherapy, which is probably due to increased levels of tumor hypoxia, correlated with reduced survival by the production of many cancers (Kallinowski 1996 ibid). ).

However, ischemia is usually characterized by a solid tumor that is unrelated to the cell origin or population of patients. It has recently shown the possibility of developing tumor hypoxia to selectively obtain expression of genes in tumors (Dachs 1997 ibid). Hypoxia is a potent regulator of gene expression in a range of different cell types in the wild (Wang and Sememnza 1993 Proc Natl Acad Sci USA 90: 4304) and hypoxia-induced hypoxia inducible factor (HIF-1). It is activated by the induction of the activity of transcription elements (Wang and Sememnza 1993 ibid) and binds to hypoxia-response elements (HREs) on various gene promoters, which are in situ DNA recognition sites. Dachs (1997 ibid) et al. Describe the use of rat phosphoglycerate kanase-1 for control of expression of therapeutic genes and labeling by human fibrosaecoma cells that respond to hypoxia in vitro and have solid tumors in vivo. Multiple bond formation of HRE from (phosphoglyserate kinase-1: PGK-1) gene was used. It is also true that labeled glucose deficiency is present in the ischemic region of tumors, and HRE can be used for the activity of heterologous gene expression specific for tumors. The truncated 632 base pair of the grp78 gene promoter, which is known to be specifically activated by glucose deficiency, indicates that expression of murine tumor receptor genes is possible at high levels in vivo (Gazit et al 1995 Cancer Res. 55). : 1660).

Ischemic damage may also occur in other tissues when the blood supply to the tissue is reduced or cut. Stroke, deep vein thrombosis, pulmonary embolus, and renal failure of the kidneys are examples of conditions that can cause damage. Cell death of cardiac tissue, known as myocardial infarction, is due to damage to many parts of the tissue by ischemia caused by ischemia and / or reperfusion. Circulating ischemia and reperfusion are typical results of oxidative damage to cells from reactive oxygen. The extent and type of damage are manifested by natural hypoxic stress and severity. For example, the stress may be due to tissue necrosis. Instead, stress may be caused by apoptosis (programmed cell death).

In pre-clinical studies, tumor cells infected with marker or therapeutic genes were used to show specific expression in tumors (See reviews by Dunbar and Eammons 1994 Stem cells 12: 563-576. Crystal 1995 Science 270: 404-410; Lee and Klein 1995 Transfusion Medicine II 9: 91-113). However, the problem of how to introduce this construct into solid tumors in vivo by the best treatment protocol remains.

The methods can be described as development cells in the immune system, which are macrophages as target media for solid tumors and therapeutic genes (UK Patent Application No. 9701975.6; UK Patent Application No. 9920952.3 number). Macrophages delivered from the bloodstream, white blood cells (monocytes) continue to enter the ischemic position of carcinomas, where they are clustered with solid tumors, creating insufficient blood vessels. In addition, the degree of ischemia-induced necrosis in tumors is clearly associated with intra-tumoral macrophage infiltration (Lewis 1997 Clin Exp Met 15:74).

Leukocytes and macrophages also invade ischemic damage, which is characteristic of other disease states, including cerebral malaria, coronary heart disease and rheumatoid arthritis.

On the other hand, leukocytes and specialized derivatives and macrophages have a relatively long lifespan than cells in vivo with associated defects using very limited proliferative potential.

Macrophages do not have the therapeutic genes introduced in the body long enough to provide prophylaxis through the subject's potential lifespan. However, some therapies that rely on gene transfer into these cells will inevitably inevitably persist in behavior limited by the lifespan of the receiving cells.

However, in the method, macrophages developed as a delivery medium for markers and therapeutic genes to solid tumors provide a method for feeding HSCs developed for delivery to NOIs sites, such as solid tumors characterized by ischemia such as hypoxia or low glucose concentrations. It may be described as need.

Furthermore, there is a need for the provision of vaccination for cancer and other related diseases characterized by ischemia such as hypoxia or low glucose concentrations.

The present invention relates to a method. More specifically, the present invention relates to a method for the delivery of a specific nucleotide sequence (NOI) to bone marrow stem cells (HSC).

The present invention also relates to the use of a vector for the delivery of important nucleotide sequences (NOIs) to hematopoietic stem cells (HSC).

Reference is made to the following figures.

1 shows the nucleotide sequence in response to hypoxia.

2 is a graphical representation of plasmid OB37. This plasmid contains the OBHRE promoter.

Figure 3 shows B-galactosidase expression in breast cancer cells transduced with Xia vector.

4A shows the synthetic hypoxia response promoter in combination with the SV40 promoter.

4B shows the relative strength of the synthetic hypoxia response promoter. Bars represent reporter gene activity levels. The numbers on the bar represent fold induction.

5 shows western blots. Protein extracts are prepared from primary human macrophages and human breast cancer T47D cells and analyzed by western blotting. Antibodies are monoclonal antibodies that are raised against purified HIF-1 and EPAS proteins. The upper panel shows the filter probed with EPAS antibody and the lower panel shows the filter probed with HIF-1 antibody.

6 shows OBHRE1 modulating hypoxia induction in macrophages.

Figure 7 shows the nucleotide sequence of XiaMac and synthetic hypoxic response macrophage specific promoter.

FIG. 8 shows hypoxia activation of reporter genes induced by the XiaMac promoter (labeled OBHREMAC) with respect to the CMV promoter in macrophages and breast cancer cell lines.

9 shows that HRE is critical for the hypoxia response of the XiaMac promoter. HRE is deleted from XiaMac (XiaMac-HRE) and no induction by hypoxia is observed.

FIG. 10 provides an overview of a method for regulating the hypoxia response promoter of the present invention through an autoregulator circuit comprising interferon gamma and IRE.

Figure 11 shows the nucleotide sequence of the XiaMacIRE sequence active in the presence of hypoxia and interferon gamma.

FIG. 12 graphically depicts a hypoxia-regulated lentiviral vector targeted to the vascular endothelium by an e-selectin or KDR promoter.

Figure 13 shows the sequences of WTPGK and MUTPGK.

14 graphically illustrates a pKAHRE structure.

FIG. 15A shows a schematic map of retroviral XiaGen-P450 containing a therapeutic gene under HRE regulation.

Figure 15b shows the induction analysis of XiaGen-P450 (Xia vector retrovirus) due to hypoxia. Cells darken when there is induction.

16A is a graphical representation of a plasmid map of pEGASUS.

16B graphically depicts a plasmid map of pONY2.1.

16C is a graphical representation of a plasmid map of pONYHRELucLac.

16D is a graphical representation of the plasmid map of pEGHRELacZ.

FIG. 17 is a graphical representation of pSecTSP-1 and pEGHRE-TSP1. FIG.

FIG. 18 is a graphical representation of a Pegasus vector expressing LacZ flaming on cells in culture. The cells are then placed in normoxia or hypoxia. Under hypoxia the reporter gene is expressed and thus the B-galactosidase enzyme is expressed such that the cells are counted. This gives the titre of the vector. This is 2 log higher under hypoxia, indicating that the reporter gene is preferentially active under these conditions.

19 shows hypoxia mediated activation of luciferase reporters in lentiviral vectors.

20A shows the hypoxia response EIAV vector arranged in a single transcription unit.

20B shows the hypoxia response autoregulation EIAV vectors arranged in a single transcription unit.

21 is a graphical representation of pE1sp1A and pJM17.

22 shows a scheme for assembling a recombinant adenoviral vector. Adeno PGKlacZ is an OBHRElacZ cassette inserted from OB37 into the Microbix delivery vector pE1sp1A.

FIG. 23 shows hypoxic induction (0.1%) from PGKLacZ Ad transformed Chiang Liver cells.

FIG. 24 shows hypoxic regulation of β-galactosidase gene expression in primary human macrophages transformed with AdHRE LacZ.

25A is a graphical representation of a plasmid map of pE1sp1A.

25B is a graphical representation of a plasmid map of pE1HREPG.

25C is a graphical representation of a plasmid map of pE1CMVPG.

26 is a graphical representation of a plasmid map of pE1RevE.

FIG. 27 graphically shows a plasmid map of pE1HORSE3.1.

28 is a graphical representation of a plasmid map of pE1PEGASUS4.

29 is a graphical representation of a plasmid map of pCI-Neo.

30 is a graphical representation of a plasmid map of pCI-Rab.

FIG. 31 graphically shows a plasmid map of pE1Rab.

32 shows a hypoxic response EIAV vector comprising two therapeutic genes.

33 is a schematic diagram.

34 is a schematic diagram.

In a first aspect of the invention, a modified hematopoietic stem cell (MHSC) consisting of each NOI is operatively associated with at least one expressed NOI or one or more ischemic like response elements (ILRE). To provide.

In a second aspect of the invention, the present invention provides an MHSC in combination with one or more agents capable of differentiating the MHSC.

In a third aspect of the present invention, there is provided a pharmaceutical composition comprising MHSC optionally mixed with a pharmaceutically acceptable diluent, excipient or carrier.

In a fourth aspect of the present invention, there is provided an MHSC which can be used as a drug according to the present invention.

In a fifth aspect of the invention, the present invention provides a method of expressing one or more NOIs in an ischemic environment comprising expression of one or more NOIs of MHSC in an ischemic environment.

In a sixth aspect of the present invention, there is provided the use of MHSC in the manufacture of a medicament for the treatment of conditions associated with ischemia caused by ischemia by the present invention.

In a seventh aspect of the present invention, a process of treatment in an individual in need thereof comprising the same administration of MHSC, or the expression of one or more NOIs with a pharmaceutical composition according to the present invention is enabled. To provide that.

In an eighth aspect of the invention, a modified cell prepared by modifying a cell by viral transduction with one or more viral vectors comprising at least one or more NOIs, the modified cell comprising a cell and an element activating the NOI To provide.

In a ninth aspect of the invention, there is provided a hybrid viral vector system for the delivery of genes in vivo, wherein the system consists of one or more primary viral vectors encoding secondary viral vectors, the primary vector or The vector capable of infecting the first target cell and the expression of the secondary virus therein, and the secondary vector can be transduced into the secondary target cell, wherein the primary viral vector and / or secondary viral vector are cell specific according to the present invention or the present invention. It includes the regulatory element ILRE.

In a tenth aspect of the present invention, there is provided a hybrid viral vector system, comprising a primary and / or retroviral vector, most preferably a lentiviral vector, based on or derived from an adenoviral vector. Is a secondary viral vector based on or derived from the primary viral vector and / or secondary viral vector comprising the ILRE of the invention or a cell specific regulatory element according to the invention.

In an eleventh aspect of the present invention, there is provided one or more novel vectors or constructs or promoters or regulatory elements described in detail herein.

In a twelfth aspect of the present invention, there is provided an adenovirus vector construct that shows low basal level activity in normal tissues but is strongly induced in ischemic conditions.

In a thirteenth aspect of the present invention, there is provided a lentiviral vector construct that shows low basal level activity in normal tissues but is strongly induced in ischemic conditions.

In a fourteenth aspect of the present invention, there is provided a combination or more of adenovirus and lentiviral vector constructs that exhibit low basal level activity in normal tissues but are strongly induced in ischemic conditions.

In a fifteenth aspect of the present invention, there is provided the use of an adenovirus vector to deliver ILRE, a regulated gene in different cell types for use in other diseases.

In a sixteenth aspect of the present invention, there is provided the use of a retroviral vector to deliver ILRE, a regulated gene in other cell types for use in other diseases.

In a seventeenth aspect of the present invention, there is provided a use by combining adenovirus and retroviral vectors to deliver ILRE, a regulated gene in different cell types, for use in other diseases.

Preferably this ILRE is used in conjunction with a transcriptional regulatory element (e.g., a promoter), which preferably exhibits activity in one or more selected cell types and preferably in only one cell type. It is activated.

Examples of non-limiting in the response elements are shown in OBHRE1 and Xiamac. Another example of non-limiting includes ILRE, which is used in common with the MLV and / or restricted tissue ischemic response promoter.

Preferably the ischemic response promoter is a limited tissue ischemic response promoter.

Preferably the ischemic response promoter of restricted tissue is a promoter specific for macrophages restricted by inhibition.

Preferably the ischemic response promoter restricted tissue is an epithelial cell specific promoter.

Preferably the vector is an ILRE regulatory retroviral vector.

Preferably the vector is an ILRE regulatory lentiviral vector.

Preferably the vector is an ILRE regulatory adenovirus vector.

Preferably the vector is an ILRE regulated hybrid adenovirus / lentiviral vector.

Preferably the vector is an autoregulated hypoxia reactive lentiviral vector.

The term "ischaemia like response element", ie, ILRE, includes elements that react or are activated under conditions of ischemia or under conditions induced by ischemia-like or ischemia. For example, conditions that are induced by ischemia-like or ischemia include hypoxia and / or low glucose concentrations.

Ischemia can inadequately supply blood to specific organs and tissues. The result of a reduced blood supply is an insufficient supply of oxygen to organs or tissues (hypoxia). Increased hypoxia may also result in damage to the organ or tissue at work.

Preferred ILRE is a hypoxia response element.

MHSCs of the invention are prepared by the use of viral vectors, which in turn may be delivered to HSCs by viral and / or non-viral means.

Examples of suitable agents capable of differentiating MHSC are cytokines and / or growth hormones. In this embodiment, the MHSC may be specialized in one or more other cell types.

In some applications a separate MHSC may be desirable that may already be delivered to the subject. MHSC can be separated by standard techniques such as filtration, centrifugation, micro-pipette and the like.

It is an advantage of the present invention to provide means and methods for use in the prophylaxis or treatment of conditions specified by ischemia, hypoxia or low glucose, such as, for example, cancer, cerebral malaria, ischemic heart disease or rheumatoid arthritis.

In one aspect, the present invention relates to the use of a delivery system to deliver NOIs to HSCs and in particular CD34 ⁺ HSCs.

In another aspect the present invention provides a general engineering method of HSC comprising at least one NOI, the method consisting of at least one NOI selected for the treatment or prevention of conditions characterized by ischemia, hypoxia or low glucose. Infection or transduction of the HSCs population of the resulting vector.

In another aspect, the present invention provides MHSCs produced by the above-described method by the present invention.

In another aspect, the present invention provides a suitable vector for the above-described method, which consists of having at least one NOI and / or at least one insertion position of NOI that can be inserted. Such vectors are suitable for delivering at least one NOI to the HSC.

In a further aspect, the present invention provides a medicament for the treatment or prevention of conditions specified by ischemia, hypoxia or low glucose comprising MHSC described in conjunction with a vector or optionally a carrier for pharmaceutical use. .

In a further aspect, the present invention provides a method for delivering at least one NOI from a treated individual to a population of HSCs, wherein the method is capable of infection or transduction of cells and infection and transduction that has been reintroduced back into the individual. It consists of cells in contact with those with detailed vectors of conditions.

Furthermore, the present invention provides a method for delivering at least one NOI to a population of HSCs of a treated individual, the method comprising administering to a subject a medicament interposed therein.

Moreover, the method of treating or preventing a mammalian cancer provided by the present invention, the method comprises an isolated population of cells enriched with HSCs from the treated individual, comprising at least one NOI under conditions capable of infection or transduction into the cells. The vector and the cells are connected to each other, and the cells are reintroduced into the resulting MHSCs and the differentiated products of the cultured MHSCs or individuals under appropriate conditions.

In accordance with the present invention, the NOI or NOIs may be any particular nucleotide sequence. For example, each sequence may be independent DNA or RNA, which may be prepared synthetically, prepared by the use of recombinant DNA techniques, or may be isolated from natural sources, or a combination thereof. This sequence may be a sense sequence or an antisense sequence. It may be a plurality of sequences which are directly or indirectly bound to each other or bound thereto.

In one preferred embodiment, the present invention is surprising for retroviral vectors for the modification of one or more HCSs with one or more NOI (s)-the modified MHSC (s) can be used in specific ways. Based on use.

In the context of the present invention, retroviral vectors may be derived or may be obtained from any suitable retrovirus. The following techniques will apply to the present invention.

In the background, retroviruses are RNA viruses that have a different life cycle from those that lytic cells. In this regard, retroviruses are infectious entities that are replicated through DNA mediators. When retroviruses were infected with cells, the genome was preserved in DNA form by reverse transcriptase enzyme. This DNA replication is supplied in prototypes for the viral encoded proteins necessary for the production of new RNA genomes and for the assembly of infectious viral particles.

Murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse mammary tumor virus (MMTV) Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moroniney murine leukemia virus (Mo-MLV), FBR murine sarcoma osteoblastic virus (FBR murine) asteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29: MC29) and avian erythroblastosis virus (AEV). A more detailed list of retroviruses can be found in Coffin et al. ("Retroviruses" 1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, He Varmous pp758-763).

Details of the genome structure of retroviruses may be found in the following description. For example, details of HIV may be found in the NCBI Genbank (i.e. Genome Accession No. AF033819).

In essence, all wild-type retroviruses contain three major coding domains: gag, pol, env, which encode essential virion proteins. Nevertheless, retroviruses will generally fall into two categories, "simple" and "complex". This category can be distinguished by the genome of the organism. A single retrovirus usually carries only basic information. In contrast, multiple retroviruses encode added regulatory proteins derived from multiple spliced messages.

Retroviruses can be further divided into seven groups. Five groups are retroviruses with oncogene potential. The remaining two groups are lentiviral and spumaviruses. An approximation to retroviruses is given in "Retroviruses" (1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, He Varmous pp 1-25).

Members of all oncogenes except the human T-cell leukemia virus-bovine leukemia virus (HTLV-BLV) group are simple retroviruses. HTLV, BLV, and rentviruses and spumaviruses are complex. Retroviruses, the best studied oncogenes, include the Lois sarcoma virus (RSV), mouse mammary tumor virus (MMTV), murine leukemia virus (MLV) and human T-cells. Human T-cell leukemia virus (HTLV).

Lentivirus groups can be further divided into "primate" and "non-primate". Examples of prime lentiviruses include agents that cause human acquired immunodeficiency (AIDS), human immunodeficiency virus and simian immunodeficiency virus (SIV). The non-primate lentiviral group includes goat arthritis-encephalitis virus (CAEV), acute infectious anaemia virus (EIAV) and the feline immunodeficiency virus described in more detail in recent years. includes the prototype "slow virus" visna / maedi virus (VMV) associated with immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV). .

In the distinction between the lentiviral family and other forms of retroviruses, lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al 1992 EMBO. J 11: 3053-3058; Lewis and Emerman 1994 J. Virol. 68: 510-516). In contrast, other retroviruses, such as, for example, MLVs, cannot infect non-dividing cells such as, for example, muscle, brain, lung, liver tissue, and the like.

During the infection process, retroviruses initially attack specific cell surface receptors. Retroviral RNA capable of entering the host cell is carried into the parent virus and replicated in the DNA by the viral reverse transcriptase.

This DNA is delivered to the nucleus of the host cell and later integrated into the host genome. The virus at this stage is described as a typical provirus. Proviruses are stable on the host's chromosome during cell division and are transcribed like other cellular proteins. Proviruses encode the packaging machinery they need to make proteins and more viruses and leave the cells by a process called "budding."

As already mentioned, each retroviral genome is composed of genes named gag, pol, and env that encode virion proteins and enzymes. In proviruses, the gene is located on either side of a region called long terminal repeats (LTRs). LTRs are involved in the integration and transcription of proviruses. It is also used as an enhancer-promoter sequence.

In another sense, LTRs can regulate the expression of viral genes. Encapsidation of retroviral RNAs is caused by the psi sequence located at the 5 'end of the viral genome.

LTRs themselves are identical sequences that can be divided into three elements named U3, R and U5. U3 can be derived from the unique sequence of the 3 'end of RNA. R can be derived from the repeated sequence at both ends of the RNA and U5 can be derived from the unique sequence at the 5 'end of the RNA. The size of the three elements can vary significantly among different retroviruses.

For ease of understanding, the genetic structure of DNA in the form of single, RNA and retroviral genomes is shown in FIG. 33, indicating the basic features of LTRs and the relative positions of gag, pol and env.

As shown in Figure 3, the basic molecular organization of the RNA genome of infectious retroviruses is (5 ') R-U5 gag, pol, env -U3 (3'). Defective retroviral vector genomes may lack gag, pol, and env or may be nonfunctional. The R region at both ends of the RNA has repeated sequences. U5 and U3 are shown as unique sequences at the 5 'and 3' ends of each RNA genome.

Reverse transcription of virion RNA into double stranded DNAs occurs in the cytoplasm and involves two jumps of reverse transcriptase from the 5 'end to the 3' end of the template molecule. The result of this jump is a copy of the sequences located at the 5 'and 3' ends of the virion RNA. This sequence is then fused in series at the ends of both virion DNAs forming long terminal repeats (LTRs) consisting of R, U5 and U3. In the completion of reverse transcription, viral DNA is translocated into the nucleus, where single-stranded replication of a retrovirus called the preintegration complex (PIC) is randomized with the help of virion integrase to form a stable provirus. Into the chromosomal DNA. The number of sites that can be integrated into the genome of a host cell is very large and widely distributed.

Regulating proviral transcription remains broad in the unencoded sequence of viral LTR. This transcription initiation site is at the interface of U3 and R on the left hand side (shown in front of the LTR) and the site of poly A is the interface of R and U5 on the right hand side (shown in front) of the LTR. Is in. U3 contains most of the transcriptional regulatory elements of proviruses, and in many cases, such as viral transcriptional activating proteins, contains promoters and multiple enhancer sequences that react in the cytoplasm. Some retroviruses have genes such as tat, rev, tax and rex that encode proteins that contain regulation of one or more gene expressions.

Transcriptional results of the proviral DNA were made from the full-length viral RNA genome and subgenomic-sized RNA molecules generated by RNA processing. Typically, all RNA products are supplied as templates for the production of viral proteins. RNA products are achieved by the association of RNA transcription splicing and ribosomal frameshifting during translation.

RNA splicing is a process that is eliminated by intervening or "intronic" RNA sequences, linking the remaining "exonic" to provide a continuous reading frame for translation. The process of doing that. Primary transcription of retroviral DNA is modified in several ways and closely resembles the mRNA of a cell. However, unlike most cell mRNAs where all introns are effectively spliced, newly synthesized retroviral RNAs fall into two groups. One population remains unspliced provided by genomic RNA and the other is spliced provided by subgenomic RNA.

The total length of the unspliced retroviral RNA transcript serves two functions: i) encoding the gag, pol gene products, and ii) they are packaged into progeny virion particles as genomic RNA. Sub-genome-sized RNA molecules provide mRNA for the remaining viral gene products. Transcripts of all spliced retroviruses carry the first exon, which is linked to the U5 region of the 5 'LTR. The last exon is always preserved in the region of U3 and R encoded by the 3 'LTR, even though the sizes vary. The composition of RNA structural residues depends on the splicing phenomena and the quantity of choice of selective splice sites.

In a single virus, one population of newly synthesized retroviral RNA remains unspliced for genomic RNA and mRNA for gag and pol. The other population is one that is fused and spliced in the genomic RNA 5 'portion of the downstream gene, typically env. Splicing uses a splice donor located upstream of the gag and a splice acceptor near the 3 'terminal of pol. The intron between the splice donor and the splice acceptor is removed by splicing and contains the gag and pol genes. This splicing phenomenon produces mRNA for envelope (EnV) proteins. Splice donors are typically upstream of gag, but for viruses such as ASLV, for example, refers to a few codons on the gag gene side and consequently contains a few amino-terminal amino acid residues along with gag. Create the primary EnV translation product. EnV proteins are synthesized in membrane-bound polyribosomes and transported by vesicular transport to cell membranes of cells, which are integrated into viral particles.

Complex retroviruses are produced not only by the env gene product but also by both single and multiple spliced transcripts encoding the regulatory and accessory proteins unique to the virus. Complex retroviruses, such as HIV, especially lentiviruses, are a prominent example of the complexity of selective splicing that can occur during retrovirus infection. In an example, currently known HIV-1 can produce more than 30 different mRNAs by sub-optimal splicing from primary genomic transcripts. This selection process has been shown to be regulated in the presence of mutations that can disrupt splicing patterns and disrupt competitive splice acceptors that can affect viral infectivity (Purcell and Martin 1993 J Virol. 67). : 6365-6378).

In the regulation of transcript levels, the relative proportions of full-length RNA and subgenomic-sized RNAs vary in infected cells, and regulation of transcription is a regulatory step that occurs during the stage of retroviral gene expression. For expression of retroviral genes, RNAs in both spliced and unspliced RNA must be transported into the cytoplasm and an appropriate proportion of spliced and unspliced RNA must be maintained for effective retroviral gene expression. will be. Other classes of retroviruses have developed a clear solution to this problem. Single retroviruses use full-length, spliced RNA in a simple manner to regulate cytoplasmic proportions by binding of useful splice sites or several cis-acting elements to their genome. Complex retroviruses are synthesized directly from two single and multiple spliced RNAs, e.g., other genomes and subgenomic-sized RNA that are protein products from one accessory gene, rev in HIV-1 and rex of HTLV-1. Adjust types and possible splicing and transport.

The structural genes of gag, pol and env itself, and a bit more in detail, encode the structural proteins inside the virus as to gag. Gag relates to the process of proteolysis of mature proteins MA (matrix), CA (capsid) and NC (nucleocapsid). The pol gene encodes a reverse transcriptase enzyme, which includes two DNA polymerases associated with RNase H activity and integrase (IN) and mediate the replication of the genome. The env gene encodes virion's surface glycoprotein (SU) glycoprotein and transmembrane (TM) protein, which interacts specifically with the receptor protein of the cell to form a complex. This interaction leads to the fusion of cell and viral membranes.

Env proteins are viral proteins that coat viral particles and play an important role in getting viruses into target cells. Envelope glycoprotein complexes of retroviruses have two polypeptides: hydrophilic polypeptide (SU) with external glycosyl groups and membrane-spanning protein (TM). In addition, they form oligomeric “knobs” and “knobbed spikes” on the virion surface. Both polypeptides are encoded by the env gene and synthesized in the form of polyprotein precursors and will be hydrolyzed while transported to the cell surface. Although undigested Env proteins can bind to receptors, the cleavage phenomenon is necessary for the activation of the binding capacity of the proteins required for the invasion of the virus into host cells. In general, SU and TM proteins are attached to glycosyl groups at multiple sites. However, for some viruses, such as MLV, TM is not attached to glycosyl groups.

Although SU and TM proteins are not essential for the assembly of enveloped virions, they play an essential role in the invasion process. At this time, the SU domain binds to a receptor molecule on a target cell, and often to a specific receptor molecule. This binding phenomenon is believed to activate membrane binding, including the potential of the TM protein, after viral and cell membrane fusion. For example, in viruses such as MLV, the removal of short fragments in the tail of the cytoplasm of TM through the cleavage phenomenon may play an important role in restoring the overall association activity of proteins (Brody et al 1994). J Virol 68: 4629-4627; Rein et al 1994 J Virol 68: 1773-1781). The "tail" of the cytoplasmic side at the end of the membrane-spanning fragment of the TM remains on the inner side of the end of the virus and varies in length in other retroviruses.

Therefore, the specificity of SU / receptor interactions limits host range and tissue flexibility of retroviruses. In some cases, this specificity limits the transduction capacity of the recombinant retroviral vector. Here, transduction involves the use of viral vectors to deliver genes other than viral genes to a target cell. For this reason, MLVs have been used in many gene therapy experiments. The MLV, which contains an envelope protein named 4070A, is known as an amphotropic virus and can infect human cells because of its phosphate transfer protein and envelope protein "docks," which are preserved in humans and mice. Can be. Such transporters exist everywhere and these viruses can infect several cell types. In some cases, however, it is beneficial to have limited target cells in terms of stability. Finally, some groups have created mouse ecotropic retroviruses that specifically infect specific human cells, unlike emporotic viruses that can also infect mouse cells. By replacing fragments of the Env protein with erythropoietin fragments, they specifically bind to human cells, resulting in recombinant retroviruses that display erythropoietin receptors on their surface like precursors of red blood cells (Maulik and Patel 1997 "). Molecular Biotechnology: Therapeutic Applications and Strategies "1997 Wiley-liss Inc. pp 45).

Substitution of the env gene by heterologous env genes is an example of a method or technique called pseudityping. Steotyping is not a new phenomenon and WO-A-98 / 05759, WO-A-98 / 05754, WO-A-97 / 17457, WO-A-96 / 09400, WO-A-91 / 00047 and Mebastsion et al 1997 Cell 90, 841-847.

In addition to gag, pol and env, complex retroviruses contain "accessory" genes that encode accessory or auxillary proteins. Adjunct or early stage proteins are proteins encoded by accessory genes in addition to those encoded by gag, pol and env, which are usually replication or structural genes. These accessory proteins differ from those involved in controlling gene expression, such as those encoded by tat, rev, tax and rex. Adjunct genes are vif, vpr, vpx, rpu and nef, with one or more of them. These accessory genes can be found, for example, in HIV (“Retrovirus” Ed. Coffin et al Pub. CSHL 1997 on pages 802 and 803). Non-essential accessory proteins will function in a particular cell type and will provide at least a partial function of replication provided by cytoplasmic proteins. In general, the accessory gene is located between pol and env, either downstream from the env containing the U3 region of the LTR or a portion overlapping with each env and others.

Complex retroviruses have developed regulatory mechanisms using encoded transcriptional activators as well as transcriptional factors of cells. These trans-acting viral proteins act as activators in RNA transcription that is processed by LTR. Transcriptional trans activity of lentiviral is encoded by the viral tat gene. Tat binds to a stable, stem-looped RNA secondary structure called TAR, which acts as an optimal external location for trans-activate transcription.

In general, retroviruses propose a delivery system (in other words, delivery vacuoles or delivery vectors) for delivery of one NOI, or a plurality of NOIs, inserted at one or more sites. Metastasis can occur in laboratory experiments, ex vivo experiments, in vivo experiments. Retroviruses when used in this manner are commonly referred to as retroviral vectors or recombinant retroviral vectors. Retroviral vectors have also been developed to study various aspects of the retroviral life cycle, including receptor usage, reverse transcription and RNA packaging (Miller, 1992 Curr Top Microiol Immunol 158: 1-24).

For recombinant retroviral vectors used for gene therapy, one or more of the gag, pol and env protein coding regions have been removed from the virus. This creates a replication defective state of the retroviral vector. The removed portion was replaced with a NOI to make a virus that could be inserted into the genome of the host, but the modified viral genome could not reproduce on its own because there was no structural protein. When inserted into the host genome, expression of NOI may, for example, benefit from therapeutic and / or diagnostic effects. Therefore, the transition of the NOI to a specific site is accomplished by the following method. The NOI is inserted into a recombinant retroviral vector or a modified viral vector is packaged into a virion coat or transduced into a specific site, such as a target cell or target cell population.

Isolation and propagation of quantities of retroviral vectors (to produce appropriate titres of retroviruses) for transduction to specific sites by packaging or by the associated use of helper cell lines and recombinant vectors. It is possible.

For example, propagation and isolation may involve isolation of the gag, pol and env genes of retroviruses and introduction into and separation of host cells to obtain a "packaging cell line". The packaging cell line makes the proteins needed to package the retroviral DNA, but because it lacks a psi region, it cannot cause encapsidation. However, recombinant vectors carrying NOI and psi regions are introduced into the packaging cell line, and helper proteins can package psi-positive recombinant vectors for the production of recombinant viral stock. It can be used to transduce cells so that they can introduce NOI into the cell genome. Recombinant viruses in the genome that lack the genes needed to make viral proteins can only be transfected once, but cannot multiply. These viral vectors that allow one to be transfected into the target cell are called replication defective vectors. Therefore, NOI can be inserted into the genome of a host / target cell that does not have a potentially harmful retrovirus generation. A summary of the available packaging cell lines is shown in "Retroviruses" (1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp449).

The design of retrovirus packaging cell lines has been undertaken to address the problem of spontaneous generation of helper viruses, which have often been encountered since the initial design. Recombination is facilitated by homology, thus reducing the problem of the production of helper viruses by reducing or eliminating homology between the vector and the helper genome. Recently, gag, pol, and env virus coding regions have been added to each expression plasmid to infect packaging cell lines independently, resulting in packaging cells in which three recombinations produce wild-type viruses. This approach could reduce the possibility of generating replication-competent viruses. This method is sometimes called the three plasmid infection method (Soneoka et al 1995 Nucl. Acids Res 23: 628-633).

Transient transfection can be used to measure vector production from the time the vector is made. Thus, transient transfection can reduce the long time required to produce robust vector producing cell lines, and will be used when vector or retroviral packaging components are harmful to the cell. Components used to make retroviral vectors include plasmids encoding Gag / Pol proteins, plasmids encoding Env proteins, and plasmids containing NOIs. One or more components are transiently transfected into cells that have other necessary components to produce a vector. If the vector encodes a gene or harmful gene that disrupts the division of the host cell, such as a gene that causes cell cycle inhibitors or apoptosis, it is difficult to build a robust vector-producing cell line, but it does produce the vector before the cell dies. Transient transfection can be used to make this possible. Cell lines have also been developed by using transient infections to produce vector titer concentration levels comparable to those obtained in robust vector producing cell lines (Pear et al 1993, Proc Natl Acad Sci 90: 8392-8396).

From the point of view of the toxicity of HIV proteins, it is difficult to make robust HIV-based packaging cells, but HIV vectors are usually produced through transient transfection of vectors and helper viruses. Some researchers have altered the HIV Env protein from that of vesicular stomatis virus (VSV). Incorporation of the Env protein into VSV raises the optimal concentration of HIV / VSV-G vector produced by transient transfection to the same concentration as 5 x 10 ⁵ (10 ⁸ after concentration) (Naldini et al 1996 Science 272: 263-267). Therefore, transient transfection of HIV vectors provides a useful method for making vectors with high concentration concentrations (Yee et al 1994 PNAS. 91: 9564-9568).

Given the optimal concentration of the vector, the practical use of the retroviral vector is to provide a suitable concentration of transduced particles (no more than 10 ⁸ particles per milliliter) and to concentrate and purely isolate the virus that can be achieved in in vitro culture. The sensitivity of many developed viruses by existing biochemical and physicochemical techniques has been very limited.

For example, several methods have been developed for concentrating retroviral vectors, using centrifugation (Fekete and Cepko 1993 Mol Cell Biol 13: 2604-2613), hollow fiber filtration (Paul et al 1993). Hum Gene Ther 4: 609-615) and tangential flow filtration (kotani et al 1994 Hum Gene Ther 5: 19-28). Although the titration level of virus has reached a 20-fold increase, the relative weakness of the retrovirus Env protein limits its ability to concentrate the retroviral vector, and generally concentrated viruses rarely recover infectious virions. This problem can be overcome by replacing the more robust VSV-G protein and the retrovirus Env protein, as well as achieving better yields and having more effective vector concentrations, whereas the VSV-G protein can be overcome by cells. Has the drawback of being very harmful.

The optimal concentration of helper virus free vectors available through the currently available vectors is 10 ⁷ cfu / ml, but experiments can be carried out with much lower titration vector stocks. However, for practical reasons, high titers of viruses should be used to infect large numbers of cells. In addition, high titer concentrations are required for high percentage transduction of particular cell types. For example, the frequency of infection of human hematopoietic progenitor cells depends on the titration of the vector, and the frequency of infection also occurs only at high titration stocks (Hock and Miller 1986 Nature 320: 275-277; Hogge and Humphries 1987 Blood 69: 611-617). In these cases, it is not enough to put a larger volume of virus than cells to correct for low virus titer concentrations. Conversely, in some cases, the concentration of infectious vector virions may play an important role in promoting efficient transduction.

The researchers have tried to create high titer vectors for use in gene transfer. For example, it is possible to determine the factors necessary to produce a virus with a high titer compared to other vectors. Early studies of other retroviral vector designs have shown that almost all MLV's internal protein coding regions have been removed without the vector's ability to infect (Miller et al 1983 Proc Natl Acad Sci 80: 4709-4713). These initial vectors simply have a small portion of the 3 'end of the env coding region. Subsequent studies show that all of the env gene coding sequence is removed but the appropriate concentration of the vector is not reduced (Miller and Rosman 1989 Biotechnique 7: 980-990; Morgenstern and Land 1990 Nucleic Acids Res 18: 3587-3596). Contains fragments required for plus and minus strand DNA priming and regions for viral RNA to selectively package virions (psi site; Mann et al 1983 Cell 33: 153-159) The short region connecting the LTR and LTR of the virus has been considered essential for vector delivery. Nevertheless, the virus titer obtained through these initial vectors was still about 10 times lower than the parental helper virus titer.

The retention of the sequence at the 5 'end of the gag gene increases the optimal concentration of the viral vector, which has been found experimentally because of the increased packaging of viral RNA into virions (Armentano et al 1987 J Virol 61: 1647-1650; Bender et al 1987 J Virol 61: 1639-1646; Adam and Miller 1988 J Virol 62: 3802-3806). This effect is not due to viral protein synthesis from the gag region of the vector. This is because rupturing the gag reading frame or transforming the gag codon into a stop codon did not affect the proper concentration of the vector (Bender et al 1987 ibid). Experiments have demonstrated that the sequences required for efficient packaging of genomic RNA in MLVs are larger than the psi signals identified through deletion analysis (Mann et al 1983 ibid). To obtain high titers (greater than 10 ⁶ to 10 ⁷ ), it is important to include a larger signal called psi plus in the retroviral vector. It is now demonstrated that these signals are downstream of the gag start codon upstream of the splice donor (Bender et al 1987 ibid). Because of this position, this signal is absent in spliced env expression transcription. This demonstrates that only full length transcriptions containing three essential genes are packaged during the viral life cycle.

In addition to preparing retroviral vectors in terms of increasing the appropriate concentration of the vector, the retroviral vectors are designed to induce the production of specific NOIs (commonly called marker proteins) in transduced cells. As already mentioned, one of the most common retroviral vectors is to replace one or more NOI and retroviral sequences to make them a replication defective vector. The simplest method is to use a promoter in the 5 'LTR of the retrovirus to regulate the expression of the cDNA encoding NOI or to alter the enhancer and promoter of the LTR to confer tissue-specific expression or induction.

Another method is to express one coding region by using an internal promoter to make it weaker when selecting a promoter.

This strategy to express specific genes has been most readily used when NOI is the selection marker, and for hypoxanthine-guanine phosphoribosyl transferase (hprt) (Miller et al 1983 Proc Natl Acad). Sci 80: 4709-4713) facilitates the selection of the transfected cells. If the vector has a NOI rather than a selection marker, the vector can be inserted into the packaging cell by co-transfection with the selection marker in the assay plasmid. Such methods may be beneficial for gene therapy in that a single protein is expressed in the final target cell and avoids the virulence potential or antigenic potential of the selection marker. However, if the inserted genes are not selected, this approach has the drawback that it is much more difficult to produce cells that produce high titers of vector stock. Also, in general, it is much more difficult to determine the optimal concentration of the vector.

Three common methods are used to create retroviral vectors that express two or more proteins. These methods include iii) expressing different proteins from spliced mRNA transcribed from one promoter, ii) using promoters and internal promoters in the 5 'LTR to proceed with transcription of another cDNA, and iii) open. The use of an internal ribosomal entry site (IRES) element of internal ribosomes that enables translation of multiple coding regions from a single mRNA or associated protein that can be expressed from an open reading frame.

Vectors containing internal promoters have been used primarily to express complex genes. Internal promoters utilize a linker of a promoter and an enhancer different from the viral LTR to progress gene expression. Multiple internal promoters can be included in retroviral vectors, allowing expression of three different cDNAs from their promoters (Overell et al 1988 Mol Cell Biol 8: 1803-1808).

A large number of vectors have been developed based on various members of the Retroviride subfamily of Retrovirides, and there are also a number of patent applications (PCT / GB97 / 02857; PCT / US96 / 15406). The simplest vector constructed from HIV-1 has the complete HIV genome, excluding deletions in parts of the env coding region or replacement of nef coding regions (Richardson, JH, Child, LA & Lever, AM (1993) J Virol 67). , 3997-4005., Buchschacher, GL, Jr. & Panganiban, AT (1992) J Virol 66,2731-9, JH, Kaye, JF, Child, LA & Lever, AM (1995) J Virol 69, 6588-92 , Carroll, R., Lin, JT, Dacquel, EJ, Mosca, JD, Burke, DS & St Louis, DC (1994) J Virol 68,6047-54) Many promoter / receptor cassettes are inserted into the ADDIN ENRf8 position (Page, KA, Landau, NR & Littman, DR (1990) J Virol 64, 5270-6., Shimada, T. Fujii, H., Mitsuya, H. & Nienhuis, AW (1991) J Clin Invest 88, 1043-76, 7). Clearly, vector expression gag / pol and all accessory genes are later required for the production of infectious viral particles. Adjunct genes of vif, vpr, vpu, and nef are not essential, but suggest that subgene expression occurs at an appropriate concentration of action (Fan, L. & Peden, K. (1992) Virology 190, 19-29, Gabuzda , DH, Lever, A., terwilliger, E. & Sodroski, J. (1992) J Virol 66, 3306-15, Schubert U., Clouse, KA & Strebel, K. (1995) J Virol 69, 7699-711 , Miller, MD, Warmerdam, MT, Gaston, I., Greene, WC & Feinberg, MB (1994) J Exp Med 179, 101-13 Zufferey, R., Nagy, D., Mandel, RJ, Naldini, L. & Trono, (1997) Nature Biotechnology 15, 871-875, Takahashi, K., Wesselingh, SL, Griffin, DE, McArthur, JC Johnson, RT & Glass, JD (1996) Ann. Neurol. 39,705-711). In addition, more recently, vectors have been described as valid for almost all or a few lacking adjunct factors (Poeschla, E., Corbeau, P. & Wong-Staal, F. (1996) Proc Natl Acad Sci USA 93, 11395). Naldini, L., Blomer, U., Gage, FH, Trono, D. & Verma, IM (1996) Proc Natl Acad Sci USA 93, 11382-8. Naldini, L., Blomer, U., Gallay , P., Ory, D., Mulligan, R., Gage, FH, Verma, IM & Trono, D. (1996) Science 272,263-7, Blomer, U., Naldini, L., Kafri, T., Trono , D., Verma, I. & Gage, F. (1997) Journal of Virology 71,6641-6649, Kim, VN, Mitrophanous, K., Kingsman, SM and Kingsman, AJ 1998. J. Virol., 72,811- 816).

Common formats for HIV-1 5'LTR and lentiviral, the leader, are the receptor response gag coding region sequence (to provide packaging functionality) and the rev response element (RRE) and 3'LTR. The function of enclosing these gag / pol vectors with adjunct gene products is either by a single plasmid or two or more coated plasmids, or by coinfection of a vector comprising a cell with HIV. Was provided.

HIV-based vectors in the U3 region of the 5'LTR that were changed to include two copies of the tax response element (TRE) capable of transactivation by the tax protein of HTLV-1 were used for transactivation. It suggests use for the treatment of grown T-cell leukemia / lymphoma (Lin, H., C., Bodkin, M., Lal, RB & Rabson, AB (1995) J Virol 69 , 7216-25). Vectors are constructed that can be expressed using constitutive promoters such as CMV (eg Kim et al 1998 ibid). Recently, lentiviral vector configurations have also been refined. Self-inactive HIV vectors have been produced lacking HIV LTR with limited expression by internal cassettes (Myoshi et al 1998 J. Virol 72,8150).

Cofection of target cells with HIV occurs in vectors that can spread through the culture of vector HIV permissive cells. This main cause has been used for the development of vectors for treatment or for the restriction of HIV-1 infection (Dropulic, B., hermankova, M. & Pitha, PM (1996) Proc Natl Acad Sci USA 93, 11103-8., Kim, JH, McLinden, RJ, Mosca, JD, Vahey, MT, Greene, WC & Redfield, RR (1996) J Acquir Immune Defic Syndr Hum Retrovirol 12,343-51, Poeschla et al 1996 PNAS 93,11395).

Many studies have described the use of HIV-based vectors for gene transfer into non-dividing cells (eg, retina, Myoshi et al 1997, PNAS 94, 10319-23., Neurons, Blomer et al 1997 J). Virol 71,6641, Blomer et al 1998 95, 2603, liver, muscle, Kafri et al Nature Genetics 1997 17,314). Other lentiviral vectors include EIAV (GB 9727135.7), FIV (Poeschla et al 1998, Nature Medicine, 4,354) and Maedi-Visna (International Application No.:PCT/GB95/00663. Priority Date: December 9/1995) On March 24, it was developed with examples of Packaging-Deficient Lentiviruses Lever, AML, Harrison, GP, Hunter, E).

The transfer of retroviral genes to murine HSCs, a common sense, is already known (Williams et al Nature 1984 310: 476-479). That is, expression of the full-length multidrug resistance (MDRL) cDNA gene of murine HSCs has been shown to be resistant to various anticancer drugs. Similarly, murine hematopoietic progenitor cells in bone marrow or peripheral blood cells have been shown to protect against the toxicity of anticancer chemotherapy by retroviral transduction of MDRI genes (Lichi et al 1995 Cytokines Mol Ther 1 : 11-20). Consistent human hematopoiesis in immunodeficient mice is either in vitro composed of neomycin phosphotransferase gene (neo) or human glucocerebrosidase cDNA (in human glucicerebrosidase cDNA). In vitro), a recombinant retroviral vector has been described by cotransplantation of a CD34 ⁺ progenitor transduced (Nolta et al 1994 Blood 83: 3041-3051). Murine HSCs were transduced with retroviral vectors containing two genes, the receptor (LacZ) and the selective marker (neo). LacZ expression was observed in PBL, which is a recipe (Asami et al 1996 Eur J Haematol 57: 278-285).

In vivo rat studies have shown that pretreatment of donors of 5 'fluorouracil prior mice obtained from bone marrow involves cycling of primitive cells and increased susceptibility to retroviral infection and integration. This indicates that the efficiency of transduction can be improved. Co-culture of retroviral producer cell lines with the use of self-targeted target cells and cell lines capable of producing at least 10 ⁵ virus particles per ml also improved efficiency (Bodine et al 1991 Exp Hematol 19). : 206-212). Successful transduction into long term re-populating cells results in a substantial resorption of 1-50% of the stable multiple hematopoietic lineage or any substantive response of cells carrying further proviral genomes. In the mice (Fraser et al 1990 Blood 76: 1071-1076).

Retroviral gene transfer to human HSCs, which is usually sense, is already known. In addition, committed human pros, such as bursts formed in units-erythroid (BFU-E) or colonies formed in units-granulocyte macrophage (CFU-GM). Zener cells have very high efficiencies in the presence of combinations of various growth factors such as, for example, IL-3, Il-6 and stem cell factor (SCF) or in the presence of primary bone marrow stroma or retroviral producer cell lines ( Often over 50%) and transduced by retroviruses (Nolta et al 1990 Hum Gen Ther 1: 257-268; Moore et al 1992 Blood 79: 1393-1399; Cournoyer et al 1991 Hum Gen Ther 2: 203 -213).

The presence of specific extracellular matrix components, for example fibronectin, will be of some importance (Moritz et al J Clin Invest 1994: 1451-1457). In addition, primitive human long-term culture initiating cells (LTC-IC) were transduced with equal efficiency under similar transduction conditions (Moore et al 1992 ibid; Hughes et al 1989 Blood 74: 1915 -1922; Hughes et al 1992 J Clin Invest 89: 1817-1824). High levels of expression of the human tumor antigen, the epithelial mucin of human dendritic cells, were achieved by transduction of retroviruses of cytokines induced by differentiation from CD34 ⁺ progenitor cells and their subsequent DCs (Henderson et al 1996 Cancer Res 56: 3763-3770).

Despite known general techniques, retroviral systems have been used to transfer genes to HSCS, and in previous known techniques specific to one or more NOIs of the invention used for modification to one or more HSCs It did not teach or suggest how.

In accordance with the present invention, suitable NOI sequences include therapeutic and / or glycemic-phase applications and include, for example, cytokine coding sequences, chemokines, hormones, immunoglobulin-like molecules made of antibodies, single Chain antibodies, fusion proteins, enzymes, immune co-stimulatory molecules, immunological molecules, anti-sense RNA, transdominant negative mutations of target proteins, toxicity, potential toxicity, antibodies, tumor suppression Not limited by purple protein and growth factors, membrane proteins, proteins and peptides that act on blood vessels, anti-viral proteins and ribosomes, and derivatives thereof (such as those associated with receptor groups). Inclusion as a coding sequence will generally be linked to a promoter that drives the expression of ribosomes, such as a suitable suitable promoter, or to another promoter or promoter, for example in one or more specific cell types.

Suitable NOIs for use in the invention for treatment or prevention of cancer include proteins encoding NOIs, which include tumor suppressors (such as wild-type p53), active agents of anti-tumor immune mechanisms (eg cytokines, co-stimulators) (co-stimulatory molecules and ibunoglobulins), act as inhibitors of angiogenesis and destroy target cells (e.g., the toxicity of ribosomes), or they are indirectly targeted by effector cells in nature. Stimulating cell destruction (eg strong antibodies to stimulate the immune system) or converting to precursor substrates for toxic substrates to destroy target cells (eg prodrugs that activate enzymes). To enhance drug sensitivity (eg prodrug activating enzymes).

The encoded protein can destroy bystander tumor cells (e.g., toxic fusion proteins of selected anti-tumor antibody-ribosomes), can indirectly stimulate the destruction of bystander tumor cells (e.g. immune It can also be through alteration of cytokines or procoagulant proteins that cause local vesicle occlusion to stimulate the system, or by changing the precursor substrate to the toxic lipids of bystander tumor cell destruction (eg For example, enzymes for activation of prodrugs on the drug to be spread).

In addition, delivery of NOI (s) encoding ribosomal or antisense transcription products may result in cell persistence for tumor persistence (eg, to myc in Burkitts' lymphoma, or to bcr-abl in chronic myeloid leukemia). It interferes with the expression of my genes. The use of such a combination of NOIs has also been observed.

Alternatively or as selectively expressed in the target tissue, the NOI or NOIs may have a meaningless or harmless effect until the pro-drug active enzyme or individual has been treated with one or more enzymes or pro-drugs that act as enzymes. It can also encode an enzyme with In the presence of active NOIs, treatment of the subject with appropriate pro-drugs leads to enhanced reduction of tumor growth or survival.

Pro-drug activating enzymes can also lead to tumor sites for cancer treatment. In each case, a suitable pro-drug will be used for the treatment of the patient with a combination of suitable pro-drug activating enzymes. Appropriate pro-drugs will be administered in combination with the vector. Examples of pro-drugs include the following: Etoposide phosphate (alkaline phosphatase): Senter et al 1988 Proc Natl Acad Sci 85: 4842-4846, 5-fluorocytosine (cytosine deaminase) Having: Mullen et al 1994 Cancer Res 54: 1503-1506), Doxorubicin-Np-hydrophemoxyacetamide (which has penicillin-V-amidase): Kerr et al 1990 Cancer Immunother 31: 202-206), para-N-bis (2-chloroethyl) aminobenzoyl glutamate: with carboxypeptidase G2 Cephalosporin nitrogen mustard carbamates (with β-lactamase), SR4233 (P450 redducase), Ganciclovir (which is HSV Tyl) With thymidine kinase: Borrelli et al 1988 Proc Natl Acad Sci 85: 7572-7576), mustard pro-drugs with nitroreductase (Friedlos et al 1997 J Med Chem 40: 1270-1275) and cyclophosphamide (Cyclophosphamide: with P450: Chen et al 1997 Cancer Res 56: 1331-1340).

Examples of suitable pro-drug activating enzymes for use in the present invention include the following: thymidine phosphorylase that activates 5-fluoro-uracil pro-drug capcetabine And thymidine kinases from Herpes Simplex Virus, which activates furtulon, liver cislovir, and cytos, which activate pro-drugs such as cislophosphamine, as a drug that destroys DNA. Chromium P450 and cytosine deaminase to activate 5-fluorocytosine. More preferably, human origin enzymes were used.

Suitable NOIs to be used for the treatment or prevention of ischemic heart disease include NOIs encoding plasminogen activators. Suitable NOIs for the treatment or prevention of rheumatoid arthritis or cerebral malaria include anti-inflammatory proteins, antibodies that directly resist tumor necrosis factor (TNF) alpha, and anti-adhesion molecules: For example, a gene encoding an antibody molecule or a receptor specific for an adhesion protein).

Examples of modifiable therapeutic NOIs for hypoxia can be found in PCT / GB95 / 00322 (WO-A-9521927).

Expression products encoded by NOIs can be proteins secreted from cells. Moreover, NOI expression products are activated in the cell rather than secreted. In this phenomenon, it is preferred for NOI expression products to account for a bystander effector or a definite bystander effect, which is related cells that induce death, or the surrounding or separate (eg metastatic). ), A product usually expressed and produced in one cell with a phenotype.

The vector contains one or more cytokine-encoding NOIs that govern the secondary differentiation of MHSCs comprising the vector. Suitable cytokines and growth factors include, but are not limited to: It is ApoE, Apo-SAA, BDNF, Cardiotrophin-1, EGF, ENA-78, eotaxin, eotaxin-2, exodus-2, FGF-exi Acidic, FGF-basic, fibroblast growth factor-10 (Marshall 1998 Nature Biotechnology 16: 129), FLT3 ligand (Kimura et al 1997), glactaline (Fractalkine: CX3C), GDNF, G-CSF , GM-CSD, GF-β1, Insulin, IFN-γ, IGF-I, IGF-II, IL-1α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7 , IL-8 (72 aa), IL-8 (77 aa), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL -17, IL-18 (IGIF), inhibin α, inhibin β, IP-10, keratinocyte growth factor-2 (KGF-2), KGF, leptin ), LIF, lymphotactin, mullerian inhibitor substrate, monosite colony inhibition factor, monosite attractant protein (Marshall 1998 ibid), M-CSF, MDC (67 aa), MDC ( 69 aa), MCP-1 (MCAF), MCP-2, MCP-3, MCP-4, MIG, MIP-1α, MIP-1β, MIP-3α, MIP-3β, MIP-4, Maier Myeloid progenitor inhibitor factor-1 (MPIF-1), NAP-2, neurturin, nerve growth factor, β-NGF, NT-3, NT-4, on costin Oncostatin M, PDGF-AA, PDGF-AB, PDGF-BB, PF-4, RANTES, SDF1α, SDF1β, SCF, SCGF, Stem Cell Factor (SCF), TARC, TGF-α, TGF-β, TGF -β2, TGF-β3, Tumor Necrosis Factor (TNF), TNF-α, TNF-β, TNIL-1, TPO, VEGF, GCP-2, GRO / MGSA, GRO-β, GRO-γ, HCCI-I -1309 and so on.

In some applications, combinations of such cytokinins comprising IL-3, IL-6 and SCF would be desirable, particularly for maintenance and increase in stem cell populations. Furthermore, in vitro differentiation, cytokinin can be added to GM-CSF and M-SCF to induce differentiation of macrophages or GM-CSF and G-CSF to obtain neutrophils. During the re-introduction of each of the cells produced as induced, the tissue's own mechanism then causes the cells or their differentiated results to migrate to the affected area, such as a tumor.

One or more NOIs may be fused. In other words, the NOI coding sequence may encode a fusion protein or fragment of a coding sequence. For example, pIXY321 is a genetically engineered fusion protein of GM-CSF and IL-3 (Bhalla et al 1995 Leukemia 11: 1854-1856) that has biological effects in maternal cytokinin and preclinical studies in vitro (Vadhan Raj et al 1995 Blood 86: 2098-2105.

Optionally, the other NOI may be a suicide gene, which is a disruptive expression of cells transfected or transduced with exogenous components. Examples of suicide genes include the herpes-simple virus thymidine kinase gene (HSVtk) that can kill infected and bystander cells following treatment with liver cislovir (Robbins et al. al Tibtech 1998 16: 35-40).

Optionally other NOIs can be target proteins, such as antibodies of stem cell element receptors (WO9217505, WO9221766). For example, an ecotropic retrovirus that displays antibodies to receptors present in HSCs (eg CD34 or stem cell elements) is caused by intravenous migration of unclassified bone marrow or virus in culture with the virus. It can be used to move target cells to these cells ex vivo.

Ligands and antibodies include, for example, monoclonal antibody c-SF-25 (Takahashi et al 1993 Science 259: 1460), which targets 125 kD antigens of human lung cancer; Antigens for various lung cancer antibodies (Souhami 1992 Thorax 47: 53-56); Antigen against human ovarian cancer antigen 14C1 (Gallagher et al 1991 Br J Cancer 64: 35-40); Antibodies against H / Lev / lLeb antigens targeting lung cancer (Masayuki et al 1992 N Eng J Med 327: 14-18); Nerve growth factor targeting nerve growth factor receptors in neuronal tumors (Chao et al 1986 Science 232: 518); Fc receptor for target macrophages (Anderson and Lis 1989 Science 246: 227); Collagen type I targeting colon cancer (Pullam and Bodmer 1992 Nature 356: 529); Interleukin-I targeting the Interleukin-I receptor of T Ses (Fanslow et al 1990 Science 248: 739); Acetylated low density lipoprotein (LDL) targeting the macrophage clearance receptor (and atherosclerotic plaques; Brown et al 1983 Ann Rev Biochem 52: 223-261); Other acetylated molecules that likewise target macrophage depletion receptors (Paulinski et al PNAS 86: 1372-1376); Virus receptors (Haywood 1994 J Virol 68 (1): 1-5); Transferrin targeting the transferrin receptor in tumor cells (Hueber et al 1987 Physio Rev 67: 520-582); Basoendothelial growth factor (vegF) targeting cells with increased vascularization; And urokinase plasminogen activator receptors (UPARs).

Instead, ligands may be used in recombinant techniques (Scott and Smith 1990 Science 249: 386; Devlin et al 1990 Science 249: 404; Houghten et al 1991 Nature 354: 84; Matthews and Wells 1993 Science 260: 1113; Nisim et al 1994 EMBO J 13 (3) 692-698) or a substantial technique using an organic component library.

In addition to the therapeutic gene or genes and expression control elements described, the vector may be an effective or modulator of a gene or genes, including a promoter / enhancer, a translation start signal, an internal ribosomal central site (IRES), a splicing and polyadenylation signal. May contain additional genetic elements for the expressed expression.

NOIs or NOIs may regulate the expression of expression control elements that are generally promoters or promoters and enhancers. Enhancers and / or promoters are preferentially activated in hypoxia or ischemia or low glucose environments, and NOI is preferentially expressed in certain tissues of interest, such as in the context of tumors, arthritis joints or other sites of ischemia. Therefore, any significant biological or detrimental effect of NOI in the individual treated can be reduced or enhanced. Enhancer components or other components that give controlled expression can be present in multiple copies. Alternatively, furthermore, enhancers and / or promoters may preferentially be activated in one or more specific cell types, such as macrophages, endothelial cells or combinations thereof. Examples further include late-mitotic and finally differentiated non-dividing cells such as respiratory tract epithelial cells, hepatocytes, muscle cells, cardiomyocytes, synoviocytes, primary mammary epithelial cells and macrophage neurons.

The term "promoter" is used in general science as an RNA polymerase binding site, for example in Jacob-Monod theory of gene expression.

The term "enhancer" includes a DNA sequence that binds to other protein components of a transcription start complex and facilitates transcription start directed by a promoter associated therewith.

Promoters and enhancers of transcription units encoding secondary vectors can be strongly activated and strongly induced in primary target cells under conditions for the generation of secondary viral vectors. Promoters and / or enhancers may be effective to construct, may be tissue, or may be temporarily limited in their activity. Suitable tissues of restricted promoters / enhancers are, for example, those that are highly active in tumor cells such as promoters / enhancers from the MUC1 gene, CEA gene or 5T4 antigen gene. Examples of temporarily limited promoters / enhancers are those that respond to hypoxia such as ischemia and / or hypoxia response components or promoters / enhancers of the grp78 or grp94 genes. Alpha fetoprotein (AFP) promoters are also tumor-specific promoters. One preferred promoter-enhancer combination is the human cytomegalovirus (hCMV) major immediate early (MIE) promoter / enhancer combination.

Preferably the present promoters are tissue specific. That is, one tissue can induce transcription of NOI or NOI (s) and in other tissue types most remain "silent."

The term "tissue specific" is not limited in activity in a single tissue type, but appears to be selective as it can be activated in one group of tissues and less active and less active in another group. A feature of the preferred promoters of the present invention is that they have low activity in the absence of activated hypoxia-regulated enhancer elements even in target tissues. The way to do this is to use a "silencer" that inhibits the activity of the selected promoter in the absence of hypoxia.

The expression level of NOI or NOIs under the control of a specific promoter can be controlled by manipulating the promoter region. For example, other domains within the promoter may have various gene regulatory activities. In general, the role of these various regions is specified using vector preparations with various variants of the promoter with specific regions deleted (ie deletion analysis). This method can be used, for example, to identify minimal areas that can give tissue characterization or hypoxia sensitivity.

As described above, many tissue specific promoters may be particularly advantageous to practice the present invention. In most cases, the promoters can be isolated as restriction digestion fragments suitable and convenient for cloning in the selected vector. Instead, promoter fragments can be isolated using polymerase chain reaction. Clones of amplified fragments can be easily made by binding restriction sites at the 5 'end of the primer.

Suitable promoters for cardiac-specific expression include murine cardiac α-myosin heavy chain (MHC) genes. Suitable vascular endothelium-specific promoters include the Et-1 promoter and the von WILLERBRAND elemental promoter.

Prostate specific promoters include the human glandular kallilrein-1 (hKLK2) gene and prostate specific antigen (hKLK3).

Examples of cell specific promoters / enhancers include elements of macrophage-specific promoters or enhancers or mannose receptor gene promoter-enhancers such as the CSF-1 promoter-enhancer (Rouleux et al 1994 Exp Cell Res 214: 113-119 ). Instead, lymphocyte specific enhancers such as promoters or enhancer elements or IL2 gene enhancers that are primarily active in Neutrofil can be used.

As described above, the present invention is a surprising result that can modify one or more HSCs and enable specific purposes.

As background information, monocytes and their differentiated derivatives, macrophages, are derived from reservoirs of embryonic cells called HSCs that can generate a variety of unique cell types. In mammals, HSCs are expressed in the liver, spleen and bone marrow of the fetus but are usually only found in the bone marrow after birth and after growth. HSCs differentiate into various cell lines in the presence of lysed cell cytokinin and microenvironmental factors such as cell-to-cell interactions.

Four major cell lineages arise from HSCs. This is the lymphocytes; Of megakaryocytes; Bone marrow (granulocytes and mononuclear phagocytes); And lymphocytes. In particular, the bone marrow and lymphocyte series are important for the function of the immune system.

Myeloid development begins in the liver of a human fetus about 6 weeks after pregnancy. Studies that colonies grow in vitro from each stem cell indicate that the first parent cells derived from HSCs are colony generating units (CFUs) capable of generating granulocytes, erythrocytes, monocytes, and megakaryocytes (CFU-GEMM). Seemed.

Maturation of these cells occurs under the linkage of various named tissue specific protein regulators including growth factors, cytokinin and interleukin. In general, there are no functional or structural features that differentiate the growth factors of the various classes. Most elements appear to be able to stimulate multiple biological responses that are critically dependent on the differentiation state of their target cells. For example, one of the haemopoietic growth factor, granulocyte colony stimulating element (G-CSF), stimulates proliferation of immature bone marrow cells as well as bacterial killing by mature Neutrophils. Erythropoietin (EPO) and thrombopoietin (TPO) are structurally similar to cytokinin and sustain proliferation and differentiation for erythrocyte and megakaryocyte families as well as primitive progenitor abnormalities (Gotoh et al 1997). Ann Hematol 75; 207-213). TPO binds to Mpl receptors that are members of the hematopoietic receptor family and initiates its biological effects (Broudy et al 1997 Blood 89: 1896-1904). HOXB4 appears to be an important regulator at very early, but not late hematopoietic cell proliferation (Sauvageau et al 1995 Genes Dev 9: 1753-1765). Kit ligand proteins (Kls) act as ligands for the transmembrane tyrosine kinase receptor C-kit and stimulate mast cells and erythroid progenitors (91EP-810609). Interleukins capable of activating HSCs include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6 and IL-12 (Molecular biology and Biotechnology Ed RA Meyers 1995 VCH Publishers Inc p 392-397).

Regulators important for the positive regulation of haemopoiesis are derived from stromal cells, mainly in the bone marrow, and are also produced in the mature form of differentiated bone marrow or lymphocytes. There are many good outcome growth factor combinations that are used only in combinations of IL-3 and IL-6 with or without other elements such as active stem cell elements (SCF) in primitive cells with the best results (Bodine et al 1989 Proc). Natl Acad Sci 86: 8897-8901; Luskey et al 1992 Blood 80: 396-402; Fraser et al 1990 76: 1071-1076). Other cytokinins may decrease the regulation of haemopoiesis.

CFU-GM cells are precursors of both Neutrophil and Protein Phagocytes. CFU-GM differentiates along the Neutrophil pathway and exhibits several unique morphological steps. Myocytes develop into promyelocytes and myelocytes, mature and circulate and are released into Neutrofil. Differentiation of mature Neutrophil cells from CFU-GM is probably the result of the capture of specific growth / differentiation factor receptors at various stages of development.

Surface differentiation markers may or may not appear on the cell surface when developing into granulocytes. For example, MHC class II molecules and CD38 are expressed only in CFU-GM, not mature Neutrophils. Other surface molecules obtained during the differentiation process are CD13, CD14, CD15, β ₁ integrin, VLA-4, β ₂ integrins, CD11a, b and c associated with the CD18 β ₂ chain, complement receptors and CD16 Fcγ with a small distribution. Contains receptor

CFU-GMs taking the mononuclear cell pathway initially proliferate into monoblasts. It differentiates into pro monocytes and finally into mature circulating monocytes. Circulating monocytes are thought to be replacement pools for tissue-residual macrophages. Many forms of macrophages include the reticuloendothelial system.

Like mature Neutrophils, mature monocytes and macrophages lose CD34. However, unlike Neutrofil, MHC class II molecules continue to express significant levels. These molecules are certainly important for the presence of antigens on T cells. Monocytes also capture many surface molecules, such as mature Neutrophils.

In addition to macrophages, most of the typical antigen-existing cells (APCs), including follicular dentritic cells, Langerhans' cells and interdigitatin cells, are present at birth. While their origin is still uncertain, most will be derived from myeloid stem cells. One possibility is that they are derived from the same CFU-GEMM precursor cells. Morphological, cytochemical and functional differences may then be due to local microenvironmental effects such as cytokinins. Instead, APCs can be derived from a variety of stem cells and exhibit distinct lines of differentiation.

In the first stage of differentiation into colony forming cells (CFU-GEMM), HSCs express CD33 and CD34. Thus, HSCs are generally characterized by the presence of cellular glycoprotein CD34 (possibly CD33) at the cell surface.

In the next stage of differentiation into erythrocytes, bone marrow monocytes and megakaryocytes, a significant increase in forming erythroid unit-erythrocytes (BFUE) cells migrates antigens CD33 and CD34, and these antigens just disappear in late division. The megakaryocyte family, including CFU-GEMM cells, carries CD33 rather than CD34, which disappears sequentially. The megakaryocyte family leads to CFU megacells carrying CD34, which initially disappears sequentially.

A more important system of antigens in HSCs and other cells is the MHC (major histocompatibility complex) class II group. Most HSCs carry an antigen called DR and express an antigen called DP during differentiation and then further to an antigen called DQ. Therefore, MHC class DR antigens are characterized as relatively early stem cells.

Methods for the maintenance and differentiation of HSCs during isolation and incubation are known and are known from 91/09938 (Santiago-Schwartz et al 1992 J Leuk Biol 52: 274-281; Charbord et al 1996 Br J Haematol 94: 449-454; Dao et al 1997 Blood 89; 446-456; Piacibello et al 1997 Blood 89: 2644-26532. Methods of transducing retroviral mediated HSCs and transferring them to patients have also been described (Dunbar et al 1996 Hum Gene Ther 7: 231-253).

The HSCs prepared in the invention are prescribed in patients or individuals at risk with a suitable prescription. Formulations include isotonic saline solutions, either buffered saline solutions or tissue-culture medium. Cells are administered to the tumor or bone marrow site in 10 ² cells / dose, for example at a concentration of approximately 10 ⁶ , either directly or in a ring or intravenous infusion.

Each is treated with a lack of stem cell bone marrow or with one or more cytokinins such as G-CSF to increase the migration of the first stem cells to peripheral blood or to promote regeneration of the bone marrow. Combinations of such treatments are possible. In addition, the treatments of the invention can now be usefully combined for anticancer treatment.

If the vector used to enhance stem cells encodes a pro-drug activating enzyme, those suffering from cancer are additionally treated with the corresponding pro-drug and according to known and known principles It is prescribed using the appropriate method.

As described above, the present invention is based on the surprising discovery that in particular it is possible to modify IRLE and one or more HSCs with specific purposes.

Preferred IRLE is a hypoxic reaction component.

High expression of therapeutic genes under hypoxic conditions can be induced in the presence of one or more hypoxic response enhancer (HRE) elements. HRE elements comprise a polynucleotide sequence located upstream (5 ') or downstream (3') of a promoter and / or therapeutic gene. In general, HRE enhancer element (HREE) is a cis-active component of about 10-300 bp in length and acts on a promoter that increases the transcription of the gene under the control of the promoter. Preferably, the promoter and enhancer elements are selected such that expression of the gene regulated by these elements is minimal in oxygen supply and upregulated in hypoxic or oxygen deficient conditions.

The term "hypoxia" means a condition in which a particular organ or tissue receives an inadequate oxygen supply.

Hypoxia response components also include, for example, erythropoietin HRE urea (HREE1), muscle paruvate kinase (RKM), HRE urea, B-enolase (enolase 3; ENO3) HRE urea, endoserine-1 (ET-1) ) HRE element and metallothionein II (MTII) HRE elements.

Further examples of hypoxia regulatory enhancers are binding elements for the transcription factor HIF-1 (Dachs et al 1997 Nature Ned 5: 515; Wang and Sememnza 1993 Proc Natl Acad Sci USA 90: 4304; Firth et al 1994 Proc Natl Acad Sci USA 91; 6496). Hypoxic response enhancer elements are also known to be associated with a number of genes, including the erythropoietin (EPO) gene (Madam et al 1993 Proc Natl Acad Sci 90: 3928; Semenza and Wang 1992 Mol Cell Biol 1992 12: 5447-54554). Other HREEs include the muscle glycolytic enzyme paruvate kinase (PKM) gene (Takenaka et al 1989 J Biol Chem 264: 2363-2367), human muscle-specific B-enolase (ENO3; Peshavaria and Day 1991 Biochem J 275). : 427-433) gene and endoselin-1 (ET-1) gene (Inoue et al 1989 J Biol Chem 264: 14954-14959).

Instead, expression of the therapeutic gene can be regulated by glucose concentration.

For example, glucose-regulating proteins such as grp 78 and grp 94 are highly conserved proteins known to be induced by glucose deficiency (Attenello and Lee 1984 Science 226: 187-190). The grp 78 gene is expressed at low levels in most normal healthy tissues under the influence of baseline promoter elements, but has at least two ideally "stress-inducible regulatory elements" upstream of TATA (Attenello 1984 ibid; Gazit et al. 1995 Cancer Res 55; 1660-1663). Addition of the truncated 632 base pair sequence at the 5 'end of the grp 78 promoter enables induction of glucose deficiency of the receptor gene in vitro (Gazit et al 1995 ibid). In addition, the sequences of the promoters in retroviral vectors were able to induce high levels of receptor expression in tumor cells, murine fibrosarcomas, especially at relatively central ischemia / fibrotic sites (Gazit et al 1995 ibid).

The present invention is believed to be applicable to a wide range of treatments, in particular depending on the selection of one or more NOIs.

For example, the present invention will be useful for the treatment of the disorders described in WO-A-98 / 05635. A portion of the list that is referenced is as follows: cancer, inflammatory or inflammatory disease, skin disorders, fever, cardiovascular symptoms, hemorrhage, coagulation and act phase reactions, cassia, anorexia, acute infection, HIV infection Shock conditions, graft and host reactions, autoimmune diseases, reperfusion damage, meningitis, migraine and aspirin pendant anti thrombosis; Tumor growth, invasion and spread, angiogenesis, metastasis, malangent, ascites and outflow of maligand pleura; Cerebral ischemia, ischemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, complex sclerosis, neurodigenesis, Alzheimer's Digiz, atherosclerosis, seizures, vasculitis, Crohn's digits and ulcerative colitis; Periodontitis, gingivitis; Psoriasis, atopic dermatitis, chronic ulcers, epidermolysis vulosa; Conil Assessment, Retinopathy and Surgical Wound Healing; Rhinitis, allergic conjunctivitis, eczema, anaphylaxis; Restenosis, congestive heart failure, endometritis, atherosclerosis or endoclerosis.

For example, the present invention will be useful for the treatment of the disorders described in WO-A-98 / 07859. A portion of the list in reference is as follows: cytokines and cell division and differentiation activity; The activity of immunosuppressants or immunostimulators in treating immune deficiencies, including, for example, infection of human immunodeficiency virus; Lymphocyte growth regulation; When treating cancer and autoimmune diseases and when inhibiting the rejection of transplants or inducing tumor immunity; Regulation of hematopoiesis, eg, when treating myeloid or lymphoid digits; Bone, cartilage, tendon, ligament, when promoting the growth of nerve tissue, for example when treating healing wounds, burns, ulcers, periodontal digits and neurodigenation; Inhibit or promote the release of polyclonal stimulating hormones that regulate fertility; Chemotactic / chemokine activity, for example when moving a particular cell type to an injury or infection site; For example, hemostatic and thrombolytic activities when treating hemophilia and seizures; Anti-inflammatory activity, for example when treating septic shock or Crohn's digits; As an antibiotic; Modulators of metabolism or reactions, for example; As analgesic; When treating unusual deficiency disorders; When treating human or livestock drugs or psoriasis.

For example, the present invention will be useful for the treatment of the disorders described in WO-A-98 / 09985. A portion of that list in reference is as follows: macrophages and T cell inhibitory activity and anti-inflammatory activity; Anti-immune activity, ie the inhibitory effect on the immune response of cells and body fluids, including those that do not involve inflammation; Macrophages and T cells interfere with the attachment of extracellular matrix components and fibronectin. As well as inhibit the expression of upregulated fas receptor in T cells; Inhibits unwanted immune responses and inflammation including arthritis and rheumatoid arthritis, sensitivity, allergic reactions, asthma, cystic lupus erythematosus, inflammation with collagen disease and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis Heart disease caused by atherosclerosis, reperfusion damage, heart attack, myocardial infarction, coronary inflammatory disorders, inflammation accompanied by respiratory distress syndrome or other cardiopulmonary diseases, peptic ulcer, ulcerative colitis and other diseases of the intestinal tract , Kidney fibrosis, cirrhosis or other kidney disease, thyroiditis or other acute diseases, glomerulonephritis or other kidney and urinary diseases, otitis or other otorhinolaryngitis, dermatitis or other skin diseases, periodontal digits or Other dental diseases, orchitis or epididymo-testisitis, infertility, okidal et al. Or other immune-related testicular disease, placental dysfunction, placental insufficiency, habitual miscarriage, convulsions, foreclosures and other immune and inflammation-related gynecological diseases, posteri Uvetis, intermediate Uvetis, entertaining Uvetis, Conjunctivitis, Corio retinitis, Ubero retinitis, Optic neuritis, Intraocula inflammation, e.g. retinitis or cyst spot edema, sympathetic ophthalmitis, scleritis, retinitis pigmentosa, degenerative vonebs digits Inflammatory components, inflammatory components associated with trauma to the eye, inflammation of the eye caused by infection, properative Virio-Retinopathsis, acute escapic optic nerve disorders, such as excessive scarring after glaucoma removal surgery, eye Immune and inflammatory responses to transplantation and inflammation with ocular diseases and autoimmune diseases with other immunity and inflammation Disorders, Parkinson's disease that benefits immunity and inflammation, and the complications and side effects of treating Parkinson's disease, HIV linked Encephalopathy with AIDS-related dementia, Devic Digiz, Sideca Correa, Alzheimer's Digiz and others Degenerative digits, CNS disorders, inflammatory components of seizures, post polio syndrome, immune and inflammatory components of mental disorders, myelitis, encephalitis, plate encephalitis with subacute atherosclerosis, encephalomyelitis, acute neurosis, subacute neurosis, chronic Neurosis, guillim-barre syndrome, cidenam chora, gravis gravure, pseudo-turmer celebrity, down syndrome, huntington digits, amiotropic stellar sclerosis, inflammatory components of CNS compression or CNS trauma or CNS Infections, inflammatory components of muscle weakness and malnutrition, and immune and inflammation related diseases, disorders of the central or distal nervous system, post traumatic inflammation, sepsis Sexual shock, infectious disease, inflammatory complications or side effects from surgery, bone marrow transplantation or other transplant complications or side effects, inflammation and immune complications and side effects from gene therapy, because they are infected with viral carriers. Or to treat or ameliorate monosite or leucosite proliferative digits such as leuchemia by reducing the amount of monosite or lymphocytes to suppress inflammation, body fluids and cellular immune responses associated with AIDS. To inhibit or treat graft rejection when transplanting tissues and organs, such as corneal, bone marrow, trachea, lens, facemaker, natural or artistic skin tissue.

The movement of one or more NOIs by the vector system according to the invention can be used alone or in combination with other treatments or treatment components.

As described above, a preferred aspect of the present invention is based on the surprising finding that transformation of retroviral vectors and one or more HSCs for specific purposes is possible.

More preferred aspects of the invention are based on the surprising finding that arrays of lentiviral vectors are possible in order to increase the production of vectors in vitro and to regulate gene expression in vivo in response to normal physiological signals.

Previous studies have shown that it is possible to develop vectors based on members of the lentiviral family, including HIV-1, HIV-2, SIV, FIV and EIAV. In the data, vectors express therapeutic genes either structurally or in response to the natural regulatory signals of their own viral vectors. No configuration has wide utility in the treatment of diseases that regulate gene expression levels that are required. For the first time, reactive retroviral vectors are described for hypoxia and hypoxia-like agents. This regulation can enhance the production of the vector in vitro and can be used to regulate gene expression in response to normal physiological signals in vivo. Such vectors have a wide range of utility in, for example, cardiovascular disease, peripheral artery disease, cancer and arthritis diseases characterized by ischemia.

Despite the in-depth studies, there are no data on rent virus vectors containing regulatory genes, and the studies in which such vectors are produced are not clear. Such vectors have utility in a wide range of diseases. It produces a set of lentiviral vectors that are regulated by tissue physiology and chemical regulators. These vectors can be cast such that the expression cassette is located inside the vector as mentioned above. In the present invention, it was further shown that there is an advantage of arranging the vector as a single transfer unit vector. In this configuration, the resulting duplication of regulatory sequences enhances the response. The regulatory system we studied takes advantage of the fact that gene expression is activated in response to ischemia. Physiological markers of ischemia are at low oxygen, low pH and low glucose, and these conditions are detected in cells activating a limited set of genes. The gene set includes DNA sequences that mediate in response to and mediate hypoxia, a hypoxic response element (HRE). The use of these elements to induce gene expression of plasmid, retrovirus and adenovirus vectors has already been described in patents (PCT / GB95 / 00322; PCT / GB97 / 02709) and studies (Dachs et al 1997 ibid).

In addition to hypoxia, HRE elements are known to respond to chemical inducers such as hypoxia. Two of these well known are cobalt and desferrioxamine (Meliilli et al 1996 J. Biol. Chem 272, 12236-12243; Wang and Semenza 1993 Blood, 82, 3610).

The present invention relates to any disease in which the chemically active agent desferriosamine or similar chemical agent can be used in any disease with ischemia, for example, neuroblastoma (Blatt 1994, Anticancer Res., 14, 2109), beta marine anemia (Giardina and Grady). 1995, Semin.Hematol. 32, 304), Alzheimer's disease (Crapper et al 1991, The Lancet, 337, 1304), VEGF deficiency (Beerrepoot et al 1996, 56, 3747), erythropoietin deficiency (Wang and Semenza op cit) and Applied to lentiviral vectors for use in enhancing tumor chemotherapy.

As is well known, vectors are mechanisms that allow or facilitate the transfer of entities from one environment to another. According to the present invention, for example, certain vectors used in recombinant DNA techniques are used to deliver entities, such as segments of DNA (eg, segments of DNA, heterologous DNA segments or heterologous cDNA segments) to target cells. When in a target cell, the vector either retains the heterologous DNA in the cell or acts as a DNA replication unit. Vectors used in recombinant DNA techniques include plasmids, chromosomes, artificial chromosomes or viruses.

Vectors can be delivered by viral or non-viral techniques.

Nonviral delivery systems include, but are not limited to, DNA transfection methods. Here, transfection involves the use of nonviral vectors to deliver genes to target mammalian cells.

Common transfection methods include electroporation, DNA bioistics, lipid mediated transfection, compacted DNA mediated transfection, liposomes, immunoliposomes, lipolectins, cationic agents mediated, cationic Nature Biotechnology 1996 14: 556, polyvalent cations such as spermine, amphiphilic lipids or polysilins, 1, 2-bis (oleoyloxy) -3- (trimethylammonio) propane (DOTAP ) -Cholesterol complex (Wolff and Trybetskoy 1998 Nature Biotechnology 16: 421) and combinations thereof.

Virus delivery systems include, but are not limited to, adenovirus vectors, adenoassociated virus (AAV) vectors, herpes virus vectors, retroviral vectors, lentiviral vectors, and bacuolvirus vectors. Vectors with delivery systems in in vitro experiments include, but are not limited to, DNA transfection methods such as electroporation, DNA bioistics, rapid mediated transfection, and compact DNA mediated transfection. .

The vector may be a plasmid DNA vector. Suitable recombinant viral vectors include adenovirus vectors, adeno-associated virus (AAV) vectors, herpes virus vectors, or preferably retroviral vectors.

The vectors of the present invention can be arranged like a split-intron vector. Split-intron vectors are described in the British patent application 9720465.5 and are now described in the PCR patents claimed as priority (title "vector") and filed concurrently with the PCT patent filing date. For example, the claims of the PCT patent are as follows: Retroviral vectors include a functional splice donor site and a functional splice acceptor site; Wherein the functional splice donor site and the functional splice acceptor site are linked to a specific primary nucleotide sequence (“NOI”); Wherein the functional splice donor site is upstream of the functional splice acceptor site; Retroviral vectors are derived from retroviral provectors; Retroviral provectors consist of a primary nucleotide sequence (NS) capable of producing a functional splice donor site and a secondary NS capable of producing a functional splice acceptor site; The primary NS is downstream of the secondary NS; Retroviral vectors are formed as a result of reverse transcription of retroviral provectors. The primary NOI in the patent is the NOI defined herein. In terms of split introns, research is provided at the end of the Example section provided below. The present invention provides, in a preferred aspect, the information on how to prepare the split intron vector.

Therefore, a preferred aspect of the present invention is that cells; And NOI; Wherein the modified cell is provided by transforming the cell by viral transduction with one or more of retroviral vectors comprising at least one NOI; Wherein the retroviral vector comprises a functional splice donor site and a functional splice acceptor site; Wherein the functional splice donor site and the functional splice acceptor site are linked to a specific primary nucleotide sequence (“NOI”); Wherein the functional splice donor site is upstream of the functional splice acceptor site; Retroviral vectors are derived from retroviral provectors; Retroviral provectors consist of a primary nucleotide sequence (NS) capable of producing a functional splice donor site and a secondary NS capable of producing a functional splice acceptor site; The primary NS is downstream of the secondary NS; Retroviral vectors provide modified cells that consist of the result of reverse transcription of retroviral provectors.

The vector of the present invention may be an adenovirus vector.

Adenoviruses are viruses with double stranded linear DNA and do not pass through RNA intermediates. There are more than 50 different human serotypes, which can be divided into six groups depending on the genome sequence homology. Targets of adenovirus cause weak symptoms in the respiratory tract or gastrointestinal epithelium. Serotypes 2 and 5 (with 95% sequence homology) are mainly used in adenovirus vector systems to infect the upper airways of young children.

Adenoviruses are regular icosohedrons without envelopes. A common adenovirus is a DNA virus wrapped in a 140 nm long capsid. The virus's isosomeron consists of 152 capsomers. That is, 240 hexons and 12 pentons. The core of the particle has a 36kb long, double-stranded DNA that is covalently bound to the terminal protein (TP), which acts as a primer during DNA replication, and the 5 'end. DNA has inverted terminal repeats (ITR) and their length varies depending on the vertical type.

The entry of adenoviruses into cells involves a series of processes. The virus attaches to the cell by binding between the fiber of the virus (37 nm) and the fiber receptor of the cell. These receptors are recently known to be identical to the Ad2 / 5 serotype and are represented by CAR (Coxsackie and Adeno Receptor, Tomko et al 1997 Proc Natl Acad Sci 94: 3352-2258). Cells of ανβ3 and ανβ5 integrins enter the endosome, which acts on the RGD sequence of the virus in the penton-base capsid protein (Wickham et al 1993 Cell 73: 309-319). After internalisation, the endosomes are broken through endosomolysis and promoted by the ανβ5 integrins of the cells (Wickham et al 1994 J Cell Biol 127: 257-264). It has also recently been demonstrated to bind with high affinity to M5 class 1α2 domains on the surface of Ad5 fibers or particular cell types, particularly human epithelial and B lymphocytes (Hong et al 1997 EMBO 16: 2294-2306).

As a result, the virus is translocated into the nucleus and activation of the initial region occurs, followed by DNA replication and later activation. Transcription, replication and packaging of the DNA of adenoviruses requires functional protein machines of both the host and the virus.

Gene expression of viruses can be divided into early phases and late phases. The late phase is the time when viral DNA replication occurs. Structural proteins of adenoviruses are generally synthesized during the late phase. After adenovirus infection, host mRNA and protein synthesis is inhibited in most serotype-infected cells. The lytic cycle of adenoviruses, as well as adenoviruses 2 and 5, is very efficient, resulting in approximately 10,000 virions per infected cell due to the synthesis of DNA and viral proteins that do not enter virions. The transcription of early adenoviruses is a complex series of biochemical processes but involves the synthesis of viral RNA before DNA replication.

The schematic shown in FIG. 34 is an adenovirus genome showing the relative direction and location of early and late gene transcription. The composition of the adenovirus genome is similar between adenovirus groups and its function is generally located at the same location for each serotype. Early cytoplasmic mRNA is complementary to four restricted and independent regions of viral DNA. These areas are denoted by E1-E4. The initial transcript is divided into the initial intermediate (E1a), the initial delay (E1b, E2a, E2b, E3, E4), and then the intermediate region.

Early genes are expressed 6-8 hours after infection and progress from seven promoters of the gene to block E1-4.

The Ela region is involved in the inhibition of transactivation as well as the transcription of other sequences in the transcription of viral and cellular genes. The E1a gene exhibits important regulatory functions for all other early adenovirus mRNAs. In normal tissues, an active E1a product is required to transfer the E1b, E2a, E3, E4 regions. However, the function of E1a seems to be ignored. Cells can be assigned to the same function as E1a or be made to have such a function naturally. Viruses can also be made to ignore E1a function. The packaging signal of the virus overlaps with the enhancer of E1a (194-358nt).

The E1b region affects blocking viral and cellular metabolism and host proteins. It also contains genes encoding the pV protein (3525-4088nt), which is required for full-length viral DNADML packaging, and is important for the thermal stability of the virus. The Elb region is required for normal progression of the virus later in infection. E1b products work in the host nucleus. Mutations occurring within the E1b sequence show impaired inhibition of host cell traffic that normally appears late in adenovirus infections, as well as reduced late viral mRNA accumulation. E1b is necessary to alter the function of the host cell so that processing and transport moves to the viral late gene product. This result is then viral packaged and released into the virion. E1b produces 19kD protein that interferes with cell death. It also produces a 55kD protein that binds to E1b p53. See WO96 / 17053 for adenoviruses and their replication.

The E2 region is essential when coding an 80kDa precursor of a 55kDa terminal protein (TP) required for protein priming to begin 72kDa DNA binding protein, DNA polymerase and DNA synthesis.

The 19kDa protein (gp19K) is encoded in the E3 region and is involved in regulating the host immune response to the virus. The expression of this protein is upregulated in response to TNF alpha during the first phase of infection, and then binds to prevent the use of MHC class I antigens on the epithelial surface, thus preventing the recognition of adenovirus infected cells by cytotoxic T lymphocytes. Prevent. The E3 region is not needed in vitro and can be removed by deletion of the 1.9 kb XbaI fragment.

The E4 region is involved in reducing the synthesis of host proteins and increasing the DNA replication of viruses.

Fiber proteins are encoded in the L5 region. The genome of the adenovirus is flanked with inverted terminal repeats, which are at Ad5, 103 bp in length, and play an essential role in DNA replication. The virus is produced 30-40 hours after infection.

Adenovirus can be used as a vector to transfer genes by removing important E1 genes that induce the E2, E3, E4 promoters. E1-replicating defect viruses can be propagated in cell lines that provide El polypeptides on the other side, such as the human Embryonic Kidney Cell Line 293. Therapeutic genes or genes may be recombinantly inserted at the E1 gene position. Expression of the gene is driven by an E1 promoter or a heterologous promoter.

Genetic adenovirus vectors have been developed that are much less toxic by removing some or all of the E4 open reading frames (ORFs). In the next generation of vectors, however, DNA could not be expressed for long periods of time, even if DNA appeared to be maintained. The function of one or more E4 ORFs is to enhance gene expression from the viral promoter.

Another approach to making the virus more flawed is to completely remove the virus, leaving only the terminal repeats needed for virus replication. These "gutted" viruses can grow to high titers along with first-generation helper viruses in 293 cell lines, but it is difficult to isolate "gut" vectors from helper viruses.

Replicable adenoviruses can be used for gene therapy. For example, the E1A gene can be inserted into a first generation virus under the control of a tumor specific promoter. Theoretically, after injection of the virus into the tumer, it was specifically replicated in the tumer but not in the surrounding normal cells. This type of vector is a thymidine kinase of the Herpes simplex virus that can kill infected and bystander cells either directly by killing tumer cells or by treating ganciclovir with lysis. Is used to deliver a "suicide gene" such as a gene. Alternatively, adenoviruses without E1b specifically have been used in phase-1 clinical trials for antitumour treatment. Polypeptides encoded by E1b can prevent p53-mediate apoptosis by preventing cells from dying on their own during virus infection. In normal non-tumor cells, E1b-free viruses can't prevent cell death and can't produce infectious viruses and can't spread. For p53 deficient tumer cells, the E1b defective virus grows and spreads to adjacent p53 defective tumer cells but not to normal cells. This type of vector can be used to deliver therapeutic genes such as HSV _tk .

Adenoviruses have many advantages as vectors for gene transfer over other vector systems used for gene therapy for the following reasons.

It is a non-envelop virus with double stranded DNA that can be transduced in vivo and in vitro, from cell types with origins in humans to cells with origins in other species. These cells include epithelial cells of the airways, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cesses, and neurons. This includes cells that differentiate after mitosis. Adenovirus vectors can also be transduced in cells that do not divide. Because of this fact, the affected cells in the lung epithelium are very important for diseases such as cystic fibrosis with slow turnover rates. In fact, several trials have been conducted using adenovirus medicated transports to deliver cistic fibrosis transporters (CFTR) to adult patients suffering from cistic fibrosis.

Adenoviruses are used as vectors for the expression and gene therapy of heterologous genes. Primary developmental recombinant adenovirus vectors (with E1 / E3 removed) are 7-8 kb of exogenous insert DNA, and secondary (with E1 / E3 / E4 removed) and tertiary development more DNA inserts Can carry Recombinant adenovirus vectors are propagated and supplied at very high concentrations. Adenovirus vector replication supplementing cell lines produces 10 ¹³ virus particle concentrations per ml. Adenovirus is therefore one of the best systems for studying gene expression in primary nonreplicated cells.

It is not necessary to be a replicating cell in order to express a virus or a foreign gene from the adenovirus genome. Adenovirus vectors enter the cell through the receptor mediaate endocytosis. When intracellularly, adenovirus vectors are rarely inserted into the chromosome of the host. Instead, the vector acts like a linear genome in the host's nucleus, independent of the host's genome. The use of recombinant adenovirus can alleviate the problems associated with random insertion into the host's genome.

There is no relationship between adenovirus infection and human malignancies. Weakened adenovirus strains have been developed and used in humans as live vaccines.

However, current adenovirus vectors have some major limitations when used for treatment in vivo. First, adenovirus vectors used for the expression of transient genes generally carry episomes and do not replicate, so no genes are subsequently delivered to progeny. Second, since the target cells divide because they cannot replicate, dilution of the vector may occur. Third, the immune response to the protein of the adenovirus causes the cells expressing the protein of the adenovirus to rupture to low levels. Fourth, in some target cells, uptake of the vector occurs due to in vivo delivery and expression of the transferred gene does not have an index for effective treatment. Fifth, the broad target range of adenoviruses is that they are minimally toxic to normal tissues and may have problems with gene therapy methods for diseased tissues. Any further adjustments used with focus on treatment in the compartments needed will benefit this vector system.

The adenovirus vectors used in the invention are derived from human adenoviruses or adenoviruses which are not normally infected with humans. The vector is derived from avian adenoviruses such as adenovirus type 2 or 5 or mouse adenovirus or CELO virus (Cotton et al 1993 J Virol 67: 3777-3785). The vectors are replicable adenovirus vectors but are more defective adenovirus vectors. Adenovirus vectors are defective because more than one component of the virus is replicated. In general, each adenovirus vector contains at least one deletion in the E1 region. While infectious adenovirus vector particles are produced, this dilation is supplemented via a virus passage in a human embryo fibroblast, such as a human 293 cell line, and contains the inte of the left part of Ad5, including the E1 gene. You will have a graded copy. The capacity for inserting heterologous DNA into such a vector is approximately 7 kb. Such vectors are thus useful for the system structure that constitutes each of three different recombinant vectors, which contain one of the essential transcriptional units for the construction of a retroviral secondary vector.

In the data, there is no known data for physiologically regulated recombinant adenoviruses. However, many tissue specific promoters have been investigated in relation to adenovirus vectors, five of which are described below.

The pancreas-related protein I promoter (strongly induced during acute pancreatic pate) shows a 90-fold induction of CAT activity in the QR-42J pancreatic cell line after stimulation with a combination of IL6 and desamethason in vitro (Dusetti et al 1997 J. Biol. Chem, 272 (9) 5800-5804). In vivo experiments in mice (adenoviruses administered intravenously to the terminal tip) showed 10-fold higher activity in animals carrying pancreatis (low activity of CAT was slightly observed in other tissues of control animals).

Recombinant adenoviruses, including the murine alpha-fetoprotein promoter, were produced to direct hepatocyte (HCC) specific expression of human interleukin-2. IL-2 expression was 3-4 fold higher in AFP-produced HCC cell lines compared to non-AFP producing non-HCC lines (Bui et al 1997 Human Gene Therapy. 8 2173-2182). Intratumoral infusion of AdVAFP1-IL2 into the dorsal flank Hep3B tumor of CB-17 / SCID mice showed significant growth inhibition and tumor suppression after three injections.

Recombinant adenoviruses were prepared containing cardiac trophinine T (cTnT) promoto fragments that regulate the expression of lacZ, EGFP or sarcoendoplasmic reticulum Ca-ATPase (SERCA) (Inesi et al 1998 American J Physiol. 274 (3,1) C645-C653). The recombinant virus is then used to transduce chick myocytes and fibroblasts in culture to show that expression from the cTnT promoter is restricted to Cardiac myocytes. Smooth muscle specific promoter (SM22α) was used to induce the expression of bacterial lacZ in recombinant adenoviruses (Kim et al 1997 J. Clin. Invest. 100 (5) 1006-1014). Expression was detected in early rat aortic SMCs and A7r5 SMCs but not in HUVECs or NIH3T3 cells. Recombinant adenoviruses were injected intravenously into Sprague Doll mice, and expression from CMVlacZ adenoviruses could be detected throughout the liver and lungs, from either SM22 derived from lacZ adenoviruses, which limits transgene expression in SMCs in any of these tissues. Not detected. The results of this study indicate that AdSMCC-lacZ expression is limited to visceral and vascular SMCs when the virus is administered intraarterally, intravenously and intramuscularly. KDR and E-celllectin promoters were prepared to upregulate the expression of murine TNF-alpha from SIN retroviral vectors in endothelial cells (Jaggar et al 1997 Hunab Gene Therapy 8 (18 2239-2247)). 10-fold increase in expression from these promoter elements in sEND endothelial cells compared to that observed with NIH-353 fibroblasts.

If the characteristics of the adenovirus are combined with the genetic stability of the retro / lentiviral, then essentially the adenovirus can be used to transduce the target cells to make transient retrovirus producing cells that stably infect surrounding cells.

Use of preferred vectors according to the invention are recombinant viral vectors, in particular recombinant retroviral vectors.

Use of preferred vectors according to the invention are recombinant viral vectors, in particular recombinant adenovirus vectors.

Use of preferred vectors according to the invention are recombinant viral vectors, in particular combinations of retroviral and adenovirus vectors.

The term “recombinant retroviral vector” (RRV) is a vector that has sufficient genetic information of the retrovirus to package the RNA genome so that viral particles capable of infecting target cells in the presence of packaging components. Infection of the target cell involves reverse transcription and fusion into the target cell genome. In use, the RRV carries a non-viral coding sequence delivered by the vector to the target cell. RRV is unable to replicate the production of infectious retroviral particles in the final target cell. In general, RRVs lack functional gag-pol and / or env genes and / or other genes required for replication.

The invention is a target vector that can be used as a vector for delivering NOI or gene to HSCs in vivo and the vector can preferably target CD34 ⁺ .

The term "target cell" refers to a vector whose ability to be expressed in a target cell or to infect / transform a cell is limited to any cell type, within the host organ, cells that generally have a common or similar phenotype.

An example of a target cell is a target retroviral vector with a genetically modified envelope protein that binds to cell surface molecules expressed only in a limited cell type in a host organ. Another example of a target cell is one that includes a promoter and / or enhancer needle that merely expresses one or more retroviral transcripts in the cell type ratio of the host organ. Thus, vectors are provided with specific ligands for CD34, such as molecules such as immunoglobulins for antibodies or CD34. Introduction into the patient to treat such vectors can infect CD34 ⁺ HSCs in particular. The vector can be administered systemically to the onset circulation.

Retroviral vector particles can transduce slowly dividing cells, but non-lentivirals, such as MLVs, cannot effectively transduce. Slowly dividing cells, including some tumers, divide about every three to four days. Although a tumer has a rapidly dividing cell, some of the tumer cells, especially those in the center of the tumer, rarely divide.

Examples of tumors that may be treated by the present invention include, but are not limited to, sarcomas, breast, lung, bladder, thyroid, prostate, colon, rectum, pancreas, stomach, liver, uterine and ovary, including bone formation and soft tissue sarcomas. Cancers such as cancer, lymphomas including Hodgkin's and non-Hodgkin's lymphomas, neuroblastomas, melanoma, myomas, holmian tumors and leukemias and lymphomas including acute myeloma, glioblastoma and retinoblastoma admit.

The target cell may be a gross arrest cell that can undergo cell division, such as a cell in the central part of the tumer mass or a stem cell such as hematopoietic stem cells (HSC) or CD34 + cells. Or the target cell may be a precursor of differentiated cells such as monosite precursors, CD34 + cells or Myelo precursors. Or target cells such as neurons, astrosites, glycal cells, microglyal cells, macrophages, monosites, epicellular rial cells, endocellular rial cells, hepatocytes, spermatocites, spurmatized or spermatozoa It may be a differentiated cell. Target cells can be isolated from the patient and then directly transduced in vitro or in vivo.

Additional vector components, which are known and standard, will provide other aspects of vector functionality such as vector retention, positioning, replication and proper fusion in the nucleus.

HSCs are removed from individuals for treatment and transformed or transduced with vectors in vitro, and cells are generally grown in culture in culture before and after introduction of NOI or NOIs. When cultured in vitro under appropriate conditions or when receiving the appropriate signal in vivo, HSCs are endothelial cells such as Neutrofil, lymphocytes, mononuclear phagocytes and NK cells, bone marrow cells, dendritic cells and immune effectors, among other cell types. Have the ability to divide.

This includes exposure to cytokinin and / or growth factors for maintenance of HSCs using tissue culture methods known in the art (Santiago-Schwartz et al 1992 J Leuk Biol 52: 274-281; Charbord et al 1996 Br J Haematol 94: 449-454; Dao et al 1997 Blood 89: 446-454; Piacibello et al 1997 Blood 89: 2644-2653). Agents that induce cleavage of HSCs may also be added.

As noted, the invention is delivered to the target site by a viral or non-viral vector.

In addition, to provide a drug and method used to treat diseases such as cancer and to provide a drug and method for use as a prophylactic. Therefore, NOIs used in the invention can have a therapeutic effect through prophylaxis. For example, the increased risk of developing cancer is diagnosed and the invention is used to prevent individuals at risk.

The invention can also be used as a pharmaceutical mixture when treating a patient with gene therapy. Here, the mixture has an effective amount of retroviral vector as a medicament. The vector consists of viral particles obtained or generated from one or more therapeutic and diagnostic NOIs or the same that can be delivered. The drug mixture is used in humans or animals. In general, doctors will determine the actual dosage, which should be most appropriate for the patient, and will vary with age and weight and the specific patient's response.

The mixture consists of a carrier, diluent, agent or adjuvant that is acceptable as a medicament. The choice of pharmaceutical carrier, excipient or diluent can be selected according to the route of administration and the actual use of standard pharmaceuticals. The pharmaceutical mixture consists of a carrier, excipient or diluent, as well as suitable binders, lubricants, suspending agents, coating agents, solubilizers, and other carriers that assist or increase viral entry to the target site, such as lipid delivery systems.

Suitable pharmaceutical mixtures may be in the form of suppositories or pessaries, or in the form of lotions, solutions, creams, ointments or dusting powders, or tablets or capsules containing supplements such as starch or lactose. Alternatively, it can be administered on its own or in the form of elixirs, solutions or suspensions containing fragrances or pigments, orally using skin patches. Or parenterally, ie, injected into an intracabine, intravenously, intramuscularly or subcutaneously. For parenteral administration, the mixture is used in the form of a sterile aqueous solution containing salts or monosaccharides for making other substances, such as blood and isotonic solutions. When administered orally or tongue, the mixtures are administered in the form of tablets or lozenges which can be formulated in the usual manner.

Stability of prophylaxis is based on genetic predisposition to cancers such as, for example, breast or ovarian cancer because of mutations in one or more of the BRCA-1 gene, BRCA-2 gene or other genes.

Standard molecular biology techniques according to the invention can be used within the level of known techniques. All such techniques are described in the paper. See, eg, Sambrook et al (1989) Molecular Cloning; a laboratory manual; Hames and Glover (1985-1997) DNA Cloning: a practical approach, Volumes I-IV (second edition). Methods for preparing immunoglobulin genes are shown in McCafferty et al (1996) "Antibody Engineering: A Practical Approach".

In summary, the present invention relates to a delivery system suitable for introducing one or more NOIs into an HSC.

The invention also relates to an MHSC comprising a vector of one or more NOIs.

The invention also relates to a vaccine comprising the aforementioned vector and / or MHSC.

Preferred aspects of the invention relate to the use of any of the aforementioned products in the prevention and treatment of conditions characterized by ischemia, hypoxia or hypoglucose, including but not limited to cancer, celebral malaria. Conditions such as ischemic heart disease or rheumatoid arthritis.

Furthermore, in a broader aspect, the present invention provides a modified HSC (MHSC) consisting of a response element comprising an actionable element in macrophages (“macrophage response element”).

Therefore, the present invention also provides a modified dividing cell (preferably the last differentiated cell) comprising at least one expressable (NOI) nucleotide sequence, wherein each NOI is active in that dividing cell. It can be connected to one or more reaction elements.

Therefore, also in a preferred aspect, the present invention provides a modified macrophage comprising at least one expressable nucleotide sequence of interest (NOI), wherein each NOI is one or more response elements active in that dividing cell. Can be connected to

Therefore, also in a preferred aspect, the present invention provides a modified endothelial cell comprising at least one expressable nucleotide sequence of interest (NOI), wherein each NOI is one or more response elements active in that dividing cell. Can be connected to

In a broad aspect of the invention, preferably, the HRE of the invention is a very preferred component of such a reaction component.

Preferably the dividing cells are derived from MHSC. This is advantageous in that it provides a method, for example, by providing selective expression in or with or from macrophages differentiated from MHSC.

Furthermore, in a broader aspect, the present invention provides a modified cell, wherein the cell can be a differentiated cell or an undifferentiated cell in which undifferentiated cells can be differentiated into differentiated cells, wherein the modified cells are cells and NOIs (defined above). And the modified cells are provided by cell transformation by viral transduction, preferably adenovirus transduction and / or lentiviral transduction. The element here is preferably the ILRE of the present invention.

Furthermore, from a broader perspective, the present invention provides a hybrid viral vector system for gene transfer in vivo, wherein the system is capable of infecting and expressing a secondary viral vector, a primary viral vector or a first target cell therein. One or more primary viral vectors encoding the present vectors, wherein the secondary vector can transduce a second target cell.

Preferably the primary vector is obtained from or based on an adenovirus vector, and / or the secondary viral vector is obtained from or based on a retrovirus, preferably a lentiviral vector.

The present invention will now be further described by way of example to aid in the common art known in carrying out the invention rather than limiting its scope.

Example 1 Preparation of an Ischemic Response Promoter

Ischemic response element (ILRE) that can be used in the present invention can be obtained from any gene that responds to ischemia. Hypoxia is one of the conditions associated with ischemia and hypoxia response promoters are particularly useful. Examples of suitable sequences are shown in FIG. 1. Suitable sequences are often found in DNA upstream (5 ') of the coding sequence but are not necessarily present at that position. Sequences downstream of the introns and coding sequences can also mediate responses to hypoxia. For example, sequences in the 5 'untranslated region of the Epo gene are well known to mediate transcriptional responses to hypoxia and sequences in the 3' region of the VEGF gene mediate transcriptional responses to hypoxia (Bunn and Poyton 1996, Physiol). Rev 76, 839).

ILRE can be associated with promoter elements either in the LTR of the retroviral vector or in other binding between tissue and tissue specific promoters. In particular, the combination of elements from the SV40 promoter and PGK HRE is useful as described below.

OBHRE1: promoter based on PGK HRE in rats

Synthetic oligonucleotides are synthesized surrounding the hypoxia response element (HRE) sequence and cloned as BglII / BamH1 into the BamH1 site of the PGL3 promoter plasmid (Promega accession no U47298). PGK sequences are synthesized as Xba1 / Nhe1 and cloned into the Nhe 1 site of this vector. pGL3 is an expression-free plasmid with no minimum SV40 promoter upstream of the luciferase coding sequence. The insertion of the HRE at this site places it upstream of the minimum SV40 promoter. Luciferase assays are performed to compare the function of this element in Normoxia and hypoxia (0.1% oxygen) and to correlate promoter strength to the function of SV40 and CMV. In the natural orientation linked to the SV40 promoter (Firth et al 1995, J Biol Chem 270, 21021) the trimers surrounding the -307 / -290 sequence of rat PGK are as follows.

GCTAGAGTCGTGCAGGACGTGACATCTAGTGTCGTGCAGGACGTGACA

HRE HRE

TCTAGTGTCGTGCAGGACGTGACAGCTAGCCCGGGCTCGAGATCTGCG

HRE

ATCTGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCC

SP1 SP1

CATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCG

(SP1) SP1 SP1 SP1

CTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTG

start start

The promoter sequence defined as OBHRE is present in plasmid OB37 described in FIG. 2.

OBHRE1 is a novel promoter.

HRE also acts like binding of promoter elements in retroviral LTRs, for example MLV LTRs shown below.

PGK Induced Enhancer Sequences in the MLV Retrovirus Promoter

PGK trimers in the MLV retroviral promoter promote natural orientation. This is identical to the OB HRE with the sequence located upstream of the Moloney MLV retrovirus promoter instead of SV40. Sequence shown until start of transcription.

AGCTAGCCTAGCGTCGTGCAGGACGTGACATCTAGTGTCGTGCAGGACGTGAC

ATCTAGTGTCGTGCAGGACGTGACATCTAGAGAACCATCAGATGTTTCCAGGG

TGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTC

GCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCA

CAACCCCTCACTCGG

PGK trimers in the MLV retrovirus promoter reverse the orientation. Sequence shown until start of transcription.

AAGCTAGCTGTCACGTCCTGCACGACACTAGATGTCACGTCCTGCACGACACT

AGATGTCACGTCCTGCACGACTCTAGAGAACCATCAGATGTTTCCAGGGTGCC

CCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTT

CTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAAC

CCCTCACTCGG

HRE can act in orientation on promoter elements.

OBHRE combined with MLV promoter

Vector series are prepared to analyze the activity of HRE linked to MoMLV promoters in transient assays. The HRE and MoMLV promoters are removed from pLNheHRE as Nhe1-Sma1 fragments and inserted into the MCS of pGL3 Basic (Promega) to produce pGLHRE and pGLMUT. The PGL3 promoter and pGL3 control (Promega) are used as negative and positive controls, respectively.

The vectors p5'HRE3'MUT, p5'MUT3'HRE, p5'MUT3'MUT, and p5'HRE3'HRE are prepared by digesting pHRE and pMUT with Sac1 and ligating the retroviral genome and linearized pLNheHRE cut with the same enzyme. .

The data shown in FIG. 3 clearly demonstrates that 5 'and 3' HREs are involved in transcriptional regulation and that there is synergy between the two. These data indicate that the optimal arrangement of hypoxia control vectors is where replication of HRE is at 5 'and 3' LTRs. This allows us to design a regulated single transcription unit lentiviral vector.

It is important to note that this data can be extrapolated to other non-HRE enhancer systems where the same synergy can be imagined.

In another example, other promoters have also been prepared for use in the invention shown in FIG. 4A.

The relative intensities of these promoters are shown in Figure 4b. All these sequences give at least SV40 promoter hypoxia induced expression. However, it is clear that under hypoxia, the induction rate and expression scale are different.

Any of these promoter sequences can be used in the invention and the selection is dictated by the therapeutic gene. Highly toxic cytokines, such as, for example, TNF-alpha, benefit from the use of simple enolase promoters that do not detect basal levels in Normoksia by ensuring that there is no inappropriate expression. Less toxic proteins such as human cytochrome P450, which are needed at high levels, benefit from the use of OBHRE1 where the maximum level of expression is very high and the basal level is detectable.

The promoters described above all contain DNA sequence motifs for HIF 1, an authentic HRE binding transcription factor. It is a heterodimer that constitutes HIF 1a and HIF 1b, members of the basal helix-loop-helix (bHLH) / PAS domain protein family (from Period, ARNT, SIM) from the discovery members of this gene family. HIF 1a was originally thought to be a protein that binds to the HRE of the erythropopietin gene in liver cancer cells (Wang et al 1995, J Biol Chem 270, 1230), but it expands the gene family regulated by hypoxia in most cell types. It has been involved in regulation. Database searches of expressed cDNA sequences identified a bHLH / PAS family closely related to HIF1 called EPAS-1 (endothelial PAS domain protein) or HRE (HIF-related elements) (Ema et al 1997, Proc Natl Acad Sci USA 94, 4273; Flamme et al 1997, Mech Dev 63, 51; Tian et al 1997, Genes Dev 11, 72). Unlike HIF1, EPAS-1 is predominantly expressed in endothelial cells and its expression appears to be critically regulated during development. As predicted from the maintenance of the DNA binding domains of the two proteins, EPAS-1 appears to bind the same consensus sequence (defined as HRE) like HIF-1. However, published data indicate that EPAS expression is limited to endothelial cells. The inventors now surprisingly find that it is impossible to detect HIF-1 in macrophages even in Normoksia (FIG. 5) and that the OBHRE promoter (PGK) is activated in these cells when placed under hypoxia conditions (FIG. 6). We analyzed macrophages using antibodies specific for HIF-1 and EPAS under two conditions. We could not detect HIF-1 in macrophages but could detect EPAS. This is the first time EPAS has been found outside of endothelial cells. Thus the induction of OB HRE 1 in macrophages is primarily or wholly mediated by EPAS-1 and accounts for the EPAS response enhancer.

It is from these observations that there will be many known or not yet discovered factors that mediate the transcriptional response under ischemic conditions. Any DNA fragment that responds to such conditions, regardless of the elements involved, is useful in the present invention.

Other conditions that result from ischemia, such as low acidity or low glucose levels, can also be used to specifically activate genes. For example, a promoter from the human grp78 gene can be isolated by PCR amplification from human genomic DNA and includes the complete promoter-enhancer sequence and the 5'UTR of the grp78 gene. This is described in Chuck et al 1992, Nucleic Acids Res 20, 6481. The 579 bp cloned fragment described in this paper corresponds to bases 6-585. The primers used in this amplification reaction had Asel sites at the 5 'end and Xhol sites at the 3' end. The grp78 promoter fragment is cloned to this site present in the Clontech pEGFPN1 vector which permits expression of the beta-gal / GFP fusion protein from this promoter.

Example 2 Preparation of Tissue-Defined Ischemic Response Promoter

Alternative gene expression constructs limit expression to cells differentiated into granulocyte-monocyte lineage. With the use of special or upregulated promoters, monosite / macrophage lineage will limit therapeutic gene expression to this cell type. Suitable promoters for this purpose include those with consensus sequences that bind upregulated transcription elements during differentiation into myeloid specific transcription elements such as PU1 or macrophages such as CEBP-β (NF IL 6) (See Clarke). and Gordon 1998, J Leukoc Biol 63, 153).

Such promoter elements can be isolated or synthesized by standard procedures. By way of example, isolation of two macrophage specific promoters derived from cellular genes and viral genes are described. The HRE element can be combined with any of these promoters. This is illustrated by example with an HIV acquisition promoter to obtain a synthetic promoter called XiaMac.

Cell promoter

Oligonucleotides are tissue specific regulatory elements present in the M CSF receptor promoter (Zhang et al 1994, Mol Cell Biol 14, 8085) in contact with the HindIII / Nco1 site for cloning and analysis with the pGL3 base vector (Promega) in the luciferase reporter assay. Based on the two parts are synthesized. The transcription element binding site is shown below.

AGCTTCCTGCCCCAGACTGCGACCCCTCCCTCTTGGGTTCAAGGCTTTGTTTTCTT

SP1

CTTAAAGACCCAAGATTTCCAAACTCTGTGGTTGCCTTGCCTAGCTAAAAGGGGAA

CEBP? PEBP2 / CBF PU.1

GAAGAGGATCAGCCCAAGGAGGAC

HIV promoter

The transcriptional regulatory sequence of HIV is present in the LTR, which generally consists of two NFkB sites and three SP1 sites upstream of the ATATAA box (Koong et al 1994, Cancer Res 54, 1425).

Entrez database nucleotide searches are performed on HIV LTR sequences, which are analyzed for the integrity of the motifs outlined above. Deposit U63538 (Zacharova et al 1997, AIDS Res Hum Retroviruses 13, 719) describes an isolation showing a well conserved motif of two NFkB sites and three SP1 sites. However, it was observed that this particular separation also has a consensus sequence for binding of NF-IL6 (C / EBPβ). As discussed above, the transcription factor is known to be active in macrophages.

Oligonucleotides are synthesized in two parts to generate sequence accession number U63538 position 279-447. It is synthesized with the Nhe1 / Sma1 end to facilitate cloning. The annealed and regated oligonucleotide is cloned into OB37.

The final preparation is shown in FIG.

We therefore made a novel synthetic promoter (XiaMac) that combines 'classical' HRE mediated responses with tissue specificity (macrophages). As shown in FIG. 8, the XiaMac promoter was not active at all when tested in non-macrophages such as breast cancer cells. However, when cells are in hypoxia, activity is observed. In contrast to the promoter being active in macrophage lines, the activity was increased by hypoxia. The XiaMAc promoter in response to hypoxia disappears when HRE is inactivated (FIG. 9).

Example 3 Preparation of Macrophage Specific Promoter Limited by Suppression

Alternative promoter constructs are where sequences are added to inhibit expression in macrophages under defined conditions.

An example of this approach would be the IRF system (Taniguchi et al 1995, J Cancer Res Clin Oncol 121, 516; Kuhl et al 1987, Cell 50, 1057). In this situation, the interferon response element (IRE) can combine the transcription elements IRF 1 and IRF 2. IRF 2 binds essentially to it in macrophages and lacks the ability to activate transcription. Interferon activates IRF 1 expression, which can compete to bind IRF 2. The ability of IRF 1 to activate transcription reverses IRF 2 inhibition. IRF 1 also induces IRF 2 gene expression to limit transcriptional activity by 'auto shut off'. Tetramer incorporation of IRE can block SV40 promoter function in the absence of IRF 1 activity. Inclusion of tetrameric sequences downstream into this HRE 5 'ATATAA (e.g., a TATA box such as urea in the SV40 promoter) results in inhibition in the absence of interferon activity.

Interferon gamma is naturally present in inflammatory responses, including responses to tumers. Interferon gamma can also be provided exogenously, such as proteins or genes, and is delivered to gene therapy. In a particular aspect of the invention, an autocrine control circuit can provide interferon gamma. In this case a simple HRE promoter such as OBHRE is linked to the interferon gamma coding sequence. The second gene, for example a pro-drug active enzyme or any of the lists, is linked to a XiaMac promoter containing an IRF-1 reaction sequence. The promoter is inactive in all cells, including macrophages. Interferon gamma is expressed when exposed to hypoxia in pathological conditions. Expression of therapeutic genes is activated by macrophage specific factors and hypoxic response factors. These two phase methods can be applied to any inhibitory protein. A schematic of this method is shown in FIG.

The IRE is cloned as follows with the XiaMAC promoter:

Oligonucleotides are designed consisting of tetramers of IRE sites, with the BanII sticky end as follows:

C (AAGTGA) ₄ GAGCC

Within the XiaMac promoter, there is a BanII site 3 'at the SPI site and 15 bp upstream of TATAA. The insertion of IRE elements at this site creates a suppressed promoter (XiaMac-IRE) that can be active in the presence of interferon and hypoxia. This is shown in FIG. 11.

Example 4 Preparation of Endothelial Specific Promoter

The invention is not limited to the generation of macrophage lineage from HSCs. For example, the inclusion of endothelial specific promoters limits the expression of therapeutic genes into the vascular endothelium. In particular, the correct choice of promoter can limit the expression of neo-vasculature specific to the tumer. For example, Jaggar et al (1997, Hum Gene Ther 8 2239) described the use of e-selectin and KDR promoters specifically to express therapeutic genes from retroviral vectors in endothelial cells. We now see that these promoters are arranged in retrovirus / lentiviral vectors and additionally regulated by hypoxia. The arrangements are shown in FIG. These ILRE-regulated endothelial specific promoters are particularly useful for delivering anti-angiogenic factors into the tumer vasculature. The preparation of lentiviral vectors is discussed in more detail in Example 6.

Any promoter that inhibits expression in a particular lineage obtained from HSC can be used in conjunction with ischemia-responsive elements.

Example 5 Preparation of ILRE Regulating Retroviral Vectors

RRVs are prepared using a packaging cell line system such as FLYRD18 (Cosset et al 1995, J Virol 69, 7430). Plasmid vectors containing the packaged vector genome are infected with the packaging cell line to obtain producer cell lines as described (Cosset et al 1995, J Virol 69, 7430). A suitable plasmid comprising the vector genome is pHIT 111 (Soneoka et al 1995, Nucl Acids Res 23, 628). The required NOI is inserted in place of the LacZ gene at pHIT111 using standard molecular biology techniques. Regulatory elements, such as promoter-enhancers from HREs or grp78 genes, are introduced into retroviral LTRs at pHIT111 in place of retroviral enhancers to ensure regulated expression of NOI. The plasmid is infected with FLYRD18 cells (eg pSV2neo) with an appropriate selectable marker NOI and the infected cells are selected to 1 mg / ml G418 (Sigma).

Suitable HRE-containing enhancers (FIG. 13) consist of three HRE copies from the PGK gene (Firth et al 1994, Proc Natl Acad Sci USA 91, 6496). FIG. 13 also shows the sequence of mutant HRE-containing sequences used for regulation that is not regulated by hypoxia. The synthetic oligonucleotides shown in FIG. 13 are inserted between the Nhe1 and Xba1 sites to generate retroviral vectors whose gene expression of target cells is under hypoxia control at 3'LTR of pHIT111. The replacement retroviral vector prepared by the same method is pKAHRE shown in FIG. 14.

Another arrangement made according to the principles described above is shown in Xia-Gen-P450-G (FIG. 15A). This vector contains therapeutic genes for human cytochrome P450 that activate the anticancer compound cyclophosphamide. The CYP2B6 gene is obtained by PCR amplification of human hepatocytes obtained from mRNA. Suitable gene sequences are identified by comparison with existing sequences (Yamano et al 1989 GenBank Accession No M29874). Other therapeutic genes re-cited above may also be used. RVV also includes a reporter gene that is a green fluorescent protein and a selectable gene that is a neomycin resistance gene. Hypoxia-mediated induction of this vector is shown by way of example in human tumer cells (FIG. 15B).

Example 6 Preparation of Hypoxia Control Lentivirus Vector

The current state of the art in stem cell isolation and replication describes the preparation of cell division. It is generally accepted that stem cells that have the potential to develop into all lineages (torti-potents) are not divided. Thus, retroviral vectors will lose these cells from individuals of fluopotent CD34 + ve cells. Lentiviral vectors provide a significant advantage over conventional MLV based retroviral vectors because they can transfer genes to slow, dividing cells.

The hypoxic response promoter was arranged with the lentiviral vector, pEGASUS (FIG. 16A) and the associated vector pONY2.1 (FIG. 16B). Both are obtained from infectious provirus EIAV clone pSPEIAV19 (Payne et al 1998, J Virol 72, 483). The production summary is shown in FIG. 16 series. In pONY2.1 the CMV promoter is cleaved into Xba1 / Asc 1 fragments and replaced with oligonucleotides comprising the Mlu1 / Xba 1 site. Thus this allows the insertion of MIu / Xba fragments isolated from OB37 (FIG. 2) to make pONY HRE luc / lac (FIG. 16C). The luciferase coding sequence was removed with the Nco 1 fragment and the backbone regated the resulting pONY HRE lac. Equally, lacZ was removed with Xba 1 / Sa11 and the backbone regated to make pONY HRE luc. In the advanced EIAV vector plasmid pEGASUS, the CMV promoter lacZ cassette is excised with EcoR1 and replaced with synthetic oligonucleotides containing SacII and Bsu36 sites. This allows cloning of the HRE luc / HRE lac cassette from pONY 2.1 like the Sac1 / Bsu36 and Sac1 / EcoR1 fragments, respectively. The final vector is denoted pEG-HRE-lacZ (FIG. 16D), pEG-HRE-luc. With the same approach pEGHRE vectors are prepared to express therapeutic genes in place of the lacZ or Luc genes.

Any of the therapeutic genes described above is suitable. The pEGHRE-TSP1 example is shown. It expresses the anti-angiogenic factor thrombospondin-1. This is illustrated in two configurations in FIG. A) is LTR used in cells in which EIAV LTR is highly inactive. B) is a typical SIN (self-inactivating) vector from which the U3 sequence is removed.

Virus particles along with the pEGHRE genome are produced in three transient plasmid systems (Soneoka et al 1995, Nucl Acids Res 23, 628). Virus is titrated to D17 cells in parallel flares and flare cultures overnight in nomoxia (21% oxygen) or hypoxia (0.1% oxygen). Cells are stained by X gal histochemistry and endpoint titration is calculated (FIG. 18). The appropriate amount is a measure of b-galactosidase gene expression and reflects changes in gene expression between cell populations under nomoxia and hypoxia conditions.

The titration obtained from the parent 'pEGASUS' vector (with CMV lacZ transcription unit) in the experiment does not change significantly under hypoxia, whereas the regulated vector, pEG-HRE-lacZ, titration is induced at least 100-fold. This data shows for the first time that it is possible to obtain highly efficient regulation with respect to lentiviral vectors.

Hypoxia regulation is also excessive in the luciferase reporter gene. This data reflects changes in the promoter activity of the cells in the population. Vector particles are produced as outlined above and used to transform D17 cells. The transformed cell populations are sown and cultured overnight in Normoxia and hypoxia. Cells undergo a luciferase assay and luminomemetry. Luciferase activity of cells converted to pEG-HRE-luc is increased 12-fold under hypoxia conditions (FIG. 19).

Alternative EIAV vectors of the invention are where the therapeutic and marker genes are expressed from a single transcription unit. Single transcription unit vectors generally prefer vectors containing SIN vectors and internal transcription units because of the advantages in vector production. This advantage is that SIN vectors must be introduced into producer cells by infection rather than transformation, which reduces the number of high efficiency producer clones that can often be obtained. It is also observed that vectors comprising internal transcription units generally give lower yields than single transcription unit vectors. Moreover, the replication of HRE achieved in the single transcription unit vector as we described above optimizes regulation. Single transcription unit lentiviral vectors regulated by hypoxia vectors are described below:

In this case lacZ is separated into Xho 1-Sph1 fragments and cloned into pSP72 to make pSPLacZ. IRES is generated by PCR to allow the resulting cloning to incorporate lateral restriction sites from pIRES-1hyg (Clontech).

ST1 (lead)

ATCGCTCGAGCTGCAGGGCCGCACTAGAGGAATTCGC

ST2 (complement)

GGTTGTGGCCCATGGTATCATCGTGTTTTTCAAAGG

This results in the Xho1 IRES Nco1 cassette. This cassette is cloned upstream of pSPlacZ of lacZ with the Nco1 site consistent with the ATG initiator of lacZ, pSPIRESlacZ. The IRES lacZ cassette was separated into Pst1 / Bst1107 fragments and was used to replace the CMV lacZ cassette of pE1PEGASUS + (resected into sse8387 / Bst1107 fragments). This plasmid is represented by pEG4 + IRES Z.

Duplicate PCR approaches are used to replace portions of the EIAV U3 enhancer region with HRE at 3'LTR. The same vector can be produced which yields large U3 regions from retroviruses or lentiviruses as described above or from other hybrid promoters. The only limitation is that the terminal nucleotides of the parent vector are reserved to confirm compatibility with the lentiviral integrase and the two R regions are consistent to allow efficient reverse transcription. Typical configurations for hybrid LTRs are described in detail in PCT / GB96 / 01230 and PCT / GB97 / 02858. The final configuration of this vector is shown in FIG.

Virus particles along with the pEGHRE genome are produced in three transient plasmid systems as described in Soneoka et al 1995, Nucl Acids Res 23,628. Alternatively, the vector can be introduced into a packaging cell line to produce stable producer cells. Appropriate packaging strains expressing the VSV-G envelope have been described [Yee et al. 1994 Proc. Natl. Acad. Sci. USA 91: 9564-9568; Ory et al. 1996 Proc. Natl. Acad. Sci. USA 93: 11400-11406; Yang et al. 1995 Human Gene Therapy 6: 1203-1213; Chen et al. 1996 Proc. Natl. Acad. Sci. USA 93: 10057-10062; Lefkowitz et al., 1990, Virology 178: 373-383; Arai et al. 1998 J. Virol. 72: 1115-1121.

Virus is titrated to D17 cells in parallel flares and flare cultures overnight in nomoxia (21% oxygen) or hypoxia (0.1% oxygen). Cells are stained by X gal histochemistry and endpoint titration is calculated (FIG. 18). The appropriate amount is a measure of B-galactosidase gene expression and reflects changes in gene expression between cell populations under nomoxia and hypoxia conditions.

The titration obtained from the parent 'pEGASUS' vector (with CMV lacZ transcription unit) in the experiment does not change significantly under hypoxia, whereas the regulated vector, pEG-HRE-lacZ, titration is induced at least 100-fold. This data shows for the first time that it is possible to obtain highly efficient regulation with respect to lentiviral vectors.

Hypoxia regulation is also excessive in the luciferase reporter gene. This data reflects changes in the promoter activity of the cells in the population. Vector particles are produced as outlined above and used to transform D17 cells. The transformed cell populations are sown and cultured overnight in Normoxia and hypoxia. Cells undergo a luciferase assay and luminomemetry. Luciferase activity of cells converted to pEG-HRE-luc is increased 12-fold under hypoxia conditions (FIG. 19).

Preparation of Autoregulated Hypoxic Responsive Lenti-Virus Vector

It has previously been shown that overexpression of HIF-1 alpha can increase expression from the number of hypoxia regulatory promoters (Semenza et al JBC 1996). This protein is unstable in normal cells and can be bypassed by overexpression. Thus overexpression will compromise the specificity of the hypoxic response. The discovery that the OBHRE promoter responds to E-PAS opens the way for amplifying the response to hypoxia. To avoid the problem of constitutive expression of HIF-1, we arranged the E-PAS gene into a lentiviral vector that itself responds to hypoxia. In this method, the vector is activated by hypoxia expressing the E-PAS gene and the E-PAS protein also responds to HRE to increase expression. Although HIF-1 is unstable to return oxygen levels to normal, this vector system has the advantage of providing a long term response to hypoxia. Initial priming of the vector is specific by HRE interacting with HIF-1 or E-PAS. Production of E-PAS maintains expression after the completion of the initial hypoxia stimulation. Ultimately, the reaction will collapse according to the half-life of the E-PAS protein.

Auto-regulated vectors expressing TSP-1 are shown in FIG. 20B. E-PAS coding sequences are obtained by PCR amplification according to known cDNA sequences (Accession number U81984; Trian et al 1997, Gene Dev. 11, 72.) using primers.

Example 7 Preparation of Hypoxia-responsive Adenovirus Vector for Expression of Therapeutic Gene

No matter what stage of division occurs when stem cells move to target tissue, they can still deliver therapy without division and differentiation. In this case a vector such as adenovirus can be used. Such vectors do not integrate their genes into the cell genome, so when the cells divide, the vector is gradually lost from the cell population. However, important vectors are still present in cells that differentiate into various lineages. CD34 + stem cells are converted to recombinant adenovirus vectors according to various methods (Neering et al 1996 Blood 88, 1147; Watanabe et al 1996, Blood 87, 5032; Watanabe et al 1998, Leukaemia and Lymphoma 29, 439; Bregni et al 1998, Gene Ther 5, 465; Frey et al 1998, Blood 91, 2781).

The first developing recombinant adenovirus vector (E1 / E3 deleted) was made such that the bacterial β-galactosidase reporter gene was under the control of a promoter regulated by hypoxia.

The first adenovirus vector consists of deletion of the E1 and E3 regions of the virus, allowing insertion into the left arm of the virus adjacent to the left inverted terminal repeat (ITR) of another DNA. Virus packaging signals (194-358nt) overlap with Ella enhancers and are therefore present in most El deleted vectors. This sequence can be relocated to the right end of the viral genome (Hearing and Shenk 1983, Cell 33, 695). Therefore, 3.2kb in the E1 deleted vector may be deleted (358-3525nt).

Adenoviruses can package 105% of the length of the genome, allowing an extra 2.1 kb addition. Therefore, the cloning capacity of E1 / E3 deleted virus vectors is 7-8 kb (2.1 kb + 1.9 kb (E3 removed) and 3.2 kb (E1 removed)). Recombinant adenoviruses cannot replicate in non-E1 supplemented cell lines because they lack the essential E1 initial genes. The 293 cell line was developed by Graham et al (1977, J Gen Virol 36, 59) and contains approximately 4 kb from the left end of the Ad5 genome, including ITR, packaging signal, E1a, E1b and pIX. The cells stably express the E1a and E1b gene products but do not express late protein IX despite the pIX sequences in E1b. In non-supplemented cells, the El deletion virus transduces the cell and is transported to the nucleus but without expression from the El deletion gene.

The diagram of FIG. 21 shows a general method used for making recombinant adenoviruses using the Microbix Biosystems-NBL Gene Sciences system.

A common method involves cloning of other DNA to an E1 shuttle vector and from 402-3328 bp the El region is replaced with another DNA cassette. The recombinant plasmid is transmitted to 293 cells with the pJM17 plasmid. pJM17 includes deletion of the E3 region and insertion of the prokaryotic pBRX vector (including ampicillin resistance and bacterial duck sequence) into the E1 region in 3.7 map units. Thus this 40 kb plasmid is so large that it cannot be packaged with adeno nucleocapsid but can grow in bacteria. Intracellular recombination in 293 cells led to the substitution of amp and orri sequences with the insertion of other DNA.

In the example cited here, two transfer vectors are used. The first one obtained from MicroVix is called pE1sp1A and the second one from Quantum Biotechnology is called pADBN. The pADBN plasmid has the advantage that new (other) DNA can be inserted in any direction. In some cases, it occupies insertions in other spatial relations with unique adenovirus genes that may adversely affect expression. In both cases the second DNA is a defective version of the adenovirus genome, for example as part of the viral DNA called the right arm of plasmid pJM17 or Ad5. Homologous recombination generates the final gene transfer vector.

The preparation of ischemic regulatory adenovirus vectors is described below:

The luciferase gene (FIG. 2) in OB37 is replaced by the bacterial b-galactosidase encoding gene from the pONY2.1 vector (FIG. 16B) to the NcoI-XbaI fragment.

The resulting OB HRE LacZ cassette was removed from the OB37 vector as a KpnI-SalI fragment and cloned into Quantum Biotechnologies ^™ pAdBN delivery vector producing AdenoOBHRElacZ.

The recombinant AdenoOBHRElacZ delivery vector is linearized (Ase I) and transferred to 293 cells to allow homologous recombination in vivo to result in the formation of the desired recombinant adenovirus with the clarified right arm of the Ad5 virus (from the ClaI site). This is summarized in FIG. 22. Adenovirus vectors containing HRE are called AdHRE depending on the inserted gene, for example AdHRE-lacZ has a bacterial β-galactosidase gene expressed by the OBHRE promoter. The range of other cell lines was converted to AdHRE-LacZ. After 6 hours conversion the virus is removed and replaced with fresh medium so that the cells are sown in two separate flocks and cultured overnight in nomoxia or hypoxia (0.1% oxygen). The results (FIG. 23) illustrate the hypoxia inducibility of LacZ reporter gene in adenovirus vectors in Chiang Liver and MCF-7 human breast cancer cell lines.

In addition, 7-14 days old primary human macrophages were converted identically to AdHRE-LacZ. These results demonstrate the availability of HRE-regulated recombinant adenovirus in cells in hematopoietic lineage as well as in transgenic.

The inserted DNA construct present in the adenovirus delivery vector is in the form of a spontaneous expression cassette containing the OBHRE promoter, LacZ coding sequence and SV40 polyadenylation signal. We observed that in the system described for the preparation of AdHRE (Quantum Biotech) high levels of protein expression are obtained when the expression cassette is in the direction of the El gene.

Alternative hypoxia response elements will be used as previously described.

HREs will be present in both 5 'and 3' multiple copies to increase the level of hypoxia induction.

In addition, HRE can be associated with tissue specific promoter elements to limit expression to specific tissue types or diseased tissue. For example, OBHRE can be used for binding to the XiaMac promoter to specifically regulate / increase expression in macrophages.

AdHRE vectors were constructed to contain therapeutic genes.

Examples for the preparation of AdHRE-2B6 and AdCMV-2B6 recombinant adenovirus vectors using the MicroVix Biosystems preparation system are described below. Plasmids are shown in FIG. 24 and are as follows:

a delivery vector adapted to contain a pE1HREPG-HRE 2B6 expression cassette

Delivery Vector PE1HREPG Using E1sp1A Delivery Plasmids from Microbix

The EMCV IRES GFP XbaI fragment from pCPGHRE is cloned into XbaI site 3 ′ with the 2B6 coding sequence in the pGL3OBHRE1p450 vector. The complete expression cassette is cloned into the microbix delivery vector pΔE1sp1B into the MluI-PshAI fragment to give pE1HREPG.

a delivery vector adapted to contain the pE1CMVPG-CMV 2B6 expression cassette (FIG. 25C)

The Bglll-NaeI CMV2B6 fragment from pCI-2B6 is cloned into the BamHI-EcoRV site of pΔE1sp1B. The EMCV IRES GFP XbaI fragment from pCPGHRE was cloned into XbaI site 3 ′ with the 2b6 coding sequence in the resulting plasmid to make pE1CMVPG (FIG. 25C).

Note: The use of the ires GFP reporter allows easier plaque purification of recombinant adenoviruses and provides viable cell markers for studying gene expression under different physiological conditions.

Any of the therapeutic genes outlined above can be inserted into a hypoxic regulatory adenovirus vector.

Example 8 Preparation of Adenovirus Vectors for Delivery of Lentivirus Components

In a detailed aspect of the invention an adenovirus vector comprising the components necessary to make a retrovirus or lentiviral vector is used to transform CD34 + ve stem cells. Stem cells converted to adenovirus vectors secrete retrovirus / lentiviral vectors. Adenovirus vectors in CD34 cells behave as they were previously described in the retrovirus factory [PCT / GB97 / 00210]. Adenovirus vectors can be arranged in several ways. First expression of one or all of the retrovirus / lentiviral vector components can be placed in an HRE regulatory adenovirus vector as described above. Instead, the vector component may be a lineage specific promoter such as a CMV promoter or an e-selectin promoter or a regulatory promoter such as the macrophage specific promoter or tetracycline regulatory system described above (Gosten and Bujard 1992 Proc Natl Acad Sci 89: 5547-5551). Or under a constitutive promoter, such as another regulated promoter / enhancer. In the latter case the specificity is given by the expression of the therapeutic gene from a retrovirus / lentiviral vector regulated by hypoxia described above. As an example the production of adenoviruses capable of producing lentiviral vectors is described.

Four adenovirus vectors are required to make the lentiviral vectors: genome, gagpol, envelope (eg Raviez G) and Rev. Lentiviral components are expressed from heterologous promoters and they contain the necessary introns (for high expression of gagpol. Rev and Lavies envelope) and polyadenylation signals. When these four viruses are converted to E1a minus cells, the adenovirus component will not be expressed but the heterologous promoter will allow expression of the lentiviral component. Examples are summarized below for the preparation of the EIAV adenovirus system (Application No .: 972135.7). EIAV is based on a minimal system lacking non-essential EIAV encoded proteins (S2, Tat or envelope). The envelope used to pseudotype EIAV is the Ravi envelope (G protein). Pseudotypes of EIAV are shown well (application number: 9811152.9).

Delivery plasmid

Described below is the preparation of a delivery plasmid comprising an EIAV component. The delivery plasmid is pE1sp1A (FIG. 25A).

Recombinant delivery plasmids can be used to make recombinant adenoviruses by homologous recombination in 293 cells.

The following plasmid is shown in the figure and attached.

A) pE1RevE. This provides the Rev protein required for efficient expression of gag and pol.

Plasmid pCI-Rev was cut with Apa LI and Cla I. The 2.3 kb band encoding EIAV Rev was blunted with Klenow polymerase and inserted into the Eco RV site of pE1sp1A to give plasmid pE1RevE (FIG. 26).

B) pE1HORSE3.1-gagpol manufacture

pHORSE3.1 is cut with Sna BI and Not I. 6.1kb band encoding EIAV gagpol is inserted into pE1RevE truncated with Sna BI and Not I (7.5kb band purified). This gives plasmid pE1HORSE3.1 (FIG. 27).

C) pE1PEGASUS-genome preparation

pEGASUS4 is cut into Bgl II and Not I. The 6.8 kb band containing the EIAV vector genome was inserted into pE1RevE truncated with Bgl II and Not I (purified 6.7 kb band). This gives plasmid pE1PEGASUS (FIG. 28).

D) pCI-Rab-Ravies Preparation

In order to make pE1Rab, the Raviez open reading frame is inserted into pCI-Neo (FIG. 29) by cleaving the plasmid pSA91RbG into Nsi I and Ahd I. The 1.25 kb band is blunt ended with T4 DNa polymerase and inserted into pCI-Neo clipped with Sma I. This gives the plasmid pCI-Rab (FIG. 30).

E) pE1Rab-Ravies Preparation

pCI-Rab is truncated with Sna BI and Not I. The 1.9 kb band encoding Ravi's envelope is inserted into pE1RevE truncated with Sna BI and Not I (7.5 kb band purified). This gives the plasmid pE1Rab (FIG. 31).

Any therapeutic gene or combination of genes can be inserted into a lentiviral vector as described above.

Example 9 Engineering Stem Cells to Express Prodrug Active Enzymes in Response to Hypoxia

Retroviral vectors, XiaGen-P450-G or lentiviral pSec-TSp1, are used to transform certain cell types. By way of example, we used human hematopoietic stem cells, human peripheral blood buffy coat and human cord blood. Isolation of CD34 ⁺ HSCs and retroviral mediated gene transfer to these cells are described (Charbord et al 1996, Br J Haematol 94, 449; Dunbar et al 1996, Hum Gene Ther 7, 231; Cassel et al 1993 Exp Haematol 21, 585; Emmons et al 1997, Blood 89, 4040; Jolly et al 1996 WO 96/33281; Kerr et al WO96 / 09400). Examples of suitable methods are as follows.

HSCs are obtained from peripheral blood after mobilization with G-CSF and / or cyclophosphamide (Casset et al 1993, Exp Haematil 21, 585). G-CSF (Amgen) is given to the skin in an amount of 10 μg / kg / day for 7 days. Apheresis and enrichment of HSCs is performed using the CellPro stem cell separator system (Cassel et al 1993, Exp Haematol 21, 585). Populations to which HSC was added were 4 μg / ml protamine sulfate and 20 ng / ml IL-3 (Sandoz), 50 ng / ml IL-6 (Sandoz), ng / ml from RRV producer cells (Example 1). Cultured at 10 ⁵ cells / ml in the presence of SCF (Amgen) (Santiago-Schwartz et al 1992, J Leuk Biol 52, 274; Charbord et al 1996, Br J Haematol 94, 449; Dao et al 1997, Blood 89, 446; Piacibello et al 1997, Blood 89, 2644; Cassel et al 1993, Exp Haematol 21, 585). Other cytokines and / or autologous stromal cells described (Dunbar et al 1996, Hum Gene Ther 7, 231) may also be added. After 24 hours, the cells are centrifuged and suspended again in fresh RRV containing medium with these growth factors and protamine sulfate. This is repeated after 24 hours and the cells are incubated up to 48 hours. After this time the cells are trypsinized, washed several times in fresh medium by centrifugation and resuspended in Plasma-Lyte A for reinjection. The total volume for reinjection is approximately 25-50 ml. Patients are infused up to 2 hours. The number of cells injected is at least 10 ⁵ cells and will be up to 10 ¹² cells.

Cells will mature along the myeloid differentiation pathway prior to reinjection according to published methods (Haylock et al 1992, Blood 80, 1405).

The transformation follows as described for retroviral vectors but the same method is used for lentiviral vectors:

Gene transfer of retroviruses and lentiviruses was enhanced by optimizing the culture conditions of the isolated CD34 cells to be cycled upon conversion. This is particularly necessary for MLV basal vectors that require cell separation to enable nuclear access and integration. Pseudotyping MLV vectors, along with other envelopes, have caused significant damage to gene transfer. As reported, GALV is better than VSVG.

We used a defined medium so that the cells were cycled upon conversion. The use of limited media ensures that proliferation factors are present when there are no antiproliferative factors found in serum or more complex media.

Isolation of CD34 cells is delivered for at least 24 hours in the following medium (based primarily on Becker et al 1998, Hum Gene Ther 9, 1561) prior to conversion. Serum-free medium X-VIVO 10, 1% BSA, 2 mM L-glutamine, 1% pen / strep, 20ng / ml IL 3, 100U / ml IL 6, 50ng / ml SCF, 100ng / ml anti-TGFb, 100ng / ml Flt 3-L. The outlined conversion protocol (Becker et al 1998 HGT 9 1561-1570) is used. This involves three cycles over three days and optimizes many of the cells that undergo mitosis in the presence of viral vectors. The method is summarized as follows:

Non-tissue culture grade plates at 10 μg / cm ² are coated with fibronectin fragment CH-269. The virus is added to the hollow wells and allowed to stick for 30 minutes. Wash with PBS. Add 10 ⁵ cells to 0.5 ml medium per well. 0.5 ml of supernatant virus is added. Centrifuge at 1020 × g for 90 minutes. Change to fresh medium after 4 hours. Repeat this for 3 days.

CD34 cells from cord blood form a widespread progenitor type but cells isolated from peripheral blood or sources obtained from peripheral blood preferentially form a high proportion of erythroid progenitors. Cord blood from cells has a high proliferative capacity. Increased stem cells can be obtained from peripheral blood 'mobilized' prior to separation from GM CSF. This approach is widely used in transplant patients.

Cells were cultured in a dark Class II safety cabinet containing metocells containing growth factors (10% petal bovine serum, transferrin, glutamine, 2-mercaptoethanol, bovine serum albumin, IL3, IL6, IL11, SCF, Metocells including Epo, GCSF, GMCSF). Using blunt needles attached to a 2.5 ml syringe, 2.5 ml metocells are injected without bubbles into a 10 ml U tube. 0.5 ml of the cell suspension (containing the required 3x cells per well so that 1 ml of metocell contains the desired cell number of 500/2000 cells per well) is injected into the tube containing metocells in Iscove's medium (Gibco) and weakly Swirl. The dishes are incubated at 37 ° C., 5% CO ₂ , 5% O ₂ and after 14 days colonies are analyzed.

GM precursor colonies are analyzed for expression of retroviral vectors by observing fluorescence of GFP. It is assessed under nomoxia and hypoxia.

Alternatively the stem cell population is converted to the same process described above but immediately after isolation. They can be frozen or used immediately for delivery to the patient.

Example 10 Interaction Between Engineered HSCs and Ovarian Cancer Xenografts

As an example of the invention we chose to study HSC infiltration into tumors using ovarian cancer as a test system. This cancer is largely limited to the peritoneal pupil. The number of animal models is useful for analyzing HSC infiltration into ovarian tumors. Three human ovarian cancer xenografts OS, HU and LA, are obtained from primary human tumors and built intraperitoneally and maintained in that way by continuous passage (Ward et al 1987, Cancer Res 47, 2662).

The same procedure is used with AdHRE vectors following the published stem cell transformation procedure as follows. Adenovirus vectors were used at high levels of infection (100-500) for 24 hours in small amounts of culture medium containing 200 units / ml IL-3, 200 units / ml GM-CSF, 200 units / ml G-CSF. Used to convert HSC. After conversion with adenovirus, HSCs can be differentiated or used immediately. When differentiated cells are used, colony forming unit- granulocytes / macrophages (CFU-GM) are quantified in soft agar containing the cytokines of the stomach after 14 days of culture. CD34 + cells or differentiated cells are introduced into the animal and migrate to the target tissue to express the therapeutic gene.

Example 11 Treatment of Ovarian Cancer with Regulated Human Stem Cells

Peripheral blood lymphocytes are collected from ovarian cancer patients as follows. The cells are transformed with the XiaGen-P450 retroviral vector described above. The stem cells prepared are returned to the patient via intraperitoneal infusion as described for monosite in Stevenson et al 1987, Cancer Res 47, 6100. In 50 ml of isotonic saline 10 ⁸ -10 ⁹ cells are introduced into the abdominal cavity directly through a needle catheter monitored with ultrasound. The decrease in tumor mass is the result of local activation of cyclophosphamide by the prepared stem cells.

The same procedure is used with the AdHRE vector following the stem cell transformation process outlined above.

Example 12 Conversion of Tumor Cells Using Lenti-Virus Vectors

As another example of the present invention, we decided to study gene transfer to glioma. Glyoma is characterized by hypervascularity and invasiveness, one of the most hypoxic tumors studied [J. Folkman pp 3075-3085 In Cancer: Principles and Practice of Oncology, Fifth Edition ed DeVita, Hellman, Rosenberg. Pub. Lippincott-Raven 1997]. Suitable lentiviral vectors are shown in FIG. 32. The model system uses human cell line U87MG or rat RT-2 line. Both give typical veinized tumors that can be analyzed in normal mice or nude or SCID mice (eg Wei et al 1994, Human Gene Therapy 5, 969). The same process is used to deal with patients. In this case the tumor may be located by PET or MRI scanning and injected with 0.1 ml of the vector or alternatively the site may be treated with the vector upon surgical debulking. The patient is treated with cyclophosphamide and the decrease in tumor growth is monitored by MRI scanning.

Example 13 Induction of Lentivirus Vector Production and Expression by Desferrioxamine

Desperioxamine is obtained from Sigma or as a licensed product Deferal in clinical formulation from Novartis Pharma. The level of induction composed of desperal is equal to or greater than that caused by hypoxia.

Producer cells comprising hypoxia regulated lentiviral vectors for in vitro use are incubated in flasks for 10 days in the presence of 50 micromolar to 1 millimolar desferrioxamine. Incubation releases the vector particles to give a total yield in excess of 10 ⁷ / ml during this period. To increase scale, cells are cultured in roller bottles and desperioxamine is used at 50-200 micromolar for 7 days. The system thus exploits the presence of HRE to allow the induction of viral vectors. The system is described where the genome is regulated by HRE in response to desperioxamine.

For in vivo use, the patient is treated with a cell comprising a hypoxia controlled lentiviral vector or a hypoxia regulated lentiviral vector. Patients are given a standard course of treatment with desferrioxamine. This activates therapy in addition to the effects of hypoxia and in some cases will replace the need for local hypoxia.

Split Intron Technology

The following are obtained from our co-pending PCT application and provide a way to invent retroviral vectors with split-intron features. These details can be adjusted to produce one or more vectors capable of delivering ILRE regulated NOIs to the cell along with the split-intron arrangement. A PCT patent application titled "Vector" is added here and all its content is incorporated herein by reference.

Retroviral vector consisting of functional splice donor site and acceptor site

The present invention relates to a vector.

In particular, the present invention relates to a new system for packaging and expressing genetic material in retroviral particles.

More specifically, the present invention relates to a new system that can produce retroviral particles capable of delivering a specific nucleotide sequence (hereinafter abbreviated as "NOI" or plurally as "NOIs") to one or more target sites.

The invention also relates to novel retroviral vectors which are particularly useful for gene therapy.

Gene therapy includes any one or more of adding, replacing, deleting, supplementing, or preparing one or more nucleotide sequences at one or more target sites, such as target cells. If the target site is a target cell, the cell may be part of a tissue or organ. General guidelines for gene therapy are described in Molecular Biology (Ed Robert Meyers, Pub VCH, p556-558).

In another example, gene therapy can provide the following methods. That is, the nucleotide sequence can be used to replace or supplement a defective gene. As with the gene, pathogenic nucleotide sequences or expression products may be removed therefrom. Nucleotide sequences or expression products, such as the above genes, can be added or inserted, for example, to make a more favorable phenotype. Nucleotide sequences or expression products, such as the genes above, may be added or inserted therefrom for the purpose of selecting transformed cells and cells that are not transformed, for example. Cells may be used to treat or prevent cancer (Schmidt-Wolf and Schmidt-Wolf, 1994, Annals of Hematology 69: 273-279) or other disease states such as immune, cardiovascular, neurological, inflammatory or infectious disorders. Can be handled at the molecular level. Antigens can also be made or inserted to induce an immune response, such as a genetic vaccine.

Recently, retroviruses have been considered useful for gene therapy. In particular, retroviruses are RNA viruses that have a different life cycle from lytic viruses. In this regard, retroviruses are infectious agents that replicate via DNA mediators. When a retrovirus infects a cell, its genome is converted into DNA form by reverse transcriptase. DNA copies serve as templates for protein production essential for the assembly of new RNA genomes and viral particles.

There are many types of retroviruses, for example: Murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse mammary tumor virus (MMTV) , Rus sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine asteosarcoma virus: FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus -29: MC29), and Avian erythroblastosis virus (AEV).

A detailed list of retroviruses is disclosed in Coffin et al ("Retroviruses" 1997 Cold Spring Harbor laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763).

Details of the genome structure of retroviruses will be conventional techniques. For example, HIV can be found in NCBI Genbank (i.e. Genome Accession No. AF033819).

In particular, the wild type retrovirus consists of three major coding domains (gag, pol, env) that encode essential viral proteins. Nevertheless, retroviruses generally fall into two categories: "simple" and "complex". These categories are divided according to the composition of their genome. Simple retroviruses usually have only basic information. Complex retroviruses, on the other hand, contain regulatory proteins derived from complex linked messages.

Retroviruses are classified into seven groups. Five of these are retroviruses with the potential of oncogenes. The other two groups are lentiviruses and spumaviruses. An overview of these retroviruses is given in "Retroviruses" (1997 Cold Spring Harbor laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 1-25).

All oncogene members except the human T-cell leukemia virus-bovine leukemia virus group are simple retroviruses. HTLV, BLV and lentiviruses and spumaviruses are complex retroviruses. The most well-researched oncogene retrovirus types are the Raus sacoma virus, the mouse barley tumor virus, the murine leukemia virus, and the human ticell leukemia virus.

Lentivirus groups can be classified into "primate" and "non-primate". Examples of free lentiviral viruses include human immunodeficiency virus, agents that cause AIDS, and apes immunodeficiency virus. In the non-primate lentiviral group there is a prototype of the "slow virus" visna / maedi virus. There are also goat arthritis-encephalitis virus (CAEV), apes infectious anemia virus (EIAV), the more recently found feline immunodeficiency virus (FIV), and bovine immunodeficiency virus.

The difference between the lentiviral family and other types of retroviruses is that the lentiviral has the ability to infect both dividing and non-dividing cells (Lewis et al 1992 EMBO.J 11: 3053-3058; Lewis and Emerman 1994 J. Virol. 68: 510-516). On the other hand, other retroviruses, such as MLV, cannot infect non-dividing cells, such as building muscle, brain, lungs, and liver tissue.

During the infection process, retroviruses first attach to specific receptors on the cell surface. When invading host cells, the RNA genome of the retrovirus is replicated into DNA by reverse transcriptase in the parent virus. This DNA is delivered to the host cell nucleus and later inserted into the host's genome. Viruses at this time are called proviruses. Proviruses are on the host's chromosome during cell division and are then transcribed like other cellular proteins. Proviruses encode the packaging machinery needed to make proteins and more viruses, and can leave cells by a process called "budding."

As already pointed out, the genome of each retrovirus consists of genes called gag, pol, and env, which encode the proteins and enzymes of the virus. In proviruses, these genes are at both ends of what are called long terminal repeats (LTRs). LTRs are involved in the insertion and transcription of proviruses. They are also provided as enhancer-promoter sequences. In other words, LTRs regulate the expression of viral genes. Encapsidation of retroviral RNAs is caused by psi sequences located at the 5 'end of the viral genome.

LTRs themselves are identical sequences and can be divided into three elements: U3, R and U5. U3 is a unique sequence at the 3 'end of RNA. R is a repeating sequence at both ends of the RNA and U5 is a unique sequence at the 5 'end of the RNA. The size of the three elements varies considerably between different retroviruses.

The simple genetic structures of the RNA and DNA forms of the retroviral genome are shown below, indicating the basic features of LTRs and the relative positions of gag, pol, and env.

As shown in FIG. 29, the RNA genome of the infectious retrovirus is composed of (5 ') R-U5-gag, pol, env-U3-R (3'). In the defective retroviral vector genome, gag, pol and env are missing or have no function. The R sites at both ends of the RNA are repeat sequences. U5 and U3 are unique sequences at the 5 'and 3' ends of the RNA genome, respectively.

Reverse transcription of viral RNA into double stranded DNA occurs in the cytoplasm, with two jumps of reverse transcriptase from the 5 'end to the 3' end of the template molecule. These jumps result in duplication of sequences located at the 5 'and 3' ends of the viral RNA. These sequences are then linked side by side at both ends of the viral DNA, forming LTRs containing R U5 and U3. When reverse transcription is complete, the viral DNA is translocated into the nucleus. A linear copy of the retroviral genome, called the preintegration complex (PIC), assists the viral integrase to form a robust provirus. It is randomly inserted into the chromosomal DNA. Sites that can be inserted into the host cell genome are very large and widely distributed.

Regulating transcription of the provirus is in the uncoded sequence of the viral LTR. The site where transcription begins is at the interface of U3 and R in the left LTR, and the poly A site is at the interface of R and U5 in the right LTR. U3 contains most of the transcriptional regulatory elements of proviruses. That is, cells and in some cases active proteins and promoters involved in the transcription of the virus and complex enhancer sequences. Some retroviruses have more than one gene, such as tat, rev, or rex, that encodes proteins involved in regulating gene expression.

Transcription of Proviral DNA Regenerates viral RNA with full length and genomic and subgenomic size RNA molecules resulting from RNA processing. In general, all RNA products are used as templates for viral protein production. Expression of the RNA product is the result of a combination of splicing of RNA transcripts and ribosomal framshifting during translation.

RNA splicing refers to a process in which intron RNA sequences are removed and the remaining exon sequences are linked to each other to provide a continuous reading frame for translation. The primary transcript of retroviral DNA is modified in several ways and is similar to the mRNA of the cell. However, unlike most cell mRNAs where all introns are efficiently spliced, the newly synthesized retrovirus RNA is classified into two groups. One population remains unspliced to serve as genomic RNA and the other spliced to be used as subgenomic RNA.

The unspliced full sequence RNA transcript of a retrovirus serves two functions. First, they encode the gene output of gag and pol. Second, it is packaged into progeny virion particles as genomic RNA. Sub genomic RNA molecules serve as mRNA for the remaining viral gene products. The transcript of the spliced retrovirus has the first exon, which is linked to the U5 region of the 5'LTR. The last exon varies in size but always has the U3 and R regions coded by the 3'LTR. The composition of the rest of the RNA structure depends on the number of splicing and which splice site to choose.

In the case of simple retroviruses, one population remains unspliced so that the newly synthesized retrovirus RNA can be used as genomic RNA and as gag and pol mRNAs. For other populations, the 5 'portion of genomic RNA is spliced to connect to downstream genes, mainly env. Splicing uses splice donors located upstream of the gag and splice acceptors near the 3 'end of pol. The intron between the splice donor and the splice acceptor is removed by splicing and has the gag and pol genes. This splicing produces mRNA for the envelope protein. In general, splice donors are upstream of gag, but for viruses such as ASLV, it refers to a few codons on the gag gene side, resulting in primary Env translations with gag and a few amino-terminal amino acid residues. Create a product. Env proteins are synthesized in a polyribosome in a membrane-bound form, and are delivered to the cell membrane of a cell through vesicular transport to bind viral particles.

Complex retroviruses produce two cases of simple or complex splices, which encode not only the Env gene product, but also a set of regulatory and coproteins that are unique to these viruses. Lentiviruses and, in particular, complex retroviruses such as HIV, are examples of alternative splicing that can occur during retrovirus infection. For example, HIV-1 can produce more than 30 different mRNAs through primary splicing from primary genomic transcripts. This selection process appears to be regulated when there is a mutation that can change the splicing pattern and disrupt a competitive splicing acceptor that can affect the ability of the virus to infect (Purcell and Martin 1993 J Virol 67: 6365-). 6378).

The ratio of full-length RNA to subgenomic RNA varies depending on the infected cells, and adjusting the levels of these transcripts is a control step that occurs during gene expression of retroviruses. In order for genes of retroviruses to be expressed, both splice RNA and non-splice RNA must be delivered to the cytoplasm and these RNAs must be maintained at an appropriate ratio for efficient retrovirus gene expression. Other kinds of retroviruses have evolved clear solutions to this problem. Simple retroviruses use full-length and spliced RNA in a simple manner, using their efficient splice site for their genome or their cytoplasmic ratio with the help of several cis-acting elements. Adjust Complex retroviruses produce RNA in two cases, simply spliced or complex spliced, which have a protein product of one of the auxiliary genes, such as rev in HIV-1 and rex in HTLV-1. It regulates the transport and splicing of different genomes and subgenomic RNAs.

Looking more closely at the structural genes gag, pol and env, gag encodes the virus's internal structural protein. Gag is proteolytically processed into mature protein MA (matrix), CA (capsid), NC (nucleocapsid). The pol gene contains both DNA polymerase and RNase H and integrase to encode reverse transcriptase and is involved in genome replication. The env gene encodes virion's surface glycogen protein (SU) and transmembrane protein (TM), which bind specifically to receptor proteins in cells to form a complex. This binding leads to the fusion of cell and viral membranes.

Env proteins are viral proteins that play a key role in coding viral particles and allowing viruses to invade target cells. The envelope glycoprotein complex of retroviruses contains two polypeptides. That is, it has hydrophilic polypeptide (SU) and membrane-spanning protein (TM) with glycosyl groups attached to the outside. In addition, they produce oligomeric "hogs" or "hump spikes" on virion surfaces. Both polypeptides are encoded by the env gene and are synthesized in the form of polyprotein precursors and hydrolyzed during delivery to the cell surface. Although uncleaved Env proteins can bind to receptors, cleavage is essential for promoting the fusion ability of the proteins involved in the virus entering the host cell. Both SU and TM proteins have glycosyl groups attached to multiple sites. However, for viruses such as MLV, the TM does not have glycosyl groups attached.

While SU and TM proteins are not necessary for the assembly of enveloped virion particles, they play an important role in the invasion process. At this time, the SU domain binds to a receptor in the target cell. This binding promotes the ability of the TM protein to induce membrane binding after the virus and cell membranes bind. Viruses such as MLV remove short fragments of the cytoplasmic tail of the TM through the cliché, preventing them from restoring the protein's fusion ability (Brody et al 1994 J Virol 68: 4629-4627; Rein et al 1994 J Virol 68). (1773-1781). The cytoplasmic "tail" of the membrane spanning segment of the TM remains on the inner side of the viral membrane, varying in length for each retrovirus. Thus, the binding specificity between SU and the receptor limits the tissue flexibility of the host and retrovirus. In some cases, these specificities limit the transduction capacity of the recombinant retroviral vector. Here, transduction refers to a process of using a viral vector to deliver a gene other than the viral gene to a target cell. For this reason, MLVs have been used in many gene therapy experiments. MLV, which contains an envelope protein called 4070A, is known as an amphotropic virus and can infect human cells because the phosphate transfer protein and envelope protein that are conserved in humans and mice dock together. . Such transporters exist everywhere and these viruses can infect several cell types. In some cases, however, it is beneficial for the target cells to be limited in terms of stability. Finally, some groups have created mouse ecotropic retroviruses that specifically infect specific human cells, unlike emporotic viruses that can also infect mouse cells. By replacing fragments of the Env protein with erythropoietin segments, they were made into recombinant retroviruses that specifically bind to human cells and make erythropoietin receptors on their surface like precursors of red blood cells (Maulik and Patel 1997 "Molecular Biotechnology: Therapeutic Applications and Strategies "1997 Wiley-liss Inc. pp 45).

In addition to gag, pol and env, complex retroviruses carry an "accessory" gene that encodes an accessory or auxillary protein. Accessory or nascent proteins usually refer to proteins encoded by the accessory gene in addition to those encoded by the replication or structural genes gag, pol and env. These accessory proteins are different from those involved in controlling gene expression, such as those encoded by tat, rev, tax, and rex. Accessory genes are vif, vpr, vpx, rpu, nef and one or more of them. These accessory genes are found in HIV. Non-essential accessory proteins are involved in the partial replication of the functions provided by cellular proteins in particular cell types. The accessory gene is located between pol and env, either in the U3 region of the LTR or downstream of env, which contains a duplicate of env.

Complex retroviruses have evolved regulatory mechanisms using encoded transcriptional activators as well as transcriptional factors of cells. These transacting viral proteins act as activators in RNA transcription that progress in the LTR direction. Transcriptional trans activity of lentiviral is encoded by the viral tat gene. Tat binds to a stable, stem-looped RNA secondary structure called TAR, and Tat is optimally on the surface when transactivate transcription occurs.

As mentioned earlier, retroviruses have been used as delivery systems or delivery vectors that deliver NOI to one or more specific sites. Transfers can occur in laboratory, in vitro and in vivo experiments. Retroviruses when used in this manner are called retroviral vectors or recombinant retroviral vectors. Retroviral vectors have also been developed to study various aspects of the retroviral life cycle, including receptor usage, reverse transcription and RNA packaging (Miller, 1992 Curr Top Microiol Immunol 158: 1-24).

In the case of recombinant retroviral vectors used for gene therapy, one or more of the gag, pol, and env protein coding regions are removed from the virus. This creates a replication defective state of the retroviral vector. The removed part is replaced with NOI, creating a virus whose genome can be inserted into the host's genome. However, the modified viral genome cannot reproduce by itself because it lacks structural proteins. When inserted into the host genome, the expression of NOI results in, for example, a therapeutic or diagnostic effect. The delivery of a NOI to a specific site is done in the following ways: That is, the NOI is inserted into a recombinant retroviral vector or a modified viral vector is packaged into a virion coat or transduced into a specific site such as a target cell or a target cell population.

It is possible to breed and isolate using packaging or helper cell lines together or using recombinant vectors to obtain appropriate titers of retroviral vectors for transduction of specific sites.

For example, breeding and isolation requires the isolation of the gag, pol, and env genes of the retrovirus and the insertion of each of those genes into a host cell to create a "packaging cell line." The packaging cell line produces the proteins needed to package the retroviral DNA but does not cause encapsidation because there is no psi region. However, if a recombinant vector containing NOI and psi regions is put into a packaging cell line, the helper protein will package a psi-positive recombinant vector to produce a recombinant virus stock. It can be used to transduce cells so that they can put NOI in the cell genome. Recombinant viruses with genomes lacking the genes needed to make viral proteins can only be transduced once, but cannot multiply. These viral vectors that allow the transduction of target cells once are called replication defect vectors. Thus, NOI can be inserted into the genome of a host or target cell that does not have a potentially harmful retrovirus generation. Available packaging cell lines are summarized in "Retroviruses" (1997 Cold Spring Harbor Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp449).

The design of retrovirus packaging cell lines has been undertaken to deal with the spontaneous generation of helper viruses, a problem encountered since the initial design. Recombination has become very convenient due to homology, which has reduced the production of helper viruses by reducing or eliminating homology between the vector and the helper genome. Recently, gag, pol, and env viral coding regions are added to each expression plasmid to transfect independently of the packaging cell line, resulting in packaging cells that produce wild-type viruses through three recombinations. lost. This approach reduces the chance of creating a replication-competent virus. This strategy is sometimes called the plasmid transfection method (Soneoka et al 1995 Nucl. Acids Res 23: 628-633).

Transient transfection can be used to measure vector production from the time the vector is created. Transient transfection reduces the time needed to create robust vector producing cell lines and is used when vector or retroviral packaging components are harmful to the cell. Components used to make retroviral vectors include plasmids encoding Gag / Pol proteins, plasmids encoding Env proteins, and plasmids containing NOIs. Vectors are generated by transient transfection of one or more of these components into cells having other necessary components. If the vector encodes a gene or harmful gene that interferes with the division of the host cell, such as a gene that causes cell cycle inhibitors or apoptosis, it is difficult to build a robust vector producing cell line, but it is difficult to produce the vector before the cell dies. Transient transfection can be used to generate. Cell lines have also been developed by using transient impact to produce vector titer levels comparable to those obtained in robust vector producing cell lines (Pear er al 1993, Proc Natl Acad Sci 90: 8392-8396).

From the point of view of the toxicity of HIV proteins, it is difficult to produce robust HIV-based packaging cells, but HIV vectors are generally made through the transient transfection of vectors and helper viruses. Some researchers have changed the HIV Env protein from that of the Vesicular Sclerosis virus (VSV). Incorporation of Env protein into VSV raises the titer of HIV / VSV-G vector produced by transient transfection to the same concentration as 5 x 10 ⁵ (10 ⁸ after concentration) (Naldini et al 1996 Science 272: 263 -267). Therefore, transient transfection of HIV vectors is a useful strategy for producing vectors with high titer concentrations (Yee et al 1994 PNAS. 91: 9564-9568).

Given the titer of the vector, the actual use of the retroviral vector is concentrated and purely separated from the titer of transducing particles (no more than 10 ⁸ particles per milliliter) and virus that can be retained in vitro culture. The sensitivity of many envelope viruses to the existing biochemical and physicochemical techniques used to make them very limited.

For example, several methods have been developed for enriching retroviral vectors. Centrifugation (Fekete and Cepko 1993 Mol Cell Biol 13: 2604-2613), hollow fiber filtration (Paul et al 1993 Hum Gene Ther 4: 609-615), tangential flow filtration filtration) (kotani et al 1994 Hum Gene Ther 5: 19-28). Although the virus titer has increased 20-fold, the relative weakness of the retrovirus Env protein limits the ability to concentrate retroviral vectors, and generally virions in infected viruses are rare. This problem can be overcome by replacing the more robust VSV-G protein with the retrovirus Env protein, as well as providing better yields and more effective vector concentrations, while VSV-G proteins are highly effective in cells. It has the drawback of being toxic. The titer of the vector without helper viruses available from the currently available vectors is 10 ⁷ cfu per milliliter, but experiments can be carried out with much lower titer vector stocks. For practical reasons, however, high titer viruses are used to infect large numbers of cells. In addition, high titers are required to increase the percent transduction of a particular cell type. For example, the frequency of infection of human hematopoietic progenitor cells depends on the titer of the vector, and the frequency of infection also occurs only in high titer stocks (Hock and Miller 1986 Nature 320: 275-277; Hogge and Humphries 1987 Blood 69: 611-617). In this case, it is not enough to put a larger volume of virus than cells to compensate for low virus titers. Conversely, in some cases, the concentration of infectious vector virions may play an important role in promoting efficient transduction.

Researchers have been trying to create high titer vectors for use in gene transfer. For example, it is possible to determine the essential factors for producing viruses with high titers compared to other vectors. Early studies on other retroviral vector designs have shown that almost all MLV's internal protein coding regions have been removed without removing the vector's infectivity (Miller et al 1983 Proc Natl Acad Sci 80: 4709-4713). These initial vectors simply have a small portion of the 3 'end of the env coding region. Subsequent studies show that all of the env gene coding sequence is removed but the titer of the vector is not reduced (Miller and Rosman 1989 Biotechnique 7: 980-990; Morgenstern and Land 1990 Nucleic Acids Res 18: 3587-3596). Segments required for plus and minus strand DNA priming and regions for viral RNA to selectively package virions (psi sites; Mann et al 1983 Cell 33: 153-159) The short region connecting the LTR and LTR of the virus has been considered essential for vector delivery. Nevertheless, viral titers obtained through these early vectors were still about 10 times lower than the parental helper virus titers.

Experiments have shown that having the sequence at the 5 'end of the gag gene raises the titer of the viral vector, which is due to the increased packaging of viral RNA into virions (Armentano et al 1987 J Virol 61: 1647-). 1650; Bender et al 1987 J Virol 61: 1639-1646; Adam and Miller 1988 J Virol 62: 3802-3806). This effect is not due to viral protein synthesis from the gag region of the vector. This is because breaking the gag reading frame or transforming the gag codon into a stop codon did not affect the titer of the vector (Bender et al 1987 ibid). Experiments have demonstrated that the sequence required for efficient packaging of genomic RNA in MLV is larger than the psi signal identified through deletion analysis (Mann et al 1983 ibid). To get high titers (greater than 10 ⁶ to 10 ⁷ ), it is important that a larger signal called psi plus is included in the retroviral vector. These signals are now demonstrated to be downstream of the gag start codon upstream of the splice donor (Bender et al 1987 ibid). Because of this location, spliced env expressing transcripts do not have this signal. This demonstrates that only full length transcripts containing three essential genes are packaged during the viral life cycle.

In addition to making retroviral vectors in terms of increasing the titer of the vector, the retroviral vectors are designed to induce the production of specific NOIs (commonly called marker proteins) in transduced cells. As already mentioned, one of the most common retroviral vectors is to replace one or more NOI and retroviral sequences to make them a replication defective vector. The simplest method is to use a promoter in the 5 'LTR of the retrovirus to regulate the expression of the cDNA encoding NOI or to alter the enhancer and promoter of the LTR to confer tissue-specific expression or induction. Another method is to express an coding region by using an internal promoter to make it weaker when selecting a promoter.

This strategy to express specific genes has been most easily used when NOI is the selection marker, and in the case of hypoxanthine-guanine phosphoribosyl transferase (Miller et al 1983 Proc Natl Acad Sci 80). (4709-4713) facilitates the selection of cells transduced with vectors. If the vector has a NOI rather than a selection marker, the vector can be inserted into the packaging cells by co-transfection with the selection marker in the separate plasmid. This approach appears to be beneficial for gene therapy in that single proteins are expressed in the final target cells and avoid the virulence potential or antigenic potential of the selection marker. But if the inserted gene is not selected, this approach has the drawback that it is much more difficult to produce cells that produce high titer vector stocks. In addition, it is generally much harder to determine the titer of a vector. Three common methods are used to create retroviral vectors that express two or more proteins. These methods firstly express different proteins from splice mRNAs transcribed in one promoter, and secondly, promoters and internal promoters in 5 'LTR to proceed with transcription of another cDNA, and third, open. The use of internal ribosomal invasion site elements that allows translation of multiple coding regions from a single mRNA or fusion protein that can be expressed from an open reading frame.

Vectors containing internal promoters have been used primarily to express complex genes. Internal promoters use a combination of a promoter and an enhancer different from the viral LTR in proceeding gene expression. Multiple internal promoters may be included in the retroviral vector, allowing expression of three different cDNAs from their promoters (Overell et al 1988 Mol Cell Biol 8: 1803-1808).

While there are many modified retroviral vectors used for expression of NOI in various mammalian cells, most of these retroviral vectors are simple retroviruses that do not transduce cells that do not divide, such as murine oncoretroviruses. Is made from

For example, a widely used vector is a selective splicing to express genes from viral LTR SV (X) (Cepko et al 1984 Cell 37: 1053-1062) and neomycin phosphotransferase as a selector marker. (neomycin phosphotransferase). This type of vector model includes the parental virus MO-MLV, where the Gag and Gag-Pol proteins are translated from full-length viral mRNAs, and the Env protein is made from splice mRNAs. The protein encoded by the vector is translated from full-length RNA while the secondary gene output splicing connects the splice donor near the 5 'LTR to the splice acceptor upstream of the secondary gene. It is translated through. One drawback of this method is that an external sequence must be inserted into the intron of the splice gene. This leads to selective splice acceptors that affect the ratio of splice RNA to nonsplice RNA or interfere with the production of splice RNA encoding secondary gene output (korman et al 1987 Proc Natl Acad Sci 84: 2150-2154). Because these effects are unpredictable, they may affect the production of coding genes.

Other modified retroviral vectors can be divided into two classes in terms of their splicing capacity.

The first class of modified retroviral vectors is represented by the pBABE vector (Morgenstern et al Nucleic Acid Research 18: 3587-3596), which has a mutation (GT → GC) in the splice donor to allow splicing of the virus's transcript. Suppress Such splicing suppression is beneficial for two reasons. First, all virus transcripts have packaging signals that can be packaged into producer cells. Second, it impedes improper splicing between the splice donor of the virus and the hidden splice acceptor of the inserted gene.

The second class of vectors of modified retroviruses is called N2 (Miller et al 1989 Biotechniques 7980-990) and more recently MFG (Dranoff et al 1993 Proc Natl Acad Sci 19: 3979-3986), a functioning intron There is this. Both of these vectors use normal splice donors that are within the packaging signal. However, their respective splice acceptors are different. In the case of N2, the SA is in an "extended" packaging signal (Bender et al 1987 ibid). For MFG, a natural SA (in pol in FIG. 1) is used. Both of these vectors have demonstrated that splicing significantly improves gene expression in transduced cells (Miller et al 1989 ibid; krall et al 1996 Gene Therapy 3: 37-48). Such observations support previous findings that splicing can improve the translation of mRNA (Lee et al 1981 Nature 294: 228-232; Lewis et al 1986 Mol Cell Biol 6: 1998-2010; Chapman et. al 1991 Nucleic Acids Res 19: 3979-3986). For this reason, the same machine that is involved in transcript splicing could also help release transcripts from the nucleus.

Unlike the modified retroviral vectors mentioned above, studies have not been conducted on selective splicing in the lentiviral system, a retrovirus that can infect non-dividing cells (Naldini et al 1996 Science 272: 263). -267). The only known lentiviral vectors to date are from HIV-1 (Kim et al 1997 J Virol 72: 811-816) and FIV (Poeschla et al 1998 Nat med 4: 354-357). These vectors still have splice donor and acceptor sequences derived from viruses (naldini et al 1996 ibid).

Another approach has been attempted to develop vectors with high titers for gene transfer, such as adenoviruses, adeno-associated viruses, herpes viruses, pox viruses. The same differentiated viral vector or modified retroviral vector is used.

Adenoviruses are viruses with double stranded linear DNA and do not pass through RNA intermediates. There are more than 50 different human serotypes, which can be divided into six groups depending on the genome sequence homology. Targets of adenovirus cause weak symptoms in the respiratory tract or gastrointestinal epithelium. The serotypes 2 and 5 have 95% sequence homology and are mainly used in adenovirus vector systems to infect the upper airways of young children.

Adenoviruses are regular icosohedrons without envelopes. A common adenovirus is a DNA virus wrapped in a 140 nm long capsid. The virus's isosomeron consists of 152 capsomers. That is, 240 hexons and 12 pentons. The core of the particle has a terminal protein (TP), which acts as a primer during DNA replication, and a 36kb long double stranded DNA covalently bonded to the 5 'end. DNA has inverted terminal repeats (ITR) and their length varies depending on the vertical type.

The entry of adenoviruses into cells involves a series of processes. The virus attaches to the cell by binding between the fiber of the virus (37 nm) and the fiber receptor of the cell. These receptors are recently known to be identical to the Ad2 / 5 serotype and are represented by CAR (Coxsackie and Adeno Receptor, Tomko et al 1997 Proc Natl Acad Sci 94: 3352-2258). Cells of ανβ3 and ανβ5 integrins enter the endosome, which acts on the RGD sequence of the virus in the penton-base capsid protein (Wickham et al 1993 Cell 73: 309-319). After internalisation, the endosomes are broken through endozomolysis and are promoted by the ανβ5 integrin of the cell (Wickham et al 1994 J Cell Biol 127: 257-264). It has also recently been demonstrated to bind with high affinity to M5 class 1α2 domains on the surface of Ad5 fibers or particular cell types, particularly human epithelial and B lymphocytes (Hong et al 1997 EMBO 16: 2294-2306).

As a result, the virus is translocated into the nucleus and activation of the early regions occurs, followed by DNA replication and activation of the late regions. Transcription, replication and packaging of the DNA of adenoviruses requires functional protein machines of both the host and the virus.

Gene expression of viruses can be divided into early phases and late phases. The late phase is the time when viral DNA replication occurs. Structural proteins of adenoviruses are generally synthesized during the late phase. After adenovirus infection, host mRNA and protein synthesis is inhibited in most serotype-infected cells. The lytic cycle of adenoviruses, as well as adenoviruses 2 and 5, is very efficient, resulting in approximately 10,000 virions per infected cell due to the synthesis of DNA and viral proteins that do not enter virions. Early adenovirus transcription is a complex series of biochemical processes but involves the synthesis of viral RNA before DNA replication.

30 is an adenovirus genome showing the relative direction and location of early and late gene transcription.

The composition of the adenovirus genome is similar between adenovirus groups and its function is generally located at the same location for each serotype. Early cytoplasmic mRNA is complementary to four restricted and independent regions of viral DNA. These areas are denoted by E1-E4. The initial transcript is divided into the initial intermediate (E1a), the initial delay (E1b, E2a, E2b, E3, E4), and then the intermediate region.

Early genes are expressed 6-8 hours after infection and progress from seven promoters of the gene to block E1-4.

The Ela region is involved in the inhibition of transactivation as well as the transcription of other sequences in the transcription of viral and cellular genes. The E1a gene exhibits important regulatory functions for all other early adenovirus mRNAs. In normal tissues, an active E1a product is needed to transfer the E1b, E2a, E3, E4 regions. However, the function of E1a seems to be ignored. Cells can be assigned to the same function as E1a or be made to have such a function naturally. Viruses can also be made to ignore E1a function. The packaging signal of the virus overlaps with the enhancer of E1a (194-358nt).

The Elb region affects blocking viral and cellular metabolism and host proteins. It also contains genes encoding the pV protein (3525-4088nt), which is required for full-length viral DNADML packaging, and is important for the thermal stability of the virus. The Elb region is required for normal progression of the virus later in infection. E1b products work in the host nucleus. Mutations occurring in the E1b sequence show not only reduced late viral mRNA accumulation, but also damage that inhibits host cell transport that normally appears late in adenovirus infection. E1b is necessary to alter the function of the host cell so that processing and transport moves to the viral late gene product. This result is then viral packaged and released into virions. E1b produces 19kD protein that interferes with cell death. It also produces a 55kD protein that binds to E1b p53. See WO96 / 17053 for adenoviruses and their replication.

The E2 region is essential when coding an 80kDa precursor of a 55kDa terminal protein (TP) required for protein priming to begin 72kDa DNA binding protein, DNA polymerase and DNA synthesis.

The 19kDa protein (gp19K) is encoded in the E3 region and is involved in regulating the host immune response to the virus. The expression of this protein is upregulated in response to TNF alpha during the first phase of infection, and then binds to prevent the use of MHC class I antigens on the epithelial surface, thus preventing the recognition of adenovirus infected cells by cytotoxic T lymphocytes. Prevent. The E3 region is not needed in vitro and can be removed by deletion of the 1.9 kb XbaI fragment.

The E4 region is involved in reducing the synthesis of host proteins and increasing the DNA replication of viruses.

Fiber proteins are encoded in the L5 region. The genome of the adenovirus lies on the side of the inverted terminal repeat sequence, which is at Ad5 and is 103 bp long and plays an essential role in DNA replication. Viruses are produced 30-40 hours after infection.

Adenovirus can be used as a vector to transfer genes by removing important E1 genes that induce the E2, E3, E4 promoters. E1-replicating defect viruses can be propagated in cell lines providing E1 polypeptides on the other side, such as the human fetal kidney cell line 293. Therapeutic genes or genes may be recombinantly inserted at the E1 gene position. Expression of the gene is driven by an E1 promoter or a heterologous promoter.

Genetic adenovirus vectors have been developed that are much less toxic by removing some or all of the E4 open reading frames (ORFs). In the next generation of vectors, however, DNA could not be expressed for long periods of time, even if DNA appeared to be maintained. The function of one or more E4 ORFs is to enhance gene expression from the viral promoter.

Another approach to making the virus more flawed is to completely remove the virus, leaving only the terminal iterations needed for virus replication. These "gutted" viruses can grow to high titers along with first-generation helper viruses in 293 cell lines, but it is difficult to isolate "gut" vectors from helper viruses.

Replicable adenoviruses can be used for gene therapy. For example, the E1A gene can be inserted into a first generation virus under the control of a tumor specific promoter. Theoretically, after injecting the virus into the tumor, it was replicated specifically in the tumor but not in the surrounding normal cells. Vectors of this type, such as the thymidine kinase gene of the Herpes simplex virus, can kill infected and bystander cells either by directly killing tumor cells or by treating ganciclovir through lysis. Used to deliver a "suicide gene". Alternatively, adenoviruses without E1b specifically have been used in phase-1 clinical trials for antitumour treatment. Polypeptides encoded by E1b can prevent p53-mediate apoptosis by preventing cells from dying on their own during virus infection. In normal non-tumor cells, E1b-free viruses can't prevent cell death and can't produce infectious viruses and can't spread. For p53 deficient tumor cells, the E1b defective virus grows and spreads to adjacent p53 defective tumor cells but not to normal cells. This type of vector can be used to deliver therapeutic genes such as HSV _tk .

Adenoviruses have many advantages as vectors for gene transfer over other vector systems used for gene therapy for the following reasons.

It is a non-envelop virus with double stranded DNA that can be transduced in vivo and in vitro, from cell types with origins in humans to cells with origins in other species. These cells are similar to epithelial cells in the airways, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cesses, and neurons. This corresponds to cells that differentiate after division. Adenovirus vectors can also be transduced in cells that do not divide. Because of this fact, the affected cells in the lung epithelium are very important for diseases such as cystic fibrosis with slow turnover rates. In fact, several trials have been conducted using adenovirus medicated transport to deliver cistic fibrosis transporters to adult patients suffering from cistic fibrosis.

Adenoviruses have been used as vectors for gene therapy and for the expression of heterologous genes. The 36 kb genome can accommodate foreign inserted DNA of less than 8 kb and replicate to create very high titers, on the order of 10 ¹² , in a complementing cell line. Thus, adenoviruses are one of the best systems for studying gene expression in primary non-replicative cells.

It is not necessary to be a replicating cell in order to express a virus or a foreign gene from the adenovirus genome. Adenovirus vectors enter the cell via mediated endocytosis by the receptor. When in cells, adenovirus vectors are rarely inserted into the host's chromosome. Instead, the vector acts like a linear genome in the host's nucleus, independent of the host's genome. The use of recombinant adenovirus can alleviate the problems associated with random insertion into the host's genome.

There is no relationship between adenovirus infection and human malignancies. Weakened adenovirus strains have been developed and used in humans as live vaccines.

However, current adenovirus vectors have some major limitations when used for treatment in vivo. First, adenovirus vectors used for the expression of transient genes generally carry episomes and do not replicate, so no genes are subsequently delivered to progeny. Second, dilution of the vector can occur when target cells divide because they cannot be replicated. Third, due to the immune response to the protein of adenovirus, cells expressing the protein of adenovirus rupture to low levels. Fourth, in vivo delivery in some target cells results in influx of the vector and expression of the transgenes and therefore cannot have an index for effective treatment.

If the characteristics of adenoviruses and the genetic stability of retro and lentiviruses can be added together, adenoviruses can be used to transduce target cells into transient retrovirus producer cells that can stably infect neighboring cells. .

The present invention is directed to new retroviral vectors.

In particular, the present invention is directed to new retroviral vectors that allow for the efficient expression of NOI at one or more target sites.

The present invention is a novel system that can be made of a vector virion high titer that is safe for use in vivo and that enables efficient expression of NOI at one or more target sites.

The first aspect of the present invention is in a retroviral vector having a functional splice donor site and a functional splice acceptor site. The functional splice donor site and the functional splice acceptor site are linked to the primary nucleotide sequence of a particular sequence ("NOI"). The functional splice donor site is upstream of the functional splice acceptor site. The provector of the retrovirus is derived from the provector of the retrovirus. The provector of the retrovirus consists of a primary nucleotide sequence (NS) that produces a functional splice donor site and a secondary NS that produces a functional splice acceptor site. The primary NS is in the downspring of the secondary NS. Thus, retroviral vectors result from reverse transcription of the provector of the retrovirus.

The second aspect of the present invention is that the retrovirus provector has the packaging signal of the retrovirus, and the secondary NS is located downstream of the packaging signal of the retrovirus and thus is not spliced at the primary target site. It's about vectors.

A third aspect of the present invention relates to retroviral vectors in which secondary NSs are located downstream of the primary NOI such that primary NOI can be expressed at the primary target site.

A fourth aspect of the present invention relates to retroviral vectors in which secondary NSs are located upstream of multiple cloning sites, allowing one or more NOIs to be inserted.

The fifth aspect of the present invention relates to a retroviral vector in which the secondary NS is a nucleotide sequence encoding a substance involved in immunity.

A sixth aspect of the present invention relates to a retroviral vector wherein the immunologically related agent is an immunoglobulin.

A seventh aspect of the present invention relates to a retroviral vector wherein the secondary NS is a nucleotide sequence encoding the heavy chain variable region of an immunoglobulin.

An eighth aspect of the present invention relates to retroviral vectors with additional functional introns.

A ninth aspect of the present invention relates to a retroviral vector in which a functional intron is located so that any of the NOIs can be expressed at the target site.

The tenth aspect of the present invention relates to a retroviral vector wherein the target site is a cell.

The eleventh aspect of the present invention relates to a retroviral vector in which the vector or provector is derived from a murine oncoretrovirus or lentivirus.

The twelfth aspect of the present invention relates to retroviral vectors in which the vector is derived from MMLV, MSV, MMTV, HIV-1 or EIAV.

The thirteenth aspect of the present invention relates to retroviral vectors wherein the retroviral vector is an integrated provirus.

A fourteenth aspect of the present invention relates to retroviral particles obtainable from retroviral vectors.

The fifteenth aspect of the present invention relates to cells transfected or transduced with a retroviral vector.

A sixteenth aspect of the present invention relates to a retroviral vector, a virus particle or a cell used as a medicine.

The seventeenth aspect of the present invention relates to retroviral vectors or viral particles or cells used in the manufacture of a medicament for delivering one or more NOIs to a target site in accordance with the same need.

An eighteenth aspect of the present invention relates to a method of transfecting or transducing a cell using a retroviral vector or viral particles or cells.

A ninth aspect of the present invention is directed to a retroviral vector or viral particle or cell delivery system, wherein the delivery system provides NOI to one or more nonretroviral expression vectors, adenoviruses, plasmids or primary target cells. In combination with retroviral vectors that deliver and deliver NOI to secondary target cells.

The twentieth aspect the present invention relates to retroviral provectors.

The twenty-first aspect of the present invention relates to the use of functional introns in limiting the expression of one or more NOIs in target cells.

The twenty second aspect of the present invention relates to the use of reverse transcriptases to deliver primary NS from the 3 'end of the retrovirus provector to the 5' end of the retroviral vector.

The twenty-third aspect of the present invention relates to a hybrid virus vector system capable of delivering genes in vivo. The system consists of one or more primary viral vectors that encode secondary viral vectors. The primary vector or vector can produce a secondary viral vector and infect the primary target cell, where the secondary vector can be transduced into the secondary target cell.

The twenty-fourth aspect of the present invention relates to a hybrid viral vector system, wherein the primary vector is based on or derived from an adenovirus vector, and the secondary viral vector is based on or derived from a retrovirus, in particular a lentiviral vector. Is derived from.

The twenty-fifth aspect of the present invention relates to a hybrid viral vector system, wherein the lentiviral vector may consist of or deliver a split-intron array.

The twenty sixth aspect of the present invention relates to a lentiviral vector system, wherein the lentiviral vector may consist of or deliver a split-intron array.

The twenty-seventh aspect of the present invention is directed to an adenovirus vector system, wherein the adenovirus vector may consist of or deliver a slitlet-intron array.

The twenty eighth aspect of the present invention relates to a vector or plasmid obtained from or based on one or more of pE1sp1A, pCI-Neo, pE1RevE, pE1dHORSE3.1, pE1PEGASUS4, pCI-Rab, pE1Rab.

The twenty-ninth aspect of the present invention relates to a retroviral vector capable of differentially expressing NOI in target cells.

Another aspect of the present invention relates to a hybrid viral vector system used for gene transfer in vivo. The system has a primary viral vector encoding a secondary viral vector, which can produce a secondary viral vector or infect primary target cells. Here, the secondary vector may be transduced into secondary target cells. Primary vectors are obtained from or based on adenovirus vectors. Secondary viral vectors are obtained from or based on retroviral vectors, in particular lentiviral vectors. The viral vector system here consists of a functional splice donor site and a functional splice acceptor site. Wherein the functional splice donor site and the functional splice acceptor site are linked to the primary nucleotide sequence of "NOI". The functional splice donor site is upstream of the functional splice acceptor site. Such retroviral vectors are derived from retroviral pro vectors. Retroviral provectors consist of a primary nucleotide sequence capable of producing a functional splice donor site and a secondary NS capable of creating a functional splice acceptor site. Here, the primary NS is downstream of the secondary NS, resulting in retroviral vectors resulting from reverse transcription of the retroviral provectors.

The retroviral provector consists of tertiary NS, which is upstream of the secondary nucleotide sequence. Here the tertiary NS can create a splice donor site that has no function.

Retroviral vectors also have secondary NOIs, which are downstream of the splice acceptor site that functions.

Retroviral provectors have secondary NOIs, which are downstream of the secondary nucleotide sequence.

Secondary NOIs and particularly expression products are included in agents for treatment or agents for diagnosis.

The primary NOI, and in particular the expression product, is included in part or in combination with one or more agents that are selective, such as marker elements or essential elements of the virus.

Primary NS is near the 3 'end of the retrovirus provector. Wherein the 3 'end consists of the U3 region and the R region, and the primary NS is located between the U3 region and the R region.

The U3 region and primary NS of the retroviral provector are NS with tertiary NOI. NOI herein refers to elements and coding sequences or portions thereof that regulate one or more transcriptions.

Primary NS can be obtained from virus.

Primary NS refers to introns or parts thereof.

Introns can be obtained from the small t-introns of the SV40 virus.

The vector component is controlled. The main aspect of the invention is whether the vector component is controlled by hypoxia.

In the invention, another aspect which is mainly seen is whether the vector is regulated by the on or off system of tetracycline. Thus, the present invention relates to a delivery system using a retroviral vector.

In the delivery system of the present invention, the retroviral vector consists of a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS) to which primary NOIs are linked. Retroviral vectors are the result of reverse transcription of retroviral provectors containing NOI.

When the FSDS is located upstream of the FSAS, the intervening sequence can be spliced. Generally, splicing removes intervening or intron RNA sequences, and the remaining exon sequences are linked to each other to provide a continuous sequence during translation.

The splicing process is shown in FIG. 31.

In Figure 31, Y refers to the interbining sequence and is removed after splicing. An outline of general splicing of retroviral vectors is shown in FIG. 27A. The contours for splicing of known vectors are shown in FIG. 27B. The splicing of this invention is shown in FIG. 27C.

As in the present invention, splicing cannot occur if the FSDS is downstream of the FSAS.

Similarly, if FSDS is a splice donor site (NFSDS) with no function and an acceptor site (NFAS) with no FSAS, splicing cannot occur.

NFSDS is a mutated FSDS and such FSDS can no longer be recognized by the splicing mechanism.

As in the present invention, each NS may be any suitable nucleotide sequence. For example, each sequence can be synthesized or made by using recombinant DNA techniques, independent of DNA or RNA, or isolated from natural sources or both. The sequence may be either a sense sequence or an antisense sequence. The majority of sequences will be sequences linked directly or indirectly to one another.

As with the present invention, each NOI may be a shootable nucleotide sequence. For example, each sequence can be synthesized or made by using recombinant DNA techniques, independent of DNA or RNA, or isolated from natural sources or both. The sequence may be either a sense sequence or an antisense sequence. The majority of sequences will be sequences linked directly or indirectly to one another.

Primary NOIs have one or more of the following cell selection markers that have been used successfully in retroviral vectors. The bacterial neomycin and hygromycin phosphotransferase genes are resistant to G418 and hygromycin, respectively (Palmer et al 1987 Proc Natl Acad Sci 84: 1055-1059; Yang et al 1987 Mol Cell Biol 7: 3923-3928). The mutant mouse dehydro folate reductase gene makes it resistant to methotrexate (Miller et al 1985 Mol Cell Biol 5: 431-437). The gpt gene of bacteria allows cells to grow in media treated with mycohpenolic acid, xanthine and aminoptrin (Mann et al 1983 Cell 33: 153-159). The bacterium his D gene is histidine free but allows cells to grow in histidinol treated media (Danos and Mulligan 1988 Proc Natl Acad Sci 85: 6460-6464). Multidrug Resistant Genes (mdr) make them resistant to various drags (Guild et al 1988 Proc natl Acad Sci 85: 1595-1599; Pastan et al 1988 Proc Natl Acad Sci 85: 4486-4490). Bacterial genes may also be resistant to puromycin or pleomycin (Morgenstern and Land 1990 Nucleic Acid Res 18: 3587-3596).

These markers are dominant selection markers and allow chemical selection for most cells expressing these genes. β-galactosidase may be a kind of dominant marker. That is, cells expressing β-galactosidase may be selected using a fluorescence-activated cell sorter. In fact, any of the proteins on the cell surface can be used as a selection marker for cells that do not already make proteins. Protein expressing cells can be selected using antigens that fluoresce against proteins and cell salts. Other selection markers that have been included in the vector include hprt and HSV thymine kinases, which allow cells to grow in hypoxanthine, amethopterin, and thymidine treated media.

The primary NOI may comprise a noncoding sequence. For example, there are retroviral packaging sites or nonsense sequences that prevent secondary NOIs from functioning in a provector. But when they are removed from the vector through splicing, a functional secondary NOI appears.

Primary NOI can also encode viral essentials, such as env, which encodes the Env protein, thereby reducing the complexity of the production system. For example, in the case of adenovirus vectors, this allows the retroviral genome and envelope to be arranged in a single adenovirus vector under the control of the same promoter, which not only simplifies the system but also adds sequence capacity that can be added into the adenovirus vector. Make it bigger. These appendable sequences may be gag-pol cassettes themselves. Thus, a retroviral vector particle is made from one adenovirus vector. Previous studies (Feng et al 1997 Nature Biotechnology 15: 866) have used multiple adenovirus vectors.

If any of the retroviral components have an env nucleotide sequence, some or all of the sequence may be partially or wholly of the other env nucleotide sequences, such as the Empotropic Env protein 4070A, influenza hemagglutinin (HA), or the Vesicular Stommatis virus G protein. It can be substituted with. Substitution of the env gene and the heterologous env gene is an example of pseudotyping. Although it is not a new method of pseudo-typing, examples are WO-A-98 / 05759, WO-A-98 / 05754, WO-A-97 / 17457, WO-A-96 / 09400 and Mebatsion et al 1997 Cell 90 As shown in 841-847.

Retroviral vectors in the present invention are pseudotypes. In this regard, pseudotypeping may have one or more advantages. For example, the env gene products of HIV-based vectors, such as lentiviruses, will restrict these vectors to infect only cells expressing CD4. However, if the env gene in these vectors is replaced with the env sequence of other RNA viruses, the range of infection will be wider (Verma and Somia 1997 Nature 389: 239-242). For example, researchers pseudotyped HIV-based vectors with glycoproteins of VSV (Verma and Somia 1997 ibid).

Env proteins can be modified env proteins, such as stools or skillfully made Env proteins. Modifications are made or screened to give target capacity or to reduce toxicity or for other purposes (Valsesia-Wittman et al 1996 J Virol 70: 2056-64; Nilson et al 1996 Gene Therapy 3: 280-6; Fielding et al 1998 Blood 9: 1802 and references cited therein). Suitable secondary NOI coding sequences include those that are in therapeutic or diagnostic applications, such as sequences encoding cytokines, chemokines, hormones, antibodies, manufactured immunoglobulin-like substances, single chain antibodies, fusion proteins, enzymes, Aesop costimulatory molybicles, immunomodulators, antisense RNAs, transdominant negative mutations of target proteins, toxicity, conditional toxicity, antigens, tumor suppressor proteins, grossfactors, membrane proteins, vasoactive proteins and peptides, anti It is not limited to viral proteins, ribozymes, and derivatives such as associated reporter groups. Such coding sequences are generally effectively linked to suitable promoters, which may be promoters or other promoters or promoters that control the expression of ribozymes.

Secondary NOI coding sequences may encode fusion proteins or fragments of coding sequences.

The retroviral vectors of the invention can be used to deliver secondary NOI, such as prodrug activating enzymes, to tumor sites for cancer treatment. In each case, appropriate prodrugs are used in patient treatment by treating the appropriate prodrug activating enzymes together. Appropriate prodrugs are administered with the vector. An example of a prodrug is as follows. Esoposide phosphate (used with alkaline phosphatase, Senter et al 1988 Proc Natl Acad Sci 85: 4842-4846), 5-fluorocytosine (used with cytosine deaminase, Mullen et al 1994 Cancer Res 54: 1503-1506), doxorubicin nP hydroxyphenoxycetamide (used with penicillin V amidase, kerr et al 1990 Cancer Immunol Immunother 31: 202-206), paraenbistuchloroethylaminobenzoylglutamate (carboxypeptidase GII With cephalosporin nitrogen mustard carbamate (with betalactamase), SR4233 (with p450 reductase), gancyclovir (with HSV thymidine kinase, Borrelli et al 1988 Proc) Natl Acad Sci 85: 7572-7576), mustard prodrug (with nitroreductase, Friedlos et al 1997 J Med Chem 40: 1270-1275) and cyclophosphamide (p450), Chen e t al 1996 Cancer Res 56: 1331-1340).

Vectors of the invention will be delivered to the target site by viral or nonviral vectors.

As is well known, vectors are mechanisms that allow or facilitate intrusion propagation from one environment to another. For example, some vectors used in recombinant DNA techniques are used to deliver entities such as fragments of DNA, such as heterologous DNA segments or heterologous cDNA fragments, to target cells. When in the target cell, the vector either retains the heterologous DNA in the cell or acts as a DNA replication unit. Vectors used in recombinant DNA techniques include plasmids, chromosomes, artificial chromosomes or viruses.

Nonviral delivery systems include, but are not limited to, DNA transfection methods. Here, transfection involves the use of nonviral vectors to deliver genes to target mammalian cells.

Common transfection methods include electroporation, DNA bioistics, repetitive intermediation transfection, compacted DNA mediated transfection, liposomes, immunoliposomes, lipolectins, cationic agents mediated, cationic Partial Amphiphiles (Nature Biotechnology 1996 14: 556).

Virus delivery systems include, but are not limited to, adenovirus vectors, adenoassociated virus vectors, herpes virus vectors, retrovirus vectors, lentivirus vectors, and bacuolvirus vectors. Vectors having ex vivo delivery systems include, but are not limited to, DNA transfection methods such as electroporation, DNA bioistics, rapid mediated transfection, and compact DNA mediated transfection.

The vector delivery system of the present invention consists of an in vitro primary vector that encodes the genes needed to make the secondary vector in vivo. Primary viral vectors or vectors are various other viral vectors, such as retroviruses, adenovirus herpes viruses, or pox virus vectors. In the case of multiple primary viral vectors, they are vector mixtures with different viral origins. In either case, the primary viral vector has a defect that cannot be replicated on its own. Thus, they can enter the target cell and transfer the secondary vector sequence, but cannot replicate and infect other target cells.

If a hybrid viral vector system consists of one or more primary vectors to encode secondary vectors, both or three primary vectors will be used to transfect or transduce primary target cell populations simultaneously.

Rather, there is a single primary viral vector that encodes all components of the secondary viral vector.

The major single or multiple primary viral vectors are adenovirus vectors.

The adenovirus vectors used in the invention are derived from human adenoviruses or adenoviruses which are not normally infected with humans. The vector is derived from adenovirus type 2 or 5 or avian adenovirus such as mouse adenovirus or CELO virus (Cotton et al 1993 J Virol 67: 3777-3785). The vectors are replicable adenovirus vectors but are more defective adenovirus vectors. Adenovirus vectors are defective because more than one component of the virus is replicated. In general, each adenovirus vector contains at least one deletion in the E1 region. While infectious adenovirus vector particles are produced, this dilation is supplemented via the passage of the virus in human fetal fibroblasts, such as the human 293 cell line, integrating the left part of Ad5, including the E1 gene. You'll have a tide copy. The capacity for inserting heterologous DNA into such a vector is approximately 7 kb. Thus, such vectors are useful for the system structure that constitutes each of three different recombinant vectors, which contain one of the necessary transcriptional units for the construction of a retroviral secondary vector.

Other adenovirus vectors have more degradation in other adenovirus genes, and these vectors are also suitable for use in the invention. Some of these second generation adenovirus vectors show reduced immunity (eg E1 + E2 deletions Gorziglia et al 1996 J Virol 70: 4173-4178; E1 + E4 deletions Yeh et al 1996 J Virol 70: 559-565). By extending the dilation, the cloning ability to introduce multiple genes in the vector increases. For example, 25 kb was digested (Lieber et al 1996 J Virol 70: 8944-8960), and a cloning vector was created that allowed all viral genes to be deduced to introduce more than 35 kb of heterologous DNA (Fisher). et al 1996 Virolology 217: 11-22). Such vectors are used to construct adenovirus primary vectors that encode two or three transcription units of a retroviral secondary vector.

Secondary viral vectors include retroviral vectors. Secondary vectors are produced by the expression of genes required for assembly and packaging of defective viral vector particles in primary target cells. It cannot be reproduced independently, so it has a defect. Thus, if a secondary retroviral vector is transduced into a secondary target cell, diffusion to other target cells through replication does not occur.

The term "retroviral vector" generally includes nucleic acids from retroviruses that can infect but cannot replicate on their own. Thus, there is a defect in replication. Retroviral vectors generally carry one or more NOIs of nonretroviral duck genes for delivery to target cells. Retroviral vectors consist of a functional splice donor site (FSDS) and a functional splice acceptor (FSAS) site. If the FSDS is upstream of the FSAS, the intervening sequence can be spliced. Retroviral vectors consist of retroviral sequences such as nonretroviral control sequences in the U3 region that affect the expression of NOI when retroviral vectors are inserted into target cells as proviruses. The retroviral vector does not need to have only one element of the retrovirus. Thus, as in the present invention, it is possible to have elements obtained from two or more different retroviruses or from different sources.

The term "retroviral provector" generally includes the retroviral vector genome as above, but a second nucleotide sequence capable of generating a functional splice donor site and a second capable of generating a functional splice acceptor site. If the primary NS is downstream of the secondary NS, splicing that connects the primary and secondary NSs cannot occur. During reverse transcription of retroviral provectors, retroviral vectors are formed.

The term "retroviral vector particle" refers to a packaged retroviral vector capable of binding to or invading target cells. As already mentioned for the vector, the components of the particles are modified compared to wild type retroviruses. For example, Env proteins in the particle's protein coat are genetically modified to alter their target specificity or to gain some other function.

In this regard, the retroviral vectors are derived from murine oncoretroviruses such as MMLV, MSV, MMTV, or lentiviruses such as HIV-1, EIAV, or other retroviruses.

Retroviral vectors of the invention can be modified to have a natural splice donor site of a retrovirus that has no function.

"Modification" includes the silencing or removal of natural splice donors. Vectors are well known, such as MLV based vectors with splice donor sites removed. An example of such a vector is pBABE (Morgenstern et al 1990 ibid). Secondary vectors can be generated due to expression of genes essential for the production of encoded retroviral vectors in the DNA of the primary vector. Such genes include the gag-pol gene of the retrovirus, the env gene of the envelope virus, and the env of a defective retroviral vector having one or more therapeutic or diagnostic NOIs. Envelope viruses and defective retroviral vectors containing more than one NOI include the env gene. Defective retroviral vectors contain sequences that can be reverse transcribed in portions of 5 'long terminal repeats and in packaging signals with portions of 3'LTR.

If we assume that the secondary vector cannot replicate, the secondary vector will be coded by one or more adenovirus vectors or by multiple transcription units in another primary vector. There are a transcription unit encoding a secondary vector genome, that is, a transcription unit encoding gag-pol and a transcription unit encoding env. Or they may serve more than one. For example, the sequence of nucleic acids encoding gag-pol and env or env and genome would be combined in a single transcription unit.

A transcription unit as used herein is a region of a nucleic acid having a coding sequence and, unlike any other coding sequence, is a signal for the expression of those coding sequences. Therefore, each transfer unit typically consists of at least one promoter, enhancer and polyadenoselection signal.

The term "promoter" refers to an RNA polymerase binding site from the Jacob-Monod hypothesis for gene expression.

The term "enhancer" refers to a DNA sequence that binds to other proteins of a transcription initiation complex and promotes transcription initiation proceeded by its associated promoter.

Promoters and enhancers of transcription units encoding secondary vectors are very active and can be very strongly induced in primary target cells under the conditions of production of secondary viral vectors. Promoters and enhancers are effective in construction or their activity is limited by tissue or time. Suitable examples of tissue-restricted promoters / enhancers include those that are highly activated in tumor cells, such as the promoters and enhancers of the MUC1 gene, CEA gene, and the 5T4 antigen gene. Proper examples of timely restrictive promoters / enhancers include those that cause ischemia or hypoxia, such as hypoxic response elements or promoters and enhancers of the grp78 or grp94 genes. Examples of promoter and enhancer combinations include the human cytomegalovirus major mediator early promoter / enhancer combination.

Another component of interest is an entity that can efficiently express NOI.

Of primary interest in the present invention, there are hypoxia or ischemia that regulate the expression of secondary vector components. In this regard, hypoxia is a potent regulator for gene expression in a wide range of different cell types, hypoxia inducible factor-1 that binds homologous DNA reconstruction sites and hypoxic responsive elements (HREs) to various gene promoters. (HIF-1; Wang & Semenza 1993 Proc Natl Acad Sci 90: 430). Dachs et al (1997 Nature Med 5: 515) describe mouse phosphoglycerides to regulate the expression of both markers and therapeutic genes in human fibrosarcoma cells showing hypoxia in vitro and in solid tumors in vivo (Dachs et al ibid). The multimeric form of HREs of Light Kinase-1 (Firth et al 1994 Proc Natl Acad Sci 91: 6496-6500) was used. On the other hand, damage to marked glucose occurs in the iscaic area of the tumor, which can be used to promote the expression of heterologous genes specifically in the tumor. It has been reported that the truncate 632 base pair sequence of the grp78 gene promoter, which is known to be specifically promoted by glucose damage in vivo, can drive high levels of reporter gene expression in murine tumors in vivo (Gazit et al 1995 Cancer Res 55: 1660). Another method of controlling the expression of such components is presented by Yoshida et al (1997 Biochem Biophys Res Comm 230: 426) for the production of gag, pol and VSV-G proteins of retroviruses and by Gossen and Bujard (1992 Proc Natl). Acad Sci 89: 5547), using the tetracycline on off system. In particular, such regulatory systems are also used in the present invention to regulate the production of the provector genome. This demonstrates that no vector components are expressed from the adenovirus vector in the absence of tetracycline.

The stability of the hybrid viral vector system is described below. One or more features are listed.

Secondary vectors benefit from in vivo use, adding one or more features that eliminate the possibility of recombination to create an independently replicating Infectious Virus. Such features were not included in previous studies (Feng et al 1997 ibid). In particular, as described below, constructing a retroviral vector from three components is not found in Feng et al (ibid).

First, sequence homology between sequences encoding components of the secondary vector can be eliminated by dividing the homology regions. Homologous regions allow genetic recombination to occur. Specifically, three transcription units are used to construct a secondary retroviral vector. The primary transcription unit carries the gag-pol gene of the retrovirus, which is regulated by nonretrovirus promoters and enhancers. The secondary transcription unit has a retrovirus env gene that is regulated by nonretrovirus promoters and enhancers. The third transcription unit consists of a defective retroviral genome regulated by a non-retrovirus promoter and an enhancer. In the case of the native retroviral genome, the packaging signal is located in some gag sequence needed to function properly. Normally, when a retroviral vector system is constructed from it, a packaging signal containing part of the gag gene remains in the vector genome. However, in the present invention, the defective retroviral genome comprises a minimal packaging signal that does not have a gag sequence and a homologous sequence in the primary transcription unit. In addition, in the case of retroviruses such as Moloney Murine Leukaemia virus, there is a small region overlapping between the 3 'end of the pol coding sequence and the 5' end of the env. The homology region between the primary and secondary transcription units can be removed by changing the 3 'end of the pol coding sequence or the 5' end of the env. This alters codon origin but does not alter the amino acid sequence of the coding protein.

Secondly, the genome of retroviruses can be pseudotyped with Env proteins from other retroviruses or other envelope viruses to eliminate the homologous region between the env and gag-pol components, thus eliminating the possibility of a secondary viral vector capable of replication.

Specifically, retroviral vectors consist of three components: The primary transcription unit contains the gag-pol gene of the retrovirus, which is regulated by nonretrovirus promoters and enhancers. The secondary transcription unit contains the env gene of the alternative envelope virus, which is regulated by nonretrovirus promoters and enhancers. The third transcription unit consists of a defective retroviral genome regulated by a non-retrovirus promoter and an enhancer. The defective retroviral genome has a minimal packaging signal that does not have a homologous sequence to the gag sequence in the primary transcription unit.

Third, the possibility of replicating retroviruses can be eliminated by using two transcription units constructed in a special way. The primary transcription unit contains a gag-pol coding region that is regulated by an active promoter-enhancer in primary target cells, such as hCMV promoter-enhancer or tissue-restricted promoter-enhancer. Secondary transcription units encode retroviral genomic RNA that can be packaged into retroviral particles. The secondary transcription unit has the retroviral sequence required for packaging, integration and reverse transcription, and has a sequence encoding the env protein of the envelope virus and one or more therapeutic genes. For example, the transcription of env and NOI coding sequences is invented so that the Env protein occurs predominantly in primary target cells while the NOI expression product occurs predominantly in secondary target cells.

A suitable intron splicing arrangement is described later in Example 5 and shown in FIG. 27C. Wherein the splice donor site is located downstream of the splice acceptor site in the retroviral genomic sequence delivered to the primary target cell by the primary vector. Therefore, primary target cells will have no or splice splice and Env protein will be preferentially expressed. However, if the vector genome has undergone reverse transcription or integration into secondary target cells, the functional splice donor sequence will be located in the 5 'LTR upstream of the functional splice acceptor sequence. When splicing occurs, the transcript of the generated NOI is linked with the env sequence.

In a second configuration of this example, the expression of NOI is limited to secondary target cells and prevented expression in primary target cells as follows. This arrangement is described later in Example 6 and shown in FIG. 18. In addition, the primary fragment of the NOI comprising the promoter 'enhancer and the 5' end of the coding sequence and the naturally or artificially induced or induced splice donor sequence inserted into the 3 'end of the retroviral genome are upstream of the R region. Is fulfilling. The secondary fragment of the NOI, which has all of the sequences necessary to complete the coding region, is located downstream of the splice acceptor sequence, which can be naturally or artificially induced or derived, wherein the acceptor sequence is in the retroviral genome structure. Located downstream of the packaging signal. When the retroviral genome is in reverse transcription and integration in secondary target cells, the promoter 5 'fragment of NOI and the functional splice donor sequence are located upstream of the functional splice acceptor and at the 3' end of the NOI. Transcription and splicing from the promoter results in translation of NOI in secondary target cells. Specifically, in the present invention, the hybrid viral vector system consists of a single or multiple adenovirus primary vectors, which encode a retroviral secondary vector.

The present invention has major problems associated with adenovirus vectors and other viral vectors. That is, gene expression from such vectors is transient. Retroviral particles from primary target cells can transduce secondary target cells, and gene expression in secondary target cells remains stable because the retroviral vector genome integrates into the genome of the host cell. Secondary target cells do not express large amounts of viral protein antigens and are therefore less immunogenic than cells transduced with adenovirus vectors.

It is beneficial to use retroviral vectors as secondary vectors. This is because, for example, by targeting cells that divide rapidly, the cells can be identified to some extent. Moreover, retroviral integration not only involves stable expression in dividing target cells but also allows stable expression of therapeutic genes in target tissues.

The use of the new retroviral vector design in the present invention has the advantage that gene expression can be limited to primary and secondary target sites. In this case, single or multiple NOIs may be preferentially expressed at the secondary target site and rarely expressed at the primary target site or at biologically significant levels. As a result, the toxicity of NOI and antigenesis can be avoided.

Primary viral vectors preferentially transduce certain cell types or cell types. The primary vector is a targeted vector, which has altered tissue trophism compared to native viruses, so the vector is targeted to specific cells.

The term "targeted vector" is not necessarily associated with "target site" or "target cell".

"Target site" refers to a site to which a vector can be transfected or transduced, whether native or targeted.

"Primary target site" refers to the first site to which a vector can be transfected or transduced, whether native or targeted.

"Secondary target site" refers to a second site to which a vector can be transfected or transduced, whether native or targeted.

A "target cell" simply refers to a cell that can be transfected or transduced by a vector, native or targeted.

"Primary target cell" refers to the first cell to which a vector can be transfected or transduced, either native or targeted.

"Secondary target cell" refers to a second cell to which a vector can be transfected or transduced, whether native or targeted.

Adenovirus primary vectors are also targeted vectors, which have a tissue trophy of a different vector than the wild-type adenovirus. Adenovirus vectors can be modified with targeted adenovirus vectors as described in the Examples below (Krasnykh et al 1996 J. Virol 70: 6839-6846; Wickham et al 1996 J. Virol 70: 6831-6838; Stevenson et al 1997 J. Virol 71: 4782-4790; Wickham et al 1995 Gene Therapy 2: 750-756; Douglas et al 1997 Neuromuscul.Disord 7: 284-298; Wickham et al 1996 Nature Biotechnology 14: 1570-1573).

Primary target cells of the vector system include hematopoietic cells, endothelial cells, tumor cells, stromal cells, including monosite, macrophase, lymphocyte, granulosite or their progenitor cells. Astrosite or glycal cells, muscle cells, epicelial cells.

The primary target cells capable of producing secondary viral vectors are probably any of the above cell types.

Specifically, the primary target cell is a monosite or macrophase transduced with a defective adenovirus vector. This defective adenovirus vector has a secondary transcription unit capable of producing a defective retroviral genome that can be packaged with a primary transcription unit for the gag-pol of a retrovirus. In this case, the second transcription unit is under the control of a promoter-enhancer that is primarily active at the intra-body digitized location, such as the microenvironment of an isometric site or a solid tumor.

Specifically, secondary transcription units are made by creating introns that reduce the expression of viral essential elements such as the env gene of the virus and efficiently express therapeutic and diagnostic NOIs while inserting the genome into secondary target cells.

The packaging cell refers to an in vivo packaging cell in the body of the patient being treated or a cell cultured in vitro, such as a tissue culture cell line. Suitable cell lines include mammalian cells such as murine fibroblast delived cell lines and human cell lines. The main packaging cell lines are human cell lines such as HEK293, 293-T, TE671, HT1080. The packaging cell, on the other hand, may be a cell obtained from the patient being treated, such as monosite, macrophase, blood cell or fibroblast. The cells can be isolated from the patient, and the packaging and vector components are dosed in Xvivo and then re-dosed in the autologus packaging cell. Meanwhile, packaging and vector components are administered to the packaging cell in vivo. Retroviral packaging and methods of incorporating vector components into patient cells are generally well known. For example, attempts to insert other DNA sequences needed to produce retroviral vector particles, such as env coding or gag-pol coding sequences, and defective retroviral genomes into cells via transient triple transfection. (Landau & Littman 1992 J. Virol. 66, 5110; Soneoka et al 1995 Nucleic Acids Res 23: 628-633).

Secondary viral vectors can also be targeted vectors. In the case of retroviral vectors, this can be done by modifying the Env protein. Env proteins of retroviral secondary vectors need to be non-toxic envelopes or envelopes that can be generated from non-toxic mounts in the primary target cell, such as, for example, MMLV ampotropic envelopes or modified amphotropic envelopes. There is. In such cases, safety is obtained by removing regions or sequence homology between retroviral components.

The envelope is to allow transduction of human cells. Examples of suitable env genes include VSV-G, MLV ampotropic env such as 4070A, RD114 Perlin Leukemia Virus env, or hemagglutinin of influenza virus. Env proteins are those capable of binding to receptors in restricted human cell types and may be manufactured envelopes that include targeting moieties. In the selected packaging cell line, the env and gag-pol coding sequences are transcribed from the active promoter and enhancer, and the transcription unit is terminated by the polyadenylation signal. For example, if the packaging cell is a human cell, a suitable promoter-enhancer from the human cytomegalovirus major imide early gene of the SV40 virus and the polyadenylation signal can be used together. Other suitable promoters and adenylation signals are generally well known.

Secondary target cell populations have the same characteristics as primary target cell populations. For example, delivering a primary vector to a tumor cell allows the replication and generation of other vector particles capable of transducing other tumor cells.

On the other hand, the secondary target cell group is different from the primary target cell group. In this case, the primary target cell acts as an endogenous factory in the patient being treated, creating an additive vector particle capable of transducing the secondary target cell population. For example, the primary target cell population may be hematopoietic cells transduced with the primary vector in vivo or in ex vivo. Primary target cells can transfer or migrate to sites in the body, such as tumors, and produce secondary vector particles capable of transducing active tumor cells in solid tumors.

Retroviral vector particles can transduce slowly dividing cells, but non-lentivirals, such as MLVs, cannot effectively transduce. Slowly dividing cells, including some tumors, divide about every three to four days. Although tumors have rapidly dividing cells, some tumor cells, especially those in the center of the tumor, rarely divide. The target cell may be a gross arrest cell that may undergo cell division, such as a cell in the center of the tumor mass or a stem cell such as a hematopoietic stem cell or a CD34 positive cell. Or the target cell may be a precursor of differentiated cells such as a monosite precursor, a CD34 positive cell or a myelo precursor. Or target cells such as neurons, astrosites, glycal cells, microglyal cells, macrophages, monosites, episelial cells, endoselial cells, hepatocytes, spermatocites, spurmatized or spermatozoa It may be a differentiated cell. Target cells can be isolated from the patient and then directly transduced in vitro or in vivo. The present invention allows for the limited production of defective retroviral vector particles with high titers in vivo at or near the site of action of a therapeutic protein or protein required for efficient transduction of secondary target cells. This is more effective than using only defective adenovirus vectors or defective retroviral vectors.

The present invention allows the production of retroviral vectors, such as MMLV base vectors, in cells that do not divide or slowly divide in vivo. Previously, MMLV-based retroviral vectors could be generated only in rapidly dividing cells, such as in vitro dividing tissue culture-adapted cells or rapidly dividing tumor cells in vivo. Increasing the range of cell types capable of producing retroviral vectors can lead to genes that are slowly dividing in many cases, and endothelial cells and endogenous factories that produce therapeutic protein products. It is beneficial for non-diving cells such as cells.

According to the present invention the delivery of one or more therapeutic genes by the vector system can be used alone or in combination with other treatments or therapeutic components.

For example, the retroviral vectors of the present invention are used to deliver one or more NOIs useful in treating the disorders described in WO-A-98 / 05635. The list is as follows: Ie cancer, inflammatory or inflammatory diseases, skin disorders, fever, cardiovascular symptoms, hemorrhages, coagulation and act phase reactions, cassia, anorexia, acute infections, HIV infection, shock conditions, graft and host reactions, Ootois digits Impaired reperfusion, meningitis, migraine and aspirin pendant anti thrombosis; Tumor growth, invasion and spread, angiogenesis, metastasis, malangent, ascites and outflow of maligand pleura; Cerebral ischemia, isometric heart digits, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, complex sclerosis, neurodigenesis, Alzheimer's digits, atherosclerosis, seizures, vasculitis, Crohn digits and ulcerative colitis; Periodontitis, gingivitis; Psoriasis, atopic dermatitis, chronic ulcers, epidermolysis vulosa; Conil Assessment, Retinopathy and Surgical Wound Healing; Rhinitis, allergic conjunctivitis, eczema, anaphylaxis; Restenosis, congestive heart failure, endometritis, atherosclerosis or endoclerosis.

The retroviral vectors of the invention can be used to deliver one or more NOIs useful for treating the disorders described in WO-A-98 / 07859. The list is as follows: Cytokine and cell division and differentiation activity; The activity of immunosuppressants or immunostimulators in treating immune deficiencies, including, for example, infection of human Aesop difficile virus; Lymphocyte growth regulation; When treating cancer and autoimmune digits and when inhibiting the rejection of transplants or inducing tumor immunity; Regulation of hematopoiesis, eg, when treating myeloid or lymphoid digits; Bone, cartilage, tendon, ligament, when promoting the growth of nerve tissue, for example when treating healing wounds, burns, ulcers, periodontal digits and neurodigenation; Inhibit or promote the release of polyclonal stimulating hormones that regulate fertility; Chemotactic / chemokine activity, for example when moving a particular cell type to an injury or infection site; For example, hemostatic and thrombolytic activities when treating hemophilia and seizures; Anti-inflammatory activity, for example when treating septic shock or Crohn's digits; As an antibiotic; Modulators of metabolism or reactions, for example; As analgesic; When treating unusual defect disorders; When treating human or livestock drugs or psoriasis.

On the other hand, the retroviral vectors of the invention can be used to deliver one or more NOIs useful for treating the disorders described in WO-A-98 / 09985. The list is as follows: Macrophage and T cell inhibitory and anti-inflammatory activity; Anti-immune activity, ie the inhibitory effect on the immune response of cells and body fluids, including those that do not involve inflammation; Macrophages and T cells interfere with attachment to extracellular matrix components and fibronectin. As well as inhibit the expression of upregulated fas receptor in T cells; Inhibits unwanted immune responses and inflammation including arthritis and rheumatoid arthritis, sensitivity, allergic reactions, asthma, cystic lupus erythematosus, inflammation associated with collagen disease and other autopython digits, inflammation associated with atherosclerosis, Atherosclerosis, heart disease caused by atherosclerosis, reperfusion damage, heart failure, myocardial infarction, coronary inflammatory disorders, inflammation accompanied by respiratory distress syndrome or other cardiopulmonary diseases, peptic ulcer, ulcerative colitis and intestinal tract Other diseases, renal fibrosis, cirrhosis or other kidney disease, thyroiditis or other acute diseases, glomerulonephritis or other kidney and urinary diseases, otitis or other otorhinolaryngitis, dermatitis or other skin diseases, periodontal digi Or other dental digits, testicles or epididymo-testisitis, infertility, okidal Testicular disease related to trauma or other immunity, placental dysfunction, placental insufficiency, habitual miscarriage, convulsions, forearm and other immune and inflammation-related gynecological diseases, posteri Uvetis, intermediate Uvetis, entertain Uve Typhoid, conjunctivitis, Corio retinitis, Ubero retinitis, optic neuritis, intraocular inflammation, e.g. retinitis or cyst spot edema, sympathetic ophthalmitis, scleritis, retinitis pigmentosa, degenerative ponebs digits Immune and inflammatory components, inflammatory components associated with trauma to the eye, eye inflammation caused by infection, properative Virio-Retinopathsis, acute escapic optic nerve disorders such as excessive scarring after glaucoma removal, Immune and Inflammatory Responses to Transplantation of Eyes, Eye Diseases with Other Immunity and Inflammation, and Inflammation with Ootois Digize Tract disorders, Parkinson's disease that benefits immunity and inflammation, and the complications and side effects of treating Parkinson's disease, HIV linked Encephalopathy with AIDS-related dementia, Devic Digiz, Sideca Correa, Alzheimer's Digiz and Other degenerative digits, CNS disorders, inflammatory components of seizures, post-polio syndrome, immune and inflammatory components of mental disorders, myelitis, encephalitis, plate encephalitis with subacute atherosclerosis, encephalomyelitis, acute neurosis, subacute neurosis, Chronic neurosis, guillim-barre syndrome, cidenam chora, gravis gravure, pseudo tumor celebrity, down syndrome, huntington digits, amiotropic stellar sclerosis, inflammatory components of CNS compression or CNS trauma or Infections of the CNS, inflammatory components of muscle weakness and malnutrition, immune and inflammation related diseases, disorders of the central or distal nervous system, post traumatic Syndrome, septic shock, infectious diseases, inflammatory complications or side effects due to surgery, bone marrow transplantation or other transplantation complications or side effects, inflammatory and immune complications and side effects due to gene therapy because it is infected with a virus carrier. Or to treat or ameliorate monosite or leucosite proliferative digits such as leukemia by reducing the amount of monosite or lymphocytes to suppress inflammation, body fluids and cellular immune responses associated with AIDS. In order to inhibit or treat graft rejection when transplanting tissues and organs such as corneal, bone marrow, trachea, lens, facemaker, natural or artistic skin tissue.

According to the present invention, there is a method of modulating the production of NOI used for treatment, wherein the NOI used for treatment is mainly expressed in the secondary target cell population and is rarely expressed in the primary target cell or at a biologically significant level.

The invention can also be used as a pharmaceutical mixture when treating a patient with gene therapy. Here, the mixture has an effective amount of retroviral vector as a medicament. The vector consists of viral particles obtained or generated from one or more therapeutic and diagnostic NOIs or the same that can be delivered. The drug mixture is used in humans or animals. In general, doctors will determine the actual dosage, which should be most appropriate for the patient, and will vary with age and weight and the specific patient's response.

The mixture consists of a carrier, diluent, agent or adjuvant that is acceptable as a medicament. The choice of pharmaceutical carrier, excipient or diluent can be selected according to the route of administration and the actual use of standard pharmaceuticals. The pharmaceutical mixture consists of a carrier, excipient or diluent, as well as suitable binders, lubricants, suspending agents, coating agents, solubilizers, and other carriers that assist or increase viral entry to the target site, such as lipid delivery systems.

Suitable pharmaceutical mixtures may be in the form of suppositories or pessaries, or in the form of lotions, solutions, creams, ointments or dusting powders, or tablets or capsules containing supplements such as starch or lactose. Alternatively, it can be administered on its own or in the form of elixirs, solutions or suspensions containing fragrances or pigments, orally using skin patches. Or parenterally, ie, injected into an intracabine, intravenously, intramuscularly or subcutaneously. For parenteral administration, the mixture is used in the form of a sterile aqueous solution containing salts or monosaccharides for making other substances, such as blood and isotonic solutions. When administered orally or tongue, the mixtures are administered in the form of tablets or lozenges which can be formulated in the usual manner.

In another aspect of the invention, there is a hybrid viral vector system for gene delivery in vivo in a general aspect. The system has one or more primary viral vectors that encode secondary viral vectors. Primary vectors or vectors can infect primary target cells where they can express secondary viral vectors. Secondary vectors can transduce secondary target cells.

Specifically, the gene vector of the present invention is a hybrid viral vector system for gene delivery, and can make a defective effector particle in a target cell. The gene vector thus consists of an in vitro manufactured primary vector that encodes the genes essential for making the secondary vector in vivo. In general use, secondary vectors carry one or more selected genes for insertion into secondary target cells. Selected genes refer to one or more marker genes and therapeutic genes. Marker genes encode selectable and detectable proteins.

There is more interest in this particular aspect of the present invention, and it follows the guidelines that can be applied to the aforementioned aspects of the present invention.

In another direction to the present invention, there are target cells capable of producing secondary viral vector particles that are infected with and can be infected by primary viral vectors or vectors.

Another interest in the present invention is a method for treating human or non-human mammals. This method involves the administration of a hybrid viral vector system or target cells infected with a primary viral vector or vectors as described herein.

Primary viral vectors or vectors include retroviral or adenovirus vectors and various other viral vectors such as the herpes virus or the Fox virus vector. In the case of multiple primary viral vectors, they are a mixture of vectors with different viral origins. In either case, primary viral vectors have a defect that cannot be replicated independently. Thus they can enter target cells and transfer secondary vector sequences but cannot infect other target cells because they cannot replicate.

If a hybrid viral vector system consists of more than one primary vector to encode a secondary vector, two or three primary vectors are used to infect the primary target cells. There is a single primary viral vector that encodes all components of the secondary viral vector.

Single or multiple primary vectors include adenovirus vectors. Adenovirus vectors are advantageous over other viral vectors in terms of titers available in in vitro culture. Adenovirus particles are also stable compared to envelope viruses and are easy to isolate and store. However, current adenovirus vectors have major limitations when used for in vivo treatment. This is because gene expression in defective adenovirus vectors is transient. Since the vector genome does not replicate, target cell division causes dilution of the vector. Cells expressing adenovirus proteins are destroyed at low levels because of the immune response to adenovirus proteins.

Secondary viral vectors include retroviral vectors. Secondary vectors are produced by expressing genes required for assembly and packaging of defective viral vector particles in primary target cells. Defective because it cannot be replicated independently. Thus, when a secondary retroviral vector is transduced into secondary target cells, diffusion to other target cells due to replication cannot occur.

Secondary vectors result from expression of genes essential for the production of retroviral vectors encoded in the DNA of the primary vector. Such genes include the gag-pol gene of the retrovirus, the envelope gene of the envelope virus, and the retroviral genome with one or more therapeutic genes. Defective retroviral genomes have sequences that can be reverse transcribed in at least a portion of the 5 'long terminal repeat and in some of the 3'LTR and packaging signal.

Secondary vectors are safe for use in vivo. This eliminates the possibility of recombination to create Infectious Viruses that can replicate independently.

To confirm that the replication is defective, the secondary vector seems to be encoded by a transcription unit in one or more adenovirus vectors or in another primary vector. Perhaps it is a transcription unit encoding the genome of the secondary vector, a transcription unit encoding gag-pol and a transcription unit encoding env. On the other hand, more than two of them may be added. For example, a nucleic acid sequence encoding gag-pol and env or env and genome would be combined in a single transcription unit. This is generally well known.

A transcription unit as described herein refers to a nucleic acid region that contains a signal for eliciting expression of a coding sequence and its coding sequence independent of any other coding sequence. Thus, each transfer unit typically consists of a promoter, enhancer and polyadenylation signal. Promoters and enhancers of transcription units encoding secondary vectors can be very strong, active or strongly induced in primary target cells under conditions in which secondary viral vectors are made. Promoters and enhancers are structurally effective, and organizational and timely limited in their activities. Suitable examples of tissue-restricted promoters and enhancers include those that are very active in tumor cells, such as the MUC1 promoter and enhancer, the CEA gene, or the 5T4 antigen gene. Examples of time-limited promoters and enhancers include those that respond to ischemia and hypoxia, such as hypoxia response elements or promoters and enhancers of the grp78 or grp94 genes. An example of a promoter and enhancer combination is the human cytomegalovirus major imide early promoter-enhancer combination.

The expression of secondary vector components is particularly useful under certain circumstances when hypoxia or ischemia is regulated. Hypoxia is a powerful regulator of gene expression in a wide range of different cell types, and hypoxia inducible factor-1 (HIF-1) that binds to hypoxic responsive elements (HRE) at homologous DNA reconstruction sites and various gene promoters. Wang & Semenza 1993. Proc. Natl. Acad. Sci USA 90: 430). Dachs et al (1997. Nature Med. 5: 515) report the expression of markers and therapeutic genes by human fibrosacoma cells in response to hypoxia in vitro and in in vivo solid tumors (Dachs et al ibid). To control this, a multimeric form of HRE of the mouse phosphoglycerate kinase-1 (PGK-1) gene (Firth et al 1994. Proc. Natl. Acad. Sci USA 91: 6496-6500) was used. On the other hand, the lack of marked glucose in the escapia area of the tumor appears, which can be used to specifically promote heterologous gene expression in the tumor. It has been found that the truncated 632 base pair sequence of the grp78 gene promoter, which is known to be specifically stimulated by glucose deficiency, can cause high levels of expression of reporter genes in murine tumors in vivo (Gazit G, et al 1995 Cancer Res. 55: 1660). The stability with hybrid virus vector systems is described below. There is more than one such feature.

First, homology between sequences encoding components of the secondary vector can be eliminated through deletion of the homology region. Horology regions allow genetic recombination to occur. Specifically, three transcription units are used to construct a secondary retroviral vector. The primary transcription unit contains the gag-pol gene of a retrovirus that is regulated by nonretroviral promoters and enhancers. The secondary transcription unit contains the env gene of a retrovirus that is regulated by a non-retrovirus promoter and an enhancer. The tertiary transcription unit consists of a defective retroviral genome regulated by a non-retrovirus promoter and an enhancer. In the case of the native retroviral genome, the packaging signal is located in part of the gag sequence needed to function properly. Usually when a retroviral vector system is created, packaging signals, including part of the gag gene, remain in the vector's genome. However, for the present invention, the defective retroviral genome comprises a minimal packaging signal that does not comprise a gag sequence and a homologous sequence in the primary transcription unit. Also in retroviruses such as the murine murine leukemia virus, there is an overlapping small region between the 3 'end of the pol coding sequence and the 5' end of the env. The corresponding homology region between the primary and secondary transcription units is removed by changing the sequence at the 3 'end of the pol coding sequence or at the 5' end of the env, resulting in a change in codon origin but no change in the amino acid sequence of the coding protein. .

Second, pseudotyped into a retroviral genome containing envelope proteins of other retroviruses or other envelope viruses, thereby eliminating the possibility of replicable secondary viral vectors by eliminating the homology region between the env and gag-pol components. Specifically, retroviral vectors consist of three components: The primary transcription unit carries the gag-pol gene of the retrovirus, which is regulated by nonretrovirus promoters and enhancers. The secondary transcription unit contains the env gene of the alternative envelope virus, which is regulated by nonretrovirus promoters and enhancers. The tertiary transcription unit consists of a non-retroviral promoter and a defensive retroviral genome regulated by an enhancer. The defective retrovirus genome has a minimal packaging signal that does not have a sequence homologous to the gag sequence in the primary transcription unit.

Pseudotypes are associated with retroviral genomes based on lentiviruses, such as HIV or apes infectious anemia viruses, and the ampotropic envelope protein, for example 4070A. Meanwhile, the retroviral genome is based on MMLV, and the envelope protein may be the envelope protein of other viruses that can be produced in non-toxic mounts in primary target cells, such as influenza hematogulutinin or Vesicula stomatitis virus mouse protein. have. The envelope protein may also be a modified envelope protein, such as a mutant or manufactured envelope protein.

Third, the possibility of replicating retroviruses can be eliminated by using two transcription units constructed in a special way. The primary transcription unit has a gag-pol coding region that is regulated by an active promoter-enhancer in primary target cells, such as the hCMV promoter-enhancer or tissue-restricted promoter-enhancer. Secondary transcription units encode retroviral genomic RNA that can be packaged into retroviral particles. The secondary transcription unit has the retroviral sequence required for packaging, integration and reverse transcription, and also has the sequence encoding the env protein of the envelope virus and the coding sequence of one or more therapeutic genes.

Specifically, the hybrid viral vector system used in the invention consists of single or multiple adenovirus primary vectors encoding retroviral secondary vectors. The adenovirus vectors used in the invention are derived from human adenoviruses or adenoviruses that do not normally infect humans. The vector is derived from avian adenoviruses such as adenovirus types 2 and 5 or mouse adenovirus or CELO virus (Cotton et al 1993 J. Virol 67: 3777-3785). The vector is an adenovirus vector capable of replication but is a more deficient adenovirus vector. Adenovirus vectors are defective by deleting one or more components necessary for the replication of the virus. In general, each adenovirus vector has at least one deletion region in the El region. During the creation of infectious adenovirus vector particles, this dilation is supplemented via viral passages in human fetal fibroblasts, such as the human 293 cell line, and includes an integrated copy of the left side of Ad5, including the E1 gene. The capacity for inserting heterologous DNA into such a vector is approximately 7 kb. Thus, when used in the invention, such vectors are useful when constructing a system consisting of three separate recombinant vectors, including one of the necessary transcriptional units that make up the retroviral secondary vector.

It is well known that other adenovirus vectors have more degradation in other adenovirus genes, and these vectors are suitable for use in the invention. Some of these second generation adenovirus vectors show reduced immunity (eg E1 + E2 deletion Gorziglia et al 1996 J. Virol. 70: 4173-4178; E1 + E4 deletion Yeh et al 1996 J. Virol. 70: 559 -565). Increasing the dilation increases the cloning capacity for multiple genes in the vector. For example, 25 kb dilation was attempted (Lieber et al 1996 J. Virol. 70: 8944-8960), and cloning vectors were digested with all viral genes capable of inserting more than 36 kb of heterologous DNA (fisher et al. al 1996 Virolology 217: 11-22). Such vectors are used to construct adenovirus primary vectors that encode two or three transcription units to construct a retroviral secondary vector. The invention described above solves one of the major problems associated with adenovirus vectors and other viral vectors, namely the transient expression of genes from such vectors. Retroviral particles made in primary target cells can infect secondary target cells, and gene expression in secondary target cells remains stable because the retroviral genome inserts into the host cell genome. Secondary target cells are far less immunogenic than cells transduced with adenovirus vectors because they do not make viral protein antigens to a significant extent. The use of retroviral vectors as secondary vectors has the advantage of allowing some of the cells to be differentiated, for example by targeting rapidly dividing cells. Moreover, integration of retroviruses allows for stable expression of therapeutic genes in target tissues, including stable expression in dividing target cells.

Primary viral vectors preferentially infect certain cell types or cell types. The primary vector is also a targeted vector, i.e. has a modified tissue flexure compared to native viruses, so the vector is targeted to a particular cell. "Target vector" is not necessarily linked to the term "target cell". "Target cell" simply refers to a cell that a vector can infect or transduce, whether negative or target.

The adenovirus primary vector used in the invention is also a target vector whose tissue flexibility is changed from wild type adenovirus. Adenovirus vectors can be modified to produce the target adenovirus vector. Krasnykh et al. 1996 J. Virol 70: 6839-6846; Wickham et al 1996 J. Virol 70: 6831-6838; Stevenson et al. 1997 J. Virol. 71: 4782-4790; Wickham et al. 1995 Gene Therapy 2: 750-756; Douglas et al. 1997 Neuromuscul. Disord. 7: 284-298; Wickham et al. An example is provided in 1996 Nature Biotechnology 14: 1570-1573.

Primary target cells for the vector system for use in the invention include hematopoietic cells, including monosite, macrophages, lymphocytes, granulosites or their progenitor cells; Endothelial cells; Tumor cells; Liver cells; Astrosite or glycal cells; Including epithelial cells, but not limited thereto.

Thus, the primary target cells used in the invention can produce secondary viral vectors, which can be any of the above cell types. Specifically, the primary target cell used in the invention is a defective adenovirus vector comprising a primary transcription unit for gag-pol of a retrovirus and a secondary transcription unit capable of producing a defective retrovirus genome. There are monosites or macrophages that get infected. In this case, at least the secondary transcription unit is under the control of a promoter-enhancer that is preferentially active at the site of disease in vivo, such as in the microenvironment of an escapic site or solid tumor. Specifically expressing this aspect of the invention, the secondary transcription unit consists of an intron that reduces the expression of the env gene of the virus and effectively expresses the therapeutic gene during insertion of the genome into the secondary target cells.

Secondary viral vectors are also targeted vectors. Retroviral vectors can be made by modifying the envelope protein. The envelope protein of the retrovirus secondary vector needs to be a non-tox envelope or an envelope that is produced in a non-toxic amount in the primary target cell, such as the MMLV Amphotropic Envelope or the modified Amphotropic Envelope. In such cases, stability can be achieved by removing regions or sequence homology between retroviral components.

Secondary target cell populations have the same characteristics as primary target cell populations. For example, by delivering the primary vector to tumor cells, the next vector particles capable of transducing other tumor cells can be cloned and generated. The secondary target cell group, on the other hand, differs from the primary target cell group. In this case, the primary target cells serve as endogenous factories in vivo in the patient under treatment, creating a special vector particle capable of infecting the secondary target cell population. For example, primary target cell populations include hematopoietic cells transduced with primary vectors in vivo or ex vivo. Primary target cell populations are delivered or transferred to human sites, such as tumor cells, to produce secondary vector particles capable of transducing tumor cells in solid tumors.

The invention allows for the limited production of defective retroviral particles with high titers in vivo near or at sites where the therapeutic protein or the action of the protein is required for effective transduction of secondary target cells. This is much more effective than using defective adenoviral vectors or defective retrovirus vectors.

The invention also allows the generation of retroviral vectors, such as MMLV based vectors in non-dividering cells and cells that divide slowly. Previously, MMLV-based retroviral vectors could be produced only in rapidly dividing cells, such as in vitro dividing tissue culture adaptive cells or rapidly dividing tumor cells in vivo. Broadening the range of cell types capable of producing retroviral vectors, in many cases, can deliver genes to the cells of slowly dividing solid tumors, and as diverse endothelial factories for the production of endothelial cells and therapeutic protein products. This is beneficial when using non-divider cells such as tic lineage cells.

The delivery of one or more therapeutic genes through the vector system used in the invention is used either alone or in combination with therapeutic components or other therapies. It is used to treat the following diseases. It is used to treat cancer, neurological diseases, hereditary diseases, heart diseases, seizures, arthritis, viral infections and immune system diseases. Suitable therapeutic genes include tumor suppressor proteins, enzymes, prodrug activating enzymes, immunomodulators, antibodies, immunoglobulin-like preparations, fusion proteins, hormones, membrane proteins, vasoactive proteins or peptides, cytokines, antivirals Proteins, antisense RNAs and those encoding ribozymes.

In a method of treatment according to the invention, the gene encoding the prodrug activating enzyme is transferred to the tumor using the inventive vector system, which is subsequently processed to the patient with the appropriate prodrug. Examples of prodrugs include etoposide phosphate (along with alkaline phosphatase. Senter et al. 1988 Proc. Natl. Acad. Sci. 85: 4842-4846); 5-fluorocytosine (use with cytosine deaminase, Mullen et al. 1994 Cancer Res. 54: 1503-1506); Doxorubicin n-hydroxyphenoxycetamide (Kerr et al 1990 Cancer Immunol. Immunother. 31: 202-206); Paraenbistuchloroethylaminobenzoyl glutamate (used with carboxypeptidase G2); Cephalosporin nitrogen mustard carbamate (with non-lactamase); SR4233 (use with p450); Gancyclovir (used with thymidine kinase from HSV, Borrelli et al 1988 Proc. Natl. Acad. Sci. 85: 7572-7576); Mustard prodrugs with nitroreductase (Friedlos et al 1997 J. Med Chem 40: 1270-1275); Cyclophosphamide or ifosfamide (used with cytochrome p450, Chen et al 1996 Cancer Res. 56: 1331-1340).

Provided according to the invention is a method of modulating the production of a therapeutic gene. Therapeutic genes are preferentially expressed in secondary target cell populations and rarely expressed in primary target cells or at biologically significant levels.

According to the invention, standard molecular biological techniques are used according to the technical level. Such techniques are explained in the following. Sambrook et al (1989) Molecular Cloning; a laboratory manual; Hames and Glover (1985-1997) DNA Cloning; a practical approach, Volumes I-IV (second edition); Methods for the engineering of immunoglobulin gene are given in McCafferty et al (1996) "Antibody Engineering: A Practical Approach".

In summary, the present invention relates to a suitable new delivery system capable of loading one or more NOIs into target cells.

An overall aspect of the present invention relates to a retroviral vector consisting of a functional splice donor site and a functional splice acceptor site. Here the functional splice donor site and the functional splice acceptor site are linked to a specific primary nucleotide sequence (NOI). The functional splice donor site is upstream of the functional splice acceptor site. Retroviral vectors are derived from retroviral provectors. Retroviral provectors consist of a primary nucleotide sequence (NS) to create a functional splice donor site and a secondary NS to create a functional splice acceptor site. Since the primary NS is downstream of the secondary NS, the retroviral vector forms the reverse transcription result of the retroviral provector.

The present invention provides a hybrid viral vector system for in vivo gene delivery. The system consists of one or more primary viral vectors that encode secondary viral vectors. Primary vectors or vectors can infect primary target cells, creating a secondary viral vector. Secondary vectors can be transduced into secondary target cells.

Primary vectors are obtained from or based on adenoviral vectors, and secondary viral vectors are obtained from or based on retroviral vectors such as lentivirus vectors.

The invention is illustrated by way of example, with reference to the following figure.

1 shows the structure of the retroviral proviral genome.

2 shows that a small T splice donor pLTR is added.

3 shows a schematic for pL-SA-N.

4 diagrammatically illustrates pL-SA-N with splice donors removed.

5 shows the sequence of the MLV pICUT.

Figure 6 shows an EIAV LTR plasmid with splice donors inserted in the CMV / R junction.

7 shows the insertion of the splice acceptor into pEGASUS-1.

8 shows EIAV with wild-type splice donors removed.

Fig. 9 shows pEICUT-1 resulting from the combination of pCMVLTR + SD and pEGASUS + SA (noSD).

10 shows the structure of pEICUT-Lac Z.

11 shows the pEICUT-Lac Z sequence.

12 shows the construction of the vector in transfected and transduced cells.

Fig. 13 shows the restriction of gene expression in packaged and transduced cells.

FIG. 14 shows the structure of MLV pICUT Neo-p450 which limits hygromycin expression in producer cells and expression of 2B6 (isoform of p450) in transduced cells.

Figure 15 shows a comparison of the sequence of the wild type MMLV at the 3 'end of the mutant env (m4070A) and the pol gene.

16 shows the entire sequence of modified env gene m4070A.

Figure 17 shows restricted gene expression constructs, 4070A envelope as primary cells and p450 as secondary cells.

18 shows the use of introns to limit the expression of NOIs such as p450 in transduced cells.

19 shows a schematic illustration of the transfector vector-pE1sp1A.

20 schematically illustrates pE1sp1A.

21 schematically illustrates the pE1RevE structure.

22 schematically illustrates the pE1hORSE3.1-gagpol structure.

Fig. 23 schematically illustrates the pE1PEGASUS4-genomic structure.

24 schematically illustrates the pCI-Neo structure.

25 schematically illustrates the pCI-Rab structure.

26 schematically illustrates the pE1Rab structure.

27A schematically illustrates the natural splicing arrangement in a retroviral vector.

27B schematically illustrates the splicing arrangement in known retroviral vectors.

27C schematically illustrates the splicing arrangement performed by the present invention.

Figure 28 schematically illustrates a dual hybrid virus vector in the present invention.

In more detail, Figure 1 shows the structure of the genome of the retrovirus provirus. The simplest retroviruses, such as the murine oncoretrovirus, have three open reading frames: gag, pol, and env. The frame shift during the translation of gag leads to the translation of pol. Splicing occurs between the splice donor (SD) and the splice acceptor (SA), resulting in Env expression and translation. Packaging signals are referred to as Psi and are only included in full length transcripts. However, for the env expressing subgenomic transcript, this signal is removed during splicing.

2 shows the pLTR with the small T splice donor added. The small-t splice donor sequence is inserted into the LTR vector downstream of the transcriptional start but not upstream of the R region. Thus, while reverse transcription of the final structure occurs, the U3 splice donor-R cassettes are inherited at the 5 'end of the proviral vector, and the expressed RNA transcription products contain splice donor sequences near their 5' terminals.

3 shows a schematic of pL-SA-N. Consensus splice acceptor (T / C) nNC / TAG-G (Mount 1982 Nucleic Acids Res 10: 459-472) and branch points are both underlined and bolded. Arrows indicate intron / exon junctions. The consensus splice acceptor sequence is inserted into the Stu1 / BamH1 site of pLXSN. In that position the acceptor will join any upstream splice donor of the final RNA transcript.

4 schematically illustrates the structure of pL-SA-N with splice donors removed. GT is converted to gC by PCR of the pL-SA-N vector using the two oligonucleotides shown below. The resulting product was cloned from Spe1-Asc1 to pL-SA-N so that the gT of the wild-type splice donor was changed to gC. Both Spe1 and Asc1 sites are indicated in bold, and mutations in the Spe1 oligonucleotide are indicated in bold capital letters.

5 shows the sequence of the MLV pICUT.

6 schematically illustrates the insertion of a splice donor into the CMV / R junction of the EIAV LTR plasmid. Two oligonucleotides summarized below are PCR and the result is cloned into CMVLTR with the same portion removed from Sac1-BamH1. In Sac1 oligonucleotides, the arrow indicates a trap start. The new insert is capitalized in the underlined splice donor sequence. The start of R is italicized.

7 schematically illustrates that a splice acceptor is inserted into pEGASUS-1. The double-stranded oligonucleotides described below are inserted into pEGASUS-1 digested by Xho1-Bpu1 102 to make plasmid pEGASUS + SA. Consensus splice acceptor (T / C) nNC / TAG-G (Mount 1982 Nucleic Acids Res 10: 459-472) and branch points are both underlined and bolded. Arrows indicate intron / exon junctions.

8 diagrammatically illustrates an EIAV vector from which wild-type splice donors have been removed. The splice donor sequence is removed by PCR in duplicate with pEGASUS + SA at the end of the temple and oligonucleotide shown below. Initially PCR with oligo1 + 2 and oligo3 + 4. The resulting amplifier product is used in a third PCR reaction. Add oligos 2 and 4 after the tenth cycle of the third reaction. This result was cloned into pEGASUS + SA in Sac1-Sal1 to make plasmid pEGASUS + SA (noSD). The position of the splice donor SD is indicated. The point mutation that converts the GT of the wild-type splice donor to GC is highlighted in oligo3, which is the complementary strand to oligo1.

9 schematically illustrates that pEICUT-1 is produced through a combination of pCMVLTR + SD and pEGASUS + SA (noSD). Insert the MIU1 fragment of pEGASUS + SA (noSD) into the unique MIU1 of pCMV-LTR.

10 schematically illustrates the structure of pEICUT-LacZ. It is made by inserting a LacZ fragment from the Xho1-Bpu1 102 site of pEGASUS-1 and inserting it into the Xho1-Bpu1 102 site of pEICUT-1, summarized below. The sequence of pEICUT-LacZ is shown in FIG.

12 diagrammatically illustrates the construction of a vector in both transfected and transduced cells. Starting pICUT vectors do not have a splice donor upstream of a splice acceptor, such as a consensus splice acceptor derived from IgSA, and consequently RNA transcripts are not spliced. After all, every transcript will be a full length transcript with a packaging signal (A). However, during transduction, splice donors, such as small-T splice donors, are inherited by the 5 'of the proviral vector, and all newly generated RNA transcripts have splice donors upstream of the splice acceptor. Thus, introns and maximum splicing occur (B).

Figure 13 illustrates schematically the restriction of gene expression for packaging and transduced cells. Restriction of gene expression results from the presence of a hygrosin ORF upstream of the neomycin ORF in MLV pEICUT (a). According to this cloning method, an RNA transcript that expresses only hygromycin in transduced cells cannot be produced because the resulting vector effectively reads only the ORF upstream of the ribosomal 5 'cap dependent translation. However, during transduction, hygromycin is included in functional introns and removed from mature transcripts, and neomycin ORF is translated into 5 'cappendant manner.

Figure 14 schematically illustrates the construction of an MLV pICUT Neo-p450 vector that limits the expression of hygromycin in producer cells and the expression of 2B6 (isoform of p450) in transduced cells. In this configuration, the starting vector is the pICUT vector of FIG. 13 that includes both hygro and neo. The neo gene is replaced with the entire p450 2B6 cDNA as follows. That is, the complete 2B6 cDNA is obtained by RT-PCR of human river RNA (Clontech) using the following primer.

5'ttcgatgatcaccaccatggaactcagcgtcctcctcttccttgcac3 '

5'ttcgagccggctcatcagcggggcaggaagcggatctggtatgttg3 '

The result is a complete 2B6 cDNA with optimized Kozak sequences flanking the unique Bcl1 and NgoM1 sites. This cDNA was cloned into the Bcl1-NgoM1 site of pICUT-Hyg-Neo, where Neo is converted to p450 (below (A)). Also shown below are the proviral DNA structures in transfected cells (B) and transduced cells (C).

Figure 15 compares the wild type MMLV sequence at the 3 'end of the pol gene with the sequence of mutant env (m4070A).

16 discloses the entire sequence of 4070A that was changed.

FIG. 17 shows limited expression of genes of retroviral vectors where primary NOI (4070A envelope ORF) is expressed in the initial vector and secondary NOI (here p450) is expressed only after vector replication. After replication, the 4070A gene is present in a functional intron and is removed during RNA splicing.

18 shows that the 5 'end of the p450 gene (marked flush on splice donor) is found only upstream of the 3' end of the p450 gene (marked flush on SA) after replication and functional p450 gene is expressed only after replication. Viral expression vectors are disclosed.

Example

Example 1 Structure of a Split-Intron MLV Vector

(i) Addition of Small-T Splice Donors

The starting plasmid in this structure is pLXSN (Miller et al 1989 ibid). First, this structure is cleaved by Nhe1 and the backbone is relinked to form the LTR (U3-R-U5) plasmid. Oligonucleotides containing a splice donor sequence between Kpn1-Bbe1 sites are inserted into this plasmid. Downstream of the splice donor contained in this oligonucleotide is the MLV R sequence up to Kpn1. This plasmid is named 3'LTR-SD (FIG. 2).

(ii) addition of splice acceptor

Splices used in this structure, including branch points representing residues on the order of 20-40 bases upstream of the splice acceptor associated with intron laritogenesis (Aebi et al 1987 Trends in Genetics 3: 102-107). The acceptor sequence is derived from the mRNA of the immunoglobulin heavy chain variable region (Bothwell et al 1981 Cell 24: 625-637) but has a consensus / optimized acceptor site. Such sequence signals also appear in pCI (Promega). The acceptor sequence is inserted into the BamH1-Stu1 site of pLXSN in a double-stranded oligonucleotide to create the vector pL-SA-N (the SV40 promoter is lost from pLNSX during cloning). See Figure 3 for an overview of the cloning strategy.

(iii) removal of original splice donor from pL-SA-N

PCR base directed mutagenesis is used to remove splice donors contained within the gag sequence of pL-SA-N. Two oligonucleotides are PCR and amplify the region of AsL1 and Spe1 unique sites of pL-SA-N. The change of agGTaag to agGCaag is also found not only in Spe1-spanning oligonucleotides but also in splicing negative pBABE vectors (Morgenstern et al 1990 ibid). The cloning strategy is summarized in FIG. 4.

(iv) combination of pL (noSD) -SA-N and 3'LTR-SD

The pL (noSD) SA-N plasmid contains 3'LTR of normal MLV. This is replaced by the 3'LTR-SD sequence by obtaining a Nhe1 insert from pL (noSD) SA-N and dropping it into the Nhe1 digested 3'LTR-SD vector. The resulting plasmid named pICUT (Intron Created Upon Transduction) contains all the features of this new generation of retroviral vectors (see sequence data for FIG. 5).

Example 2 Structure of Split-Intron Lentivector

Structure of initial EIAV lentiviral expression vector (British patent application 9727135.7)

The starting point for the construction of the split-function lentiviral vector is the vector pEGASUS-1 (British patent application 9727135.7). This vector is derived from the infectious provirus EIAV clone pSPEIAV19 (Patent Registration U01866: Payne et al 1994). The configuration is summarized below. First, EIAV LTR amplified by PCR is cloned into pBluescript II KS + (Stratagene). The Mlu1 / Mlu1 (216/8124) fragment of pSEIAV19 is inserted into pBluescript II KS + (FIG. 1) to generate wild type proviral clone (pONY2). The env region is then lost due to the removal of the Hind III / Hind III fragment to make pONY2-H. In addition, the BglII / NcoI fragment in pol (1901/4949) is removed and the beta galactosidase gene, which is carried by the HCMC IE enhancer / promoter, is inserted in place. This is called pONY2.10nlsLacZ. To reduce the EIAV sequence to 759 base pairs and the primary transcript to turn off the CMV promoter, firstly, the sequence containing the EIAV polypurine tract (PPT) and the 3 'LTR was amplified by PCR with pONY2.10LacZ using the following primers: Pie.

PPTEIAV + (Y8198): GACTACGACTAGTGTATGTTTAGAAAAACAAGG,

3'NEGSpeI (Y8199): CTAGGCTACTAGTACTGTAGGATCTCGAACAG

The PCR product is then cloned into the SpeI site of pBS II KS ⁺ and U5 is near Not1 of pBlueScript II KS ⁺ .

Next, for the reporter gene cassette, the CMV promoter / LacZ of pONY2 10nlsLacZ is removed by Pst1 digest and cloned into the Pst1 site of pBS.3'LTR. The LacZ gene is near 3'LTR and this vector is called pBS CMVLacZ.3'LTR. The 5 'region of the EIAV vector is constructed from the expression vector pCIEneo. pCIEneo is derived from modified pCIneo (Promega) by including approximately 400 bp derived from the 5 'end of the CMV promoter. This 400bp fragment is obtained by PCR using the following primers.

VSAT1: (GGGCTATATGAGATCTTGAATAATAAAATGTGT)

VSAT2: (TATTAATAACTAGT)

PHIT60 (Soneoka et al 1995 Nucleic Acids Res 23: 628-633) is used as a template. The result is digested by BglII and SpeI and cloned into the BglII / SpeI site of pCIE-Neo.

Fragments of the EIAV genome from the R region of gag coding region (nt268-675) to nt150 are amplified from pSEIAV using the following primers.

CMV5'EIAV2: (Z0591) (GCTACGCAGAGCTCGTTTAGTGAACCGGGCACTCAGATTCTG:

(The underlined portion is the sequence that anneals to the EIAV region.)

3'PSI.NEG (GCTGAGCTCTAGAGTCCTTTTCTTTTACAAAGTTGG)

The resulting PCR product is flanked by XbaI and SacI sites. It is then cleaved and cloned into the pCIE-Neo XbaI-SacI site. The resulting plasmid, namely pCIEneo5'EIAV, contains the start of the EIAV R region at the transcriptional start point of the CMV promoter. The CMVLacZ / 3LTR cassette is then inserted into the pCIEneo 5'EIAV plasmid. At this time, the pCIEneo 5'EIAV plasmid obtains a fragment from pBS.CMVLacZ.3LTR to ApaI to NotI, which is obtained through the digest of Sal1-Not1, and the pCIEneo.5'EIAV (Sal1 and Apa1 sites make blunt ends in front of the vector and the Not1 digest). It is a result of cloning with T4 "polysheet" for insertion. The resulting plasmid is named pEGASUS-1. The gene transfer vector, pEGASUS-1, requires expression of both gag / pol and env provided in trans by the packaging cell. For the source of gag / pol, the EIAV gag / pol expression plasmid (pONY3) is made by inserting the MluI / MluI fragment of pONY2-H into the mammalian expression vector pCI-neo (Promega). The gag-pol gene is expressed from the hCMV-MIE promoter-enhancer and has no LTR sequence. For the env source, the pV583 VSV-G expression plasmid is mainly used. These three vectors are used for three plasmid coatfections as described for the MLV base vector (Soneoka et al 1995 Nucl. Acids Res. 23: 628-633). The titer of virus produced in D17 5 blasts is 10 ⁴ to 10 ⁵ lacZ forming units per ml.

the structure of the EIAV lentiviral version vector of pICUT; PEICUT by name

To construct the pEICUT, the Xma1-SexA1 fragment of pEGASUS-1 was removed from pEGASUS-1, and the blunt end and plasmid produced by T4 polymerase were relinked to carry pEGASUS with SV40-Neo cassette on the backbone. A plasmid containing only a portion of CMV-R-U5 of -1 is made. This plasmid is named CMVLTR. To insert a splice donor at the CMV-R interface, PCR is performed with the two oligonucleotides shown in Figure 6 below. The resulting plasmid is named pCMVLTR + SD. Immunoglobulin-based consensus splice acceptors such as the MLV pICUT are used in the EIAV version. It is inserted at the XhoI-Bpu1102 site of pEGASUS-1 using the oligonucleotide shown in FIG. 7. The result is plasmid pEGASUS + SA. By overlapping the method of PCR with oligonucleotides and using pEGASUS + SA as a template as shown in Figure 8, the wild-type splice donors of EIAV are removed. The result is plasmid pEGASUS + SA (noSD). Then, to make pEICUT-1, inserting the Mlu1-Mlu1 fragment of pEGASUS + SA (noSD) into the unique Mlu1 site of pCMVLTR + SD produces pEICUT-1 (FIG. 9). LacZ can be transferred from pEGASUS-1 to pEICUT-1 using the Xho1-Bpu1102 digest (FIG. 10; sequence data is FIG. 11). Both the MLV and EIAV pICUT vectors have a splice acceptor strongly upstream of the splice donor, resulting in a non-functional intron (the intron requires a splice donor located 5 'of the splice acceptor). For this reason, the resulting transcription product will not be spliced when the vector is transfected into producer cells. Thus the packaging signal is not lost, and consequent maximal packaging occurs (FIG. 12).

However, because of the way retroviruses replicate only during transduction, the transcripts generated in the integrated pICUT vector differ from those of the transfected cells described above. This is because during replication the 3'U3 promoter (up to 5 'onset of R) is copied and used as a 5' promoter in transduced cells. For this reason, transcripts built on the integrated pICUT will strongly contain a strong splice donor at 5 'of the splice acceptor. Both are located upstream of the neo ORF. Therefore, such a transcript will have an intron that functions in the 5'UTR (untranslated region) and will be spliced and translated to the maximum.

Another advantage of the vectors described above is that since introns are made only during transduction, they limit gene expression in packaged cells or transduced cells. One example of how this occurs is shown in FIG. 13. The method involves cloning secondary genes such as hygromycin upstream of the splice acceptor. This is done by extracting the hygromycin cDNA from the SalI fragment of Selectavector Hygro (Ingenius; Oxfordshire, UK) and cloning it to the XhoI site of pICUT (located upstream of the splice acceptor). This vector selectively expresses hygromycin in transformed cells and neomycin in transduced cells. This is because only one primary gene is translated by ribosomes without the aid of internal ribosomal binding sites (IRESs) in any one mRNA transcript. In transformed cells such genes may be hygromycin. However, in transduced cells, since the hygromycin open reading frame is contained within a functional intron, these genes are removed from the mature mRNA transcript to allow for translation of the neo ORF.

Vectors with such cell specific gene expression will be used clinically for a variety of reasons. For example, expression of the resident marker can be limited to the producer cell. They are necessary but not present in immunogenic transduced cells. In another example, expression of virulence genes such as lysine and dominant negative signaling protein may be limited to transduced cells. They are needed to arrest cell growth or kill cells, but no producer cells exist. Such a feature would prevent the high titer virus from being produced. 14 shows Neo-p450 MLV pICUT where only Neo is expressed in producer cells and prodrug p450 2B6 isoform is expressed in transduced cells.

Another advantage of generating introns during transduction is that any essential elements necessary for vector function are located in the functional introns. This intron is produced during transduction and is removed from the transcript of the transduced cells. For example, both MLV and lentiviral pICUT vectors have viral transcripts generated during transduction and have a functional Psi packaging signal in the intron that is removed from the transduced cells transcript (the location of Psi in MLV is Bender et al. al 1987; Psi position of EIAV is shown in British Patent Application No. 9727135.7).

The advantages of such a structure are as follows.

(i) The translation from the resulting transcript is improved because ribosomes "stutter" in the Psi secondary structure (Krall et al 1996 ibid, referenced in the references).

(ii) In the absence of a packaging signal, transcript packaging by endogenous retroviruses is inhibited.

(iii) Undesired premature translational initiation is inhibited when viral essential elements such as gag and other potential ATG translational start sites are removed from the transcripts expressed in the transduced cells. This is particularly beneficial when the packaging signal extends to gag, as in both the EIAV and MLV pICUT vectors.

(iv) The promoters, enhancers and suppressors are located in introns generated during transduction. Thus, it mimics the construction of other transcripts, such as those from CMVs containing such entities in introns (Chapman et al 1991 ibid).

In summary, the new pICUT vector system described in the present invention facilitates the following configuration.

(i) Maximum script packaging and reduced translation of producer cells

(ii) introns that enhance transcribation splicing and translation in transduced cells

(iii) restriction of gene and viral essential expression in producer cells or transduced cells;

Example 3 Construction of MMLV Ampotropic Env Gene with Minimum Homology for pol Gene and Gag-pol Transcription Cassette

In Maloney murine leukemia virus (MMLV), the first about 60 bp of the env coding sequence overlaps with the sequence at the 3 'end of the pol gene. To eliminate the possibility of recombination between them in cells expressing two genes, the homology region between these two genes is removed.

The amino acid sequence of the coding protein is maintained as follows while the DNA sequence of the first 60 bp of the coding sequence of env is changed. The synthesized oligonucleotides are configured to alter the codon content at the 5 'end of env (FIG. 15) and are inserted into the rest of env as follows.

The starting plasmid for reconstitution of the 5 ′ end of the 4070A gene is the pCI plasmid (Promega). It is cloned into Xba1-Xba1 fragment containing 4070A gene of pHIT456 (Soneoka et al 1995 ibid) to form pCI-4070A. PCR with pCI-4070A using primary A and B (FIG. 15) yields a 600bp product. This result is cloned between the Nhe1 and Xho1 sites of pCI-4070A. The resulting structure is arranged across the Nhe1 / Xho1 region. Even if the resultant amino acid sequence is the same as the original 4070A, the region homologous to the pol gene is removed.

The full sequence of the modified env gene m4070A is shown in FIG. 16. This sequence is inserted into the expression vector pCI (Promega) by standard techniques. The CMV gag-pol transcription unit is derived from pHIT60 (Soneoka et al 1995 ibid).

Example 4 Removal of Gag Sequences from Retrovirus Packaging Signals

DNA fragments containing LTR and minimally functional signaling signals can be obtained by retroviral vector MFG (Bandara et al 1993 Proc Natl Acad Sci 90: 10764-10768) or by PCR using the following oligonucleotide primers: It is derived from DNA.

HindIIIR: GCATTAAAGCTTTGCTCT

L523: GCCTCGAGCAAAAATTCAGACGGA

This PCR fragment contains MMLV nucleotides +1 to +523 and does not include a gag coding sequence starting at +621 (number based on the nucleotide sequence of MMLV. Shinnick et al 1981 Nature 293: 543- 548).

PCR fragments can be used to construct the retroviral genome using cleavage by HindIII and Xho1 and subcloning using standard techniques. Such vectors lack homology to gag coding sequences.

Example 5 Construction of a Defective Retrovirus Genome

A transcription unit capable of generating a defective retroviral genome is shown in FIG. 17. It contains the following elements; Hypoxia regulating the promoter / enhancer consisting of three copies of the PGK-gene HRE and the SV40 promoter from which the 72 bp repeat enhancer of pGL3 (Promega) was removed; An MMLV sequence comprising R, U5 and a packaging signal; coding sequence of m4070A (Example 3); Splice acceptors; Cloning site when inserting the coding sequence for the therapeutic protein; Polypyrimidine tract of MMLV; Secondary copy of HRE including promoter / enhancer; Splice donor sites; Secondary copies of R and U5;

During the integration and reverse transcription of the vector into secondary target cells, splice donors are inserted upstream of the env gene. As a result, splicing removes the mRNA so that the therapeutic gene is effectively expressed only in the secondary target cells (FIG. 17).

Example 6 Construction of a Conditional Expression Vector for Cytochrome p450

FIG. 18 shows the structure of the retroviral expression vector cDNA coding sequence of cytochrome p450 gene in which p450 is expressed due to direct splicing during transduction. Therefore this limits expression in the transduced cells.

1) The starting plasmid for the construction of this vector is pLNSX (Miller and Rosman 1989 BioTechniques 7: 980-990). Natural splice donors (... agGTaag ...) are included in the pLNSX (position 781/782) packaging signal and are mutated by PCR mutagenesis using the ALTERED SITES II mutagenesis kit (Promega) and synthetic oligonucleotide sequences. .

5'-caaccaccgggagGCaagctggccagcaactta-3 '

2) The CMV promoter of pCI expression vector (Promega) is isolated by PCR using the following two oligonucleotides.

Primer 1: 5'-atcggctagcagatcttcaatattggccattagccatat-3 '

Primer 2: 5'-atcgagatctgcggccgcttacctgcccagtgcctcacgaccaa-3 '

This produces a fragment comprising a CMV promoter with a 5 'Nhe1 site (Primer 1) and a 3' Not1 and Xba1 site (Primer 2). It is cleaved into Nhe1 and Xba1 and cloned into pLNSX from the removed Nhe1-Nhe1 fragment.

3) The 5 'end of the cytochrome p450 cDNA coding sequence is isolated by RT-PCR of human River RNA (Clontech) using the following primers.

Primer 3: 5'-atcggcggccgcccaccatggaactcagcgtcctcctcttccttgcaccctagg-3 '

Primer 4: 5'-atcggcggccgcacttacCtgtgtgccccaggaaagtatttcaagaagccag-3 '

This amplifies the 5 'end of p450 from ATG to 693 residue (numbered from the translation initiation site. Yamano et al 1989 Biochem 28: 7340-7348). Also included is the Not1 site and the optimized "Kozak" translation initiation signal at the 5 'end of the fragment (derived from Primer 3). Consensus splice donor sequences (also found in pCI, originally derived from the human beta globin gene) with GT splice donors flushed to other Not1 sites and 704 residues of p450 were derived from the sequence from Primer 4. Included at the 3 'end. This fragment is digested by Not1 and cloned into the Not1 digested plasmid generated in step 2.

4) The Nhe1-Nhe1 fragments removed during the cloning of Step 2 are reinserted into the plasmid of Step 3. As a result, the retroviral vector described in FIG. 17 is generated, but the 3 'end of p450 is lost.

5) 3 ′ of the p450 coding sequence is isolated by RT-PCR human River RNA (Clontech) using the following primers.

Primer5: 5'-actgtgatcataggcacctattggtcttactgacatccactttctctccacagGcaagtttacaaaacctgcaggaaatcaatgcttacatt-3 '

Primer 6: 5'-actgatcgatttccctcagccccttcagcggggcaggaagc-3 '

This results in an amplepie from 705 residues (in capital letters of Primer 5) to the 3 'end of p450, extending to the translation termination codon. The branch point upstream of the Bcl1 site, the consensus splice acceptor, and 705 residues (found in pCI and originally derived from the immunoglobulin gene) are contained within the 5 'end of the resultant and are generated by primer 5. The Cla1 site is included at the 3 'end of the result downstream of the stop codon and is generated by primer 6. This PCR result is cleaved by Bcl1 and Cla1 and cloned into the vector of step 3 with the Bcl1-Cla1 fragment removed to make the retroviral vector described in FIG.

The following examples illustrate the construction of adenorentivirus systems that can be used in the transient production of lentiviruses in vitro or in vivo.

First generation recombinant adenovirus

First-generation adenovirus vectors consist of the deletion of E1 and E3 of the virus. This allows the insertion of porin DNA and is usually inserted into the left arm of the virus in proximity to the left inverted terminal repeat (ITR). Virus packaging signals (194-358nt) overlap the E1a enhancer and most of the E1 appears in the deleted vector. This sequence can be translocated to the right end of the viral genome (Hearing & Shenk, 1983 Cell 33: 59-74). Therefore, 3.2kb may be deleted from the E1 deficient vector (358-3525nt).

Adenovirus can package 105% of the genome. Thus we can add an extra 2.1kb. Therefore, in viral vectors with E1 / E3 deleted, the cloning capacity is 7-8 kb (2.1 kb + 1.9 kb (delete E3) +3.2 kb (delete E1)). Recombinant adenovirus cannot be replicated in non-E1 complimenting cell lines because it lacks the essential E1 initial gene. The 293 cell line was developed by Graham et al (1977 J Gen Virol 36: 59-74) and contains about 4 kb from the left end of the Ad5 genome, including ITR, packaging signal, E1a, E1b, pLX. Cells stably express E1a and E1b gene products, but do not express late protein LX even if the pLX sequence is in E1b. In non-complementing cells, the El dilated virus transduces the cell and delivers it to the nucleus but without expression from the El dilated genome.

First Generation Adenovirus Production System

Microbix Biosystems-nbl Gene Science

The schematic of FIG. 19 shows the general method used to generate recombinant adenovirus using a microbix system.

A common method involves cloning foreign DNA with an El shuttle vector in which the El region of 402-3328 bp is replaced by a porin DNA cassette. Recombinant plasmids are transfected into 293 cells with pJM17. pJM17 includes the insertion of a procarrier pBRX vector (including ampicillin resistance and bacterial ori sequences) into the deleted E3 region and the E1 region in the 3.7 map unit. This 40 kb plasmid is too large to be packaged in adeno nucleocapsids but can grow in bacteria. Intracellular recombination in 293 cells resulted in the insertion of foreign DNA and the amp and ori sequences.

Example 7 Configuration of Transfer Plasmid for Generation of Adenovirus Containing EIAV Component

To create a lentiviral vector, four adenoviruses must be produced. Genome, gagpol, envelope (Raviz G) and Rev. Lentiviral components are expressed from heterologous promoters, and they contain intron and polyadenylation signals necessary for high expression of the envelope of gagpol, Rev, Raviz. When these four viruses are transduced into El la minus cells, the adenovirus components will not be expressed but the heterologous promoter will cause the expression of the lentiviral components. The construction of the EIAV adenovirus system is summarized below (Example 1) (application 9727135.7). EIAV is based on a minimal system without any of the non-essential EIAV encoded proteins (S2, Tat or envelope). The envelope used to pseudotype EIAV is the labyrinth envelope (G protein). This is well described to pseudotype the EIAV (application no. 9811152.9).

Transfer plasmid

Described below is the construction of the transfer plasmid containing the EIAV components. The transfer plasmid is pE1sp1A (FIG. 20).

Recombinant transfer plasmids can be used to make recombinant adenoviruses by homologous recombination in 293 cells.

A schematic description of the following plasmids is attached.

A) pE1RevE-Rev Structure

Plasmid pCI-Rev is cleaved by Apa L1 and ClaI. The 2.3 kb band encoding EIAV Rev has blunt ends by the Clinow polymerase and is inserted into the EcoRV site of pE1sp1A to generate plasmid pE1RevE (FIG. 21).

B) pE1HORSE3.1-gagpol structure

pHORSE3.1 is cleaved by Sna B1 and Not I. The 6.1kb band encoding EIAV gagpol is inserted into pE1RevE cleaved by SnaB1 and NotI (7.5kb band is purified), resulting in plasmid pE1HORSE3.1 (FIG. 22).

C) pE1PEGASUS- genomic construct

pEGASUS4 is cleaved by BglII and NotI. The 6.8 kb band containing the EIAV vector genome is inserted into pE1RevE cleaved by BglII and NotI (6.7 kb band is purified). As a result, pE1PEGASUS is produced (FIG. 23).

D) pCI-Rab-Raviz structure

To make pE1Rab, the open reading frame of the labyrins is inserted into pCI-Neo by cleaving the plasmid pSA91RbG with NsiI and AhdI (FIG. 24). The 1.25 kb band has a blunt end by T4 DNA polymerase and is inserted into pCI-Neo cleaved by SmaI. As a result, pCI-Rab is generated (FIG. 25).

F) pE1Rab-Raviz structure

pCI-Rab is cleaved by SnaB1 and NotI. The 1.9 kb band encoding the labyrinth envelope is inserted into pE1RevE truncated by SnaB1 and NotI. The result is plasmid pE1Rab (FIG. 26).

Summary

The present invention relates to a novel delivery system suitable for introducing one or more NOIs into a target cell.

The present invention includes a retroviral vector consisting of a functional splice donor site and a functional splice acceptor site. Functional splice donor sites and functional splice acceptor sites are flanked by specific primary nucleotide sequences (NOIs). The functional splice donor site is upstream of the functional splice acceptor site. Retroviral vectors are derived from retroviral provectors. Retroviral provectors consist of a primary nucleotide sequence (NS) capable of producing a functional splice donor site and a secondary NS capable of generating a functional splice acceptor site. The primary NS is downstream of the secondary NS. Retroviral vectors are generated through reverse transcription of retroviral provectors.

In other words, the functional SD and SA include a new delivery system consisting of one or more NOIs on the side. This is generated from the inverted provectors so that SD and SA are spliced out of function.

This aspect of the invention may be referred to as "split-intron". A schematic showing this aspect of the invention is shown in FIG. 27C. In contrast, FIGS. 27A and 27B show splicing structures in known retroviral vectors.

Another aspect of the invention involves a novel delivery system consisting of one or more adenovirus vector components that can package one or more lentiviral vector components. Wherein the lentiviral vector consists of a split intron array.

This aspect of the invention may generally be referred to as a hybrid viral vector system. In this particular case, the combination of adenovirus components and lentiviral components is called a dual hybrid viral vector system.

A schematic showing this aspect of the invention is shown in FIG.

These aspects of the invention are addressed here.

All publications mentioned above are incorporated by reference. Various modalities, various methods, and systems of the invention appear proficient without departing from the scope and spirit of the invention. Although the invention has been specifically described and described, it is to be understood that the invention should not be unduly limited to such particular specific language as claimed. Various modifications of the modes of carrying out the invention which are obvious to those skilled in molecular biology and related fields are included within the scope of the following claims.

Claims

1. In a retroviral vector consisting of a functional splice donor site and a functional splice acceptor site, the functional splice donor site and the functional splice acceptor site are specific primary nucleotide sequences (NOIs), The functional splice donor site is upstream of the functional splice acceptor site, the retroviral vector is from a retroviral provector, and the retrovirus provector is capable of producing the functional splice donor site. It consists of a primary nucleotide sequence (NS) and a secondary NS capable of producing the functional splice acceptor site, the primary NS downstream of the secondary NS, and the retroviral vector reverse transcription of a retroviral provector. Results formed Retroviral vectors in.

2. The retroviral provector of claim 1, wherein the retroviral provector consists of a tertiary NS upstream of the secondary nucleotide sequence, wherein the tertiary NS is capable of producing splice donor sites having no function. Retrovirus vectors.

3. The retroviral vector of claim 1 or 2, wherein the retroviral vector further comprises a secondary NOI, wherein the secondary NOI is downstream of a functional splice acceptor site.

4. The retroviral vector of claim 3, wherein the retroviral provector comprises a secondary NOI and the secondary NOI is downstream of the secondary nucleotide sequence.

5. The retroviral vector according to item 3 or 4, wherein the secondary NOI or an expression thereof is or comprises a therapeutic substance or a diagnostic substance.

6. The retro according to any one of the preceding paragraphs, characterized in that the primary NOI or its expression is at least one substance having a selectivity, such as a marker element, a viral essential element or part thereof, or a combination thereof. Virus vector.

7. The method according to any one of the preceding items, wherein the primary NS is at or near the 3 'end of the retroviral provector, preferably the 3' end comprises a U3 region and an R region, preferably The primary NS is a retroviral vector characterized by being located between the U3 region and the R region.

8. The method of claim 7, wherein the U3 region and / or primary NS of the retroviral provector comprises a NS that is a tertiary NOI, wherein the NOI comprises a transcriptional control element, a coding sequence or part thereof, and the like. Retrovirus vector.

9. The retroviral vector according to any one of the preceding clauses wherein the primary NS can be obtained from a virus.

10. The retroviral vector of claim 9, wherein the primary NS is intron or part thereof.

11. The retroviral vector of claim 10 wherein the intron is obtained from the small t-intron of the SV40 virus.

12. The method of any one of the preceding clauses, wherein the retroviral provector comprises a retroviral packaging signal and the secondary NS is located downstream of the retroviral packaging signal such that splicing is inhibited at the primary target site. Retrovirus vector characterized in that.

13. The retroviral vector of any one of the preceding clauses wherein the secondary NS is located downstream of the primary NOI such that the primary NOI can be expressed at the primary target site.

14. The retroviral vector of any one of the preceding clauses, wherein the secondary NS is located upstream of the multiple cloning site so that one or more additional NOIs can be inserted.

15. The retroviral vector of any one of the preceding clauses wherein the secondary NS is a nucleotide sequence encoding an immunogen or part thereof.

16. The retroviral vector of claim 15 wherein the immunogen is an immunoglobulin.

17. The retroviral vector of claim 16 wherein the secondary NS is a nucleotide sequence encoding an immunoglobulin heavy chain variable region.

18. A retroviral vector according to any one of the preceding clauses wherein the vector further comprises a functional intron.

19. The retroviral vector of claim 18, wherein the functional intron is in a position where it can inhibit expression of at least one of the NOIs at a desired target site.

20. The retroviral vector of claim 19 wherein the target site is a cell.

21. The retroviral vector of any one of the preceding clauses wherein the vector or provector is derived from a murine oncoretrovirus or lentivirus.

22. Retroviral vector according to item 21, wherein the vector is derived from MMLV, MSV, MMTV, HIV-1, EIAV.

23. The retroviral vector of any one of the preceding clauses wherein the retroviral vector is an integrated provirus.

24. Retroviral particles obtainable from the retroviral vectors of any one of the preceding paragraphs.

25. A cell transfected or transduced with the retroviral vector of any one of preceding paragraphs 1-23 or the retroviral particles of paragraph 23 above.

26. Use of the retroviral vector of any of the preceding paragraphs 1-23 or the retroviral particles of paragraph 23 or the cell of paragraph 25 as a drug.

27. Use of a retroviral vector of any one of claims 1-23 or a viral particle according to claim 24 or a cell according to claim 25 for the preparation of a pharmaceutical mixture for delivering one or more NOIs to a target site in the same need.

28. A method comprising the use of a cell transfected or transfected with a retroviral vector according to any one of claims 1-23 or a virus particle according to claim 24 or a cell according to claim 25.

29. The retroviral vector according to any one of claims 1-23 or the viral particle according to claim 24 or the cell according to claim 25, wherein the delivery system is one for delivering NOI or multiple NOIs to primary target cells. A non-retroviral expression vector, adenovirus or plasmid or combination thereof and a delivery system comprising a retroviral vector for NOI or multiple NOI delivery to secondary target cells.

30. Retrovirus provectors as defined in any of the preceding claims.

31. Use of a functional intron to limit the expression of one or more NOIs in a desired target cell.

32. Use of reverse transcriptase to deliver primary NS from the 3 'end of the retroviral provector to the 5' end of the retroviral vector.

33. A hybrid viral vector system for gene transfer in vivo, wherein said system consists of one or more primary viral vectors encoding secondary viral vectors, said primary vectors or vectors capable of infecting primary target cells, wherein 2 A hybrid viral vector system, characterized in that it can express a secondary viral vector, and the secondary vector can transduce secondary target cells.

34. The hybrid virus of paragraph 33, wherein the primary vector is obtained from or based on an adenovirus vector, and the secondary viral vector is obtained from or based on a retroviral vector, preferably a lentiviral vector. Vector system.

35. Use of a hybrid viral vector system according to paragraphs 33 and 34, wherein the lentiviral vector has a split-intron arrangement.

36. A hybrid viral vector system, characterized in that the lentiviral vector can carry or comprise a split-intron array.

37. A lentiviral vector system, characterized in that the lentiviral vector can carry or comprise a split-intron array.

38. An adenoviral vector system, characterized in that the adenovirus vector can carry or comprise a split-intron arrangement.

39. Vector or plasmid obtained from or based on one or more of pE1sp1A, pCI-Neo, pE1RevE, pE1HORSE3.1, pE1PEGASUS4, pCI-Rab, pE1Rab.

40. A hybrid viral vector system for gene transfer in vivo, wherein said system consists of a primary viral vector encoding a secondary viral vector, said primary vector capable of infecting primary target cells, wherein said secondary viral vector is Can express, secondary vectors can transduce secondary target cells, primary vectors are obtained from or based on adenovirus vectors, secondary viral vectors are obtained from or based on retroviruses, particularly lentiviral vectors. A hybrid virus vector system, characterized in that it can be placed.

41. In a hybrid viral vector system for gene transfer in vivo, the system consists of a primary viral vector encoding a secondary viral vector, the primary vector capable of infecting primary target cells, where the secondary viral vector is Can express, secondary vectors can transduce secondary target cells, primary vectors can be obtained from or based on adenovirus vectors, secondary viral vectors can be obtained from retroviral vectors, particularly lentiviral vectors. Or based thereon, wherein the viral vector system consists of a functional splice donor site and a functional splice acceptor site, wherein the functional splice donor site and the functional splice acceptor site are specific primary nucleotides. Functional splice donor flanking the sequence The teuneun is upstream of the functional splice acceptor site. Retroviral vectors are derived from retroviral provectors. Retroviral provectors consist of a primary nucleotide capable of producing a functional splice donor site and a secondary NS capable of generating a functional splice acceptor site, the primary NS being downstream of the secondary NS. And thus the retroviral vector is generated as a result of reverse transcription of the retroviral provector.

42. Retroviral vectors capable of differentially expressing NOI in target cells described above.

summary

The present invention describes retroviral vectors. The retroviral vector is a retroviral vector composed of a functional splice donor site and a functional splice acceptor site, wherein the functional splice donor site and the functional splice acceptor site are specific primary nucleotide sequences (NOIs). Wherein the functional splice donor site is upstream of the functional splice acceptor site, the retroviral vector is derived from a retroviral provector, and the retrovirus provector is capable of generating the functional splice donor site. A primary nucleotide sequence (NS) and a secondary NS capable of producing the functional splice acceptor site, the primary NS downstream of the secondary NS, and the retroviral vector is a retroviral provector. Reversal of It is a retroviral vector characterized by the result of death.

drawing

(Figure 1)

(Figure 2)

(Figure 3)

(Figure 4)

(Figure 5)

(Figure 6)

(Figure 7)

(Figure 8)

(Figure 9)

(Figure 10)

(Figure 11)

(Figure 12)

(Figure 13)

(Figure 14)

(Figure 15)

(Figure 16)

(Figure 17)

(Figure 18)

(Figure 19)

(Figure 20)

(Figure 21)

(Figure 22)

(Figure 23)

(Figure 24)

(Figure 25)

(Figure 26)

(FIG. 27A)

(FIG. 27B)

(FIG. 27C)

(Figure 28)

(Figure 29)

(Figure 30)

(Figure 31)

Base sequence

(SEQ ID NO. 1)

(SEQ ID NO. 2)

(SEQ ID NO. 3)

Summary

In a broad aspect the present invention provides a modified cell comprising a response element active in that cell; Wherein the modified cell is prepared by transforming a cell or progenitor cell and virally transforming it into one or more viral vectors and comprising at least one response element.

In a preferred aspect the present invention provides a modified cell comprising a response element active in that cell; Wherein the modified cell is prepared by transforming a cell or progenitor cell and virally transforming into one or more viral vectors comprising at least one response element and the response element comprising ILRE.

In a preferred aspect the present invention provides a modified cell comprising a response element active in that cell; Wherein the modified cell is prepared by transforming a cell or progenitor cell and virally transforming into one or more viral vectors comprising at least one response element and the response element comprising HRE.

In a more preferred aspect the present invention provides a modified hematopoietic stem cell (MHSC) comprising at least one specific nucleotide sequence (NOI) that can be expressed, wherein each particular nucleotide sequence (NOI) is ischemic. It is practically related to one or more response elements, including an ischaemia like response element (ILRE).

The vectors, structures, regulatory elements and promoters described in the examples are each novel and also included in the present invention.

All publications mentioned herein are incorporated herein by reference. Various modifications and variations of the methods and systems described herein will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the invention. While the present invention has been described in connection with particularly preferred embodiments, it is to be understood that the claimed invention is not limited to such particular embodiments. Accordingly, various modifications of the modes described for carrying out the invention which are apparent to those skilled in molecular biology or related fields are intended within the scope of the following claims.

Claims (20)

Each particular nucleotide sequence (NOI) is operatively related to one or more ischaemia like response elements (ILREs) and includes at least one specific nucleotide sequence (NOI) that can be expressed. Characterized Modified Hematopoietic Stem Cells (MHSC) The modified hematopoietic stem cell (MHSC) of claim 1, wherein the modified hematopoietic stem cell (MHSC) is associated with one or more agents capable of differentiating MHSC. A pharmaceutical composition according to claim 1 or 2, comprising MHSC, which is optionally mixed with a diluent, excipient or carrier. The MHSC according to claim 1 or 2, which is used as a drug. A method according to claim 1 or 2, comprising expression of one or more NOIs of MHSC in an ischemic environment. Use of MHSC in a pharmaceutical manufacturing process for treating a condition caused by or associated with ischemia, according to claim 1 or 2 A process of treatment in an individual as claimed in claim 1 or claim 2 in need of equal administration of MHSC or according to claim 3, capable of expressing one or more of one or more NOIs. Pharmaceutical composition characterized in that vector or plasmid obtained from or based on one or more sets of pE1splA, pCI-Neo, pE1RevE, pE1HORSE3.1, pE1PEGASUS4, pCI-Rab, pE1Rab Modified HSCs (MHSCs) characterized by including response elements feasible in macrophages Modified cells comprising a reactive cell active in the cell and a modified cell prepared by transforming the cell by NOI, ie viral transduction by one or more viral vectors comprising at least one of the NOI and / or response element. One or more primary viral vectors encoding secondary viral vectors, primary viral vectors or vectors that allow expression of secondary viral vectors and infection of primary target cells, and secondary vectors are secondary target cells. A system comprising a primary viral vector and / or a secondary viral vector comprising the ILRE of the present invention, which can be transduced, is a hybrid viral vector system for gene delivery in vivo 12. The hybrid viral vector according to claim 11, characterized in that it is a primary vector based on or obtained from an adenovirus vector, and / or a retroviral vector more preferably a secondary viral vector based on or obtained from a lentiviral vector. system Use of adenovirus vectors to deliver regulated gene ILRE in certain cell types to be used for certain diseases Use of retroviral vectors to deliver regulated gene ILRE in certain cell types to be used for certain diseases Use for combining adenovirus and retroviral vectors to deliver regulated gene ILRE in certain cell types to be used for certain diseases One or each NOI is characterized in that it comprises at least one expressible specific (NOI) nucleotide sequence that is operatively associated with one or more response element (s) active in the differentiated cell And differentiated cells (preferably terminally differentiated) One or more adenovirus vector constructs that exhibit low basal level activity in normal tissues but are strongly induced under ischemic conditions One or more lentiviral vector constructs that exhibit low basal level activity in normal tissues but are strongly induced under ischemic conditions Combination of one or more adenovirus and lentiviral constructs with low basal level activity in normal tissues but strongly induced under ischemic conditions One or more new vectors or structures or promoters or regulatory elements described herein