NZ503318A - Modified haemopoietic stem cell comprised of a spliced upstream with a nucleotide sequence of interest to be used as in gene therapy - Google Patents

Modified haemopoietic stem cell comprised of a spliced upstream with a nucleotide sequence of interest to be used as in gene therapy

Info

Publication number
NZ503318A
NZ503318A NZ503318A NZ50331898A NZ503318A NZ 503318 A NZ503318 A NZ 503318A NZ 503318 A NZ503318 A NZ 503318A NZ 50331898 A NZ50331898 A NZ 50331898A NZ 503318 A NZ503318 A NZ 503318A
Authority
NZ
New Zealand
Prior art keywords
vector
retroviral
noi
viral
cell
Prior art date
Application number
NZ503318A
Inventor
Claire Elizabeth Lewis
Katie Mary Binley
Christopher Robert Bebbington
Michael Stuart Naylor
Original Assignee
Oxford Biomedica Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9720216.2A external-priority patent/GB9720216D0/en
Priority claimed from GBGB9720465.5A external-priority patent/GB9720465D0/en
Application filed by Oxford Biomedica Ltd filed Critical Oxford Biomedica Ltd
Publication of NZ503318A publication Critical patent/NZ503318A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15051—Methods of production or purification of viral material
    • C12N2740/15052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/20011—Rhabdoviridae
    • C12N2760/20111—Lyssavirus, e.g. rabies virus
    • C12N2760/20122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/40—Vectors comprising a peptide as targeting moiety, e.g. a synthetic peptide, from undefined source
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6045—RNA rev transcr viruses
    • C12N2810/6054—Retroviridae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor

Abstract

A retroviral vector comprises a functional splice donor site and a functional splice acceptor site; wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of interest ("NOI"). The functional splice donor site is upstream of the functional splice acceptor site; wherein the retroviral vector is derived from a retroviral pro-vector. The retroviral pro-vector comprises a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; wherein the first NS is downstream of the second NS; such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector. A modified haematopoeitic stem cell (MHSC) is specifically described. The MHSC comprises at least one expressable nucleotide sequence of interest (NOI) wherein each NOI is operably linked to one or more ischaemia like response element (ILRE).

Description

<div class="application article clearfix" id="description"> <p class="printTableText" lang="en">WO 99/15684 PCT/GB98/02885 <br><br> 1 <br><br> 503318 <br><br> EXPRESSION OF GENES IN HEMATOPOIETIC STEM CELLS UNDER <br><br> IJ5CHAEMIC CONDITIONS <br><br> The present invention relates, to a method. In particular, the present invention relates to a method for the delivery of &amp; nucleotide sequence of interest (NOI) to a haematopoietic <br><br> 5 stem cell (HSC). <br><br> This invention alsb relates to the use of vectors for the delivery of a nucleotide sequence of interest (NOI) to a haematopoietic stem cell (HSC). <br><br> 10 Gene transfer involves the delivery to target cells, such as HSCs, of an expression cassette made up of one or more NOIs and the sequences controlling their expression. This can be carried out ex vivo in a procedure in which the cassette is transferred to cells in the laboratory and the modified cells are then administered to a recipient. Alternatively, gene transfer can be carried out in vivo in a procedure in which the expression cassette is 15 transferred directly to cells within an individual. In both strategies, the transfer process is usually aided by a vector that helps deliver the cassette to the appropriate intracellular site. <br><br> The expression of a therapeutic gene at a targeted site can be regulated by promoter and enhancer elements. Promoters and enhancers consist of short arrays of DNA sequences 20 that interact specifically with cellular proteins involved in transcription (Maniatis et al 1987 Science 236: 1237). Promoter and enhancer elements have been isolated from a variety of eucaryotic sources including genes in yeast, insect, mammalian cells and viruses. The selection of a particular promoter and enhancer depends on what cell type is be used to express the protein/gene of interest. <br><br> 25 <br><br> A promoter may be functional in a variety of tissue types and in several different species of organisms or its function may be restricted to a particular species and/or a particular tissue. A promoter/enhancer may have a broad host range (such as SV40, human CMV) or it may be functional in a limited subset of cell types. Further, a promoter may be constitutively 30 active or it may be selectively activated by certain substances (eg a tissue specific factor), <br><br> intellectual property office of n.z. <br><br> - 9 OCT 2001 RECEIVED <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 2 <br><br> under certain conditions (eg hypoxia or the presence of an enhancer element) or dunng certain developmental stages of the organism (eg active m the fetus and silent m the adult) Bone marrow has been the traditional source of HSCs for transduction, more recent studies have suggested that peripheral blood stem cells or cord blood cells may be equally good or 5 better target cells (Cassel et al 1993 Exp Hematol 21: 585-591; Bregni et al 1992 Blood 80" 1418-1422, Lu et al 1993 J Exp Med 178: 2089-2096). <br><br> Even more recently, potent stem cells have been extracted from an embryo cloned by nuclear transfer from fetal bovine fibroblasts (First and Thompson 1998 Nature 10 Biotechnology 16' 620; Cohen 1998 New Scientist 11 July 4-5) When human embryonic stem cell lines become available, they will be capable of providing an unlimited source of in-vitro derived differentiated cells to treat specific diseases by gene therapy and/or transplantation <br><br> 15 Pretransduction enrichment for HSCs via positive selection for antigens such as CD34+ or negative selection for lineage specific antigens has also been investigated. While it does not seem to greatly influence transduction efficiency it does allow much more practical volumes for ex vivo manipulation and transduction (Hughes et al 1992 ibid, Berenson et al 1988 J Clin Invest 81. 951-955). <br><br> 20 <br><br> It has been suggested that the low efficiency transfer to HSCs may be due to a lack of cell cycling and integration but could also be due to insufficient viral receptor density. <br><br> In attempts to surmount this problem, various strategies have been employed to target a 25 viral vector to a particular site These include: (i) modifying the envelope protein on the retroviral vector, (11) using a promoter/enhancer to restricts expression to a particular site, and (iii) providing a vector with a ligand specific for a receptor on a target cell. <br><br> By way of example, a recombinant retroviral vector capable of targeting human cells 30 expressing a c-Kit receptor via a hgand-receptor interaction has been engineered (Yajima et al 1998 Hum Gen Ther 10. 779-787) The ecotropic (Moloney murine leukemia virus) <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 3 <br><br> envelope protein was modified by inserting a sequence encoding the N-termmal 161 ammo acids of munne stem cell factor (mSCF). It has been suggested that this vector may prove useful for targeting cells expressing c-Kit on their surface. <br><br> 5 By way of further example, other researchers (Fielding et al 1998 Blood 91' 1802-1809) have shown that in vitro cancer cells can be selectively transduced by a retroviral vector displaying stem cell factor (SCF) as part of a chimeric envelope glycoprotein whereas HSCs can be selectively transduced by a retroviral vector displaying epidermal growth factor (EGF) as part of its envelope <br><br> 10 <br><br> In addition, HSCs have also been transduced with a viral vector bearing the vesicular stomatitis G (VSV-G) According to W09609400, CD34+ Thy-1+ mobilised blood cells are transduced at surprisingly high efficiency by a VSV-G pseudotyped retroviral vector as compared with a CD34+ adult bone marrow cells and as compared with the transduction 15 efficiency of a conventional amphotropic vector <br><br> The increasing ability to detect individuals within a population who are at an increased risk of developing cancer due to their genetic make-up (Cornelisse et al 1996 Pathol Res Pract. 192. 684-693) means that there is a need to provide prophylaxis in individuals who are 20 particularly at risk from contracting these diseases. The same is true for individuals within a population who are genetically pre-disposed to coronary heart disease or rheumatoid arthritis or who have been exposed to plasmodium parasites which cause cerebral malaria, means that there is a need to provide prophylaxis m individuals who are particularly at risk from contracting these diseases <br><br> 25 <br><br> In particular, an increased understanding of the molecular genetics of cancer has led to the development of vanous novel therapeutic strategies for cancer. Gene-based therapies currently being tested in clinical trials involve largely the ex vivo or in vivo use of viral or liposomal vectors to deliver genes to tumours for (l) tumour suppressor gene replacement 30 or oncogene mactivation, (u) the expression of cytokines/vaccines known to activate or enhance anti-tumour immune mechanisms, (lii) enhanced drug sensitivity (e g. pro-drug <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 4 <br><br> delivery or activation) (iv) drug resistance for bone marrow protection from high dose chemotherapy, and (v) inhibitors of tumour angiogenesis (Roth and Cnstiano 1997 J Natl Cancer Inst 89. 21, Jaggar and Bicknell R 1997 In. 'Tumour Angiogenesis' Eds Bicknell, Lewis and Ferarra pp357-372. Oxford University Press, Oxford. UK). <br><br> 5 <br><br> Targeting the expression of such therapeutic genes specifically to solid tumours has, until recently, been problematic In some instances, recombinant viral vectors bearing therapeutic genes have been targeted to specific cell types by the insertion of ligands/antibodies in to the viral capsid. This approach requires the expression of tumour-10 antigens - as well as tissue-specific antigens by the malignant cell Thus any therapy is restricted to use in particular patient groups and tumour types showing expression of the selected tumour antigen. Alternatively, naked or viral-incorporated DNA can be injected directly m to the tumour (or at least into the local blood supply for the tumour) to maximise specificity of delivery and expression at the tumour site Although, this approach has met 15 with limited success for superficial tumours (e.g. breast and melanoma lesions), it relies on the accurate localisation of the tumour and does not ensure DNA uptake by the entire tumour mass or treat secondary local or distant metastatic deposits (Roth and Cristiano 1997 J Natl Cancer Inst 89 21). <br><br> 20 Recently, an alternative approach for targeting therapeutic gene expression to tumours has been developed (Dachs et al 1997 Nature Med 5 515) This utilises the abnormal physiology that exists in almost all solid tumours, regardless of their origin or location, and uses the tumour-specific condition of severe ischaemia, and its effects on specific enhancer regions of certain genes, to control the expression of heterologous genes (Dachs et al 1997 25 ibid, UK Patent Application No 9701975.6) <br><br> Aggressive tumours generally have insufficient blood supply, partly because tumour cells grow faster than the endothelial cells that make up the blood vessels, and partly because the newly formed vascular supply is disorganised (Vaupel 1993 In 'Drug Resistance in 30 Oncology' pp53-85 Ed. Teicher BA. Marel Dekker, New York) This results m areas of ischaemia and nutrient depnvation, including regions with both reduced oxygen tension <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 5 <br><br> (hypoxia) and glucose. Oxygen electrode measurements of tumours have shown significant proportions of readings below 2.5 mmHg (normal tissues ranges from 24 to 66 mmHg) (Kalhnowski 1996 The Cancer J 9. 37) Moreover, hypoxic cells are markedly less sensitive to radiotherapy - and chemotherapy, which is why, in part, increased levels of 5 tumour hypoxia correlate with reduced survival in many forms of cancer (Kallinowski 1996 ibid). <br><br> Thus, ischaemia is a general feature of solid tumours regardless of their cellular origin or patient population It has recently been shown that it is possible to exploit tumour hypoxia 10 to obtain selective expression of genes m tumours (Dachs 1997 ibid). Hypoxia is a powerful regulator of gene expression in a wide range of different cell types (Wang and Sememnza 1993 Proc Natl Acad Sci USA 90.4304) and acts by the induction of the activity of hypoxia-inducible transcription factors such as hypoxia inducible factor-1 (HIF-1) (Wang and Sememnza 1993 ibid), which bind to cognate DNA recognition sites, the 15 hypoxia-response elements (HREs) on various gene promoters. Dachs et al (1997 ibid) used a multimenc form of the HRE from the mouse phosphoglycerate kmase-1 (PGK-1) gene (Firth et al 1994 Proc Natl Acad Sci USA 91. 6496) to control expression of both marker and therapeutic genes by human fibrosarcoma cells m response to hypoxia in vitro and withm solid tumours in vivo (Dachs et al 1997 ibid). Alternatively, the fact that 20 marked glucose deprivation is also present in ischaemic areas of tumours, HRE can be used to activate heterologous gene expression specifically m tumours A truncated 632 base pair sequence of the grp78 gene promoter, known to be activated specifically by glucose deprivation, has also been shown to be capable of driving high level expression of a reporter gene in murine tumours in vivo (Gazit et al 1995 Cancer Res. 55' 1660). <br><br> 25 <br><br> Ischaemic damage may also occur in may other tissues when the blood supply to the tissue is reduced or cut off Stroke, deep vein thrombosis, pulmonary embolus and renal failure are examples of conditions that can cause such damage. The cell death of cardiac tissue, called myocardial infarction, is due m large part to tissue damage caused by ischemia 30 and/or ischemia followed by reperfusion Recurrent ischaemia and reperfusion typically results in oxidative damage to cells from reactive oxygen species. The extent and type of <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 6 <br><br> damage depends on the seventy and nature of the hypoxic stress. For example, the stress may cause tissue necrosis. Alternatively, the stress may initiate apoptosis (programmed cell death) to eliminate the damaged cells. <br><br> 5 The pre-climcal studies have, to date, only used tumour cells transfected with marker or therapeutic genes to show their specific expression in tumours. (See reviews by Dunbar and Eammons 1994 Stem Cells 12 563-576, Crystal 1995 Science 270: 404-410; Lee and Klein 1995 Transfusion Medicine II 9: 91-113). Thus, there remains the question of how best to introduce these constructs to solid tumours in vivo for gene therapy protocols. 10 Methods have also been described which exploit cells in the immune system called macrophages as a delivery vehicle for targeting drugs and therapeutic genes to solid tumours (UK Patent Application No. 9701975.6, UK Patent Application No 9620952.3). It has been shown that macrophages, denved from monocytes from the bloodstream, continually enter solid tumours and congregate in poorly vasculansed, ischaemic sites in 15 breast carcinomas (Leek et al 1996 Cancer Res. 56. 4625). Moreover, the degree of ischaemia-induced necrosis in these tumours was positively correlated with the degree of mtra-tumoral macrophage infiltration (Lewis 1997 Clin Exp Met 15:74) <br><br> Monocytes and macrophages also infiltrate ischaemic lesions which are a feature of other 20 disease states including cerebral malaria (Kato et al 1996 Brain Res 734: 203-212; Patnaik et al 1994 Am J Trop Med Hyg 51: 642-647; Sakurai et al 1995 J Cardiol 26' 139-147); coronary heart disease (Stary et al 1994 J Arterio Thromb 14. 840-856; Ueda et al 1997 Hiroshima J Med Sci 46. 31-42), and rheumatoid arthritis (Mapp et al 1995 Br Med Bull 51. 419-436, Sack et al 1994 Rheumatol Int 13 181-186, Liote et al 1996 Clin Exp 25 Immunol 106 13-19). <br><br> While monocytes and their differentiated derivatives, macrophages, are relatively long-lived cells in vivo a drawback associated with their use is their very limited proliferative potential <br><br> 30 Macrophages do not persist for long enough in the body for therapeutic genes introduced into them to provide prophylaxis throughout the potential lifetime of the individual. Thus <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 7 <br><br> any therapy which depends on gene transfer to such cells will inevitably have a duration of action which is limited by the life-span of the recipient cells. <br><br> Although methods have been described which exploit macrophages as a delivery vehicle 5 for marker and therapeutic genes to solid tumours there is a need to provide ways of expoitmg HSCs to deliver NOIs to sites such as solid tumours which are characterised by ischaemia, such as hypoxia or low glucose concentration. <br><br> Furthermore there is a need to provide prophylactic vaccination for cancer and other related 10 disorders which are charactensed by ischaemia, such as hypoxia and low glucose concentration. <br><br> According to a first aspect of the present invention there is provided a modified haematopoeitic stem cell (MHSC) compnsing at least one expressable nucleotide sequence of interest (NOI) wherein the or each NOI is operably linked to one or more ischaemia like 15 response element (ILRE) <br><br> According to a second aspect of the present invention there is provided a MHSC according to the present invention in combination with one or more agents that are capable of differentiating the MHSC <br><br> 20 <br><br> According to a third aspect of the present invention there is provided a pharmaceutical composition compnsing a MHSC according to the present invention optionally admixed with a pharmaceutically acceptable diluent, exceipient or earner. <br><br> 25 According to a fourth aspect of the present invention there is provided a MHSC according to the present invention for use in medicine <br><br> According to a fifth aspect of the present invention there is provided a method of expressing one or more NOIs m an ischaemic environment compnsing expressing the one <br><br> % <br><br> 30 or more NOIs of the MHSC according to the present invention m the ischaemic environment. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> According to a sixth aspect of the present invention there is provided the use of a MHSC according to the present invention m the manufacture of a medicament to treat a condition associated with or caused by ischaemia. <br><br> 5 <br><br> According to a seventh aspect of the present invention there is provided a process of treating an individual in need of same compnsing administenng a MHSC according to the present invention, or a pharmaceutical composition according to the present invention, and allowing expression of one or more of the one or more NOIs. <br><br> 10 <br><br> According to an eight aspect of the invention there is provided a modified cell comprising an element that is active m that cell, and an NOI; wherein the modified cell is prepared by transforming a cell by viral transduction with one or more viral vectors wherein at least one of which compnses the NOI. <br><br> 15 <br><br> According to a ninth aspect of the present invention there is provided a hybnd viral vector system for in vivo gene delivery, which system compnses one or more primary viral vectors which encode a secondary viral vector, the primary vector or vectors capable of infecting a first target cell and of expressing therein the secondary viral vector, which 20 secondary vector is capable of transducing a secondary target cell, wherein the pnmary viral vector and/or the secondary viral vector comprises an ILRE of the present invention or a cell specific regulatory element according to the present invention. <br><br> According to a tenth aspect of the present invention there is provided a hybrid viral 25 vector system wherein the primary vector is obtainable from or is based on a adenoviral vector and/or the secondary viral vector is obtainable from or is based on a retroviral vector preferably a lentiviral vector, wherein the primary viral vector and/or the secondary viral vector compnses an ILRE of the present invention or a cell specific regulatory element according to the present invention <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 9 <br><br> According to a eleventh aspect of the present invention there is provided one or more novel vectors or constructs or promoters or regulatory elements as defined herein. <br><br> According to a twelfth aspect of the present invention there is provided adenoviral vector 5 constructs that show low basal activity in normal tissue but are strongly induced under ischaemic conditions. <br><br> According to a thirteenth aspect of the present invention there is provided lentiviral vector constructs that show low basal activity in normal tissue but are strongly induced under 10 ischaemic conditions. <br><br> According to a fourtheenth aspect of the present invention there is provided or more of a combination of adenoviral and lentiviral constructs that show low basal activity in normal tissue but are strongly induced under ischaemic conditions <br><br> 15 <br><br> According to a fifteenth aspect of the present invention there is provided the use of an adenoviral vector to deliver an ILRE regulated gene to any cell type for use in any disease <br><br> According to a sixteenth aspect of the present invention there is provided the use of a 20 retroviral vector to deliver an ILRE regulated gene to any cell type for use in any disease. <br><br> According to a seventeenth aspect of the present invention there is provided the use of a combination of adenoviral and lentiviral vector to deliver an ILRE regulated gene to any cell type for use m any disease <br><br> 25 <br><br> Preferably the ILRE is used m combination with a transcriptional regulatory element (such as a promoter), which transcriptional regulatory element is preferably active in one or more selected cell type(s), preferably being only active in one cell type <br><br> 30 This combination aspect of the present invention is called a responsive element, wherein the responsive element compnses at least the ILRE as herein defined <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 10 <br><br> Non-limiting examples of such a responsive element are presented as OBHRE1 and XiaMac. Another non-limitmg example includes the ILRE in use in conjunction with an MLV promoter and/or a tissue restncted ischaemic responsive promoter. <br><br> 5 <br><br> Preferably the ischaemic responsive promoter is a tissue restncted ischaemic responsive promoter. <br><br> Preferably the tissue restncted ischaemic responsive promoter is a macrophage specific 10 promoter restncted by repression. <br><br> Preferably the tissue restncted ischaemic responsive promoter is an endothelium specific promoter. <br><br> 15 Preferably the vector is an ILRE regulated retroviral vector. <br><br> Preferably the vector is an ILRE regulated lentiviral vector Preferably the vector is an ILRE regulated adenoviral vector <br><br> 20 <br><br> Preferably the vector is an ILRE regulated hybnd adenoviral /lentiviral vector. <br><br> Preferably the vector is an autoregulated hypoxia responsive lentiviral vector <br><br> 25 The term "ischaemia like response element" - otherwise written as ILRE - includes an element that is responsive to or is active under conditions of ischaemia or conditions that are like ischaemia or are caused by ischaemia. By way of example, conditions that are like ischaemia or are caused by ischaemia include hypoxia and/or low glucose concentration(s) <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 11 <br><br> Ischaemia can be an insufficient supply of blood to a specific organ or tissue A consequence of decreased blood supply is an inadequate supply of oxygen to the organ or tissue (hypoxia) Prolonged hypoxia may result m injury to the affected organ or tissue <br><br> 5 A preferred ILRE is an hypoxia response element (HRE). <br><br> The MHSC of the present invention may be prepared by use of a viral vector - which vector m turn may be delivered to a HSC by viral and/or non-viral means. <br><br> 10 A example of a suitable agent that is capable of differentiating the MHSC is a cytokine and/or growth factor. In this embodiment, the MHSC may then differentiate into one or more different cell types. <br><br> In some applications it may be desirable to isolate the MHSC - such as prior to delivery to 15 an individual. The MHSC may be isolated by standard techniques such filtration, centrifugation, micro-pipette <br><br> An advantage of the present invention is that it provides means and methods for use in the treatment or prevention of conditions charactensed by ischaemia, hypoxia or low glucose 20 such as, without limitation, cancer, cerebral malana, ischaemic heart disease or rheumatoid arthritis. <br><br> In one aspect, the present invention concerns the use of delivery systems to deliver NOIs to HSCs and more particularly to CD34+ HSCs <br><br> 25 <br><br> In another aspect, the invention provides a method of genetically engineenng a HSC to contain at least one NOI, which method compnses transfectmg or transducing a population of HSCs with a vector compnsing at least one NOI, wherein the NOI is selected for treatment or prophylaxis of a condition charactensed by ischaemia, hypoxia or low 30 glucose <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 12 <br><br> In another aspect, the invention provides MHSCs produced by the above-mentioned method according to the invention. <br><br> In yet another aspect, the invention provides vectors suitable for use m the above-5 mentioned method, comprising at least one NOI and/or having at least one insertion site into which the NOI can be inserted. Such vectors are adapted to deliver at least one NOI to a HSC <br><br> In a further aspect, the invention provides a medicament for treatment or prophylaxis of 10 conditions charactensed by ischaemia, hypoxia or low glucose, comprising a vector and/or MHSC as descnbed together with a suitable pharmaceutically acceptable earner. <br><br> In a still further aspect the invention provides a method for dehvenng at least one NOI to a population of HSCs from an individual to be treated, which method compnses contacting 15 the cells with a vector as descnbed under conditions to allow transfection or transduction of the cells, and reintroducing the transfected or transduced cells back into the individual. <br><br> The invention further provides a method for dehvenng at least one NOI to a population of HSCs of an individual to be treated, which method compnses admimstenng to the 20 individual a medicament as descnbed herein <br><br> Further provided according to the invention is a method of treatment or prophylaxis of cancer in a mammal, which method comprises isolating a population of cells enriched in HSCs from an individual to be treated, contacting the cells with a vector as descnbed 25 herein containing at least one NOI, under conditions to allow transfection or transduction of the cells, cultunng the resulting engineered MHSCs under suitable conditions and reintroducing the cultured MHSCs or their differentiated progeny into the individual <br><br> In accordance with the present invention, the NOI or NOIs can be any suitable nucleotide 30 sequence. For example, each sequence can be independently DNA or RNA - which may be synthetically prepared or may be prepared by use of recombinant DNA techniques or <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 13 <br><br> may be isolated from natural sources or may be combinations thereof. The sequence may be a sense sequence or an antisense sequence. There may be a plurality of sequences, which may be directly or indirectly joined to each other, or combinations thereof. <br><br> 5 In one preferred embodiment, the present invention is based on the surprising use of a retroviral vector to transform one or more HSCs with one or more NOI(s) - wherein the transformed MHSC(s) can be used m a specific manner. <br><br> The retroviral vector aspect of the present invention may be derived from or may be 10 denvable from any suitable retrovirus Any of the following teachings are applicable to the present invention <br><br> By way of background information, retroviruses are RNA viruses with a life cycle different to that of lytic viruses In this regard, a retrovirus is an infectious entity that replicates 15 through a DNA intermediate When a retrovirus infects a cell, its genome is converted to a DNA form by a reverse transcriptase enzyme. The DNA copy serves as a template for the production of new RNA genomes and virally encoded proteins necessary for the assembly of infectious viral particles. <br><br> 20 There are many retroviruses and examples include, murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney munne sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), 25 Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis virus (AEV). A detailed list of retroviruses may be found in Coffin et al ("Retroviruses" 1997 Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763) <br><br> Details on the genomic structure of some retroviruses may be found in the art By way of 30 example, details on HIV may be found from the NCBI Genbank (i.e Genome Accession No AF033819) <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 14 <br><br> Essentially, all wild type retroviruses contain three major coding domains, gag, pol, env, which code for essential virion proteins. Nevertheless, retroviruses may be broadly divided into two categories: namely, "simple" and "complex" These categories are distinguishable 5 by the organisation of their genomes. Simple retroviruses usually carry only elementary information. In contrast, complex retroviruses also code for additional regulatory proteins derived from multiple spliced messages <br><br> Retroviruses may even be further divided into seven groups Five of these groups 10 represent retroviruses with oncogenic potential. The remaining two groups are the Antiviruses and the spumaviruses. A review of these retroviruses is presented in "Retroviruses" (1997 Cold Spring Harbour Laboratory Press Eds- JM Coffin, SM Hughes, HE Varmus pp 1-25) <br><br> 15 All oncogenic members except the human T-cell leukemia virus-bovine leukemia virus group (HTLV-BLV) are simple retroviruses. HTLV, BLV and the Antiviruses and spumaviruses are complex Some of the best studied oncogenic retroviruses are Rous sarcoma virus (RSV), mouse mammary tumour virus (MMTV) and murine leukemia virus (MLV) and the human T-cell leukemia virus (HTLV). <br><br> 20 <br><br> The lentivirus group can be split even further into "primate" and "non-pnmate". Examples of primate Antiviruses include the human immunodeficiency virus (HIV), the causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV) The non-pnmate lentiviral group includes the prototype 25 "slow virus" visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FTV) and bovine immunodeficiency virus (BIV). <br><br> A distinction between the lentivirus family and other types of retroviruses is that 30 Antiviruses have the capability to infect both dividing and non-dividing cells (Lewis et al 1992 EMBO. J 11. 3053-3058; Lewis and Emerman 1994 J. Virol. 68- 510-516). In <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 15 <br><br> contrast, other retroviruses - such as MLV - are unable to infect non-dividing cells such as those that make up, for example, muscle, brain, lung and liver tissue <br><br> During the process of infection, a retrovirus initially attaches to a specific cell surface 5 receptor. On entiy into the susceptible host cell, the retroviral RNA genome is then copied to DNA by the virally encoded reverse transcriptase which is earned mside the parent virus. This DNA is transported to the host cell nucleus where it subsequently integrates into the host genome. At this stage, it is typically referred to as the provirus The provirus is stable m the host chromosome dunng cell division and is transcnbed like other cellular 10 proteins. The provirus encodes the proteins and packaging machinery required to make more virus, which can leave the cell by a process sometimes called "budding". <br><br> As already indicated, each retroviral genome compnses genes called gag, pol and env which code for vmon proteins and enzymes In the provirus, these genes are flanked at 15 both ends by regions called long terminal repeats (LTRs) The LTRs are responsible for proviral integration, and transcription. They also serve as enhancer-promoter sequences In other words, the LTRs can control the expression of the viral gene. Encapsidation of the retroviral RNAs occurs by virtue of a psi sequence located at the 5' end of the viral genome. <br><br> 20 <br><br> The LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5 U3 is denved from the sequence unique to the 3' end of the RNA R is denved from a sequence repeated at both ends of the RNA and U5 is denved from the sequence unique to the 5' end of the RNA. The sizes of the three 25 elements can vary considerably among different retroviruses. <br><br> For ease of understanding, simple, genenc structures (not to scale) of the RNA and the DNA forms of the retroviral genome are presented m Figure 33 in which the elementary features of the LTRs and the relative positioning of gag, pol and env are indicated <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 16 <br><br> As shown in Figure 3, the basic molecular organisation of an infectious retroviral RNA genome is (5') R - U5 - gag,pol, env - U3-R (3') In a defective retroviral vector genome gag, pal and env may be absent or not functional The R regions at both ends of the RNA are repeated sequences. U5 and U3 represent unique sequences at the 5' and 3' ends of the 5 RNA genome respectively <br><br> Reverse transcnption of the vinon RNA into double stranded DNA takes place in the cytoplasm and involves two jumps of the reverse transcnptase from the 5' terminus to the 3' terminus of the template molecule The result of these jumps is a duplication of 10 sequences located at the 5' and 3' ends of the vinon RNA. These sequences then occur fused in tandem on both ends of the viral DNA, forming the long terminal repeats (LTRs) which compnse R U5 and U3 regions On completion of the reverse transcnption, the viral DNA is translocated into the nucleus where the linear copy of the retroviral genome, called a premtegration complex (PIC), is randomly inserted into chromosomal DNA with the aid 15 of the vinon mtegrase to form a stable provirus. The number of possible sites of integration into the host cellular genome is very large and very widely distributed. <br><br> The control of proviral transcnption remains largely with the noncodmg sequences of the viral LTR. The site of transcnption initiation is at the boundary between U3 and R in the 20 left hand side LTR (as shown above) and the site of poly (A) addition (termination) is at the boundary between R and U5 m the nght hand side LTR (as shown above). U3 contains most of the transcriptional control elements of the provirus, which include the promoter and multiple enhancer sequences responsive to cellular and in some cases, viral transcriptional activator proteins Some retroviruses have any one or more of the following 25 genes such as tat, rev, tax and rex that code for proteins that are involved m the regulation of gene expression. <br><br> Transcnption of proviral DNA recreates the full length viral RNA genomic and subgenomic-sized RNA molecules that are generated by RNA processing. Typically, all 30 RNA products serve as templates for the production of viral proteins. The expression of <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 17 <br><br> the RNA products is achieved by a combination of RNA transcript splicmg and nbosomal framshiftmg dunng translation <br><br> RNA splicmg is the process by which intervening or "intronic" RNA sequences are 5 removed and the remaining "exomc" sequences are hgated to provide continuous reading frames for translation The pnmary transcnpt of retroviral DNA is modified in several ways and closely resembles a cellular mRNA. However, unlike most cellular mRNAs, in which all introns are efficiently spliced, newly synthesised retroviral RNA must be diverted into two populations One population remains unsphced to serve as the genomic 10 RNA and the other population is spliced to provide subgenomic RNA <br><br> The full-length unsphced retroviral RNA transcnpts serve two functions: (l) they encode the gag and pol gene products and (11) they are packaged into progeny vinon particles as genomic RNA Sub-genomic-sized RNA molecules provide mRNA for the remainder of 15 the viral gene products. All spliced retroviral transcnpts bear the first exon, which spans the U5 region of the 5' LTR. The final exon always retains the U3 and R regions encoded by the 3' LTR although it varies in size The composition of the remainder of the RNA structure depends on the number of splicing events and the choice of alternative splice sites. <br><br> 20 <br><br> In simple retroviruses, one population of newly synthesised retroviral RNA remains unsphced to serve as the genomic RNA and as mRNA for gag and pol. The other population is spliced, fusing the 5' portion of the genomic RNA to the downstream genes, most commonly env Splicing is achieved with the use of a splice donor positioned 25 upstream of gag and a splice acceptor near the 3' terminus of pol. The intron between the splice donor and splice acceptor that is removed by splicing contains the gag and pol genes. This splicing event creates the mRNA for envelope (Env) protein Typically the splice donor is upstream of gag but in some viruses, such as ASLV, the splice donor is positioned a few codons into the gag gene resulting in.a pnmary Env translation product 30 that includes a few ammo-terminal amino acid residues in common with Gag. The Env <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 18 <br><br> protein is synthesised on membrane-bound polyribosomes and transported by the cell's vesicular traffic to the plasma membrane, where it is incorporated into viral particles. <br><br> Complex retroviruses generate both singly and multiply spliced transcnpts that encode not 5 only the env gene products but also the sets of regulatory and accessory proteins umque to these viruses Compex retroviruses such as the Antiviruses, and especially HIV, provide stnking examples of the complexity of alternative splicing that can occur dunng retroviral infection. For example, it is now known that HIV-1 is capable of producing over 30 different mRNAs by sub-optimal splicing from pnmary genomic transcripts This 10 selection process appears to be regulated as mutations that disrupt competing splice acceptors can cause shifts in the splicing patterns and can affect viral infectivity (Purcell and Martin 1993 J Virol 67: 6365-6378) <br><br> The relative proportions of full-length RNA and subgenomic-sized RNAs vary in infected cells and modulation of the levels of these transcnpts is a potential control step during retroviral gene expression. For retroviral gene expression, both unsphced and spliced RNAs must be transported to the cytoplasm and the proper ratio of spliced and unspliced RNA must be maintained for efficient retroviral gene expression Different classes of retroviruses have evolved distinct solutions to this problem The simple retroviruses, which use only full-length and singly spliced RNAs regulate the cytoplasmic ratios of these species either by the use of vanably efficient splice sites or by the incorporation of several czs-acting elements, that have been only partially defined, into their genome. The complex retroviruses, which direct the synthesis of both singly and multiply spliced RNA, regulate the transport and possibly splicing of the different genomic and subgenomic-sized RNA species through the interaction of sequences on the RNA with the protein product of one of the accessory genes, such as rev m HTV-1 and rex m HTLV-1. <br><br> With regard to the structural genes gag, pol and env themselves and m slightly more detail, gag encodes the internal structural protein of the virus Gag is proteolytically processed 30 into the mature proteins MA (matnx), CA (capsid) and NC (nucleocapsid) The pol gene encodes the reverse transcnptase (RT), which contains both DNA polymerase, and <br><br> 20 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 19 <br><br> associated RNase H activities and integrase (IN), which mediates replication of the genome. The env gene encodes the surface (SU) glycoprotein and the transmembrane (TM) protein of the vinon, which form a complex that interacts specifically with cellular receptor proteins This interaction leads ultimately to fusion of the viral membrane with 5 the cell membrane <br><br> The Env protein is a viral protein which coats the viral particle and plays an essential role in permitting viral entry into a target cell. The envelope glycoprotein complex of retroviruses includes two polypeptides: an external, glycosylated hydrophihc polypeptide 10 (SU) and a membrane-spanning protein (TM) Together, these form an oligomeric "knob" or "knobbed spike" on the surface of a virion. Both polypeptides are encoded by the env gene and are synthesised m the form of a polyprotein precursor that is proteolytically cleaved dunng its transport to the cell surface Although uncleaved Env proteins are able to bind to the receptor, the cleavage event itself is necessary to activate the fusion potential 15 of the protein, which is necessary for entry of the virus into the host cell. Typically, both SU and TM proteins are glycosylated at multiple sites However, in some viruses, exemplified by MLV, TM is not glycosylated <br><br> Although the SU and TM proteins are not always required for the assembly of enveloped 20 vinon particles as such, they play an essential role in the entry process. In this regard, the SU domain binds to a receptor molecule, often a specific receptor molecule, on the target cell It is believed that this binding event activates the membrane fusion-inducing potential of the TM protein after which the viral and cell membranes fuse. In some viruses, notably MLV, a cleavage event, resulting m the removal of a short portion of the cytoplasmic tail 25 of TM, is thought to play a key role m uncovenng the full fusion activity of the protein (Brody et al 1994 J Virol 68. 4620-4627; Rein et al 1994 J Virol 68. 1773-1781). This cytoplasmic "tail", distal to the membrane-spanning segment of TM remains on the internal side of the viral membrane and it vanes considerably m length in different retroviruses <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 20 <br><br> Thus, the specificity of the SU/receptor interaction can define the host range and tissue tropism of a retrovirus In some cases, this specificity may restrict the transduction potential of a recombinant retroviral vector Here, transduction includes a process of using a viral vector to deliver a non-viral gene to a target cell. For this reason, many gene 5 therapy experiments have used MLV A particular MLV that has an envelope protein called 4070A is known as an amphotropic virus, and this can also infect human cells because its envelope protein "docks" with a phosphate transport protein that is conserved between man and mouse This transporter is ubiquitous and so these viruses are capable of infecting many cell types. In some cases however, it may be beneficial, especially from a 10 safety point of view, to specifically target restncted cells. To this end, several groups have engineered a mouse ecotropic retrovirus, which unlike its amphotropic relative normally only infects mouse cells, to specifically infect particular human cells Replacement of a fragment of an Env protein with an erythropoietin segement produced a recombinant retrovirus which then binds specifically to human cells that express the erythropoietin 15 receptor on their surface, such as red blood cell precursors (Maulik and Patel 1997 "Molecular Biotechnology Therapeutic Applications and Strategies" 1997 Wiley-Liss Inc. PP 45) <br><br> Replacement of the env gene with a heterologous env gene is an example of a technique 20 or strategy called pseudotyping Pseudotyping is not a new phenomenon and examples may be found m WO-A-98/05759, WO-A-98/05754, WO-A-97/17457, WO-A-96/09400, WO-A-91/00047 and Mebatsion et al 1997 Cell 90, 841-847 <br><br> In addition to gag, pol and env, the complex retroviruses also contain "accessory" genes 25 which code for accessory or auxiliary proteins. Accessory or auxiliary proteins are defined as those proteins encoded by the accessory genes in addition to those encoded by the usual replicative or structural genes, gag, pol and env. These accessory proteins are distinct from those involved m the regulation of gene expression, like those encoded by tat, rev, tax and rex Examples of accessory genes include one or more of vif, vpr, vpx, vpu and nef 30 These accessory genes can be found in, for example, HIV (see, for example pages 802 and 803 of "Retroviruses" Ed Coffin et al Pub CSHL 1997) Non-essential accessory proteins <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 21 <br><br> may function m specialised cell types, providing functions that are at least in part duplicative of a function provided by a cellular protein. Typically, the accessory genes are located between pol and env, just downstream from env including the U3 region of the LTR or overlapping portions of the env and each other. <br><br> 5 <br><br> The complex retroviruses have evolved regulatory mechanisms that employ virally encoded transcriptional activators as well as cellular transcriptional factors. These transacting viral proteins serve as activators of RNA transcnption directed by the LTRs. The transcnptional /rans-activators of the Antiviruses are encoded by the viral tat genes. Tat 10 binds to a stable, stem-loop, RNA secondary structure, referred to as TAR, one function of which is to apparently optimally position Tat to trans-activate transcnption. <br><br> In the general sense, retroviruses have been proposed as a delivery system (otherwise expressed as a delivery vehicle or delivery vector) for inter alia the transfer of a NOI, or a 15 plurality of NOIs, to one or more sites of interest. The transfer can occur in vitro, ex vivo, in vivo, or combinations thereof When used in this fashion, the retroviruses are typically called retroviral vectors or recombinant retroviral vectors Retroviral vectors have even been exploited to study vanous aspects of the retrovirus life cycle, including receptor usage, reverse transcnption and RNA packaging (reviewed by Miller, 1992 Curr Top 20 Microbiol Immunol 158.1-24) <br><br> In a typical recombinant retroviral vector for use in gene therapy, at least part of one or more of the gag, pol and env protein codmg regions may be removed from the virus. This makes the retroviral vector replication-defective The removed portions may even be 25 replaced by a NOI m order to generate a virus capable of integrating its genome into a host genome but wherein the modified viral genome is unable to propagate itself due to a lack of structural proteins. When integrated in the host genome, expression of the NOI occurs -resulting in, for example, a therapeutic and/or a diagnostic effect Thus, the transfer of a NOI into a site of interest is typically achieved by. integrating the NOI into the 30 recombinant viral vector, packaging the modified viral vector into a vinon coat, and <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 22 <br><br> allowing transduction of a site of interest - such as a targeted cell or a targeted cell population <br><br> It is possible to propagate and isolate quantities of retroviral vectors (e.g. to prepare 5 suitable titres of the retroviral vector) for subsequent transduction of, for example, a site of interest by using a combination of a packaging or helper cell line and a recombinant vector. <br><br> In some instances, propagation and isolation may entail isolation of the retroviral gag, pol and env genes and their separate introduction into a host cell to produce a "packaging cell 10 line". The packaging cell line produces the proteins required for packaging retroviral DNA but it cannot bring about encapsidation due to the lack of a psi region. However, when a recombinant vector carrying a NOI and a psi region is introduced into the packaging cell line, the helper proteins can package the ^-positive recombinant vector to produce the recombinant virus stock This can be used to transduce cells to introduce the NOI into the 15 genome of the cells. The recombinant virus whose genome lacks all genes required to make viral proteins can tranduce only once and cannot propagate These viral vectors which are only capable of a single round of transduction of target cells are known as replication defective vectors Hence, the NOI is introduced into the host/target cell genome without the generation of potentially harmful retrovirus. A summary of the available 20 packaging lines is presented m "Retroviruses" (1997 Cold Spring Harbour Laboratory Press Eds. JM Coffin, SM Hughes, HE Varmus pp 449). <br><br> The design of retroviral packaging cell lines has evolved to address the problem of inter alia the spontaneous production of helper virus that was frequently encountered with early 25 designs. As recombination is greatly facilitated by homology, reducing or eliminating homology between the genomes of the vector and the helper has reduced the problem of helper virus production. More recently, packaging cells have been developed m which the gag, pol and env viral coding regions are earned on separate expression plasmids that are independently transfected into a packaging cell line so that three recombinant events are 30 required for wild type viral production. This reduces the potential for production of a <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 23 <br><br> replication-competent virus This strategy is sometimes referred to as the three plasmid transfection method (Soneoka et al 1995 Nucl Acids Res. 23: 628-633) <br><br> Transient transfection can also be used to measure vector production when vectors are 5 being developed In this regard, transient transfection avoids the longer time required to generate stable vector-producing cell lines and is used if the vector or retroviral packaging components are toxic to cells Components typically used to generate retroviral vectors include a plasmid encoding the Gag/Pol proteins, a plasmid encoding the Env protein and a plasmid containing a NOI Vector production involves transient transfection of one or 10 more of these components into cells containing the other required components. If the vector encodes toxic genes or genes that interfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that mducc apotosis, it may be difficult to generate stable vector-producing cell lines, but transient transfection can be used to produce the vector before the cells die Also, cell lines have been developed using transient infection 15 that produce vector titre levels that are comparable to the levels obtained from stable vector-producing cell lines (Pear et al 1993, Proc Natl Acad Sci 90.8392-8396) <br><br> In view of the toxicity of some HIV proteins - which can make it difficult to generate stable HIV-based packaging cells - HIV vectors are usually made by transient transfection 20 of vector and helper virus Some workers have even replaced the HIV Env protein with that of vesicular stomatis virus (VSV) Insertion of the Env protein of VSV facilitates <br><br> 5 8 <br><br> vector concentration as HIV/VSV-G vectors with titres of 5x10 (10 after concentration) have been generated by transient transfection (Naldini et al 1996 Science 272: 263-267) Thus, transient transfection of HIV vectors may provide a useful strategy for the generation 25 of high titre vectors (Yee et al 1994 PNAS 91:9564-9568) <br><br> With regard to vector titre, the practical uses of retroviral vectors have been limited largely by the titres of transducing particles which can be attained m in vitro culture (typically not <br><br> O <br><br> more than 10 particles/ml) and the sensitivity of many enveloped viruses to traditional 30 biochemical and physicochemical techniques for concentrating and purifying viruses. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 24 <br><br> By way of example, several methods for concentration of retroviral vectors have been developed, including the use of centrifugation (Fekete and Cepko 1993 Mol Cell Biol 13 2604-2613), hollow fibre filtration (Paul et al 1993 Hum Gene Ther 4 609-615) and tangential flow filtration (Kotani et al 1994 Hum Gene Ther 5: 19-28). Although a 20-fold 5 increase m viral titre can be achieved, the relative fragility of retroviral Env protein limits the ability to concentrate retroviral vectors and concentrating the virus usually results in a poor recovery of infectious virions. While this problem can be overcome by substitution of the retroviral Env protein with the more stable VSV-G protem, as descnbed above, which allows for more effective vector concentration with better yields, it suffers from the 10 drawback that the VSV-G protein is quite toxic to cells <br><br> •j <br><br> Although helper-virus free vector titres of 10 cfu/ml are obtainable with currently available vectors, expenments can often be done with much lower-titre vector stocks. However, for practical reasons, high-titre virus is desirable, especially when a large number 15 of cells must be infected. In addition, high titres are a requirement for transduction of a large percentage of certain cell types. For example, the frequency of human hematopoietic progenitor cell infection is strongly dependent on vector titre, and useful frequencies of infection occur only with very high-titre stocks (Hock and Miller 1986 Nature 320. 275-277; Hogge and Humphnes 1987 Blood 69: 611-617) In these cases, it is not sufficient 20 simply to expose the cells to a larger volume of virus to compensate for a low vims titre On the contrary, in some cases, the concentration of infectious vector vinons may be cntical to promote efficient transduction <br><br> Workers are trying to create high titre vectors for use in gene delivery By way of example, a companson of different vector designs has proved useful in helping to define 25 the essential elements required for high-titre viral production. Early work on different retroviral vector design showed that almost all of the internal protein-encoding regions of MLVs could be deleted without abolishing the mfectivity of the vector (Miller et al 1983 Proc Natl Acad Sci 80 4709-4713) These early vectors retained only a small portion of the 3' end of the env-codmg region Subsequent work has shown that all of the env-gene-30 coding sequences can be removed without further reduction in vector titre (Miller and Rosman 1989 Biotechnique 7 980-990, Morgenstern and Land 1990 Nucleic Acids Res <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 25 <br><br> 18 3587-3596) Only the viral LTRs and short regions adjoining the LTRs, including the segments needed for plus- and minus-strand DNA priming and a region required for selective packaging of viral RNA into virions (the psi site, Mann et al 1983 Cell 33 153-159) were deemed necessary for vector transmission. Nevertheless, viral titres obtained 5 with these early vectors were still about tenfold lower than the parental helper virus titre. <br><br> Additional experiments indicated that retention of sequences at the 5' end of the gag gene significantly raised viral vector titres and that this was due to an mcrease m the packaging efficiency of viral RNA into virions (Armentano et al 1987 J Virol 61 • 1647-1650; Bender 10 et al 1987 J Virol 61 1639-1646, Adam and Miller 1988 J Virol 62. 3802-3806). This effect was not due to viral protein synthesis from the gag region of the vector because disruption of the gag reading frame or mutating the gag codon to a stop codon had no effect on vector titre (Bender et al 1987 ibid) These experiments demonstrated that the sequences required for efficient packaging of genomic RNA in MLV were larger than the 15 psi signal previously defined by deletion analysis (Mann et al 1983 ibid). In order to obtain high titres (106 to &gt; 107), it was shown to be important that this larger signal, called psi plus, be included in retroviral vectors. It has now been demonstrated that this signal spans from upstream of the splice donor to downstream of the gag start codon (Bender et al 1987 ibid) Because of this position, m spliced env expressing transcnpts this signal is 20 deleted. This ensures that only full length transcripts contaimng all three essential genes for viral life cycle are packaged <br><br> In addition to manipulating the retroviral vector with a view to increasing vector titre, retroviral vectors have also been designed to induce the production of a specific NOI 25 (usually a marker protein) in transduced cells. As already mentioned, the most common retroviral vector design involves the replacement of retroviral sequences with one or more NOIs to create replication-defective vectors. The simplest approach has been to use the promoter in the retroviral 5' LTR to control the expresssion of a cDNA encoding an NOI or to alter the enhancer/promoter of the LTR to provide tissue-specific expression or 30 inducibihty <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 26 <br><br> Alternatively, a single coding region has been expressed by using an internal promoter which permits more flexibility in promoter selection <br><br> These strategies for expression of an NOI have been most easily implemented when the 5 NOI is a selectable marker, as in the case of hypoxanthine-guamne phosphonbosyl transferase (hprt) (Miller et al 1983 Proc Natl Acad Sci 80. 4709-4713) which facilitates the selection of vector transduced cells. If the vector contains an NOI that is not a selectable marker, the vector can be introduced into packaging cells by co-transfection with a selectable marker present on a separate plasmid This strategy has an appealing 10 advantage for gene therapy in that a single protein is expressed m the ultimate target cells and possible toxicity or antigenicity of a selectable marker is avoided. However, when the inserted gene is not selectable, this approach has the disadvantage that it is more difficult to generate cells that produce a high titre vector stock In addition it is usually more difficult to determine the titre of the vector. <br><br> 15 <br><br> The current methodologies used to design retroviral vectors that express two or more proteins have relied on three general strategies These include (l) the expression of different proteins from alternatively spliced mRNAs transcnbed from one promoter, (li) the use of the promoter in the 5' LTR and internal promoters to dnve transcription of 20 different cDNAs and (111) the use of internal nbosomal entry site (IRES) elements to allow translation of multiple coding regions from either a single mRNA or from fusion proteins that can then be expressed from an open reading frame. <br><br> Vectors containing internal promoters have been widely used to express multiple genes. 25 An internal promoter makes it possible to exploit the promoter/enhancer combinations other than the viral LTR for dnving gene expression Multiple internal promoters can be included in a retroviral vector and it has proved possible to express at least three different cDNAs each from its own promoter (Overell et al 1988 Mol Cell Biol 8 1803-1808) <br><br> 30 A number of vectors have been developed based on various members of the lentivirus sub-familiy of the retrovindae and a number of these are the subject of patent applications <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 27 <br><br> (PCT/GB97/02857, PCT US96/15406) The simplest vectors constructed from HIV-1 have the complete HIV genome except for a deletion of part of the env coding region or replacement of the nef coding region (Richardson, J. H., Child, L. A. &amp; Lever, A. M. (1993) J Virol 67, 3997-4005 , Buchschacher, G L , Jr &amp; Panganiban, A T. (1992) J Virol 5 66, 2731-9, Richardson, J H , Kaye, J. F , Child, L A. &amp; Lever, A. M. (1995) J Gen Virol 76, 691-6, Kaye, J. F , Richardson, J. H. &amp; Lever, A M. (1995) J Virol 69, 6588-92, Carroll, R, Lm, J. T., Dacquel, E J., Mosca, J. D , Burke, D S. &amp; St Louis, D. C. (1994) J Virol 68, 6047-51. A number of promoter /reporter cassettes have been inserted at these positions ADDIN ENRf8 (Page, K. A., Landau, N R. &amp; Littman, D. R. (1990) J Virol 64, 10 5270-6 , Shimada, T., Fujn, H, Mitsuya, H &amp; Nienhuis, A W. (1991) J Clin Invest 88, 1043-76, 7) Notably these vectors express gag/pol and all of the accessory genes hence require only an envelope to produce infectious virus particles. Of the accessory genes vif, vpr, vpu and nef are non-essential, however it has been proposed that accessory gene expression does influence titre 15 (Fan, L. &amp; Peden, K. (1992) Virology 190, 19-29, Gabuzda, D. H., Lever, A , Terwilhger, E &amp; Sodroski, J (1992) J Virol 66, 3306-15, Schubert, U, Clouse, K. A. &amp; Strebel, K. <br><br> (1995) J Virol 69, 7699-711, Miller, M D , Warmerdam, M. T , Gaston, I, Greene, W. C. &amp; Feinberg, M. B. (1994) J Exp Med 179, 101-13 Zufferey, R, Nagy, D., Mandel, R.J., Naldini, L &amp; Trono, (1997) Nature Biotechnology 15, 871-875, Takahashi, K, <br><br> 20 Wesselingh, S L , Griffm, D E., McArthur, J. C Johnson, R.T. &amp; Glass, J D (1996) Ann Neurol 39, 705-711 More recently however vector have been describe that are efficient yet lack most or all of the accessory factors Poeschla, E, Corbeau, P. &amp; Wong-Staal, F. <br><br> (1996) Proc Natl Acad Sci U S A 93, 11395-9. Naldmi, L., Blomer, U., Gage, F. H., Trono, D &amp; Verma, I M (1996) Proc Natl Acad Sci U S A 93, 11382-8. Naldmi, L., Blomer, U., <br><br> 25 Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I M. &amp; Trono, D. (1996) Science 272, 263-7, Blomer, U., Naldmi, L., Kafri, T., Trono, D , Verma, I. &amp; Gage, F. (1997) Journal of Virology 71, 6641-6649, Kim, V.N, Mitrophanous, K., Kingsman, S.M. and Kmgsman, A J 1998 J Virol, 72, 811-816. <br><br> 30 The general format for these lentiviral vectors is, HIV-1 5'LTR and leader, some gag coding region sequences (to supply packaging functions), a reporter cassette, the rev <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 28 <br><br> response element (RRE) and the 3'LTR. In these vectors gag/pol, accessory gene products and envelope functions are supplied either from a single plasmid or from two or more co-transfected plasmids, or by co-infection of vector containing cells with HIV. Transactivation has also been utilised in an HIV-based vector m which the U3 region of the 5 5'LTR is altered to contain two copies of the tax responsive element (TRE), which allows transactivation by the tax protein of HTLV-I. This is proposed as a therapeutic for adult T-cell leukemia/lymphoma (Lin, H C, Bodkin, M, Lai, R. B. &amp; Rabson, A B. (1995) J Virol 69, 7216-25.) Vectors have also been constructed that can be expressed using a constitutive promoter such as the CMV promoter (e.g Kim et al 1998 ibid) More recently 10 the lentiviral vector configurations have been further refined. For example self inactivating HIV vectors have been produced where the HIV LTR is deleted to restrict expression to the internal cassette (Myoshi et al 1998 J Virol 72, 8150) <br><br> Where co-infection of a target cell with HIV occurs the vector can be spread throughout a 15 culture of HIV permissive cells This principal has been used for the development of vectors for the treatment or limitation of HIV-1 infection (Dropulic, B., Hermankova, M. &amp; Pitha, P. M. (1996) Proc Natl Acad Sci U S A 93, 11103-8., Kim, J H , McLinden, R. J., Mosca, J. D., Vahey, M. T,, Greene, W. C &amp; Redfield, R. R. (1996) J Acquir Immune Defic Syndr Hum Retroviral 12, 343-51, Poeschla et al 1996 PNAS 93, 11395 <br><br> 20 <br><br> Numerous studies have now descnbed the utility of HIV based vectors for gene transfer to non-dividing cells.( e.g. retina, Myoshi et al 1997, PNAS 94, 10319-23.,neurons, Blomer et al 1997 J Virol 71, 6641, Blomer et al 1998 95, 2603, liver, muscle, Kafri et al Nature Genetics 1997 17, 314). Other lentiviral vectors have also been developed for example 25 EIAV (GB 9727135.7) and FIV (Poeschla et al 1998, Nature Medicine, 4, 354) and Maedi-Visna (International Application Number PCT/GB95/00663 Prionty date 9 Dec 1994/24 March 1995 Packaging-Deficient Lentiviruses Lever, A.M.L, Harrison, G.P., Hunter, E) <br><br> 30 Retroviral gene transfer into munne HSCs m the general sense has already been reported (Williams et al Nature 1984 310. 476-479) Here, the expression of a full-length MDRI <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 29 <br><br> (multidrug resistance) cDNA gene in murine HSCs was shown to render them resistant to various anticancer drugs Similarly, murine haematopoietic progenitor cells m bone marrow or penpheral blood cells have been shown to be protected from the toxicity of anticancer chemotherapy by retroviral transduction of the MDRI gene (Licht et al 1995 5 Cytokines Mol Ther 1: 11-20). Sustained human hematopoiesis m immunodeficient mice has also been demonstrated by cotransplantation of CD34+ progemtor cells which had been transduced in vitro with a recombiant retroviral vector compnsing either a neomycin phosphotransferase gene (neo) or a human glucocerebrosidase cDNA (Nolta et al 1994 Blood 83 3041-3051). Munne HSCs have also been transduced with a two gene retroviral 10 vector containing a reporter (LacZ) and selectable marker {neo) LacZ expression was detectable in the PBL of the recipients (Asami et al 1996 Eur J Haematol 57' 278-285) <br><br> In vivo munne studies have indicated that the pretreatment of donor mice with 5-fluorouracil pnor to harvest of bone marrow can improve transduction efficiencies by 15 inducing the cycling of pnmitive cells and increasing the susceptibility to retroviral infection and integration. The co-culture of target cells with retroviral producer cell line and the use of cell lines capable of producing at least 105 viral particles per ml has also improved efficiencies (Bodine et al 1991 Exp Hematol 19. 206-212) Successful gene transfer into long terms re-populating cells has been achieved m virtually all recipient mice 20 with reconstitution of multiple haematopoietic lineages stably with 1-50% or more cells carrying the proviral genome (Fraser et al 1990 Blood 76 1071-1076). <br><br> Retroviral gene transfer into human HSCs in the general sense has been reported (Duphar and Emmons 1994 Stem Cells 12: 563-576) Also, committed human progenitor cells such 25 as colony forming units-granulocyte macrophage (CFU-GM) or burst forming units-erythroid (BFU-E) have been transduced by retroviral vectors at very high efficiencies (often greater than 50%) m the presence of vanous combinations of growth factors such as IL-3,11-6 and Stem Cell Factor (SCF) or m the presence of primary marrow stroma or the retroviral producer cell line (Nolta et al 1990 Hum Gen Ther 1: 257-268; Moore et al 1992 30 Blood 79 1393-1399, Cournoyer et al 1991 Hum Gen Ther 2: 203-213). <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 30 <br><br> The presence of specific extracellular matrix components such as fibronectin may be of some importance as well (Montz et al J Clin Invest 1994 93: 1451-1457). More primitive human long-term culture initiating cells (LTC-IC) have been transduced at equivalent efficiencies under similiar transduction conditions (Moore et al 1992 ibid; Hughes et al 5 1989 Blood 74: 1915-1922, Hughes et al 1992 J Clm Invest 89: 1817-1824). The expression of high levels of a human tumour antigen, epithelial cell mucin (MUC-1) on human dendntic cells (DCs) has been achieved by retroviral transduction of CD34+ progenitor cells and their subsequent cytokme-induced differentiation into Dcs (Henderson et al 1996 Cancer Res 56' 3763-3770). <br><br> 10 Despite the general teachings in the art that retroviral systems have been used to transfer genes into HSCs, the prior art does not teach or suggest the present invention wherein one or more NOIs are used to transform one or more HSCs and m a specific manner. <br><br> In accordance with the present invention, suitable NOI sequences include those that are of 15 therapeutic and/or diagnostic application such as, but are not limited to: sequences encoding cytokines, chemokmes, hormones, antibodies, engineered immunoglobuhn-like molecules, a single chain antibody, fusion proteins, enzymes, immune co-stimulatory molecules, immunomodulatory molecules, anti-sense RNA, a transdominant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a tumour suppressor 20 protein and growth factors, membrane proteins, vasoactive proteins and peptides, anti-viral proteins and nbozymes, and derivatives therof (such as with an associated reporter group) When included, such coding sequences may be typically operatively linked to a suitable promoter, which may be a promoter driving expression of a ribozyme(s), or a different promoter or promoters, such as m one or more specific cell types. <br><br> 25 <br><br> Suitable NOIs for use in the invention in the treatment or prophylaxis of cancer include NOIs encoding proteins which destroy the target cell (for example a nbosomal toxin), act as tumour suppressors (such as wild-type p53), activators of anti-tumour immune mechanisms (such as cytokines, co-stimulatory molecules and immunoglobulins); 30 inhibitors of angiogenesis, or which provide enhanced drug sensitivity (such as pro-drug activation enzymes), indirectly stimulate destruction of target cell by natural effector cells <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 31 <br><br> (for example, strong antigen to stimulate the immune system or convert a precursor substance to a toxic substance which destroys the target cell (for example a prodrug activating enzyme) Encoded proteins could also destroy bystander tumour cells (for example with secreted antitumour antibody-nbosomal toxin fusion protein), indirectly 5 stimulated destruction of bystander tumour cells (for example cytokines to stimulate the immune system or procoagulant proteins causing local vascular occlusion) or convert a precursor substance to a toxic substance which destroys bystander tumour cells (eg an enzyme which activates a prodrug to a diffusible drug). <br><br> 10 Also, the delivery of NOI(s) encoding antisense transcripts or ribozymes which interfere with expression of cellular genes for tumour persistence (for example against aberrant myc transcnpts m Burkitts lymphoma or against bcr-abl transcnpts in chronic myeloid leukemia. The use of combinations of such NOIs is also envisaged <br><br> 15 Instead of or as well as being selectively expressed m target tissues, the NOI or NOIs may encode a pro-drug activation enzyme or enzymes which have no significant effect or no deletenous effect until the individual is treated with one or more pro-drugs upon which the enzyme or enzymes act. In the presence of the active NOI, treatment of an individual with the appropriate pro-drug leads to enhanced reduction in tumour growth or survival. <br><br> 20 <br><br> A pro-drug activating enzyme may be delivered to a tumour site for the treatment of a cancer In each case, a suitable pro-drug is used in the treatment of the patient in combination with the appropnate pro-drug activating enzyme An appropnate pro-drug is admimstered m conjunction with the vector Examples of pro-drugs include, etoposide 25 phosphate (with alkaline phosphatase, Senter et al 1988 Proc Natl Acad Sci 85: 4842-4846), 5-fluorocytosine (with cytosme deaminase, Mullen et al 1994 Cancer Res 54: 1503-1506), Doxorubicin-N-p-hydroxyphenoxyacetamide (with Penicilhn-V-Amidase, Kerr et al 1990 Cancer Immunol Immunother 31 202-206); Para-N-bis(2-chloroethyl) ammobenzoyl glutamate (with carboxypeptidase G2), Cephalosponn nitrogen mustard 30 carbamates (with p-lactamase), SR4233 (with P450 Reducase); Ganciclovir (with HSV thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci 85' 7572-7576); mustard pro- <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 32 <br><br> drugs with nitroreductase (Fnedlos et al 1997 J Med Chem 40 1270-1275) and Cyclophosphamide (with P450 Chen et al 1996 Cancer Res 56. 1331-1340) <br><br> Examples of suitable pro-drug activation enzymes for use m the invention include a 5 thymidine phosphorylase which activates the 5-fluoro-uracil pro-drugs capcetabine and furtulon; thymidine kinase from Herpes Simplex Virus which activates ganciclovir; a cytochrome P450 which activates a pro-drug such as cyclophosphamide to a DNA damaging agent; and cytosine deaminase which activates 5-fluorocytosine. Preferably, an enzyme of human origin is used <br><br> 10 <br><br> Suitable NOIs for use in the treatment or prevention of ischaemic heart disease include NOIs encoding plasminogen activators. Suitable NOIs for the treatment or prevention of rheumatoid arthritis or cerebral malaria include genes encoding anti-inflammatory proteins, antibodies directed against tumour necrosis factor (TNF) alpha, and anti-adhesion 15 molecules (such as antibody molecules or receptors specific for adhesion molecules). <br><br> Examples of hypoxia regulatable therapeutic NOIs can be found in PCT/GB95/00322 (WO-A-9521927). <br><br> 20 The expression products encoded by the NOIs may be proteins which are secreted from the cell Alternatively the NOI expression products are not secreted and are active within the cell In either event, it is preferred for the NOI expression product to demonstrate a bystander effector or a distant bystander effect, that is the production of the expression product in one cell leading to the killing of additional, related cells, either neighbouring or 25 distant (e.g. metastatic), which possess a common phenotype. <br><br> The vector may also contain one or more cytokme-encodmg NOIs which serve to direct the subsequent differentiation of the MHSCs containing the vector Suitable cytokines and growth factors include but are not limited to: ApoE, Apo-SAA, BDNF, Cardiotrophin-1, 30 EGF, ENA-78, Eotaxin, Eotaxm-2, Exodus-2, FGF-acidic, FGF-basic, fibroblast growth factor-10 (Marshall 1998 Nature Biotechnology 16. 129).FLT3 ligand (Kimura et al <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 33 <br><br> (1997), Fractalkme (CX3C), GDNF, G-CSF, GM-CSF, GF-pl, insulin, IFN-y, IGF-I, IGF-II, IL-la, IL-lp, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (72 a a.), IL-8 (77 a.a), IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18 (IGIF), Inhibm a, Inhibm P, IP-10, keratmocyte growth factor-2 (KGF-2), KGF, Leptin, LIF, Lymphotactm, Mullerian 5 inhibitory substance, monocyte colony inhibitory factor, monocyte attractant protein (Marshall 1998 ibid), M-CSF, MDC (67 a.a.), MDC (69 a.a.), MCP-1 (MCAF), MCP-2, MCP-3, MCP-4, MDC (67 a a), MDC (69 a a.), MIG, MlP-la, MIP-lp, MIP-3a, MIP-3p, MIP-4, myeloid progemtor inhibitor factor-1 (MPIF-1), NAP-2, Neurturin, Nerve growth factor, p-NGF, NT-3, NT-4, Oncostatin M, PDGF-AA, PDGF-AB, PDGF-BB, PF-4, 10 RANTES, SDFla, SDFip, SCF, SCGF, stem cell factor (SCF), TARC, TGF-a, TGF-p, TGF-P2, TGF-P3, tumour necrosis factor (TNF), TNF-a, TNF-P, TNIL-1, TPO, VEGF, GCP-2, GRO/MGSA, GRO-p, GRO-y, HCC1, 1-309, <br><br> For some applications, a combination of some of these cytokines may be preferred, m 15 particular a combination which includes IL-3, IL-6 and SCF, for the maintenance and expansion of stem cell populations. For differentiation in vitro, further cytokines may be added such as GM-CSF and M-CSF to induce differentiation of macrophages or GM-CSF and G-CSF to obtain neutrophils On reintroduction of the engineered cells into the individual from which they were derived, the body's own mechanisms then permit the cells 20 or their differentiated progeny to migrate into the affected area e g the tumour. <br><br> One or more of the NOIs may be fused That is, the NOI coding sequence may encode a fusion protein or a segment of a coding sequence For example, pIXY321 is a genetically engineered fusion protein of GM-CSF and IL-3 (Bhalla et al 1995 Leukemia 11: 1851-25 1856) which exhibits biologic effects of both its parent cytokines in vitro and m preclinical studies (Vadhan-Raj et al 1995 Blood 86 2098-2105) <br><br> Optionally, another NOI may be a suicide gene, expression of which in the presence of an exogenous substance results m the destruction of the transfected or transduced cell An 30 example of a suicide gene includes the herpes-simplex virus thymidine kinase gene (HSV <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 34 <br><br> tk) which can kill infected and bystander cells following treatment with ganciclovir (Robbins et al Tibtech 1998 16. 35-40). <br><br> Optionally another NOI may be a targeting protein (such as an antibody to the stem cell 5 factor receptor (W09217505, W09221766) For example, recombinant (ecotropic) retroviruses displaying an antibody (or growth factor or peptide) against a receptor present on HSCs (CD34 or stem cell factor, for example) might be used for targeted cell delivery to these cells, either ex vivo by incubating unfractionated bone marrow with virus or by intravenous delivery of virus <br><br> 10 <br><br> Ligands and antibodies may be utilised to target selected cell types, including for example, monoclonal antibody c-SF-25 to target a 125kD antigen on human lung carcinoma (Takahashi et al 1993 Science 259:1460), antibodies to various lung cancer antigens (Souhami 1992 Thorax 47- 53-56); antibodies to human ovarian cancer antigen 14C1 15 (Gallagher et al 1991 Br J Cancer 64. 35-40); antibodies to H/Lev/lLeb antigens to target lung carcinoma (Masayuki et al 1992 N Eng J Med 327:14-18); nerve growth factor to target nerve growth factor receptors on neural tumours (Chao et al 1986 Science 232 518); the Fc receptor to target macrophages (Anderson and Looney 1987 Immunol Today 1. 264-266); lectins (Sharon and Lis 1989 Science 246' 227); collagen type I to target colon 20 cancer (Pullam and Bodmer 1992 Nature 356: 529), Interleukm-1 to target the Interleukin-1 receptor on T Cess (Fanslow et al 1990 Science 248 739); acetylated low density lipoproteins ("LDL") to target macrophage scavenger receptors (and atherosclerotic plaques; see Brown et al 1983 Ann Rev Biochem 52 223-261); as well as other acetylated molecules which target macrophage scavenger receptors (Pauhnski et al PNAS 86 1372-25 1376); viral receptors (Haywood 1994 J Virol 68(1): 1-5); transferrin to target transferrin receptors on tumour cells (Huebers et al 1987 Physio Rev 67: 520-582); vasoendothelial growth factor ("vegF") to target cells where increased vascularisation occurs; and urokinase plasminogen activator receptor (UPAR). <br><br> 30 Alternatively, ligands may be selected from libraries created utilising recombinant techniques (Scott and Smith 1990 Science 249 386, Devlin et al 1990 Science 249: 404; <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 35 <br><br> Houghten et al 1991 Nature 354. 84, Matthews and Wells 1993 Science 260. 1113, Nisim et al 1994 EMBO J 13(3) 692-698) or equivalent techniques utilising organic compound libraries. <br><br> 5 In addition to the therapeutic gene or genes and the expression regulatory elements described, the vector may contain additional genetic elements for the efficient or regulated expression of the gene or genes, including promoters/enhancers, translation initiation signals, internal nbosome entry sites (IRES), splicing and polyadenylation signals. <br><br> 10 The NOI or NOIs may be under the expression control of an expression regulatory element, usually a promoter or a promoter and enhancer. The enhancer and/or promoter may be preferentially active in a hypoxic or ischaemic or low glucose environment, such that the NOI is preferentially expressed in the particular tissues of interest, such as m the environment of a tumour, arthritic joint or other sites of ischaemia. Thus any significant 15 biological effect or deleterious effect of the NOI on the individual bemg treated may be reduced or eliminated The enhancer element or other elements conferring regulated expression may be present m multiple copies Likewise, or m addition, the enhancer and/or promoter may be preferentially active in one or more specific cell types - such as any one or more of macrophages, endothelial cells or combinations thereof Further 20 examples include include respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cess and post-mitotically terminally differentiated non-replicating cells such as macrophages neurons. <br><br> The term "promoter" is used in the normal sense of the art, e g an RNA polymerase 25 binding site in the Jacob-Monod theory of gene expression. <br><br> The term "enhancer" includes a DNA sequence which binds to other protein components of the transcription initiation complex and thus facilitates the initiation of transcription directed by its associated promoter. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 36 <br><br> The promoter and enhancer of the transcription units encoding the secondary vector are preferably strongly active, or capable of being strongly induced, in the primary target cells under conditions for production of the secondary viral vector. The promoter and/or enhancer may be constitutively efficient, or may be tissue or temporally restricted m their 5 activity. Examples of suitable tissue restncted promoters/enhancers are those which are highly active in tumour cells such as a promoter/enhancer from a MUC1 gene, a CEA gene or a 5T4 antigen gene. Examples of temporally restncted promoters/enhancers are those which are responsive to ischaemia and/or hypoxia, such as hypoxia response elements or the promoter/enhancer of a grp78 or a grp94 gene. The alpha fetoprotein (AFP) promoter is 10 also a tumour-specific promoter One preferred promoter-enhancer combination is a human cytomegalovinis (hCMV) major immediate early (MIE) promoter/enhancer combination. <br><br> Preferably the promoters of the present invention are tissue specific. That is, they are 15 capable of dnvmg transcription of a NOI or NOI(s) in one tissue while remaimng largely "silent" in other tissue types. <br><br> The term "tissue specific" means a promoter which is not restricted m activity to a single tissue type but which nevertheless shows selectivity m that they may be active m one group 20 of tissues and less active or silent in another group. A desirable charactenstic of the promoters of the present invention is that they posess a relatively low activity in the absence of activated hypoxia-regulated enhancer elements, even m the target tissue One means of achieving this is to use "silencer" elements which suppress the activity of a selected promoter in the absence of hypoxia. <br><br> 25 <br><br> The level of expression of an NOI or NOIs under the control of a particular promoter may be modulated by manipulating the promoter region For example, different domains within a promoter region may possess different gene regulatory activities The roles of these different regions are typically assessed using vector constructs having different 30 vanants of the promoter with specific regions deleted (that is, deletion analysis) This <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 37 <br><br> approach may be used to identify, for example, the smallest region capable of confemng tissue specificity or the smallest region conferring hypoxia sensitivity. <br><br> A number of tissue specific promoters, descnbed above, may be particularly advantageous 5 m practising the present invention. In most instances, these promoters may be isolated as convenient restriction digestion fragments suitable for cloning m a selected vector. Alternatively, promoter fragments may be isolated using the polymerase chain reaction. Cloning of the amplified fragments may be facilitated by incorporating restriction sites at the 5' end of the pnmers. <br><br> 10 <br><br> Promoters suitable for cardiac-specific expression include the promoter from the munne cardiac a-myosin heavy chain (MHC) gene. Suitable vascular endothelium-specific promoters include the Et-1 promoter and von Willebrand factor promoter. <br><br> 15 Prostate specific promoters include the 5'flankmg resion of the human glandular kallikrein-1 (hKLK2) gene and the prostate specific antigen (hKLK3). <br><br> Examples of promoters/enhancers which are cell specific include a macrophage-specific promoter or enhancer, such as CSF-1 promoter-enhancer, or elements from a mannose 20 receptor gene promoter-enhancer (Rouleux et al 1994 Exp Cell Res 214:113-119) Alternatively, promoter or enhancer elements which are preferentially active m neutrophils, or a lymphocyte-specific enhancer such as an IL-2 gene enhancer, may be used. <br><br> As indicated above, the present invention is based on the surprising finding that it is 25 possible to transform one or more HSCs and for a specific purpose <br><br> By way of background information, monocytes and their differentiated derivatives, macrophages are denved from a reservoir of embryonic cells, called HSCs which are capable of giving rise to a vanety of distinct cell types HSCs, m mammals, are found 30 within the fetal liver, spleen and bone marrow but after birth and throughout adult life, they are normally found only m the bone marrow HSCs differentiate into vanous cell lineages <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 38 <br><br> under the influence of microenvironmental factors such as cell-to-cell interactions and the presence of soluble cell cytokines. <br><br> Four major cell lineages arise from the HSCs. These include. Erythroid (Erythrocytes); <br><br> 5 Megakaryocyte (platelets), Myeloid (granulocytes and mononuclear phagocytes), and Lymphoid (lymphocytes). In particular, the myeloid and lymphoid lineages are critical to the functioning of the immune system. <br><br> Myelopoiesis commences m the liver of the human foetus at about six weeks of gestation. 10 Studies in which colonies have been grown m vitro from individual stem cells have shown that the first progenitor cell denved from HSCs is the colony forming unit (CFU) which can give nse to Granulocytes, Erythrocytes, Monocytes and Megakaryocytes (CFU-GEMM). <br><br> 15 Maturation of these cells occurs under the influence of a network of tissue specific protein regulators which have been given a vanety of names including growth factors, cytokines and interleukms. In the mam, there is no functional or structural characteristic that distinguishes the different classes of growth factors. Most factors appear to be capable of stimulating multiple biological responses that depend cntically on the differentiation state 20 of their target cells For example, one of the haemopoietic growth factors, granulocyte colony stimulating factor (G-CSF) stimulates proliferation of immature bone marrow cells as well as activating bactenal killing by mature neutrophils Erthropoietm (EPO) and thrombopoietm (TPO) are structurally similiar cytokines and support respectively, the proliferation and differentiation for erythroid and megakaryocyte lineages as well as more 25 pnmitive progenitors (Gotoh et al 1997 Ann Hematol 75; 207-213). TPO initiates its biologic effects by binding to the Mpl receptor, which is a member of the haematopoietic receptor family (Broudy et al 1997 Blood 89. 1896-1904) HOXB4 has been shown to be an important regulator of very early but not late haematopoietic cell proliferation (Sauvageau et al 1995 Genes Dev 9: 1753-1765) The soluble Kit ligand proteins (Kls) act 30 as a ligand for the transmembrane tyrosine kinase receptor C-kit and stimulate mast cell and erythroid progenitors (91EP-810609). The interleukms, include IL-1, 11-2, IL-3, IL-4, <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 39 <br><br> IL-5, 11-6 and IL-12, which are capable of activating HSCs (see "Molecular biology and Biotechnology Ed RA Meyers 1995 VCH Publishers Inc p 392-397). <br><br> These mediators, which are important in the positive regulation of haemopoiesis, are 5 denved mainly from stromal cells m the bone marrow, but they are also produced by mature forms of differentiated myeloid and lymphoid cells. There are a number of successful growth factor combinations in use but combinations of IL-3 and IL-6 with or without other factors such as stem cell factor (SCF) active on primitive cells have achieved the best results (Bodine et al 1989 Proc Natl Acad Sci 86. 8897-8901; Luskey et al 1992 10 Blood 80: 396-402, Fraser et al 1990 Blood 76. 1071-1076) Other cytokines (such as TGFP) may downregulate haemapoiesis. <br><br> The CFU-GM cell is the precursor of both neutrophils and mononuclear phagocytes. As the CFU-GM differentiates along the neutrophil pathway, several distinct morphological 15 stages are seen Myeloblast develop into promyelocytes and myelocytes, which mature and are released into the circulation as neutrophils. The one-way differentiation of cells from the CFU-GM into mature neutrophils is probably the result of acquiring specific growth/differentiation factor receptors at different stages of development <br><br> 20 Surface differentiation markers disappear or appear on the cells as they develop into granulocytes For example, MHC class II molecules and CD38 are expressed on the CFU-GM but not on mature neutrophils. Other surface molecules acquired dunng the differentiation process include CD13, CD14 at low density, CD15, the p[ integrin, VLA-4, the p2 integnns CD1 la, b and c associated with CD 18 p2 chains, complement receptors and 25 CD16 Fey receptors. <br><br> CFU-GMs taking the monocyte pathway give nse initially to profilerating monoblasts. These differentiate into promonocytes and finally into mature circulating monocytes. Circulating monocytes are thought to be a replacement pool for tissue-resident 30 macrophages. The different forms of macrophages comprise the reticulo-endothelial system. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 40 <br><br> Like mature neutrophils, mature monocytes and macrophages lose CD34. However, unlike neutrophils, they continue to express significant levels of MHC class II molecules. These molecules are clearly important for the presentation of antigen to T cells. Monocytes also 5 acquire many of the same surface molecules as mature neutrophils. <br><br> In addition to macrophages, most of the classical antigen-presentmg cells (APCs) which include the follicular dentntic cells, Langerhans' cells and mterdigitating cells are present at birth. While their origin is still unclear, it is likely that most are denved from bone-10 marrow stem cells One possibility is that they are denved from the same CFU-GEMM precursor cell Morphological, cytochemical and functional differences would then be due to local microenvironmental influences such as cytokines Alternatively, APCs could be derived from different stem cells and represent separate lineages of differentiation. <br><br> 15 In the first stage of differentiation into colony forming cells (such as CFU-GEMM) the HSCs express CD33 and CD34 Thus, HSCs can usually be charactensed by the presence of the cell glycoprotein CD34 (and possibly CD33) at the cell surface. <br><br> In the next stage of differentiation to cells of the erythroid, myelomonocytic and 20 megakaryotic lineages, the vital burst forming units-erythroid (BFUE) cells of the erythroid lineage carry antigens CD33 and CD34 but these antigens are lost in later differentiation. The myelomonocytic lineage which includes CFU-GM cells carry CD33 but not CD34 and this CD33 is subsequently lost. The megakaryotic lineage leads initially to CFU Mega cells which carry CD34 which is also subsequently lost. <br><br> 25 <br><br> A further significant system of antigens on HSC and other cells is the MHC (major histocompatibility complex) Class II group It has been found that the majority of HSC carry an antigen termed DR and on differentiation express an antigen termed DP and then a further antigen termed DQ Thus, the MHC Class II DR antigen is charactenstic of 30 relatively early stem cells. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 41 <br><br> Methods for isolation of HSCs and their maintenance and differentiation in culture are known in the art (Santiago-Schwartz et al 1992 J Leuk Biol 52:274-281; Charbord et al 1996 Br J Haematol 94- 449-454; Dao et al 1997 Blood 89 446-456, Piacibello et al 1997 Blood 89: 2644-2653) and m W091/09938 Methods for retroviral mediated transduction 5 of HSCs and transfer to patients are also descnbed (Dunbar et al 1996 Hum Gene Ther 7.231-253) <br><br> Engineered HSCs of the invention are administered to a patient or an at-risk individual m a suitable formulation The formulation may include an isotonic salme solution, a buffered 10 saline solution or a tissue-culture medium. The cells are administered by bolus injection or by infusion intravenously or directly to the site of a tumour or to the bone marrow at a concentration of for example between approximately 106 and of the order of 1012 cells / dose. <br><br> The individual may first be treated to deplete the bone marrow of stem cells or may be 15 treated with one or more cytokines such as G-CSF to increase the mobilisation of stem cells into the penpheral blood or one or more cytokines to enhance repopulation of bone marrow Combinations of such treatments are also envisaged The treatments of the invention may also be combined with currently available anti-cancer therapies. <br><br> 20 In the event that the vector used for stem cell engineenng encodes a pro-drug activating enzyme, the individual suffenng from cancer is additionally treated with the corresponding pro-drug, administered using an appropnate regimen according to pnnciples known m the art. <br><br> As indicated above, the present invention is based on the surprising finding that it is 25 possible to transform one or more HSCs with inter alia a IRLE and for a specific purpose. <br><br> A preferred IRLE is an hypoxic response element. <br><br> The elevated expression of a therapeutic gene under hypoxic conditions can be induced by 30 the presence of one or more hypoxic response enhancer (HRE) elements. HRE elements contain polynucleotide sequences that may be located either upstream (5') or downstream <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 42 <br><br> (3') of the promoter and/or therapeutic gene The HRE enhancer element (HREE) is typically a m-actmg element, usually about 10-300 bp in length, that acts on a promoter to increase the transcnption of a gene under the control of the promoter Preferably, the promoter and enhancer elements are selected such that expression of a gene regulated by 5 those elements is minimal in the presence of a healthy supply of oxygen and is upregulated under hypoxic or anoxic conditions <br><br> The term "hypoxia" means a condition under which a particular organ or tissue receives an inadequate supply of oxygen. <br><br> 10 <br><br> The hypoxia response element may also be selected from, for example, the erythropoietin HRE element (HREE1), muscle pyruvate kinase (PKM), HRE element, B-enolase (enolase 3, EN03) HRE element, endothehn-1 (ET-l)HRE element and metallothionem II (MTII) HRE element. <br><br> 15 <br><br> A further example of a hypoxia regulated enhancer is a binding element for the transcription factor HIF-1 (Dachs et al 1997 Nature Med 5: 515; Wang and Sememnza 1993 Proc Natl Acad Sci USA 90*4304, Firth et al 1994 Proc Natl Acad Sci USA 91: 6496). Hypoxia response enhancer elements have also been found m association with a 20 number of genes including the erythropoietin (EPO) gene (Madan et al 1993 Proc Natl Acad Sci 90: 3928, Semenza and Wang 1992 Mol Cell Biol 1992 12. 5447-5454) Other HREEs have been isolated from regulatory regions of both the muscle glycolytic enzyme pyrivate kinase (PKM) gene (Takenaka et al 1989 J Biol Chem 264: 2363-2367), the human muscle-specific p-enolase gene (EN03, Peshavana and Day 1991 Biochem J 275 25 427-433 ) and the endothehn-1 (ET-1) gene (Inoue et al 1989 J Biol Chem 264: 14954-14959). <br><br> Alternatively the expression of a therapeutic gene can be regulated by glucose concentration. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 43 <br><br> For example, the glucose-regulated proteins (grp's) such as grp78 and grp94 are highly conserved proteins known to be induced by glucose deprivation (Attenello and Lee 1984 Science 226 187-190) The grp 78 gene is expressed at low levels m most normal healthy tissues under the influence of basal level promoter elements but has at least two critical 5 "stress inducible regulatory elements" upstream of the TATA element (Attenello 1984 ibid, Gazit et al 1995 Cancer Res 55. 1660-1663) Attachment to a truncated 632 base pair sequence of the 5'end of the grp78 promoter confers high mducibility to glucose deprivation on reporter genes in vitro (Gazit et al 1995 ibid). Furthermore, this promoter sequence in retroviral vectors was capable of driving a high level expression of a reporter 10 gene in tumour cells in munne fibrosarcomas, particularly in central relatively ischaemic/fibrotic sites (Gazit et al 1995 ibid) <br><br> The present invention is believed to have a wide therapeutic applicability - depending on inter alia the selection of the one or more NOIs. <br><br> 15 <br><br> For example, the present invention may be useful m the treatment of the disorders listed m WO-A-98/05635 For ease of reference, part of that list is now provided: cancer, inflammation or inflammatory disease, dermatological disorders, fever, cardiovascular effects, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute 20 infection, HIV infection, shock states, graft-versus-host reactions, autoimmune disease, reperfusion injury, meningitis, migraine and aspmn-dependent anti-thrombosis; tumour growth, invasion and spread, angiogenesis, metastases, malignant, ascites and malignant pleural effusion, cerebral ischaemia, ischaemic heart disease, osteoarthntis, rheumatoid arthntis, osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, 25 atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; penodontitis, gingivitis; psonasis, atopic dermatitis, chronic ulcers, epidermolysis bullosa; corneal ulceration, retinopathy and surgical wound healing; rhinitis, allergic conjunctivitis, eczema, anaphylaxis, restenosis, congestive heart failure, endometriosis, atherosclerosis or endosclerosis <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 44 <br><br> In addition, or in the alternative, the present invention may be useful m the treatment of disorders listed m WO-A-98/07859. For ease of reference, part of that list is now provided- cytokine and cell proliferation/differentiation activity; immunosuppressant or unmunostimulant activity (e g for treating immune deficiency, including infection with 5 human immune deficiency virus, regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumour immunity), regulation of haematopoiesis, e.g. treatment of myeloid or lymphoid diseases; promoting growth of bone, cartilage, tendon, ligament and nerve tissue, e g. for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration; 10 inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokmetic activity (e.g. for mobilising specific cell types to sites of injury or infection), haemostatic and thrombolytic activity (e g for treating haemophilia and stroke), antiinflammatory activity (for treating e.g. septic shock or Crohn's disease); as antimicrobials; modulators of e g. metabolism or behaviour; as analgesics; treating specific 15 deficiency disorders; in treatment of e g psoriasis, m human or veterinary medicine. <br><br> In addition, or in the alternative, the present invention may be useful in the treatment of disorders listed m WO-A-98/09985. Foi ease of reference, part of that list is now provided, macrophage inhibitory and/or T cell inhibitory activity and thus, anti-20 inflammatory activity; anti-immune activity, i.e. inhibitory effects against a cellular and/or humoral immune response, including a response not associated with inflammation, inhibit the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as up-regulated fas receptor expression in T cells; inhibit unwanted immune reaction and inflammation including arthritis, including rheumatoid arthritis, 25 inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, 30 ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 45 <br><br> glomerulonephritis or other renal and urologic diseases, otitis or other oto-rhmo-laryngological diseases, dermatitis or other dermal diseases, periodontal diseases or other dental diseases, orchitis or epididimo-orchitis, infertility, orchidal trauma or other immune-related testicular diseases, placental dysfunction, placental insufficiency, habitual abortion, 5 eclampsia, pre-eclampsia and other immune and/or inflammatory-related gynaecological diseases, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretimtis, optic neuritis, intraocular inflammation, e g. retinitis or cystoid macular oedema, sympathetic ophthalmia, sclentis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components 10 of ocular trauma, ocular inflammation caused by infection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, excessive scarring, e g following glaucoma filtration operation, immune and/or inflammation reaction against ocular implants and other immune and inflammatory-related ophthalmic diseases, inflammation associated with autoimmune diseases or conditions or disorders where, both in the central 15 nervous system (CNS) or m any other organ, immune and/or inflammation suppression would be beneficial, Parkinson's disease, complication and/or side effects from treatment of Parkinson's disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, inflammatory components of stokes, post-polio 20 syndrome, immune and inflammatory components of psychiatric disorders, myelitis, encephalitis, subacute sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Guillaim-Barre syndrome, Sydenham chora, myasthenia gravis, pseudo-tumour cerebn, Down's Syndrome, Huntington's disease, amyotrophic lateral sclerosis, inflammatory components of CNS compression or CNS 25 trauma or infections of the CNS, inflammatory components of muscular atrophies and dystrophies, and immune and inflammatory related diseases, conditions or disorders of the central and penpheral nervous systems, post-traumatic inflammation, septic shock, infectious diseases, inflammatory complications or side effects of surgery, bone marrow transplantation or other transplantation complications and/or side effects, inflammatory 30 and/or immune complications and side effects of gene therapy, e.g. due to infection with a viral carrier, or inflammation associated with AIDS, to suppress or inhibit a humoral and/or <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 46 <br><br> cellular immune response, to treat or ameliorate monocyte or leukocyte proliferative diseases, e.g. leukaemia, by reducing the amount of monocytes or lymphocytes, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, 5 natural or artificial skm tissue <br><br> The delivery of one or more NOIs by a vector system according to the present invention may be used alone or in combination with other treatments or components of the treatment. <br><br> 10 As indicated above, a preferred aspect of the present invention is based on the surprising finding that it is possible to transform one or more HSCs with a retroviral vector and for a specific purpose <br><br> An even more preferred aspect of the present invention is based on the surprising finding 15 that it is possible to congifure lentiviral vectors in order to enhance production of the vector in vitro or to regulate gene expression in vivo in response to a normal physiological signal <br><br> Previous work has shown that it is possible to develop vectors based on members of the 20 lentivirus family which includes HIV-1, HIV-2, SIV, FIV and EIAV To data all of the vectors express the therapeutic genes either constitutively or m response to the natural regulatory signals of the viral vectors themselves. Neither configuration has broad utility for the treatment of disease where controlled levels of gene expression are required. We now describe, for the first time, lentiviral vectors that are responsive to hypoxia and to 25 agents that mimic hypoxia This regulation can be harnessed m vitro to enhance production of the vector and it can be used in vivo to regulate gene expression in response to a normal physiological signal. Such vectors have utility in a wide range of diseases where ischaemia is a feature, for example, cardiovascular disease, peripheral arterial disease, cancer and arthritis. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 47 <br><br> Despite intense research there has been no description to date of a lentiviral vector that contains a regulated gene and it is not clear from the literature that such a vector could be produced. Such a vector would have broad utility for a range of diseases. We have now produced a set of lentiviral vectors that are regulated by tissue physiology and by a 5 chemical modulator These vectors can be configured where the expression cassette is place internally to the vector as described above. However we have shown that there is further advantage to configuring such vectors as single transcnption unit vectors. In this configuration the resultant duplication of the regulatory sequence enhances the response. The regulatory system that we have studied exploits the fact that gene expression is 10 activated in response to ischaemia The physiological markers of ischaemia are low oxygen, low pH and low glucose and these conditions are sensed m cells to result in activation of a restncted set of genes One such set of genes contain sequences in the DNA that mediate a response pnncipally to hypoxia these are the hypoxia response elements (HRE). The use of these elements to dnve the expression of genes m plasmid, retroviral 15 and adenoviral vectors has been descnbed previously in patent aplications [PCT/GB95/00322; PCT/GB97/02709] and m the literature (e g Dachs et al 1997 ibid). It has not however been demonstrated previously that they have utility in lentiviral vectors. <br><br> In addition to responding to hypoxia the HRE elements are known to respond to chemical 20 inducers that mimic hypoxia. Two of these are known, these are cobalt and desfemoxamine (Meliillo et al 1996 J Biol Chem 272, 12236-12243, Wang and Semenza <br><br> 1993, Blood, 82, 3610) <br><br> The invention is applicable to any lentiviral vector for use m any cell type for use in any 25 disease where ischaemia is evident or for use in any disease where the chemical activator desfemoxamine or analogous chemicals might be used, for example neuroblastoma (Blatt <br><br> 1994, Anticancer Res., 14, 2109), beta thalassemia (Giardina and Grady 1995, Semin. Hematol. 32, 304, Alzheimers disease (Crapper et al 1991, The Lancet, 337, 1304, VEGF deficiency (Beerrepoot et al 1996, 56, 3747), Eprythropoetm deficiency (Wang and <br><br> 30 Semenza op cit) and enhancement of tumour chemotherapy (Voest et al 1993, Cancer Chemother. Pharmacol 31, 357) <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 48 <br><br> As it is well known in the art, a vector is a tool that allows or faciliates the transfer of an entity from one environment to another In accordance with the present invention, and by way of example, some vectors used in recombinant DNA techniques allow entities, such as 5 a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into a target cell Optionally, once within the target cell, the vector may then serve to maintain the heterologous DNA within the cell or may act as a unit of DNA replication. Examples of vectors used in recombinant DNA techniques include plasmids, chromosomes, artificial chromosomes or viruses. <br><br> 10 <br><br> The vector can be delivered by viral or non-viral techniques <br><br> Non-viral delivery systems include but are not limted to DNA transfection methods Here, transfection includes a process using a non-viral vector to deliver a gene to a target 15 mammalian cell <br><br> Typical transfection methods include electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, lipofectin, cationic agent-mediated, catiomc facial amphiphiles (CFAs) (Nature 20 Biotechnology 1996 14, 556), multivalent cations such as spermine, cationic lipids or polylysine, 1, 2,-bis (oleoyloxy)-3-(tnmethylammonio) propane (DOTAP)-cholesterol complexes (Wolff and Trubetskoy 1998 Nature Biotechnology 16: 421) and combinations thereof. <br><br> 25 Viral delivery systems include but are not limited to adenovirus vector, an adeno-associated viral (AAV) vector, a herpes viral vector, retroviral vector, lentiviral vector, baculoviral vector. Other examples of vectors include ex vivo delivery systems, which include but are not limited to DNA transfection methods such as electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 49 <br><br> The vector may be a plasmid DNA vector Suitable recombinant viral vectors include adenovirus vectors, adeno-associated viral (AAV) vectors, Herpes-virus vectors, or retroviral vectors which are preferred In the case of viral vectors, gene delivery is mediated by viral infection of a target cell <br><br> 5 <br><br> The vector of the present invention may be configured as a split-mtron vector. A split intron vector is descnbed m GB 9720465 5 and now in a PCT patent application claiming pnonty therefrom (titled VECTOR) and filed on the same date as the filing of this PCT patent application. For ease of reference, that PCT patent application claims: A retroviral 10 vector comprising a functional splice donor site and a functional splice acceptor site; wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of interest ("NOI"), wherein the functional splice donor site is upstream of the functional splice acceptor site, wherein the retroviral vector is derived from a retroviral pro-vector; wherein the retroviral pro-vector comprises a first 15 nucleotide sequence (NS) capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site, wherein the first NS is downstream of the second NS, such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector In this application, the first NOI is an NOI as herein defined Teachings on the split intron aspect are provided at the end of 20 the Expample Section provided below These teachings provide information on this preferred aspect - namely how to construct a split intron viral vector. <br><br> Thus, in this preferred asepct of the present invention there is provided a modified cell comprising an element that is active m that cell; and an NOI; wherein the modified cell is 25 prepared by transforming a cell by viral transduction with one or more retroviral vectors wherein at least one of which compnses the NOI; wherein the retroviral vector compnses a functional splice donor site and a functional splice acceptor site, wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of interest ("NOI"), wherein the functional splice donor site is upstream of the functional 30 splice acceptor site; wherein the retroviral vector is derived from a retroviral pro-vector; wherein the retroviral pro-vector comprises a first nucleotide sequence (NS) capable of <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 50 <br><br> yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site, wherein the first NS is downstream of the second NS, such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector. <br><br> 5 <br><br> The vector of the present invention may be an adenoviral vector. <br><br> The adenovirus is a double-stranded, linear DNA virus that does not go through an RNA intermediate. There are over 50 different human serotypes of adenovirus divided into 6 10 subgroups based on the genetic sequence homology The natural target of adenovirus is the respiratory and gastrointestinal epithelia, generally giving rise to only mild symptoms. Serotypes 2 and 5 (with 95% sequence homology) are most commonly used m adenoviral vector systems and are normally associated with upper respiratory tract infections m the young <br><br> 15 <br><br> Adenoviruses are nonenveloped, regular icosohedrons A typical adenovirus compnses a 140nm encapsidated DNA virus The icosahedral symmetry of the virus is composed of 152 capsomeres 240 hexons and 12 pentons. The core of the particle contains the 36 kb linear duplex DNA which is covalently associated at the 5' ends with the Terminal Protein 20 (TP) which acts as a pnmer for DNA replication. The DNA has inverted terminal repeats (ITR) and the length of these vanes with the serotype <br><br> Entry of adenovirus into cells involves a senes of distinct events. Attachment of the virus to the cell occurs via an interaction between the viral fibre (37nm) and the fibre receptors 25 on the cell This receptor has recently been identified for Ad2/5 serotypes and designated as CAR (Coxsackie and Adeno Receptor, Tomko et al (1997 Proc Natl Acad Sci 94 3352-3358) Internalisation of the virus into the endosome via the cellular av(J3 and avp5 integrals is mediated by and viral RGD sequence in the penton-base capsid protein (Wickham et al, 1993 Cell 73. 309-319). Following internalisation, the endosome is 30 disrupted by a process known as endosomolysis, an event which is believed to be preferentially promoted by the cellular av[}5 mtegnn (Wickham et al., 1994 J Cell Biol <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 51 <br><br> 127- 257-264). In addition, there is recent evidence that the Ad5 fibre knob binds with high affinity to the MHC class 1 a.2 domain at the surface of certain cell types including human epithelial and B lymphoblast cells (Hong et al., 1997 EMBO 16: 2294-2306). <br><br> 5 Subsequently the virus is translocated to the nucleus where activation of the early regions occurs and is shortly followed by DNA replication and activation of the late regions. Transcription, replication and packaging of the adenoviral DNA requires both host and viral functional protein machinery. <br><br> 10 Viral gene expression can be divided into early (E) and late (L) phases. The late phase is defined by the onset of viral DNA replication. Adenovirus structural proteins are generally synthesised dunng the late phase. Following adenovirus infection, host cellular mRNA and protein synthesis is inhibited in cells infected with most serotypes. The adenovirus lytic cycle with adenovirus 2 and adenovirus 5 is very efficient and results in <br><br> 15 approximately 10, 000 vmons per infected cell along with the synthesis of excess viral protein and DNA that is not incorporated into the virion Early adenovirus transcnption is a complicated sequence of interrelated biochemical events but it entails essentially the synthesis of viral RNAs prior to the onset of DNA replication. <br><br> 20 The schematic diagram below is of the adenovirus genome showing the relative direction and position of early and late gene transcnption: <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 52 <br><br> Late mRNA <br><br> MLP LI L2 L3 L4 L5 <br><br> , 1 1 1 1 ► <br><br> E1B ► <br><br> E1A E3 ► ► <br><br> """" 5' "► 3- <br><br> Map Units <br><br> 50 100 <br><br> E2A E4 <br><br> E2B <br><br> The organisation of the adenovirus genome is simihar in all of the adenovirus groups and specific functions are generally positioned at identical locations for each serotype studied Early cytoplasmic messenger RNAs are complementary to four defined, noncontiguous regions on the viral DNA. These regions are designated E1-E4. The early transcripts have been classified into an array of intermediate early (Ela), delayed early (Elb, E2a, E2b, E3 and E4), and intermediate regions. <br><br> The early genes are expressed about 6-8 hours after infection and are driven from 7 promoters m gene blocks El-4 <br><br> 10 <br><br> The Ela region is involved m transcriptional transactivation of viral and cellular genes as well as transcriptional repression of other sequences. The Ela gene exerts an important control function on all of the other early adenovirus messenger RNAs. In normal tisssues, m order to transcribe regions Elb, E2a, E2b, E3 or E4 efficiently, active Ela product is <br><br> 15 required However, the Ela function may be bypassed Cells may be manipulated to provide Ela-like functions or may naturally contain such functions. The virus may also be manipulated to bypass the Ela function. The viral packaging signal overlaps with the Ela enhancer (194-358 nt). <br><br> 20 The Elb region influences viral and cellular metabolism and host protein shut-off. It also <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 53 <br><br> includes the gene encoding the pIX protein (3525-4088 nt) which is required for packaging of the full length viral DNA and is important for the thermostability of the virus. The Elb region is required for the normal progression of viral events late in infection. The Elb product acts in the host nucleus Mutants generated within the Elb sequences exhibit 5 diminished late viral mRNA accumulation as well as impairment in the inhibition of host cellular transport normally observed late in adenovirus infection Elb is required for altering functions of the host cell such that processing and transport are shifted in favour of viral late gene products. These products then result in viral packaging and release of virions Elb produces a 19 kD protein that prevents apoptosis Elb also produces a 55 kD 10 protein that binds to p53. For a review on adenoviruses and their replication, see WO 96/17053 <br><br> The E2 region is essential as it encodes the 72 kDa DNA binding protein, DNA polymerase and the 80 kDa precurser of the 55 kDa Terminal Protein (TP) needed for protein priming 15 to initiate DNA synthesis <br><br> A 19 kDa protein (gpl9K) is encoded within the E3 region and has been implicated in modulating the host immune response to the virus Expression of this protein is upregulated in response to TNF alpha dunng the first phase of the infection and this then 20 binds and prevents migration of the MHC class I antigens to the epithelial surface, thereby dampening the recognition of the adenoviral infected cells by the cytotoxic T lymphocytes. The E3 region is dispensible m in vitro studies and can be removed by deletion of a 1.9 kb Xbal fragment. <br><br> 25 The E4 region is concerned with decreasing the host protein synthesis and increasing the DNA replication of the virus <br><br> There are 5 families of late genes and all are initiated from the major late promoter. The expression of the late genes includes a very complex post-transcnptional control 30 mechanism involving RNA splicmg The fibre protein is encoded within the L5 region The adenoviral genome is flanked by the inverted terminal repeat which in Ad5 is 103 bp <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 54 <br><br> and is essential for DNA replication. 30-40 hours post infection viral production is complete <br><br> Adenoviruses may be converted for use as vectors for gene transfer by deleting the El 5 gene, which is important for the induction of the E2, E3 and E4 promoters. The El-replication defective virus may be propagated in a cell line that provides the El polypeptides in trans, such as the human embryonic kidney cell line 293 A therapeutic gene or genes can be inserted by recombination in place of the El gene. Expression of the gene is dnven from either the El promoter or a heterologous promoter <br><br> 10 <br><br> Even more attenuated adenoviral vectors have been developed by deleting some or all of the E4 open reading frames (ORFs). However, certain second generation vectors appear not to give longer-term gene expression, even though the DNA seems to be maintained Thus, it appears that the function of one or more of the E4 ORFs may be to enhance gene 15 expression from at least certain viral promoters earned by the virus. <br><br> An alternative approach to making a more defective virus has been to "gut" the virus completely maintaining only the terminal repeats required for viral replication The "gutted" or "gutless" viruses can be grown to high titres with a first generation helper virus 20 m the 293 cell line but it has been difficult to separate the "gutted" vector from the helper virus <br><br> Replication-competent adenoviruses can also be used for gene therapy For example, the Ela gene can be inserted into a first generation virus under the regulation of a tumour-25 specific promoter In thoery, following injection of the virus into a tumour, it could replicate specifically m the tumour but not m the surrounding normal cells. This type of vector could be used either to kill tumour cells directly by lysis or to deliver a "suicide gene" such as the herpes-simplex-virus thymidine-kinase gene (HSV tk) which can kill infected and bystander cells following treatment with ganciclovir Alternatively, an 30 adenovirus defective only for Elb has been used specifically for antitumour treatment m phase-1 clinical tnals The polypeptides encoded by Elb are able to block p53-mediated <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 55 <br><br> apoptosis, preventing the cell from killing itself m response to viral infection. Thus, in normal nontumour cells, m the absence of Elb, the virus is unable to block apoptosis and is thus unable to produce infectious virus and spread In tumour cells deficient in p53, the Elb defective virus can grow and spread to adjacent p53-defective tumour cells but not to 5 normal cells. Again, this type of vector could also be used to deliver a therapeutic gene such as HSV tk <br><br> The adenovirus provides advantages as a vector for gene delivery over other gene therapy vector systems for the following reasons- <br><br> 10 <br><br> It is a double stranded DNA nonenveloped virus that is capable of in vivo and in vitro transduction of a broad range of cell types of human and non-human origin. These cells include respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, pnmary mammary epithelial cess and post-mitotically terminally 15 differentiated non-replicatmg cells such as macrophages neurons (with perhaps the important exception of some lymphoid cells including monocytes). <br><br> Adenoviral vectors are capable of transducing both dividing and non dividing cells This is very important for diseases, such as cystic fibrosis, in which the affected cells in the lung epithelium, have a slow turnover rate. In fact, several tnals are underway utilising 20 adenovirus-mediated transfer of cystic fibrosis transporter (CFTR) into the lungs of afflicted adult cystic fibrosis patients <br><br> Adenoviruses have beena used as vectors for gene therapy and for expression of heterologous genes. First generation recombinant adenovirus vectors (E1/E3 deleted) can 25 accommodate 7-8kb of foreign insert DNA, second (E1/E3/E4 deleted) can third ("gutless") generation can carry much larger DNA inserts Recombinant adenovirus vectors can be propagated and stocked to very high titres Adenoviral vector replication in complementing cell lines may produce very high titres of up to 1013 viral particles per ml Adenovirus is thus one of the best systems to study the expression of genes m primary non-30 replicative cells <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 56 <br><br> The expression of viral or foreign genes from the adenovirus genome does not require a replicating cell Adenoviral vectors enter cells by receptor mediated endocytosis Once inside the cell, adenovirus vectors rarely integrate into the host chromosome. Instead, it functions episomally (independently from the host genome) as a linear genome in the host 5 nucleus Hence the use of recombinant adenovirus alleviates the problems and avoids the risks associated with random integration into the host genome. <br><br> There is no association of human malignancy with adenovirus infection Attenuated adenoviral strains have been developed and have been used m humans as live vaccines. <br><br> 10 <br><br> However, current adenoviral vectors suffer from some major limitations for in vivo therapeutic use These include (i) transient gene expression- the adenoviral vector generally remains episomal and does not replicate so that it is not passed onto subsequent progeny (ii) because of its inability to replicate, target cell proliferation can lead to 15 dilution of the vector (ui) an immunological response raised agamst the adenoviral proteins so that cells expressing adenoviral proteins, even at a low level, are destroyed (iv) an inability to achieve an effective therapeutic index since in vivo delivery leads to an uptake of the vector and expression of the delivered genes m only a proportion of target cells (v) the broad target range of adenoviruses can be problematic with gene 20 therapy approaches that need to be directed to diseased tissue with minimal toxicity of normal tissues Any additional controls that can be used to focus therapy in the required compartment would be advantageous with this vector system. <br><br> Adenoviral vectors for use m the invention may be derived from a human adenovirus or an 25 adenovirus which does not normally infect humans. Preferably the vectors are denved from adenovirus type 2 or adenovirus type 5 (Ad2 or Ad5) or a mouse adenovirus or an avian adenovirus such as CELO virus (Cotton et al 1993 J Virol 67:3777-3785). The vectors may be replication competent adenoviral vectors but are more preferably defective adenoviral vectors Adenoviral vectors may be rendered defective by deletion of one or 30 more components necessary for replication of the virus. Typically, each adenoviral vector contains at least a deletion in the El region For production of infectious adenoviral vector <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 57 <br><br> particles, this deletion may be complemented by passage of the virus m a human embryo fibroblast cell line such as human 293 cell line, containing an integrated copy of the left portion of Ad5, including the El gene. The capacity for insertion of heterologous DNA into such vectors can be up to approximately 7 kb. Thus such vectors are useful for 5 construction of a system according to the invention comprising three separate recombinant vectors each containing one of the essential transcnption units for construction of the retroviral secondary vector. <br><br> To date, there has been no published data on physiologically regulated recombinant 10 adenoviruses. However, a number of tissue specific promoters which have been explored in the context of adenoviral vectors, five of which are described below: <br><br> The Pancreatitis-associated Protein I promoter (which is strongly induced dunng the acute phase of pancreatis) shows a 90-fold induction of CAT activity in AR-42J pancreatic cell 15 line after stimulation with a combination of IL6 and dexamethasone in vitro (Dusetti et al 1997 J Biol Chem 272(9) 5800-5804) Mouse in vivo expenments (adenovirus administered via intravenous injection into the tail vein) showed a 10 -fold higher activity m animals with pancreatis (low activity of CAT was observed in some other tissues of the control animal). <br><br> 20 <br><br> A recombinant adenovirus contaimng the munne alpha-fetoprotein promoter was constructed to direct hepatocellular (HCC) specific expression of the human mterleukin-2 gene.IL-2 expression was 3-4 fold higher m AFP-producing HCC cell lines compared to non-AFP producing non-HCC lines (Bui et al 1997 Human Gene Therapy. 8 2173-2182). 25 Intratumoral injection of the AdVAFPl-IL2 into Hep3B tumours established in the dorsal flanks of CB-17/SCED mice resulted m substantial growth arrest and tumour regression after 3 injections. <br><br> A recombinant adenovirus was constructed containing a segment the cardiac tropmin T 30 (cTnT) promoter controlling the expression of either lacZ, EGFP or the sarcoendoplasmic reticulum Ca-ATPase (SERCA) gene (Inesi et al 1998 American J. Physiol. 274(3,1) <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 58 <br><br> C645-C653) The recombinant viruses were then used to transduce chick myocytes and fibroblasts in culture to show that expression from the cTnT promoter was restncted to cardiac myocytes. <br><br> 5 The smooth muscle specific promoter (SM22a) was used to dnve expression of the bactenol lacZ reporter gene in a recombinant adenovirus (Kim et al (1997 J Clin Invest 100(5) 1006-1014). Expression was detected in pnmary rat aortic SMCs and immortalised A7r5 SMCs, but not in HUVECs or NIH3T3 cells. The recombinant adenovirus was injected intravenously into Sprague Dawley rate and although expression from the 10 CMVlacZ adenovirus was detected throughout the liver and lung no expression in either of these tissues was detected from the SM22 dnven lacZ adenovirus, restncting transgene expression to SMCs The conclusion of the paper states that the AdSMCC-lacZ expression was restncted to visceral and vascular SMCs when the virus was administered mtraatenally, mtravenously or intramuscularly. <br><br> 15 <br><br> The KDR and E-selectin promoters were engineered to upregulated the expression of munne TNF-alpha from a SIN retroviral vector in endothelial cells (Jaggar et al 1997 Human Gene Therapy 8(18) 2239-2247) A 10 fold increase in expression from these promoter elements within sEND endothelial cells as compared to NIH-353 fibroblasts was 20 observed <br><br> If the features of adenoviruses are combined with the genetic stability of retro/lentiviruses then essentially the adenovirus can be used to transduce target cells to become transient retroviral producer cells that could stably infect neighbouring cells. <br><br> 25 <br><br> Preferred vectors for use m accordance with the present invention are recombinant viral vectors, in particular recombinant retroviral vectors. <br><br> Preferred vectors for use m accordance with the present invention are recombinant viral 30 vectors, in particular recombinant adenoviral vectors. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 59 <br><br> Preferred vectors for use in accordance with the present invention are recombinant viral vectors, m particular a combination of adenoviral and retroviral vectors. <br><br> The term "recombmant retroviral vector" (RRV) refers to a vector with sufficient retroviral 5 genetic information to allow packaging of an RNA genome, in the presence of packaging components, into a viral particle capable of infecting a target cell. Infection of the target cell includes reverse transcnption and integration into the target cell genome. The RRV in use carries non-viral coding sequences which are to be delivered by the vector to the target cell. An RRV is incapable of independent replication to produce infectious retroviral 10 particles within the final target cell. Usually the RRV lacks a functional gag-pol and/or env gene and/or other genes essential for replication <br><br> Where the invention uses a vector for delivery of an NOI or genes to HSCs in vivo, the vector is preferably a targeted vector capable of targeting CD34+ HSCs <br><br> 15 <br><br> The term "targeted vector" refers to a vector whose ability to infect/transfect a cell or to be expressed in the target cell is restricted to certain cell types within the host organism, usually cells having a common or similar phenotype. <br><br> 20 An example of a targeted vector is a targeted retroviral vector with a genetically modified envelope protein which binds to cell surface molecules found only on a limited number of cell types in the host organism Another example of a targeted vector is one which contains promoter and/or enhancer elements which only permit expression of one or more retroviral transcripts m a proportion of the cell types of the host organism. Thus, the vector may be 25 provided with a ligand specific for CD34, such as an antibody or an lmmunoglobulm-like molecule directed against CD34. On introduction into an individual to be treated such a vector will specifically transfect CD34+ HSCs The vector may be administered systemically, to the penpheral circulation <br><br> 30 The retroviral vector particle according to the invention will also be capable of transducing cells which are slowly-dividing, and which non-lentiviruses such as MLV would not be <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 60 <br><br> able to efficiently transduce Slowly-dividing cells divide once in about every three to four days including certain tumour cells. Although tumours contain rapidly dividing cells, some tumour cells especially those m the centre of the tumour, divide infrequently <br><br> 5 Examples of tumours that may be treated by the present invention include but are not limited to: sarcomas including osteogenic and soft tissue sarcomas, carcinomas such as breast, lung, bladder, thyroid, prostate, colon, rectum, pancreas, stomach, liver, uterine, and ovarian carcinoma, lymphomas including Hodgkm and non-Hodgkm lymphomas, neuroblastoma, melanoma, myeloma, Wilms tumour, and leukemias, including acute 10 lymphoblastic leukemia and acute myeloblastic leukemia, gliomas and retmblastomas. <br><br> Alternatively the target cell may be a growth-arrested cell capable of undergoing cell division such as a cell in a central portion of a tumour mass or a stem cell such as a HSC or a CD34+ cell As a further alternative, the target cell may be a precursor of a differentiated 15 cell such as a monocyte precursor, a CD33+ cell, or a myeloid precursor. As a further alternative, the target cell may be a differentiated cell such as a neuron, astrocyte, glial cell, microglial cell, macrophage, monocyte, epithelial cell, endothelial cell or hepatocyte Target cells may be transduced either in vitro after isolation from a human individual or may be transduced directly in vivo. <br><br> 20 <br><br> Additional vector components which are standard m the art will be provided for other aspects of vector function such as vector maintenance, nuclear localisation, replication, and integration as appropnate. <br><br> 25 Where the HSCs are removed from the individual to be treated and are transfected or transduced with the vector in vitro, the cells are generally expanded in culture pnor to and after introduction of the NOI or NOIs When cultured in vitro under appropriate conditions or when appropnate signals are received in vivo, HSC have the capacity to differentiate into, among other cell types, endothelial cells, myeloid cells, dendntic cells and immune 30 effector cells such as neutrophils, lymphocytes, mononuclear phagocytes and NK cells. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 61 <br><br> This involves the use of tissue culture methods which are known m the art and include exposure to cytokines and/or growth factors for the maintenance of HSCs (Santiago-Schwartz et al 1992 J Leuk Biol 52 274-281, Charbord et al 1996 Br J Haematol 94- 449-454, Dao et al 1997 Blood 89 446-454, Piacibello et al 1997 Blood 89: 2644-2653) 5 Agents which induce the differentiation of the HSCs may also be added <br><br> As indicated, the vector of the present invention may be a delivered to a target site by a viral or a non-viral vector. <br><br> 10 The invention also provides reagents and methods for use in treating diseases such as cancer, and also reagents and methods for use in preventative medicine Thus the NOIs used in the invention may have a therapeutic effect via prophylaxis. For example, where an increased risk of developing cancer is diagnosed, the invention may be used to vaccinate the at-nsk individual. <br><br> 15 <br><br> The present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherem the composition comprises a therapeutically effective amount of the retroviral vector of the present invention compnsing one or more deliverable therapeutic and/or diagnostic NOI(s) or a viral particle produced by or obtained from same. 20 The pharmaceutical composition may be for human or animal usage. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular patient. <br><br> The composition may optionally comprise a pharmaceutically acceptable earner, diluent, 25 excipient or adjuvant. The choice of pharmaceutical earner, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as - or in addition to - the earner, excipient or diluent any suitable bmder(s), lubncant(s), suspending agent(s), coating agent(s), solubihsing agent(s), and other earner agents that may aid or increase the 30 viral entry into the target site (such as for example a lipid delivery system). <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 62 <br><br> Where appropnate, the pharmaceutical compositions can be administered by any one or more of- inhalation, m the form of a suppository or pessary, topically m the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or m capsules or ovules 5 either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colounng agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used m the form of a stenle aqueous solution which may contain other substances, for example enough salts or 10 monosacchandes to make the solution isotonic with blood For buccal or sublmgual administration the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner <br><br> Suitability for prophylaxis may be based on genetic predisposition to cancer, for example 15 cancer of the breast or ovary because of one or more mutations in a BRCA-1 gene, a BRCA-2 gene (Cornehsse et al 1996 Pathol Res Pract 192. 684-693) or another relevant gene. <br><br> In accordance with the invention, standard molecular biology techniques may be used 20 which are withm the level of skill in the art Such techniques are fully descnbed in the literature See for example, Sambrook et al (1989) Molecular Cloning, a laboratory manual, Hames and Glover (1985 - 1997) DNA Cloning- a practical approach, Volumes I-IV (second edition), Methods for the engineenng of immunoglobulin genes are given in McCafferty et al (1996) "Antibody Engineering. A Practical Approach". <br><br> 25 <br><br> In summation, the present invention relates to: a delivery system suitable for introducing one or more NOIs into a HSC. <br><br> The present invention also relates to a MHSC containing a vector compnsing one or more 30 NOIs. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 63 <br><br> The present invention also relates to a vaccine compnsing the aforementioned vector and/or MHSC <br><br> A preferred aspect of the present invention relates to uses of any of the aforementioned 5 products m the treatment or prevention of a condition characterised by ischaemia, hypoxia or low glucose; particularly, but not exclusively, a condition such as cancer, cerebral malana, ischaemic heart disease or rheumatoid arthntis. <br><br> In a further broad aspect, the present invention provides a modified HSC (MHSC) which 10 compnses a responsive element that compnses an element that is operable in a macrophage ("macrophage responsive element"). <br><br> Thus, the present invention also provides a modified differentiated cell (preferably terminally differentiated cell) compnsing at least one expressable nucleotide sequence of 15 interest (NOI) wherein the or each NOI is operably linked to one or more responsive element(s) active in that differentiated cell <br><br> Thus, m a preferred asepct, the present invention also provides a modified macrophage compnsing at least one expressable nucleotide sequence of interest (NOI) wherein the or 20 each NOI is operably linked to one or more responsive element(s) active in that differentiated cell. <br><br> Thus, in a preferred aspect, the present invention also provides a modified endothelial cell compnsing at least one expressable nucleotide sequence of interest (NOI) wherein the or 25 each NOI is operably linked to one or more responsive element(s) active in that differentiated cell <br><br> With these broad aspects of the present invention, preferably the HRE of the present invention is a highly preferred component of such a responsive element. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 64 <br><br> Preferably, the differentiated cell is denved from the MHSC This aspect is advantageous as it provides a means for providing for selective expression in or by or from, for example, a macrophage that has been differentiated from the MHSC. <br><br> 5 In a further broad aspect, the present invention provides a modified cell, which cell may be a differentiated or undifferentiated cell which undifferentiated cell is capable of being differentiated to a differentiated cell, which modified cell compnses an element that is active in that cell (preferably only active in that cell type), and an NOI (as defined above); wherein the modified cell is prepared by transforming a cell by viral transduction, 10 preferably by adenoviral transduction and/or lentiviral transduction. Here, the element is preferably the ILRE of the present invention <br><br> In a further broad aspect, the present invention provides a hybrid viral vector system for in vivo gene delivery, which system compnses one or more pnmary viral vectors which 15 encode a secondary viral vector, the primary vector or vectors capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell <br><br> Preferably the pnmary vector is obtainable from or is based on a adenoviral vector 20 and/or the secondary viral vector is obtainable from or is based on a retroviral vector preferably a lentiviral vector <br><br> The invention will now be further descnbed by way of examples, which are meant to serve to assist one of ordinary skill m the art in carrying out the invention and are not intended in 25 any way to limit the scope of the invention. <br><br> Reference is made to the following Figures: <br><br> Figure 1 which shows nucleotide sequences that are responsive to hypoxia, <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 65 <br><br> Figure 2 which is a pictonal representation of Plasmid OB37. This plasmid contams the OBHRE promoter, <br><br> Figure 3 which shows the induction of B-galactosidase expression in breast cancer cells 5 transduced with Xiavector; <br><br> Figure 4a which shows a synthetic hypoxia responsive promoter m combination with the SV40 minimal promoter; <br><br> 10 Figure 4b which illustrates the relative strengths of synthetic hypoxic responsive promoters The bars indicate the level of reporter gene activity The numbers above the bars give the fold induction, <br><br> Figure 5 presents Western blots Protein extracts were prepared from pnmary human 15 macrophages and human breast cancer T47D cells and analysed by Western blotting. The antibodies were monoclonal antibodies raised against punfied HIF-1 and EPAS proteins The top panel shows the filter probed with EPAS antibody and the bottom panel shows the filter probed with the HIF-1 antibody; <br><br> 20 Figure 6 which shows that OBHRE 1 mediates hypoxic induction m macrophages; <br><br> Figure 7 which shows the nucleotide sequence of XiaMac and synthetic hypoxia responsive macrophage specific promoter, <br><br> 25 Figure 8 which shows that hypoxia activation of a reporter gene dnven by the XiaMac promoter (labelled OBHREMAC) relative to the CMV promoter in macrophages and breast cancer cell lines, <br><br> Figure 9 which shows that the HRE is cntical for the hypoxic response of the XiaMac 30 promoter The HRE was deleted in XiaMac (XiaMac-HRE) and no induction by hypoxia is observed; <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 66 <br><br> PCT/GB98/02885 <br><br> Figure 10 which provides an outline of a strategy to regulate our hypoxia response promoter via an autoregulatory circuit involving interferon gamma and an IRE; <br><br> 5 Figure 11 shows the nucleotide sequence of the XiaMacIRE sequence that is only active in the presence of hypoxia and interferon gamma, <br><br> Figure 12 is a schematic diagram of a hypoxia regulated lentiviral vector targeted to vascular endothelium by the e-selectm or KDR promoter; <br><br> 10 <br><br> Figure 13 which shows the sequences of the WTPGK and MUTPGK, <br><br> Figure 14 which shows a pictorial representation of a pKAHRE construct; <br><br> 15 Figure 15a shows a schematic map of a retroviral XiaGen-P450 vector comprising a therapeutic gene under the control of an HRE, <br><br> Figure 15b shows an analysis of the induction of XiaGen-P450 (a Xiavector retrovirus) by hypoxia. Cells stain dark when there is induction, <br><br> 20 <br><br> Figure 16a shows a pictorial representation of a plasmid map of pEGASUS, <br><br> Figure 16b shows a pictorial representation of a plasmid map of pONY2.1, <br><br> 25 Figure 16c shows a pictorial representation of a plasmid map of pONYHRELucLac, <br><br> Figure 16d shows a pictorial representation of a plasmid map of pEGHRELacZ; <br><br> Figure 17 is schematics representation of pSecTSP-1 and pEGHRE-TSPl, <br><br> 30 Figure 18 shows a pictorial representation of a Pegasus vector expressing LacZ was plated onto cells in culture Cells were then placed in normoxia or hypoxia. Under hypoxia the <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 67 <br><br> reporter gene is expressed and hence B-galactosidase enzyme is expressed allowing the cells to be counted This gives the titre of the vector. This is 2 logs higher under hypoxia indicating that the reporter gene is preferentially active under this condition, <br><br> 5 Figure 19 shows hypoxia mediated activation of a luciferase reporter m a lentiviral vector; <br><br> Figure 20a shows a hypoxia responsive EIAV vector configured as a single transcnption unit, <br><br> 10 Figure 20b shows a hypoxia responsive autoregulated EIAV vector configured as a single transcnption unit; <br><br> Figure 21 shows a pictonal representation ofpElsplA and pJM17; <br><br> 15 Figure 22 shows a scheme for contracting recombinant adenoviral vectors Adeno PGKlacZ is the OBHRElacZ cassette from OB37 inserted into the Microbix transfer vector pElsplA, <br><br> Figure 23 shows hypoxic induction (0.1%) from PGKLacZ Ad transduced Chiang Liver 20 cells, <br><br> Figure 24 shows hypoxic regulation of p-galactosidase gene expression in pnmary human macrophages transduced with AdHRE LacZ, <br><br> 25 Figure 25a shows a pictonal representation of a plasmid map of pElsp 1 A, <br><br> Figure 25b shows a pictorial representation of a plasmid map of pElHREPG; <br><br> Figure 25c shows a pictonal representation of a plasmid map of pElCMVPG; <br><br> 30 Figure 26 shows a pictonal representation of a plasmid map of pElRevE; <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 68 <br><br> Figure 27 shows a pictorial representation of a plasmid map of pE 1HORSE3.1; <br><br> Figure 28 shows a pictonal representation of a plasmid map of pElPEGASUS4, <br><br> 5 Figure 29 shows a pictonal representation of a plasmid map of pCI-Neo; <br><br> Figure 30 shows a pictonal representation of a plasmid map of pCI-Rab; <br><br> Figure 31 shows a pictonal representation of a Plasmid map of pElRab; <br><br> 10 <br><br> Figure 32 shows a hypoxia responsive EIAV vector containing two therapeutic genes; and Figure 33 is a schematic diagram. <br><br> 15 EXAMPLES <br><br> Example 1: Construction of ischaemia responsive promoters <br><br> The ischaemia response element (ILRE) that can be used in this invention can be taken 20 from any gene that is responsive to ischaemia Hypoxia is one of the conditions that are associated with ischaemia and hypoxia responsive promoters are particularly useful. Some examples of suitable sequences are shown in Figure 1. Suitable sequences will often be found in DNA that is upstream (5') to the coding sequence but they are not necessarily present in such locations Sequences within introns and downstream of the coding 25 sequence can also mediate a response to hypoxia. For example sequences in the 5 'untranslated region of the Epo gene are well known to mediate a transcriptional response to hypoxia and sequences m the 3' region of the VEGF gene mediate a translational response to hypoxia (Bunn and Poyton 1996, Physiol Rev 76, 839). <br><br> 30 The ILRE can be combined with the promoter elements that are resident m the LTR of retroviral vectors or m other combinations with constitutive and tissue specific promoters. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 69 <br><br> In particular a combination of the PGK HRE with the elements from the SV40 promoter is useful as descnbed below. <br><br> OBHRE 1: A promoter based on the murine PGK HRE <br><br> 5 <br><br> Synthetic oligonucleotides were synthesised encompassing hypoxia response element (HRE) sequences and cloned as Bglll/BamHl fragments into the BamHl site of the pGL3 promoter plasmid (Promega accession no U47298) PGK sequences were synthesised as Xbal/Nhel and cloned into the Nhe 1 site of this vector pGL3 is an enhancerless 10 expression plasmid with a minimal SV40 promoter upstream of a luciferase coding sequence. Insertion of the HRE at this site places it upstream of the minimal SV40 promoter. Luciferase assays were performed to compare function of this element in normoxia and hypoxia (0.1% oxygen) and to relate promoter strength to that of SV40 and CMV. The tnmer encompassing -307/-290 sequence of murine PGK in the natural 15 orientation (Firth et al 1995, J Biol Chem 270, 21021) linked to the SV40 promoter is shown. <br><br> GCTAGAGTCGTCtCAGGACGTGACATCTAGTGTCGTCtCAGGACGTGACA HRE HRE <br><br> 20 TCTAGTCtTCCtTGCAGGACGTCtACAGCTAGCCCGCtGCTCGAGATCTGCG <br><br> HRE <br><br> ATCTGCATCTCAATTAGTC AGCAACCATAGTCCCGCC.CCT A A CTCCGCC <br><br> SP 1 SP 1 <br><br> CATCCCGCCCCTAACTC.CGCCCAGTTCCGCCCATTCTCCGCCCCATCG 25 (SP 1) SP 1 SP 1 SP 1 <br><br> CTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTG <br><br> start start <br><br> The promoter sequence defined as OBHRE is present m the plasmid OB37 that is 30 described m Figure 2. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> OBHRE 1 is a novel promoter <br><br> 70 <br><br> PCT/GB98/02885 <br><br> The HRE also functions in combination with the promoter elements m retroviral LTRs for example as shown below the MLV LTR. <br><br> 5 <br><br> PGK derived enhancer sequences in the context of the MLV retroviral promoter <br><br> PGK tnmer m context of MLV retroviral promoter, forward (natural) orientation This is identical to OB HRE with the sequences placed upstream of the Moloney MLV retroviral 10 promoter instead of SV40 Sequence shown up to transcription start. <br><br> AGCTAGCCTAGCGTCGTGCAGGACGTGACATCTAGTGTCGTGCAGGACGTGAC ATCTAGTGTCGTGCAGGACGTGACATCTAGAGAACCATCAGATGTTTCCAGGG TGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTC 15 GCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCA CAACCCCTCACTCGG <br><br> PGK trimer m context of MLV retroviral promoter, reverse orientation. Sequence shown up to transcnption start <br><br> 20 <br><br> AAGCTAGCTGTCACGTCCTGCACGACACTAGATGTCACGTCCTGCACGACACT AGATGTCACGTCCTGCACGACTCTAGAGAACCATCAGATGTTTCCAGGGTGCC CCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTT CT CGCTT CT GTT CGCGCGCTT CTGCTCCCCG AGCT C AATAAAAGAGCCC AC AAC 25 CCCTCACTCGG <br><br> The HREs can function in either orientation with respect to the promoter element. <br><br> OBHRE in combination with the MLV promoter <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 71 <br><br> A senes of vectors were constructed to analyse the activity of the HRE linked to the MoMLV promoter in a transient assay. The HRE and MoMLV promoter were removed from pLNheHRE as an Nhel-Smal fragment and inserted into the MCS of pGL3 basic (Promega) to produce pGLHRE and pGLMUT. PGL3 promoter and pGL3 control 5 (Promega) were used as negative and positive controls respectively. <br><br> The vectors p5'HRE3'MUT, p5'MUT3'HRE, p5'MUT3'MUT and p5'HRE3'HRE were constructed by digesting pHRE and pMUT with Sacl and ligatmg the resulting retroviral genome with linearised pLNheHRE cut with the same enzyme <br><br> 10 <br><br> The data shown (FIG3) clearly demonstrates that both 5' and 3' HRE are involved m transcriptional regulation and furthermore there is true synergy between the two These data show that the optimum configuration of a hypoxia regulated vector is one where there is a duplication of the HRE in the 5'and 3' LTRs. This has lead us to design a regulated 15 single transcription unit lentiviral vectors (see later). <br><br> It is important to note that these data can be extrapolated to other non HRE enhancer systems where a similar synergy can be envisaged <br><br> I <br><br> 20 By way of further example other promoters have also been constructed for use m the invention as shown m Figure 4a. <br><br> The relative strengths of these promoters are shown m Fig 4b All these sequences confer on the minimal SV40 promoter hypoxia induced expression However what is clear is the 25 different induction ratios and the scale of expression under hypoxia. <br><br> Any of these promoter configurations can be used in the invention and the choice is dictated by the therapeutic gene For example a highly toxic cytokine such as TNF-alpha would benefit from the use of the simple enolase promoter, as basal levels are undetectable 30 in normoxia so guaranteeing that there is no inappropriate expression A less toxic protein such as human cytochrome P450 that is needed in high levels would benefit from using <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 72 <br><br> OBHRE 1 where the maximum levels of expression are very high but the basal levels are detectable. <br><br> These promoters descnbed above all contain DNA sequence motifs for the classical HRE 5 binding transcnption factor, HLF 1. This is a heterodimer consisting of HIF la and KEF lb, a member of the basic helix-loop-helix (bHLH)/PAS domain protein family (from the founding members of this gene family; Penod, ARNT, and SIM). HEF la was ongmally identified as a protein binding to the HRE of the erythropopietin gene in hepatoma cells (Wang et al 1995, J Biol Chem 270, 1230) but has since been implicated in the regulation 10 of an expanding family of genes that are regulated by hypoxia in most cell types. Database searching of expressed cDNA sequences have identified a further bHLH/PAS family member that is closely related to HIF 1, termed EPAS-1 (endothelial PAS domain protein) or HRF (HEF-related factor) (Ema et al 1997, Proc Natl Acad Sci USA 94, 4273; Flamme et al 1997, Mech Dev 63, 51, Tian et al 1997, Genes Dev 11, 72). Unlike HIF 1, EPAS-1 15 is expressed predominantly m endothelial cells and its expression appears to be significantly regulated dunng development. As predicted from the conservation of the DNA binding domain of the two proteins, EPAS -1 appears to bind to the same consensus sequence (defined as the HRE) as HIF-1 Published data have however indicated that EPAS expression is restncted to endothelial cells. We now show (Figure 5) that, 20 surpnsmgly, m macrophages it is not possible to detect the HIF-1 protem even under normoxia and yet the OBHRE promoter (PGK) is activated in these cells when they are placed m hypoxic conditions (Figure 6). We have analysed macrophages under the two conditions using antibodies that are specific for HIF-1 and EPAS We could not detect HIF-1 in macrophages but we could detect EPAS. This is the first time that EPAS has been 25 found outside of epithelial cells. Thus the induction of OB HRE 1 in macrophages is either principally or entirely mediated by EPAS-1 and as such represents an EPAS responsive enhancer. <br><br> It follows from these observations that there may be many factors, known or not yet 30 discovered that mediate a transcnptional response under ischaemic conditions. Any piece <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 73 <br><br> of DNA that is operationally responsive to such conditions irrespective of the factors involved is useful for the present invention. <br><br> Other conditions that are a consequence of ischaemia, such as low acidity or low glucose 5 levels, can also be used to specifically activate genes. For example a promoter from the human grp78 gene may be isolated by PCR amplification from human genomic DNA and includes the complete promoter-enhancer sequence and 5'UTR of the grp78 gene. This is described m Chuck et al 1992, Nucleic Acids Res 20, 6481 The cloned fragment of 579 bp described in that paper corresponds to bases 6-585 The primers used m the 10 amplification reaction incorporate an Asel site at the 5' end and a Xhol site at the 3' end. The grp78 promoter fragment is then cloned into these sites present in a Clontech pEGFP-N1 vector allowing expression of a beta-ga//GFP fusion protein from this promoter <br><br> Example 2. Construction of tissue restricted ischaemia responsive promoters <br><br> 15 <br><br> An alternative gene expression configuration confines the expression to cells that have differentiated into the granulocyte-monocyte lineage. Using promoters that are specific to, or upregulated in, the monocyte/macrophage lineage will restrict therapeutic gene expression to these cell types Suitable promoters for this purpose include those with 20 consensus sequences that bind myeloid specific transcnption factors such as PU1 or transcription factors that are up-regulated dunng differentiation into macrophages such as CEBP-P (NFIL 6) (See Clarke and Gordon 1998, J Leukoc Biol 63, 153). <br><br> These promoter elements can be isolated or synthesised by standard procedures By way of 25 example the isolation of two macrophage specific promoters denved from a cellular gene, and a viral gene is described The HRE elements can be combined with any of these promoters. This is shown by way of example with the HIV derived promoter to produce a synthetic promoter referred to as XiaMac. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 74 <br><br> a) Cellular promoter <br><br> An oligonucleotide was synthesised in two parts based on tissue specific control elements residing in the M CSF receptor promoter (Zhang et al 1994, Mol Cell Biol 14, 8085) 5 flanked with a HindUUNcol site for cloning into pGL3 basic vector (Promega) and subsequent analysis in luciferase reporter assays. Sites of transcnption factor binding are shown underneath <br><br> AGr,TTr,CTGrf.CCAGACTGr.GACCr.CTf.f,rTf,lTGGGTTCAAGGCTTrGTTTTC.TT 10 SPl <br><br> CTTAAAGACCCAAGATTTCCAAACTCTGTGGTTGCCTTGCCTAGCTAAAAGGGGAA <br><br> CEBP? PEBP2/CBF PU. 1 <br><br> GAAGAGGATCAGCCCAAGGAGGAC <br><br> b) HIV promoter <br><br> 15 <br><br> The transcnption control sequences of HIV reside in the LTR, this generally consists of two NFkB sites and three SPl sites upstream of the ATATAA box (Koong et al 1994, Cancer Res 54, 1425) <br><br> 20 An Entrez database nucleotide search was performed for HIV LTR sequences and these were analysed for the mtegnty of the motifs outlined above. Submission U63538 (Zacharova et al 1997, AIDS Res Hum Retroviruses 13, 719) describes an isolate that shows the well conserved motifs of two NFkB sites and three SPl sites. However we observed that this particular isolate also had the consensus sequence for binding of NF-IL6 25 (C/EBPp). As discussed above this transcription factor is known to be active in macrophages <br><br> Oligonucleotides were synthesised m two parts to generate the sequence from Accession No U63538 positions 279 - 447 These were synthesised with Nhel/Smal ends to 30 facilitate cloning The annealed and ligated oligonucleotide was cloned into OB37 <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 75 <br><br> The final construction is shown m Figure 7. <br><br> We have therefore constructed a novel synthetic promoter (XiaMac) that combines the 'classical' HRE mediated response with tissue specificity (macrophage) As shown in 5 Figure 8 when the XiaMac promoter was tested in non-macrophage cells such as breast cancer cells there was no activity at all. However if the cells were subjected to hypoxia then activation was observed. In contrast the promoter was active in macrophage cell line and the activity was boosted by hypoxia. The XiaMAc promoter response to hypoxia is abolished if the HRE is inactivated (Figure 9). <br><br> 10 <br><br> Example 3. Construction of a macrophage specific promoter restricted by repression. <br><br> An alternative promoter configuration is where sequences are added to further restrict the expression to macrophages under defined conditions. <br><br> 15 <br><br> An example of this approach would be the ERF system (Taniguchi et al 1995, J Cancer Res Clin Oncol 121, 516; Kuhl et al 1987, Cell 50, 1057). In this situation an interferon response element (IRE) can bind the transcnption factors IRF1 and IRF 2. IRF 2 is constitutively bound to this in macrophages and lacks the ability to activate transcnption 20 Interferon activates IRF 1 expression that can then compete for binding with IRF 2 The ability of IRF 1 to activate transcription thereby reverses IRF 2 repression IRF 1 also induces IRF 2 gene expression thereby limiting activation of transcription by 'auto shut off. Inclusion of a tetramer of the IRE can block SV40 promoter function m the absence of IRF 1 activation. Inclusion of this tetramenc sequence downstream of the HRE 5' to 25 the ATATAA (i.e. the TATA box like element m the SV40 promoter) confers repression m the absence of activation by interferon <br><br> Interferon gamma is naturally present in inflammatory responses including the response to tumours. Alternatively interferon gamma can be provided exogenously as a protein or as a 30 gene and delivered as a gene therapy. In a particular aspect of the invention an autocnne regulatory circuit can provide interferon gamma. In this case a simple HRE promoter such <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 76 <br><br> as OBHRE is linked to interferon gamma coding sequence A second gene, for example a pro-drug activating enzyme or any from the above list is linked to the XiaMac promoter that contains an IRF-1 responsive sequence The promoter is inactive m all cells including macrophages. Upon exposure to hypoxia in the pathological condition then interferon 5 gamma is expressed. The expression of the therapeutic gene is then activated by the macrophage specific factors and the hypoxia responsive factors This two phase strategy can be applied to any repressor protein. An over view of this strategy is shown in Figure 10. <br><br> 10 The IRE is cloned into the XiaMAc promoter as follows:- <br><br> Oligonucleotides are designed consisting of a tetramer of the IRE site as follows with Banll sticky ends. <br><br> 15 C(AAGTGA)4GAGCC <br><br> Within the XiaMac promoter there is a Banll site which is 3' to the last SPl site and 15 bp upstream of the TATAA Insertion of the IRE elements at this site produces a repressed promoter (XiaMac-IRE) that can only become active in the presence of interferon and 20 hypoxia This is shown m Figure 11 <br><br> Example 4. Construction of Endothelium specific promoters <br><br> The invention is not restncted to the generation of the macrophage lineage from HSC. For 25 example the inclusion of an endothelium specific promoter restncts the expression of the therapeutic gene to vascular endothelium In particular the correct choice of promoter can restrict expression to the neo-vasculature that is specific to tumours For example Jaggar et al (1997, Hum Gene Ther 8 2239) have descnbed the use of the e-selectin and KDR promoters to express therapeutic genes from retroviral vectors specifically in endothelial 30 cells. We now show that these promoters can be configured into retroviral/lentiviral vectors and furthermore they can be additionally regulated by hypoxia. Configurations are shown <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 77 <br><br> m Figure 12. These ILRE regulated endothelium specific promoters are particularly useful for the delivery of anti-angiogenic factors to tumour vasculature The construction of lentiviral vectors is outlined m more detail m Example 6 <br><br> 5 It follows that any promoter that restricts the expression to particular lineage denved from HSC can be used m combination with an ischaemia-hke response element. <br><br> Example 5. Construction of ILRE regulated retroviral vectors <br><br> 10 RRVs are constructed using a packaging cell line system such as FLYRD18 (Cosset et al 1995, J Virol 69, 7430) A plasmid vector containing the vector genome to be packaged is transfected into the packaging cell line as describe (Cosset et al 1995, J Virol 69, 7430) to derive the producer cell line A suitable plasmid contaimng vector genome is pHITl 11 (Soneoka et al 1995, Nucl Acids Res 23, 628). The required NOI is inserted m place of the 15 LacZ gene m pHITl 11 using standard molecular biology techniques. Regulatory elements such as HREs or a promoter-enhancer from the grp78 gene may similarly be introduced into the retroviral LTR in pHITl 11 in place of the retroviral enhancer to ensure regulated expression of the NOI. The plasmid is then co-transfected with a selectable marker NOI appropnate for FLYRD18 cells (eg pSV2neo) and transfected cells are selected in 1 20 mg/ml G418 (Sigma) <br><br> A suitable HRE-contammg enhancer (Fig 13) consists of three copies of the HRE from the PGK gene (Firth et al 1994, Proc Natl Acad Sci USA 91, 6496). Figure 13 also shows the sequence of a mutant HRE-contaimng sequence to be used as a control which is not 25 regulated by hypoxia. The synthetic oligonucleotides shown m Figure 13 are inserted between the Nhel and Xbal sites in the 3'LTR of pHITlll to generate a retroviral vector m which gene expression m the target cell is under hypoxia control An alternative retroviral vector, constructed in the same way, is pKAHRE shown in Figure 14 <br><br> 30 Another configuration constructed according to the pnncipals outlined above is found m Xia-Gen-P450-G (Figure 15a) This vector contains a therapeutic gene for human <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 78 <br><br> cytochrome P450 which activates the anti-cancer compound cyclophosphamide The CYP2B6 gene was obtained by PCR amplification from human hepatocyte derived mRNA. The correct gene sequence was confirmed by comparison to the established sequence (Yamano et al 1989 GenBank Accession No M29874) Any other therapeutic gene as 5 recited above could be used The RW also contains a reporter gene that is green fluorescent protein and a selectable gene that is the neomycin resistance gene The hypoxia mediated induction of this vector is shown by way of example m human tumour cells (Figure 15b) <br><br> 10 Example 6. Construction of hypoxia regulated lentiviral vectors <br><br> At present the state of the art in stem cell isolation and manipulation descnbes the preparation of cells that are probably dividing. It is generally accepted that the true stem cell which has the potential to develop mto all lineages (toti-potent) is not dividing. <br><br> 15 Retroviral vectors will therefore miss these cells from a population of pluropotent CD34+ve cells Lentiviral vectors offer significant advantages to conventional MLV based retroviral vectors because they can transfer genes to non-dividing and slowly dividing cells. <br><br> 20 The hypoxia responsive promoter has been configured into a lentiviral vector, pEGASUS (Fig 16a) and the related vector pONY2 1 (Fig 16b) Both are denved from infectious proviral EIAV clone pSPEIAV19 (Payne et al 1998, J Virol 72, 483). The construction strategy is shown in the Figure 16 senes. The CMV promoter in pONY 2.1 was excised as Xbal/Asc 1 fragment and replaced with an oligonucleotide containing a Mlul/Xba 1 site <br><br> 25 This consequently allows insertion of the Mlu/Xba fragment isolated from OB37 (Figure 2) creating pONY HRE luc/lac (Fig 16c) Luciferase coding sequence was removed as an Neo 1 fragment and the backbone religated creating pONY HRE lac. Similarly, lacZ was removed as Xba 1/ Sail then backbone religated to create pONY HRE luc. In the advanced EIAV vector plasmid pEGASUS the CMV promoter lacZ cassette was excised <br><br> 30 with EcoRl and replaced with a synthetic oligonucleotide contaimng a SacII and a Bsu36 site This allows the cloning of the HRE luc/HRE lac cassette from pONY 2.1 as <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 79 <br><br> Sacl/Bsu36 and Sacl/EcoRl fragments respectively The final vectors are designated pEG-HRE-lacZ (shown m Fig 16d), pEG-HRE-luc. Using the same approach pEGHRE vectors are constructed to express therapeutic genes in place of the lacZ or Luc genes. <br><br> 5 Any of the therapeutic genes listed above are suitable By way of example pEGHRE-TSPl is shown. This expresses the anti-angiogemc factor thrombospondm-1. This is shown in Figure 17 in two typical configurations A) is a silent LTR for use in cells where the EIAV LTR is largely inert B) is a typical SIN (self-inactivatmg) vector where the U3 sequence is removed. <br><br> 10 Viral particles with the pEGHRE genome are produced in a transient three plasmid system (Soneoka et al 1995, Nucl Acids Res 23, 628) Virus is titred on D17 cells on parallel plates and the plates are incubated overnight in normoxia (21% oxygen) or hypoxia (0 1% oxygen) Cells are stained by X gal histochemistry and end point titres calculated (see Figure 18). Titre is a measure of b-galactosidase gene expression and reflects changes m 15 gene expression between cell populations under conditions of normoxia and hypoxia. <br><br> In the experiment shown the titre obtained from the parent 'pEGASUS' vector (with a CMV lacZ transcriptional unit) does not change significantly under hypoxia, whereas the regulated vector, pEG-HRE-lacZ, titre is induced by at least 100 fold. These data indicate 20 for the first time that it is possible to obtain highly efficient regulation in the context of a lentiviral vector <br><br> Hypoxic regulation was also assessed with the luciferase reporter gene. This data reflects changes in promoter activity of cells withm the population. Vector particles were produced 25 as outlined above and used to transduce D17 cells. The transduced cell population was split and incubated overnight in normoxia and hypoxia. Cells were processed for luciferase assay and luminometry Luciferase activity of cells transduced with pEG-HRE-luc increases 12 fold under hypoxic conditions (Figure 19). <br><br> 30 An alternative EIAV vector for use in this invention is where the therapeutic gene and a marker gene are expressed from a single transcnption unit. Single transcnption unit vectors <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 80 <br><br> are generally preferred over SIN vectors and vectors containing internal transcription unit because of advantages in vector production. These advantages are that the SIN vector must be introdiced into a producer cell by transfection rather than transduction and this often reduces the number of high efficiency producer clones that can be obtained It is also 5 observed that vectors that contain internal transcription units generally give lower yields than single transcription unit vectors. Furthermore as we describe above the duplication of the HRE that can be achieved m a single transcnption unit vector optimises the regulation A single transcnption unit lentiviral vector regulated by hypoxia vector is described below.- <br><br> .0 <br><br> In this case the lacZ was isolated as a Xho 1-Sphl fragment and cloned into pSP72 to make pSPLacZ. The IRES was generated by PCR from pIRES-lhyg (Clontech) to incorporate flanking restriction sites to enable subsequent cloning; <br><br> 15 ST1 (lead) <br><br> ATCGCTCGAGCTGCAGGGCCGCACTAGAGGAATTCGC <br><br> ST2 (complement) <br><br> GGTTGTGGC CC ATGGT ATC ATCGTGTTTTT C AAAGG 20 This results in a Xhol IRES Ncol cassette. This cassette is then cloned into pSPlacZ upstream of lacZ such that the Ncol site coincides with the ATG initiator of lacZ, pSPIRESlacZ). The IRES lacZ cassette was isolated as a Pstl/Bstl 107 fragment and used to replace the CMV lacZ cassette of pElPEGASUS+ (excised as sse8387/Bstll07 fragment) This plasmid was designated pEG4+ IRES Z. <br><br> 25 <br><br> An overlapping PCR approach was used to replace part of the EIAV U3 enhancer region in the 3'LTR with an HRE. A similar vector can be constructed where the U3 region is largely denved from any retrovirus or lentivirus or and other hybrid promoter such as those described above. The only limitations are that the terminal nucleotides of the parental 30 vector are retained to ensure compatability with the lentiviral mtegrase and that the two R regions are hmologous to allow efficient reverse transcnption. A typical configuration for <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 81 <br><br> such a hybrid LTR is descnbed m detail in PCT GB96/01230 and PCT/GB97/02858. The final configuration of this vector is shown m Figure 20. <br><br> Viral particles with the pEGHRE genome are produced either in a transient three plasmid 5 system as described by Soneoka et al 1995, Nucl Acids Res 23, 628. Alternatively the vector can be introduced into a packaging cell line to make a stable producer cells Suitable packaging lines that express the VSV-G envelope have been descnbed [Yee et al. (1994 Proc. Natl Acad. Sci USA 91 9564-9568; Ory et al (1996 Proc Natl. Acad Sci. USA 93.11400-11406(Yang et al (1995 Human Gene Therapy 6T203-1213) Chen et al (1996 10 Proc Natl Acad Sci USA 93 10057-10062 Lefkowitz et al, 1990, Virology 178;373-383). <br><br> Arai et al (1998 J. Virol. 72 1115-1121))) <br><br> Virus is titred on suitable indicator cells such as the dog cell line D17 cells on parallel 15 plates and the plates are incubated overnight in normoxia (21% oxygen) or hypoxia (0.1% oxygen). Cells are stained by X gal histochemistry and end point titres calculated (see Figure 18) Titre is a measure of B-galactosidase gene expression and reflects changes in gene expression between cell populations under conditions of normoxia and hypoxia <br><br> 20 In the expenment shown the titre obtained from the parent pEGASUS vector (with a CMV lacZ transcnptional unit) does not change significantly under hypoxia, whereas the regulated vector, pEG-HRE-lacZ, titre is induced by at least 100 fold These data mdicate for the first time that it is possible to obtain highly efficient regulation m the context of a lentiviral vector <br><br> 25 <br><br> Hypoxic regulation was also assessed with the luciferase reporter gene. This data reflects changes in promoter activity of cells within the population. Vector particles were produced as outlined above and used to transduce D17 cells. The transduced cell population was split and incubated overnight in normoxia and hypoxia Cells were processed for luciferase 30 assay and lummometry. Luciferase activity of cells transduced with pEG-HRE-luc increases about 12 fold under hypoxic conditions (Figure 19) <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 82 <br><br> Construction of an autoregulated hypoxia responsive Ienti-viral vector <br><br> It has previously been shown that the over expression of HIF-1 alpha can increase the 5 expression from a number of hypoxia regulated promoters (Semenza et al JBC 1996.) This protein is known to be unstable m normal cells but this can be bypassed by over expression Such over expression would therefore compromise the specificity of the hypoxia response. The discovery that the OBHRE promoter is responsive to E-PAS opens up a new route to amplifying the response to hypoxia. To avoid the problem of 10 constitutive expression of HIF-1 we have configured the E-PAS gene into a lenti-viral vector that is itself responsive to hypoxia In this way the vector is activated by hypoxia to express the E-PAS gene and the E-PAS protein then acts further on the HRE to augment expression Given that HIF-1 is known to be labile once oxygen levels return to normal this vector system has the advantage of providing a longer term response to hypoxia. The initial 15 priming of the vector is specific by virtue of the HRE interacting with HEF-1 or E-PAS The production of E-PAS maintains the expression after the initial hypoxia stimulus is finished. Ultimately the response will decay according to the half life of the E-PAS protein. <br><br> The auto-regulated vector that expresses TSP-1 is shown m Figure 20b The E-PAS 20 coding sequence is obtained by PCR amplification using primers according to the known sequence of the cDNA (Accession number U81984; Trian et al 1997, Gene Dev. 11, 72.) <br><br> Example 7. Construction of a hypoxia responsive adenoviral vector for the 25 expression of a therapeutic gene. <br><br> When stem cells migrate to target tissue then they are still capable of delivering a therapy without division and differentiation, although such division is likely to occur at some stage In this case vectors such as adenoviruses can be used. Such vectors do not integrate their 30 genes into the cell genome and hence as the cell divides the vector is gradually lost from the cell population However significant vector is still present m cells following <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 83 <br><br> differentiation into various lineages. CD34+ stem cells are transduced with recombinant adenoviral vectors according to a variety of methods. (Neering et al 1996 Blood 88, 1147; Watanabe et al 1996, Blood 87, 5032, Watanabe et al 1998, Leukaemia and Lymphoma 29, 439, Bregni et al 1998, Gene Ther 5, 465; Frey et al 1998, Blood 91, 2781) <br><br> 5 <br><br> A first generation recombinant adenoviral vector (E1/E3 deleted) has been constructed such that the bacterial (3-galactosidase reporter gene is under the control of a hypoxically regulated promoter <br><br> 10 The first generation adenovirus vectors consist of a deletion of the El and E3 regions of the virus allowing insertion of foreign DNA, usually into the left arm of the virus adjacent to the left Inverted Terminal Repeat (ITR) The viral packaging signal (194-358nt) overlaps with the Ela enhancer and hence is present m most El deleted vectors. This sequence can be translocated to the nght end of the viral genome (Heanng and Shenk 1983, Cell 33, 15 695) Therefore, m an El deleted vector 3 2 kb can be deleted (358-3525nt). <br><br> Adenovirus is able to package 105% length of the genome, thus allowing for addition of an extra 2. lkb Therefore, in an E1/E3 deleted viral vector the cloning capacity becomes 7-8 kb (2.1 kb +1.9 kb (removal of E3) and 3.2 kb (removal of El) Since the recombinant 20 adenovirus lacks the essential El early gene it is unable to replicate m non-El complementing cell lines. The 293 cell line was developed by Graham et al (1977, J Gen Virol 36, 59) and contains approximately 4 kb from the left end of the Ad5 genome including the ITR, packaging signal, Ela, Elb and pIX. The cells stably express Ela and Elb gene products, but not the late protein IX, even though pIX sequences are within Elb 25 In non-complementing cells the El deleted virus transduces the cell and is transported to the nucleus but there is no expression from the El deleted genome. <br><br> The diagram m Figure 21 shows the general strategy used to create recombinant adenoviruses using the Microbix Biosystems - NBL Gene Sciences system <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 84 <br><br> The general strategy involves cloning the foreign DNA into an El shuttle vector, where the El region from 402-3328 bp is replaced by the foreign DNA cassette. The recombmant plasmid is then co-transfected into 293 cells with the pJM17 plasmid. pJM17 contains a deletion of the E3 region and an insertion of the prokaryotic pBRX vector (including the 5 ampicilhn resistance and bactenal ori sequences) into the El region at 3 7 map units. This 40 kb plasmid is therefore too large to be packaged into adeno nucleocapsids but can be propagated m bacteria. Intracellular recombination m 293 cells results in replacement of the ampr and ori sequences with the insert of foreign DNA <br><br> 10 In the examples quoted herein two transfer vectors have been used The first obtained from Microbix is called pElsplA and the second obtained from Quantum Biotechnologies is called pADBN The pADBN plasmid has the advantage that the new (foreign) DNA can be inserted in either orientation. This places the insert in a different spatial relationship with the resident adenoviral genes which can m some cases adversely affect expression. In 15 both cases the second DNA is a defective version of the adenoviral genome, either as a plasmid for example pJM17 or as a part of the viral DNA for example the so-called right arm of Ad5. Homologous recombination generates the final gene transfer vector. <br><br> The construction of the ischaemia regulated adenoviral vector is descnbed below. <br><br> 20 <br><br> The luciferase gene m OB37 (Figure 2) was replaced by the bacterial b-galactosidase encoding gene via an Neo l-Xba I fragment swap from the pONY2 1 vector (Figure 16b) <br><br> The resulting OB HRE LacZ cassette was removed from the OB 3 7 vector as a Kpnl-SaR 25 fragment and cloned into the Quantum Biotechnologies™ pAdBN transfer vector producing AdenoOBHRElacZ. <br><br> The recombmant AdenoOBHRElacZ transfer vector was lineansed (Ase I) and co-transfected into 293 cells along with the punfied nght arm of the Ad5 virus (from the Cla I site) to allow m vivo homologous recombination to occur resulting m the formation of the 30 desired recombmant adenovirus. This is outlined in Figure 22. Adenoviral vectors <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 85 <br><br> containing the HRE are referred to as AdHRE followed by the inserted gene, for example AdHRE-lacZ has the bacterial p-galactosidase gene expressed by the OBHRE promoter. <br><br> A range of different cell lines have been transduced with AdHRE-LacZ After a 6 hour 5 transduction the virus is removed and replaced with fresh medium and the cells are split into two separate plates for overnight incubation in either normoxia or hypoxia (0.1% oxygen). The results (Figure 23) demonstrate the hypoxic mducibility of the LacZ reporter gene within the adenoviral vector in Chiang Liver and the MCF-7 human breast cancer cell line. <br><br> 10 <br><br> In addition, 7-14 day old pnmary human macrophages have similarly been transduced with AdHRE-LacZ. This result not only demonstrates the transducibility but also the utility of using a HRE regulated recombmant adenovirus m cells in the haematopoietic lineage. <br><br> 15 The inserted DNA construct present in the adenoviral transfer vector is in the form of an autonomous expression cassette contaimng the OBHRE promoter, the LacZ coding sequence and the SV40 polyadenylation signal (splice sites can also be included if necessary) In the system descnbed for the construction of AdHRE (Quantum Biotech) we observed that a high level of protein expression was obtained if the expression cassette was 20 directed in the onentation of the El genes. <br><br> Alternative hypoxia response elements may also be used as described earlier. <br><br> The HREs may be present m multiple copies both 5' and 3' to the gene to further mcrease 25 the level of hypoxic induction. <br><br> In addition, the HRE could be combined with tissue specific promoter elements to restnct expression to specific tissue types or diseased tissue. For example, the OBHRE could be used in combination with the XiaMac promoters to regulate/increase expression 30 specifically m macrophages <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 86 <br><br> AdHRE vectors have been configured to contain therapeutic genes. <br><br> An example is descnbed below for the construction of AdHRE-2B6 and AdCMV-2B6 recombinant adenoviral vectors using the Microbix Biosystems construction system. 5 Plasmids are shown m Figure 24 and they are as follows pElHREPG - The transfer vector engineered to contain the HRE driven 2B6 expression casssette <br><br> 10 Using the Elspl A transfer plasmid from Microbix the transfer vector PElHREPG <br><br> The EMCV IRES GFP Xbal fragment from pCPGHRE is cloned into the Xbal site 3' to the 2B6 coding sequence m the pGL30BHRElp450 vector The complete expression cassette is cloned into the Microbix transfer vector pAElsplB as Mlul-PshAl fragment to 15 give pElHREPG (Figure 25b) <br><br> pElCMVPG - The transfer vector engineered to contain the CMV driven 2B6 expression cassette (Figure 25c) <br><br> 20 The Bglll-Nael CMV2B6 fragment from pCI-2B6 is cloned mto the BamHl-EcoRV site of pAElsplB The EMCV IRES GFP Xbal fragment from pCPGHRE is cloned mto the Xbal site 3' to the 2b6 coding sequence m the resulting plasmid to create pElCMVPG (Figure 25c). <br><br> Note: The use of the ires GFP reporter allows easier plaque punfication of the recombmant 25 adenovirus and provides viable cell marker for studying gene expression dunng different physiological conditions <br><br> Any of the therapeutic genes outlined above can be inserted into the hypoxia regulated adenoviral vectors. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 87 <br><br> Example 8. Construction of Adenoviral vectors to deliver lentiviral components <br><br> In a particular aspect of the invention adenoviral vectors that contain the components that are required to make a retroviral or a lentiviral vector are used to transduce CD34+ve stem cells The stem cell that has been transduced with the adenoviral vector therefore secretes the retroviral/lentiviral vector The adenoviral vector m the CD34 cells therefore acts as an in situ retroviral factory as descnbed previously [PCTGB97/00210] The adenoviral vector can be configured in several ways. Firstly the expression of one or all of the retroviral/lentiviral vector components can be placed m a HRE regulated adenoviral vector as descnbed above. Alternatively the vector components can be placed under a constitutive promoter such as the CMV promoter or a lineage specific promoter such as the e-selectin promoter or the macrophage specific promoter descnbed above or a regulated promoter such as the tetracycline regulated system (Gosten and Bujard 1992 Proc Natl Acad Sci 89. 5547-5551) or any other regulated promoter/enhancer. In this latter case specificity is conferred by making the expression of the therapeutic gene from the retroviral/lentiviral vector regulated by hypoxia as described above. By way of example the production of an adenoviral vector that can produce a lentiviral vector is now descnbed <br><br> In order to produce lentiviral vectors four adenovirus vectors need to be made genome, gagpol, envelope (for example rabies G) and Rev The lentiviral components are expressed from heterologous promoters they contain mtrons where needed (for high expression of gagpol, Rev and Rabies envelope) and a polyadenylation signal When these four viruses are transduced into Ela minus cells the adenoviral components will not be expressed but the heterologous promoters will allow the expression of the lentiviral components. An example is outlined below of the construction of an EIAV adenoviral system (Application number 972135.7). The EIAV is based on a minimal system that is one lacking any of the non-essential EIAV encoded proteins (S2, Tat or envelope). The envelope used to pseudotype the EIAV is the rabies envelope (G protein). This has been shown to pseudotype EIAV well (Application number 9811152 9). <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 88 <br><br> Transfer Plasmids <br><br> Described below is the construction of the transfer plasmids containing the EIAV 5 components The transfer plasmid is pElsplA (Figure 25a). <br><br> The recombinant transfer plasmids can then be used to make recombmant adenoviruses by homologous recombination in 293 cells. <br><br> 10 A pictorial representation of the following plasmids is attached <br><br> A) pElRevE. This provides the Rev protein required for the efficient expression of gag and pol <br><br> 15 The plasmid pCI-Rev is cut with Apa LI and Cla I. The 2.3 kb band encoding EIAV Rev is blunt ended with Klenow polymerase and inserted into the Eco RV site of pElsplA to give plasmid pElRevE (Figure 26) <br><br> B) pElHORSE3.1-gagpol Construct <br><br> 20 <br><br> pHORSE3.1 was cut with Sna BI and Not I The 6.1 kb band encoding EIAV gagpol was inserted into pElRevE cut with Sna BI and Not I (7.5 kb band was purified). This gives plasmid pElHORSE3 1 (Figure 27) <br><br> 25 C) pElPEGASUS-Genome Construct pEGASUS4 was cut with Bgl II and Not I The 6.8 kb band containing the EIAV vector genome was inserted into pElRevE cut with Bgl II and Not I (6.7 kb band was purified) This gave plasmid pElPEGASUS (Figure 28) <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 89 <br><br> D) pCI-Rab - Rabies Construct <br><br> In order to make the pElRab the rabies open reading frame was inserted into pCI-Neo 5 (Figure 29) by cutting plasmid pSA91RbG with Nsi I and Ahd I. The 1.25 kb band was bluntended with T4 DNa polymerase and inserted into pCI-Neo cut with Sma I. This gave plasmid pCI-Rab (Figure 30) <br><br> E) pElRab - Rabies Construct <br><br> 10 <br><br> pCI-Rab was cut with Sna BI and Not I. The 1 9kb band encoding Rabies envelope was inserted mto pElRevE cut with Sna BI and Not I (7.5 kb band was purified). This gave plasmid pElRab (Figure 31) <br><br> 15 Any therapeutic gene or combination of genes can be inserted into the lentiviral vector as described above <br><br> Example 9. Engineering stem cells to express a prodrug activating enzyme in response to hypoxia. <br><br> 20 <br><br> The retroviral vector, XiaGen-P450-G or the lentiviral vector pSec-TSpl is used to transduce any cell type. As an example, we use human haematopoietic stem cells, human penpheral blood buffy coat and human cord blood Procedures for isolation of CD34+ HSCs and retroviral mediated gene transfer into these cells are described (such as Charbord 25 et al 1996, Br J Haematol 94,449; Dunbar et al 1996, Hum Gene Ther 7, 231, Cassel et al 1993, Exp Haematol 21, 585, Emmons et al 1997, Blood 89, 4040; Jolly et al 1996 WO 96/33281, Kerr et al W096/09400) An example of a suitable method is as follows <br><br> HSCs are harvested from penpheral blood after mobilisation with G-CSF and/or 30 cyclophosphamide (Casset et al 1993, Exp Haematol 21, 585) G-CSF (Amgen) is given at a dose of 10 p.g/kg/day sub-cutaneously for 7 days. Apheresis and enrichment of HSCs is <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 90 <br><br> earned out using the CellPro Stem Cell Separator system (Cassel et al 1993, Exp Haematol 21, 585). The HSC-ennched population is cultured at 105 cells/ml m spent medium from RRV producer cells (Example 1) m the presence of 4 pg/ml protamine sulphate and 20 ng/ml IL-3 (Sandoz), 50 ng/ml IL-6 (Sandoz), 100 ng/ml SCF (Amgen) (Santiago-5 Schwartz et al 1992, J Leuk Biol 52, 274; Charbord et al 1996, Br J Haematol 94,449, Dao et al 1997, Blood 89, 446, Piacibello et al 1997, Blood 89, 2644; Cassel et al 1993, Exp Haematol 21, 585) Other cytokines and/or autologous stromal cells prepared as descnbed (Dunbar et al 1996, Hum Gene Ther 7, 231) may also be added. After 24 hours the cells are centnfuged and resuspended in fresh RRV-containing medium with growth factors and 10 protamine sulphate as above This is repeated after a further 24 hours and the cells cultured for up to a further 48 hours. After this time the cells are trypsmised, washed several times in fresh medium by centrifugation and resuspended in Plasma-Lyte A for re-infusion. The total volume for re-infusion is approximately 25 - 50ml Patients are infused over a penod of up to two hours. The number of cells infused is at least 105 cells and may be up to the 15 order of 1012 cells. <br><br> Cells may also be matured along the myeloid differentiation pathway pnor to re-infusion according to published methods (Haylock et al 1992, Blood 80, 1405). <br><br> 20 Transduction is as follows as descnbed for retroviral vectors but the same methods are used for lentiviral vectors.- <br><br> Gene transfer with retroviral or lentiviral vectors has been enhanced by optimising culture conditions of isolated CD34 cells such that they are cycling at the time of transduction. 25 This is particularly necessary with MLV based vectors that require cell division to enable nuclear access and integration. Pseudotyping MLV vectors with different envelopes has also had a major impact on gene transfer. As reported m the literature GALV is markedly better than VSVG <br><br> 30 We have used a defined medium containing to ensure that cells are cycling at the time of transduction. Use of a defined media ensures that proliferative factors are present m the <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 91 <br><br> absence of antiproliferative factors that may be found in serum or more complex media. <br><br> Upon isolation CD34 cells are transferred to the following media (based principally on Becker et al 1998, Hum Gene Ther 9, 1561) for at least 24 hours prior to transduction 5 Serum-free medium X-VTVO 10, 1% BSA, 2mM L-glutamme, 1% pen/strep, 20ng/ml IL 3, lOOU/ml IL 6, 50ng/ml SCF, 100 ng/ml anti-TGFb, 100 ng/ml Fit 3-L The transduction protocol outlined (Becker et al 1998 HGT 9 1561-1570) is used. This involves three cycles over 3 days and optimises the likelihood of the majority of cells undergoing mitosis m the presence of viral vector. The method is briefly as follows:- <br><br> 10 <br><br> Coat non-tissue culture grade plates with fibronectm fragment CH-269 at 10p.g/cm2 (Takahara). Add virus to empty wells and allow to bind for 30mms Wash with PBS. Add 105 cells m 0.5ml media per well. Add 0.5ml virus of supernatant Centrifuge at 1020xg for 90min. After 4 hours replace with fresh media as above. This is repeated for 3 consecutive 15 days. <br><br> Cells isolated from penpheral blood or from sources denved from penpheral blood preferentially form a higher proportion of erythroid progenitors whereas CD34 cells from cord blood results m the formation of a broader spread of progenitor type. Cord blood 20 derived cells have a higher inherent proliferative capacity. Increased stem cell numbers can be derived from penpheral blood that has been 'mobilised' pnor to isolation with GM CSF. This approach is widely used in transplant patients. <br><br> Cells are then plated out m methocel medium containing growth factors (Methocel 25 containing 10% fetal bovine serum, transferrin, glutamme, 2-mercaptoethanol, bovme serum albumin, IL3, IL6, IL11,SCF, Epo, GCSF, GMCSF) in a dark Class II safety cabinet according to the following protocol Using a blunt needle attached to a 2.5ml syringe, dispense 2.5ml methocel mto a 10ml U tube avoiding air bubbles. Dispense 0.5ml of the cell suspension (containing 3x the cell number required for each well so that 1ml of the 30 methocel will contain the desired cell number of 500/2000 cells per well) in Iscove's medium (Gibco) into the tube containing the methocel and vortex gently Gently dispense <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 92 <br><br> lml of the methocel and cell mix into a non-tissue culture petri dish (35x10mm) or a single well coverglass chamber using a blunt needle and syringe. Triplicate dishes/wells can be set up from each sample Place the dishes/chambers into a Falcon 3025 dish (150x25mm) housing small petn dishes of sterile distilled water to ensure correct humidity. Incubate 5 dishes at 37°C, 5% C02 and 5% 02 and analyse colonies after 14 days. <br><br> To enhance production of CD34 derived monocytes, culture conditions are phased to optimise formation of GM progenitors (Haylock et al 1992, Blood 80, 1405) and subsequently monocyte progenitors This is enabled using the CFU assay to monitor aliquots from the pnmary culture and ensure conditions are optimal for monocyte 10 generation. Supplementation of culture media with relatively high doses of GM CSF to optimise generation of GM progenitors, followed by phased administration of MCSF as the dominant growth factor skews differentiation toward the myeloid lineage. Following transduction of the HSC they are differentiated to form GM precursors <br><br> 15 The GM precursor colonies are analysed for the expression of the retroviral vector by observation of the fluorescence of GFP. This is assessed under normoxia and hypoxia. <br><br> Alternatively the stem cell population can be transduced using the same procedures as descnbed above but immediately after isolation They can then be frozen or used 20 immediately for transfer into patients In this case totipotent stem cells are preserved <br><br> Example 10. Interaction of engineered HSCs with ovarian cancer xenografts <br><br> As an example of the invention we have chosen to study HSC infiltration into tumours 25 using ovanan cancer as the test system. This cancer is largely confined to the pentoneal cavity. A number of animal models are available to analyse HSC infiltration into ovanan tumours Three human ovanan cancer xenografts OS, HU and LA have been derived from pnmary human tumours and established mtrapentoneally and they are mamtamed by senal passage by that route (Ward et al 1987, Cancer Res 47, 2662). None of these lines grow 30 well in long term culture. All grow primanly as free floating ascites surrounded by mucm This is not reflective of the human disease that exists as solid implanted tumour deposits <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 93 <br><br> with accompanying ascites. Intraperitoneal administration of TNF converts the HU and LA models from this ascitic state to implanted solid tumour deposits on the surface of the peritoneum and associated organs (Malik et al 1989, Int J. Cancer 44, 918) This closely represented the pathology of the human disease and more specifically resembles the 5 original pathology of the tumour from which they were denved This solid tumour model has been used as a more relevant starting point for study of therapeutic agents m ovanan cancer, (eg interferon gamma, Malik et al 1991, Cancer Res 51, 6643; Burke et al 1997, Eur. J. Cancer, 33 1114) Human stem cells engineered with the adenoviral or retroviral or lentiviral vectors descnbed above are mtroduced at a concentration of 105 /0.1ml into the 10 pentoneal cavity of mice beanng the tumours descnbed above. The HSCs express the therapeutic genes. The action of these genes extends beyond the HSC i.e. there is a bystander effect so that the surrounding tumour tissue is killed. In a particular example of this invention the vector XiaGen-P450 is used. The mice are treated with the engineered HSC and then treated with cyclophosphamide at lOOmg/Kg administered mtraperitoneally 15 The tumours of mice treated with engineered HSC are killed by the cyclophosphamide. <br><br> Similar procedures are used with AdHRE vectors following the published stem cell transduction procedure as follows. Adenoviral vector is used to transduce HSC at a high multiplicity of infection (100 to 500) in a small volume of cullture medium containing 200 20 units/ml IL-3, 200 units/ml GM-CSF, 200 units/ml G-CSF for 24 hours. After transduction with the adenoviral vector the HSC can either be differentiated or used directly. If differentiated cells are to be used then colony forming units-granulocye/macrophage (CFU-GM) are quantified m soft agar containing the above cytokines after incubation for 14 days. The CD34+ cells or differentiated cells are 25 introduced into the animal and migrate to the target tissue and express a therapeutic gene . <br><br> Example 11. Treatment of ovarian cancer with modified human stem cells <br><br> Penpheral blood lymphocytes are collected from ovanan cancer patients as follows. The 30 cells are transduced with the XiaGen-P450 retroviral vector as descnbed above. The engineered stem cells are returned to the patient via an intrapentoneal injection broadly as <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 94 <br><br> descnbed for monocytes by Stevenson et al 1987, Cancer Res 47, 6100. Basically 108 to 109 cells m 50mls of isotonic saline are introduced directly mto the abdominal cavity via a needle catheter monitored by ultrasound. The cells are distributed widely in the pentoneal cavity and remain associated with serosal surfaces and do not traffic to other organs. After 5 1 to 7 days the patients are treated with cyclophosphamide and tumours are analysed after a further 2 weeks. Reduction in tumour mass is a consequence of local activation of the cyclophosphamide by the engineered stem cells. <br><br> Similar procedures are used with AdHRE vectors following the stem cell transduction 10 procedure outline above. <br><br> Example 12. Transduction of tumour cells with lenti-viral vectors <br><br> As a further example of the present invention we have chosen to study gene transfer to 15 glioma. Gliomas are charactensed by hypervasculanty and invasiveness yet they are one of the most hypoxic tumours that have been studied [J. Folkman pp3075- 3085 In Cancer: Principles and Paractice of Oncology, Fifth Edition ed DeVita, Hellman, Rosenberg Pub Lippincott-Raven 1997]. A lentiviral vector is configured to deliver a combination therapy of a prodrug activating enzyme and an anti angiogenic factor, in this example this is the 20 human cytochrome P450 gene and the anti-angiogemc factor TSP-1. The expression is activated m hypoxia thus ensunng that the therapy is administered m the local environment of the tumour A suitable lentiviral vector is descnbed m the Figure 32. The model systems use either the human cell line U87MG or the rat RT-2 line. Both give typical vasculansed tumours that can be analysed either in normal rats or m nude or SCID mice (e g Wei et al 25 1 994, Human Gene Therapy 5, 969). In both cases the tumour model is created by the intra-cerebral implantation of tumour cell lines Lentiviral vector preparations are injected directly into the tumour mass at multiple sites. Vector is delivered in 1 to 3 ul amounts at a titre of at least 104 transducing umts/ul The same procedure is used in treating human patients. In this case the tumour is located by PET or MRI scanning and injected with 30 vector in 0 1ml aliquots or alternatively at the time of surgical debulking the site can be treated with vector. Patients are treated with cyclophosphamide and the reduction in tumour growth is monitored by MRI scanning <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 95 <br><br> Example 13. Induction of lentiviral vector production and expression by desferoxamine <br><br> 5 Desfemoxamine is obtained from Sigma or as a clinical formulation from Novartis Pharmaceuticals as the licensed product Deferal. The level of iduction achieved with Desferal is equal to or greater than that achieved by hypoxia. <br><br> For in vitro use producer cells containing the hypoxia regulated lentiviral vectors are 10 cultured m flasks for 10 days m the presence of 50 micromolar to 1 millimolar desfemoxamine Cultures release vector particles during this period to give total yields in excess of 107/ml For scale up cells are cultured m roller bottles and desfemoxamine is used at 50 to 200 micromolar for seven days This system therefore exploits the presence of the HRE to alow induction of viral vectors. The system is descnbed whereby the genome is 15 regulated by HRE in response to desfemoxamine It follows that the other components i.e. the gagpol and the envelope can be similarly regulated. It follows that this system can be used to egulate the production of the components fro any retroviral or lentiviral vector. <br><br> For m vivo use patients are treated with the hypoxia regulated lentiviral vector or with cells 20 that contain the hypoxia regulated lentiviral vector Patients are then give a standard course of treatment with desfemoxamine This activates the therapy m addition to any effects of hypoxia and in some cases mey replace the requirement for local hypoxia. For example if the cells are implanted to provide a therapeutic protein such as Epo or a blood clotting factor, such as factor IX then the delivery can be regulated by adjusting the dose of 25 Desferal. <br><br> Split Intron Technology <br><br> The following teachings are taken from our co-pendmg application and provide teachings 30 on how to devise retroviral vectors with split-intron features. These teachings can be adapted to prepare one or more vectors that are capable of delivenng ILRE regulated NOIs <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 96 <br><br> to cells in combination with a split-intron configuration. That PCT patent application is annexed hereto and all of its contents are incorportated herein by reference. <br><br> Summary <br><br> 5 <br><br> In a broad aspect the present invention provides a modified cell comprising a response element that is active in that cell, wherein the modified cell is prepared by transforming a cell or progenitor cell therefor by viral transduction with one or more viral vectors wherein at least one of which compnses the response element. <br><br> 10 <br><br> In a preferred aspect the present invention provides a modified cell compnsing a response element that is active m that cell, wherein the modified cell is prepared by transforming a cell or progemtor cell therefor by viral transduction with one or more viral vectors wherein at least one of which compnses the response element, and wherein the response element 15 comprises an ILRE. <br><br> In a preferred aspect the present invention provides a modified cell compnsing a response element that is active in that cell; wherein the modified cell is prepared by transforming a cell or progenitor cell therefor by viral transduction with one or more viral vectors wherein 20 at least one of which compnses the response element, and wherein the response element compnses an HRE. <br><br> In a more preferred aspect the present invention provides a modified haematopoeitic stem cell (MHSC) comprising at least one expressable nucleotide sequence of interest (NOI) 25 wherein the or each NOI is operably linked to one or more response elements comprising an ischaemia like response element (ILRE). <br><br> The vectors, constructs, regulatory elements and promoters descnbed m the Examples Section - each of which is novel - are also encompassed by the present invention. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 97 <br><br> All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled m the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 98 <br><br> VECTOR <br><br> PCT/GB98/02885 <br><br> The present invention relates to a vector <br><br> 5 In particular, the present invention relates to a novel system for packaging and expressing genetic material in a retroviral particle. <br><br> More in particular, the present invention relates to a novel system capable of expressing a retroviral particle that is capable of delivering a nucleotide sequence of interest 10 (hereinafter abbreviated as "NOI") - or even a plurality of NOIs - to one or more target sites. <br><br> In addition, the present invention relates to inter alia a novel retroviral vector useful in gene therapy <br><br> 15 <br><br> Gene therapy may mclude any one or more of- the addition, the replacement, the deletion, the supplementation, the manipulation etc. of one or more nucleotide sequences in, for example, one or more targeted sites - such as targeted cells. If the targeted sites are targeted cells, then the cells may be part of a tissue or an organ 20 General teachings on gene therapy may be found in Molecular Biology (Ed Robert Meyers, Pub VCH, such as pages 556-558) <br><br> By way of further example, gene therapy can also provide a means by which any one or more of a nucleotide sequence, such as a gene, can be applied to replace or supplement 25 a defective gene; a pathogenic nucleotide sequence, such as a gene, or expression product thereof can be eliminated; a nucleotide sequence, such as a gene, or expression product thereof, can be added or mtroduced m order, for example, to create a more favourable phenotype, a nucleotide sequence, such as a gene, or expression product thereof can be added or introduced, for example, for,selection purposes (i.e to select 30 transformed cells and the like over non-transformed cells), cells can be manipulated at the molecular level to treat, cure or prevent disease conditions - such as cancer (Schmidt- <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 99 <br><br> Wolf and Schmidt-Wolf, 1994, Annals of Hematology 69;273-279) or other disease conditions, such as immune, cardiovascular, neurological, inflammatory or infectious disorders, antigens can be manipulated and/or mtroduced to elicit an immune response, such as genetic vaccmation <br><br> 5 <br><br> In recent years, retroviruses have been proposed for use m gene therapy. Essentially, retroviruses are RNA viruses with a life cycle different to that of lytic viruses In this regard, a retrovirus is an mfectious entity that replicates through a DNA intermediate. When a retrovirus infects a cell, its genome is converted to a DNA form by a reverse 10 transcriptase enzyme. The DNA copy serves as a template for the production of new RNA genomes and virally encoded protems necessary for the assembly of infectious viral particles. <br><br> There are many retroviruses and examples mclude. murine leukemia virus (MLV), 15 human immunodeficiency virus (HIV), equine infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis 20 virus (AEV) <br><br> A detailed list of retroviruses may be found in Coffin et al ("Retroviruses" 1997 Cold Spring Harbour Laboratory Press Eds JM Coffm, SM Hughes, HE Varmus pp 758-763) <br><br> 25 <br><br> Details on the genomic structure of some retroviruses may be found m the art. By way of example, details on HIV may be found from the NCBI Genbank (i.e Genome Accession No AF033819) <br><br> 30 Essentially, all wild type retroviruses contain three major coding domains, gag, pol, env, which code for essential virion proteins Nevertheless, retroviruses may be broadly <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 100 <br><br> divided into two categories, namely, "simple" and "complex". These categories are distinguishable by the organisation of their genomes Simple retroviruses usually carry only elementary information In contrast, complex retroviruses also code for additional regulatory proteins derived from multiple spliced messages. <br><br> 5 <br><br> Retroviruses may even be further divided into seven groups. Five of these groups represent retroviruses with oncogenic potential The remaining two groups are the lentiviruses and the spumaviruses. A review of these retroviruses is presented in "Retroviruses" (1997 Cold Spring Harbour Laboratory Press Eds JM Coffin, SM 10 Hughes, HE Varmus pp 1-25). <br><br> All oncogenic members except the human T-cell leukemia virus-bovine leukemia virus group (HTLV-BLV) are simple retroviruses HTLV, BLV and the lentiviruses and spumaviruses are complex Some of the best studied oncogemc retroviruses are Rous 15 sarcoma virus (RSV), mouse mammary tumour virus (MMTV) and murine leukemia virus (MLV) and the human T-cell leukemia virus (HTLV). <br><br> The lentivirus group can be split even further mto "primate" and "non-primate". Examples of primate lentiviruses include the human immunodeficiency virus (HIV), the 20 causative agent of human auto-immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV) The non-primate lentiviral group includes the prototype <br><br> * <br><br> "slow virus" visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency 25 virus (BIV) <br><br> A distinction between the lentivirus family and other types of retroviruses is that lentiviruses have the capability to infect both dividing and non-dividing cells (Lewis et al 1992 EMBO J 11. 3053-3058; Lewis and Emerman, 1994 J Virol 68 510-516). In 30 contrast, other retroviruses - such as MLV - are unable to infect non-dividing cells such as those that make up, for example, muscle, brain, lung and liver tissue. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 101 <br><br> PCT/GB98/02885 <br><br> During the process of infection, a retrovirus initially attaches to a specific cell surface receptor On entry into the susceptible host cell, the retroviral RNA genome is then copied to DNA by the virally encoded reverse transcriptase which is carried inside the 5 parent virus This DNA is transported to the host cell nucleus where it subsequently integrates into the host genome. At this stage, it is typically referred to as the provirus. The provirus is stable in the host chromosome during cell division and is transcribed like other cellular proteins. The provirus encodes the proteins and packaging machinery required to make more virus, which can leave the cell by a process sometimes called io "budding". <br><br> As already indicated, each retroviral genome comprises genes called gag, pol and env which code for virion proteins and enzymes. In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs) The LTRs are responsible for 15 proviral integration, and transcription They also serve as enhancer-promoter sequences. In other words, the LTRs can control the expression of the viral gene. Encapsidation of the retroviral RNAs occurs by virtue of a psi sequence located at the 5' end of the viral genome <br><br> 20 The LTRs themselves are identical sequences that can be divided into three elements, which are called U3, R and U5 U3 is derived from the sequence unique to the 3' end of the RNA. R is derived from a sequence repeated at both ends of the RNA and U5 is derived from the sequence unique to the 5' end of the RNA The sizes of the three elements can vary considerably among different retroviruses. <br><br> 25 <br><br> For ease of understanding, simple, generic structures (not to scale) of the RNA and the DNA forms of the retroviral genome are presented below m which the elementary features of the LTRs and the relative positioning of gag, pol and env are indicated. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> PCT/GB98/02885 <br><br> 102 <br><br> Virion RNA <br><br> R <br><br> U5 <br><br> gag <br><br> pol <br><br> nv <br><br> J3 <br><br> R <br><br> i <br><br> ' <br><br> Reverse <br><br> 10 <br><br> Transcriptase <br><br> 15 <br><br> U3 <br><br> LTR <br><br> R <br><br> U5 <br><br> m pol <br><br> nv <br><br> 1 <br><br> t <br><br> LTR <br><br> L <br><br> R I <br><br> rs <br><br> Provirus Transcription <br><br> 20 <br><br> Transcript <br><br> As shown in the diagram above, the basic molecular organisation of an mfectious <br><br> 30 retroviral RNA genome is (5') R - U5 - gag, pol, env - U3-R (3') In a defective retroviral vector genome gag, pol and env may be absent or not functional. The R regions at both ends of the RNA are repeated sequences U5 and U3 represent unique sequences at the 5' and 3' ends of the RNA genome respectively. <br><br> 35 Reverse transcription of the virion RNA into double stranded DNA takes place in the cytoplasm and involves two jumps of the reverse transcriptase from the 5' terminus to the 3' terminus of the template molecule. The result of these jumps is a duplication of sequences located at the 5' and 3* ends of the virion RNA These sequences then occur fused in tandem on both ends of the viral DNA, forming the long terminal repeats <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 103 <br><br> (LTRs) which comprise R U5 and U3 regions On completion of the reverse transcription, the viral DNA is translocated mto the nucleus where the linear copy of the retroviral genome, called a preintegration complex (PIC), is randomly inserted into chromosomal DNA with the aid of the virion integrase to form a stable provirus. The 5 number of possible sites of integration mto the host cellular genome is very large and very widely distributed. <br><br> The control of proviral transcription remains largely with the noncoding sequences of the viral LTR. The site of transcription initiation is at the boundary between U3 and R in 10 the left hand side LTR (as shown above) and the site of poly (A) addition (termination) is at the boundary between R and U5 in the right hand side LTR (as shown above). U3 contains most of the transcriptional control elements of the provirus, which mclude the promoter and multiple enhancer sequences responsive to cellular and in some cases, viral transcriptional activator proteins. Some retroviruses have any one or more of the 15 following genes such as tat, rev, tax and rex that code for proteins that are involved in the regulation of gene expression. <br><br> Transcription of proviral DNA recreates the full length viral RNA genomic and subgenomic-sized RNA molecules that are generated by RNA processing Typically, all 20 RNA products serve as templates for the production of viral proteins The expression of the RNA products is achieved by a combination of RNA transcript splicmg and ribosomal framshifting during translation <br><br> RNA splicmg is the process by which intervening or "mtronic" RNA sequences are 25 removed and the remaining "exonic" sequences are ligated to provide continuous readmg frames for translation The primary transcript of retroviral DNA is modified in several ways and closely resembles a cellular mRNA. However, unlike most cellular mRNAs, m which all introns are efficiently spliced, newly synthesised retroviral RNA must be diverted into two populations One population remains unsphced to serve as the 30 genomic RNA and the other population is spliced to provide subgenomic RNA. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 104 <br><br> The full-length unsphced retroviral RNA transcripts serve two functions' (i) they encode the gag and pol gene products and (11) they are packaged into progeny virion particles as genomic RNA Sub-genomic-sized RNA molecules provide mRNA for the remainder of the viral gene products All spliced retroviral transcnpts bear the first exon, which 5 spans the U5 region of the 5' LTR The final exon always retains the U3 and R regions encoded by the 3' LTR although it varies in size The composition of the remainder of the RNA structure depends on the number of splicing events and the choice of alternative splice sites <br><br> 10 In simple retroviruses, one population of newly synthesised retroviral RNA remains unsphced to serve as the genomic RNA and as mRNA for gag and pol The other population is spliced, fusing the 5' portion of the genomic RNA to the downstream genes, most commonly env, Splicmg is achieved with the use of a splice donor positioned upstream of gag and a splice acceptor near the 3' terminus of pol The intron 15 between the splice donor and splice acceptor that is removed by splicing contains the gag and pol genes This splicmg event creates the mRNA for envelope (Env) protein. Typically the splice donor is upstream of gag but in some viruses, such as ASLV, the splice donor is positioned a few codons into the gag gene resulting in a pnmary Env translation product that includes a few ammo-terminal ammo acid residues m common 20 with Gag The Env protein is synthesised on membrane-bound polyribosomes and transported by the cell's vesicular traffic to the plasma membrane, where it is incorporated mto viral particles. <br><br> Complex retroviruses generate both singly and multiply spliced transcripts that encode 25 not only the env gene products but also the sets of regulatory and accessory proteins unique to these viruses Compex retroviruses such as the lentiviruses, and especially HIV, provide striking examples of the complexity of alternative splicmg that can occur during retroviral infection. For example, it is now known that HIV-1 is capable of producing over 30 different mRNAs by sub-optimal, splicmg from primary genomic 30 transcnpts This selection process appears to be regulated as mutations that disrupt <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 105 <br><br> competing splice acceptors can cause shifts in the splicing patterns and can affect viral infectivity (Purcell and Martin 1993 J Virol 67. 6365-6378). <br><br> The relative proportions of full-length RNA and subgenomic-sized RNAs vary in 5 infected cells and modulation of the levels of these transcnpts is a potential control step during retroviral gene expression. For retroviral gene expression, both unspliced and spliced RNAs must be transported to the cytoplasm and the proper ratio of spliced and unspliced RNA must be maintained for efficient retroviral gene expression. Different classes of retroviruses have evolved distinct solutions to this problem. The simple 10 retroviruses, which use only full-length and singly spliced RNAs regulate the cytoplasmic ratios of these species either by the use of variably efficient splice sites or by the incorporation of several as-acting elements, that have been only partially defined, into their genome. The complex retroviruses, which direct the synthesis of both smgly and multiply spliced RNA, regulate the transport and possibly splicing of the different 15 genomic and subgenomic-sized RNA species through the interaction of sequences on the RNA with the protein product of one of the accessory genes, such as rev in HTV-1 and rex in HTLV-1. <br><br> With regard to the structural genes gag, pol and env themselves and in slightly more 20 detail, gag encodes the internal structural protein of the virus Gag is proteolytically processed into the mature proteins MA (matrix), CA (capsid) and NC (nucleocapsid) The pol gene encodes the reverse transcriptase (RT), which contains both DNA polymerase, and associated RNase H activities and integrase (IN), which mediates replication of the genome. The env gene encodes the surface (SU) glycoprotem and the 25 transmembrane (TM) protem of the virion, which form a complex that interacts specifically with cellular receptor protems This interaction leads ultimately to fusion of the viral membrane with the cell membrane. <br><br> The Env protein is a viral protein which coats the viral particle and plays an essential 30 role in permitting viral entry mto a target cell The envelope glycoprotein complex of retroviruses includes two polypeptides an external, glycosylated hydrophilic polypeptide <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 106 <br><br> (SU) and a membrane-spanning protem (TM) Together, these form an oligomeric ' knob" or "knobbed spike" on the surface of a virion. Both polypeptides are encoded by the env gene and are synthesised m the form of a polyprotetn precursor that is proteolytically cleaved during its transport to the cell surface Although uncleaved Env 5 proteins are able to bmd to the receptor, the cleavage event itself is necessary to activate the fusion potential of the protein, which is necessary for entry of the virus into the host cell. Typically, both SU and TM proteins are glycosylated at multiple sites. However, in some viruses, exemplified by MLV, TM is not glycosylated. <br><br> 10 Although the SU and TM proteins are not always required for the assembly of enveloped virion particles as such, they play an essential role in the entry process. In this regard, the SU domain binds to a receptor molecule, often a specific receptor molecule, on the target cell It is believed that this binding event activates the membrane fusion-inducing potential of the TM protein after which the viral and cell membranes fuse. In some 15 viruses, notably MLV, a cleavage event, resulting in the removal of a short portion of the cytoplasmic tail of TM, is thought to play a key role in uncovering the full fusion activity of the protein (Brody et al 1994 J Virol 68: 4620-4627; Rem et al 1994 J Virol 68' 1773-1781). This cytoplasmic "tail", distal to the membrane-spanning segment of TM remains on the internal side of the viral membrane and it varies considerably m 20 length in different retroviruses <br><br> Thus, the specificity of the SU/receptor interaction can define the host range and tissue tropism of a retrovirus In some cases, this specificity may restrict the transduction potential of a recombmant retroviral vector. Here, transduction includes a process of using a viral vector to deliver a non-viral gene to a target cell. For this reason, many 25 gene therapy experiments have used MLV A particular MLV that has an envelope protein called 4070A is known as an amphotropic virus, and this can also infect human cells because its envelope protein "docks" with a phosphate transport protem that is conserved between man and mouse This transporter is ubiquitous and so these viruses are capable of infecting many cell types In some cases however, it may be beneficial, 30 especially from a safety point of view, to specifically target restricted cells. To this end, several groups have engineered a mouse ecotropic retrovirus, which unlike its <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 107 <br><br> amphotropic relative normally only infects mouse cells, to specifically infect particular human cells Replacement of a fragment of an Env protem with an erythropoietin segement produced a recombinant retrovirus which then bmds specifically to human cells that express the erythropoietin receptor on their surface, such as red blood cell 5 precursors (Maulik and Patel 1997 "Molecular Biotechnology Therapeutic Applications and Strategies" 1997 Wiley-Liss Inc. pp 45). <br><br> In addition to gag, pol and env, the complex retroviruses also contain "accessory" genes which code for accessory or auxiliary protems Accessory or auxiliary proteins are 10 defined as those protems encoded by the accessory genes in addition to those encoded by the usual replicative or structural genes, gag, pol and env. These accessory proteins are distinct from those involved m the regulation of gene expression, like those encoded by tat, rev, tax and rex. Examples of accessory genes include one or more of vtf vpr, vpx, vpu and nef These accessory genes can be found in, for example, HIV (see, for 15 example pages 802 and 803 of "Retroviruses" Ed. Coffin et al Pub. CSHL 1997). Nonessential accessory protems may function in specialised cell types, providing functions that are at least in part duplicative of a function provided by a cellular protein. Typically, the accessory genes are located between pol and env, just downstream from env mcludmg the U3 region of the LTR or overlappmg portions of the env and each 20 other. <br><br> The complex retroviruses have evolved regulatory mechanisms that employ virally encoded transcriptional activators as well as cellular transcriptional factors. These transacting viral protems serve as activators of RNA transcription directed by the LTRs The 25 transcriptional trans-activators of the lentiviruses are encoded by the viral tat genes. Tat binds to a stable, stem-loop, RNA secondary structure, referred to as TAR, one function of which is to apparently optimally position Tat to Trans-activate transcription. <br><br> As mentioned earlier, retroviruses have been proposed as a delivery system (otherwise 30 expressed as a delivery vehicle or delivery vector) for inter alia the transfer of a NOI, or a plurality of NOIs, to one or more sites of interest The transfer can occur in vitro, ex <br><br> Printed from Mimosa <br><br> WO 99/15684 ] Qg PCT/GB98/02885 <br><br> vivo, in vivo, or combinations thereof When used in this fashion, the retroviruses are typically called retroviral vectors or recombinant retroviral vectors Retroviral vectors have even been exploited to study various aspects of the retrovirus life cycle, including receptor usage, reverse transcription and RNA packaging (reviewed by Miller, 1992 5 Curr Top Microbiol Immunol 158'1-24) <br><br> In a typical recombinant retroviral vector for use in gene therapy, at least part of one or more of the gag, pol and env protein coding regions may be removed from the virus. This makes the retroviral vector replication-defective. The removed portions may even 10 be replaced by a NOI in order to generate a virus capable of integrating its genome into a host genome but wherein the modified viral genome is unable to propagate itself due to a lack of structural protems When integrated m the host genome, expression of the NOI occurs - resulting m, for example, a therapeutic and/or a diagnostic effect. Thus, the transfer of a NOI mto a site of interest is typically achieved by integrating the NOI mto 15 the recombmant viral vector; packagmg the modified viral vector into a virion coat; and allowing transduction of a site of mterest - such as a targeted cell or a targeted cell population <br><br> It is possible to propagate and isolate quantities of retroviral vectors (e.g to prepare 20 suitable titres of the retroviral vector) for subsequent transduction of, for example, a site of mterest by using a combination of a packaging or helper cell line and a recombmant vector <br><br> In some instances, propagation and isolation may entail isolation of the retroviral gag, 25 pol and env genes and their separate introduction mto a host cell to produce a "packaging cell line" The packagmg cell line produces the protems required for packagmg retroviral DNA but it cannot bring about encapsidation due to the lack of a psi region However, when a recombinant vector carrying a NOI and a psi region is introduced into the packagmg cell line, the helper proteins can package the /wz-positive recombinant 30 vector to produce the recombmant virus stock This can be used to transduce cells to introduce the NOI into the genome of the cells The recombmant virus whose genome <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> lacks all genes required to make viral proteins can tranduce only once and cannot propagate These viral vectors which are only capable of a single round of transduction of target cells are known as replication defective vectors Hence, the NOI is introduced into the host/target cell genome without the generation of potentially harmful retrovirus. 5 A summary of the available packaging lines is presented in "Retroviruses" (1997 Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 449) <br><br> The design of retroviral packagmg cell lines has evolved to address the problem of inter alia the spontaneous production of helper virus that was frequently encountered with 10 early designs As recombination is greatly facilitated by homology, reducing or eliminating homology between the genomes of the vector and the helper has reduced the problem of helper virus production More recently, packagmg cells have been developed in which the gag, pol and env viral coding regions are carried on separate expression plasmids that are independently transfected into a packagmg cell line so that 15 three recombmant events are required for wild type viral production This reduces the potential for production of a replication-competent virus. This strategy is sometimes referred to as the three plasmid transfection method (Soneoka et al 1995 Nucl. Acids Res 23 628-633) <br><br> 20 Transient transfection can also be used to measure vector production when vectors are being developed In this regard, transient transfection avoids the longer time required to generate stable vector-producmg cell lines and is used if the vector or retroviral packaging components are toxic to cells Components typically used to generate retroviral vectors include a plasmid encodmg the Gag/Pol protems, a plasmid encoding 25 the Env protein and a plasmid containing a NOI Vector production involves transient transfection of one or more of these components mto cells containing the other required components If the vector encodes toxic genes or genes that mterfere with the replication of the host cell, such as inhibitors of the cell cycle or genes that induce apotosis, it may be difficult to generate stable vector-producmg cell lines, but transient 30 transfection can be used to produce the vector before the cells die Also, cell Imes have been developed using transient infection that produce vector titre levels that are <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> comparable to the levels obtained from stable vector-producing cell lines (Pear et al 1993, Proc Natl Acad Sci 90'8392-8396). <br><br> In view of the toxicity of some HIV proteins - which can make it difficult to generate <br><br> 5 stable HIV-based packagmg cells - HIV vectors are usually made by transient transfection of vector and helper virus Some workers have even replaced the HIV Env protem with that of vesicular stomatis virus (VSV): Insertion of the Env protem of VSV <br><br> 5 8 <br><br> facilitates vector concentration as HIV/VSV-G vectors with titres of 5 x 10 (10 after concentration) have been generated by transient transfection (Naldini et al 1996 Science 10 272: 263-267) Thus, transient transfection of HIV vectors may provide a useful strategy for the generation of high titre vectors (Yee et al 1994 PNAS. 91' 9564-9568). <br><br> With regard to vector titre, the practical uses of retroviral vectors have been limited largely by the titres of transducing particles which can be attained in in vitro culture <br><br> O <br><br> 15 (typically not more than 10 particles/ml) and the sensitivity of many enveloped viruses to traditional biochemical and physicochemical techniques for concentrating and purifying viruses. <br><br> By way of example, several methods for concentration of retroviral vectors have been 20 developed, including the use of centrifugation (Fekete and Cepko 1993 Mol Cell Biol 13 2604-2613) hollow fibre filtration (Paul et al 1993 Hum Gene Ther 4 609-615) and tangential flow filtration (Kotani et al 1994 Hum Gene Ther 5- 19-28) Although a 20-fold increase in viral titre can be achieved, the relative fragility of retroviral Env protem limits the ability to concentrate retroviral vectors and concentrating the virus usually 25 results in a poor recovery of infectious virions. While this problem can be overcome by substitution of the retroviral Env protem with the more stable VSV-G protem, as descnbed above, which allows for more effective vector concentration with better yields, it suffers from the drawback that the VSV-G protein is quite toxic to cells Although helper-virus free vector titres of 107 cfu/ml are obtainable with currently 30 available vectors, experiments can often be done with much lower-titre vector stocks. However, for practical reasons, high-titre virus is desirable, especially when a large <br><br> Printed from Mimosa <br><br> WO 99/15684 j j ^ PCT/GB98/02885 <br><br> number of cells must be infected. In addition, high, titres are a requirement for transduction of a large percentage of certain cell types. For example, the frequency of human hematopoietic progenitor cell infection is strongly dependent on vector titre, and useful frequencies of infection occur only with very high-titre stocks (Hock and Miller 5 1986 Nature 320: 275-277, Hogge and Humphries 1987 Blood 69- 611-617) In these cases, it is not sufficient simply to expose the cells to a larger volume of virus to compensate for a low virus titre On the contrary, in some cases, the concentration of infectious vector virions may be critical to promote efficient transduction. <br><br> 10 Workers are trymg to create high titre vectors for use m gene delivery. By way of example, a comparison of different vector designs has proved useful in helping to define the essential elements required for high-titre viral production. Early work on different retroviral vector design showed that almost all of the internal protein-encoding regions of MLVs could be deleted without abolishing the infectivity of the vector (Miller et al 1983 15 Proc Natl Acad Sci 80. 4709-4713). These early vectors retained only a small portion of the 3' end of the env-codmg region Subsequent work has shown that all of the env-gene-coding sequences can be removed without further reduction in vector titre (Miller and Rosman 1989 Biotechmque 7 980-990; Morgenstern and Land 1990 Nucleic Acids Res 18 3587-3596) Only the viral LTRs and short regions adjoining the LTRs, 20 including the segments needed for plus- and minus-strand DNA priming and a region required for selective packaging of viral RNA into virions (the psi site, Mann et al 1983 Cell 33 153-159) were deemed necessary for vector transmission Nevertheless, viral titres obtained with these early vectors were still about tenfold lower than the parental helper virus titre. <br><br> 25 <br><br> Additional experiments indicated that retention of sequences at the 5' end of the gag gene significantly raised viral vector titres and that this was due to an increase in the packaging efficiency of viral RNA into virions (Armentano et al 1987 J Virol 61. 1647-1650, Bender et al 1987 J Virol 61 1639-1646; Ad?un and Miller 1988 J Virol 62 30 3802-3806) This effect was not due to viral protein synthesis from the gag region of the vector because disruption of the gag reading frame or mutating the gag codon to a <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> stop codon had no effect on vector titre (Bender et al 1987 ibid). These experiments demonstrated that the sequences required for efficient packaging of genomic RNA in MLV were larger than the psi signal previously defined by deletion analysis (Mann et al 1983 ibid) In order to obtain high titres (106 to &gt; 107), it was shown to be important S that this larger signal, called psi plus, be included in retroviral vectors It has now been demonstrated that this signal spans from upstream of the splice donor to downstream of the gag start codon (Bender et al 1987 ibid) Because of this position, in spliced env expressing transcnpts this signal is deleted. This ensures that only full length transcripts containing all three essential genes for viral life cycle are packaged. <br><br> 10 <br><br> In addition to manipulating the retroviral vector with a view to increasing vector titre, retroviral vectors have also been designed to induce the production of a specific NOI (usually a marker protein) in transduced cells As already mentioned, the most common retroviral vector design involves the replacement of retroviral sequences with one or 15 more NOIs to create replication-defective vectors. The simplest approach has been to use the promoter m the retroviral 5' LTR to control the expresssion of a cDNA encodmg an NOI or to alter the enhancer/promoter of the LTR to provide tissue-specific expression or inducibility Alternatively, a smgle coding region has been expressed by using an internal promoter which permits more flexibility m promoter selection. <br><br> 20 <br><br> These strategies for expression of a gene of interest have been most easily implemented when the NOI is a selectable marker, as m the case of hypoxanthine-guanine phosphonbosyl transferase (hprt) (Miller et al 1983 Proc Natl Acad Sci 80 4709-4713) which facilitates the selection of vector transduced cells. If the vector contams an NOI 25 that is not a selectable marker, the vector can be introduced mto packaging cells by co-transfection with a selectable marker present on a separate plasmid. This strategy has an appealing advantage for gene therapy in that a smgle protem is expressed in the ultimate target cells and possible toxicity or antigenicity of a selectable marker is avoided. However, when the inserted gene is not selectable, this approach has the disadvantage 30 that it is more difficult to generate cells that produce a high titre vector stock. In addition it is usually more difficult to determine the titre of the vector <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> The current methodologies used to design retroviral vectors that express two or more proteins have relied on three general strategies. These include, (i) the expression of different proteins from alternatively spliced mRNAs transcribed from one promoter; (li) the use of the promoter m the 5' LTR and internal promoters to drive transcription of 5 different cDNAs and (in) the use of internal ribosomal entry site (IRES) elements to allow translation of multiple coding regions from either a single mRNA or from fusion proteins that can then be expressed from an open reading frame. <br><br> Vectors containing internal promoters have been widely used to express multiple genes. 10 An internal promoter makes it possible to exploit the promoter/enhancer combinations other than the viral LTR for driving gene expression. Multiple internal promoters can be included in a retroviral vector and it has proved possible to express at least three different cDNAs each from its own promoter (Overell et al 1988 Mol Cell Biol 8 1803-1808) <br><br> 15 <br><br> While there now exist many such modified retroviral vectors which may be used for the expression of NOIs m a variety of mammalian cells, most of these retroviral vectors are denved from simple retroviruses such as murine oncoretroviruses that are incapable of transducmg non-dividmg cells <br><br> 20 <br><br> By way of example, a widely used vector that employs alternative splicmg to express genes from the viral LTR SV(X) (Cepko et al 1984 Cell 37 1053-1062) contains the neomycm phosphotransferase gene as a selectable marker The model for this type of vector is the parental virus, MO-MLV, in which the Gag and Gag-Pol proteins are 25 translated from the full-length viral mRNA and the Env protem is made from the spliced mRNA One of the protems encoded by the vector is translated from the full-length RNA whereas splicing that links the splice donor near the 5'LTR to a splice acceptor just upstream of the second gene produces an RNA from which the second gene product can be translated One drawback of this strategy is that foreign sequences are inserted into 30 the intron of the sphced gene This can affect the ratio of spliced to unspliced RNAs or provide alternative splice acceptors that interfere with production of the spliced RNA <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 114 <br><br> encoding the second gene product (Korman et al 1987 Proc Natl Acad Sci 84 2150-2154). Because these effects are unpredictable, they can affect the production of the encoded genes. <br><br> Other modified retroviral vectors can be divided mto two classes with regards to splicing 5 capabilities. <br><br> The first class of modified retroviral vector, typified by the pBABE vectors (Morgenstern et al 1990 Nucleic Acid Research 18 3587-3596), contain mutations within the splice donor (GT to GC) that inhibit splicing of viral transcnpts. Such 10 splicmg inhibition is beneficial for two reasons. Firstly, it ensures all viral transcnpts contain a packaging signal and thus all can be packaged in the producer cell. Secondly, it prevents potential aberrant splicing between viral splice donors and possible cryptic splice acceptors of inserted genes. <br><br> 15 The second class of modified retroviral vector, typified by both N2 (Miller et al 1989 Biotechniques 7 980-990) and the more recent MFG (Dranoff et al 1993 Proc Natl Acad Sci 19. 3979-3986), contam functional introns. Both of these vectors use the normal splice donor found within the packagmg signal. However, their respective splice acceptors (SAs) differ For N2, the SA is found within the "extended" packagmg signal 20 (Bender et al 1987 ibid). For MFG, the natural SA (found within pol, see Figure 1 thereof) is used For both these vectors, it has been demonstrated that splicmg greatly enhances gene expression m transduced cells (Miller et al 1989 ibid, Krall et al 1996 Gene Therapy 3: 37-48). Such observations support previous findings that, in general, splicing can enhance niRNA translation (Lee et al 1981 Nature 294. 228-232, Lewis et 25 al 1986 Mol Cell Biol 6. 1998-2010; Chapman et al 1991 Nucleic Acids Res 19. 3979-3986) One likely reason for this is that the same machinery involved in transcript splicmg may also aid m transcript export from the nucleus <br><br> Unlike the modified retroviral vectors descnbed above, there has been very little work 30 on alternative splicing m the retroviral lentiviral systems which are capable of infecting non-dividing cells (Naldmi et al 1996 Science 272. 263-267). To date the only <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> published lentiviral vectors are those derived from HIV-1 (Kim et al 1997 J Virol 72 811-816) and FIV (Poeschla et al 1998 Nat Med 4. 354-357). These vectors still contain virally denved splice donor and acceptor sequences (Naldmi et al 1996 ibid) <br><br> 5 Some alternative approaches to developing high titre vectors for gene delivery have included the use of: (l) defective viral vectors such as adenoviruses, adeno-associated virus (AAV), herpes viruses, and pox viruses and (n) modified retroviral vector designs. <br><br> The adenovirus is a double-stranded, linear DNA virus that does not go through an RNA 10 intermediate. There are over 50 different human serotypes of adenovirus divided mto 6 subgroups based on the genetic sequence homology. The natural target of adenovirus is the respiratory and gastrointestinal epithelia, generally giving rise to only mild symptoms Serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are normally associated with upper respiratory tract infections m the 15 young <br><br> Adenoviruses are nonenveloped, regular icosohedrons. A typical adenovirus compnses a 140nm encapsidated DNA virus. The icosahedral symmetry of the virus is composed of 152 capsomeres- 240 hexons and 12 pentons. The core of the particle contains the 36kb 20 linear duplex DNA which is covalently associated at the 5' ends with the Terminal Protein (TP) which acts as a primer for DNA replication The DNA has inverted terminal repeats (ITR) and the length of these vanes with the serotype <br><br> Entry of adenovirus into cells involves a senes of distinct events Attachment of the virus 25 to the cell occurs via an interaction between the viral fibre (37nm) and the fibre receptors on the cell This receptor has recently been identified for Ad2/5 serotypes and designated as CAR (Coxsackie and Adeno Receptor, Tomko et al (1997 Proc Natl Acad Sci 94' 3352-2258) Internalisation of the virus mto the endosome via the cellular avp3 and avp5 integnns is mediated by and viral RGD sequence lp the penton-base capsid protein 30 (Wickham et al., 1993 Cell 73. 309-319) Following internalisation, the endosome is disrupted by a process known as endosomolysis, an event which is believed to be <br><br> Printed from Mimosa <br><br> WO 99/15684 n6 PCT/GB98/02885 <br><br> preferentially promoted by the cellular av(35 mtegnn (Wickham et al., 1994 J Cell Biol 127. 257-264) In addition, there is recent evidence that the Ad5 fibre knob binds with high affinity to the MHC class 1 a2 domain at the surface of certain cell types including human epithelial and B lymphoblast cells (Hong et al., 1997 EMBO 16. 2294-2306). <br><br> 5 <br><br> Subsequently the virus is translocated to the nucleus where activation of the early regions occurs and is shortly followed by DNA replication and activation of the late regions. Transcnption, replication and packaging of the adenoviral DNA requires both host and viral functional protein machinery <br><br> 10 <br><br> Viral gene expression can be divided into early (E) and late (L) phases. The late phase is defined by the onset of viral DNA replication Adenovirus structural proteins are generally synthesised dunng the late phase Following adenovirus infection, host cellular mRNA and protein synthesis is inhibited in cells infected with most serotypes. The adenovirus 15 lytic cycle with adenovirus 2 and adenovirus 5 is very efficient and results in approximately 10, 000 vmons per infected cell along with the synthesis of excess viral protem and DNA that is not incorporated into the vinon. Early adenovirus transcnption is a complicated sequence of interrelated biochemical events but it entails essentially the synthesis of viral RNAs pnor to the onset of DNA replication <br><br> 20 <br><br> The Schematic diagram below is of the adenovirus genome showing the relative direction and position of early and late gene transcnption. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> Late mRNA <br><br> MLP LI L2 L3 L4 L5 ! 1 i 1 1 ► <br><br> E1B ► <br><br> E1A E3 ► <br><br> 3 ^ 5. <br><br> 5 ► 3 <br><br> I 1 Map Units | <br><br> 50 100 <br><br> E2A E4 <br><br> E2B <br><br> The organisation of the adenovirus genome is simihar in all of the adenovirus groups and specific functions are generally positioned at identical locations for each serotype studied 5 Early cytoplasmic messenger RNAs are complementary to four defined, noncontiguous regions on the viral DNA These regions are designated E1-E4 The early transcnpts have been classified into an array of intermediate early (Ela), delayed early (Elb, E2a, E2b, E3 and E4), and intermediate regions <br><br> 10 The early genes are expressed about 6-8 hours after infection and are dnven from 7 promoters m gene blocks El-4 <br><br> The Ela region is mvolved m transcnptional transactivation of viral and cellular genes as well as transcnptional repression of other sequences The Ela gene exerts an important 15 control function on all of the other early adenovirus messenger RNAs In normal tisssues, in order to transcnbe regions Elb, E2a, E2b, E3 or E4 efficiently, active Ela product is required. However, the Ela function may be bypassed Cells may be manipulated to provide Ela-hke functions or may naturally contain such' functions. The virus may also be manipulated to bypass the Ela function The viral packagmg signal overlaps with the Ela 20 enhancer (194-358 nt) <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 118 <br><br> PCT/GB98/02885 <br><br> The Elb region influences viral and cellular metabolism and host protem shut-off. It also includes the gene encoding the pIX protein (3525-4088 nt) which is required for packagmg of the full length viral DNA and is important for the thermostability of the virus. The Elb 5 region is required for the normal progression of viral events late m infection. The Elb product acts in the host nucleus Mutants generated within the Elb sequences exhibit diminished late viral mRNA accumulation as well as impairment m the inhibition of host cellular transport normally observed late in adenovirus infection. Elb is required for altering functions of the host cell such that processing and transport are shifted in favour of io viral late gene products. These products then result in viral packaging and release of virions. Elb produces a 19 kD protein that prevents apoptosis. Elb also produces a 55 kD protein that bmds to p53 For a review on adenoviruses and their replication, see WO 96/17053 <br><br> 15 The E2 region is essential as it encodes the 72 kDa DNA binding protein, DNA polymerase and the 80 kDa precurser of the 55 kDa Terminal Protein (TP) needed for protem pruning to initiate DNA synthesis. <br><br> A 19 kDa protein (gpl9K) is encoded withm the E3 region and has been implicated m 20 modulating the host immune response to the virus Expression of this protein is upregulated in response to TNF alpha dunng the first phase of the infection and this then binds and prevents migration of the MHC class I antigens to the epithelial surface, thereby dampening the recognition of the adenoviral infected cells by the cytotoxic T lymphocytes The E3 region is dispensible in in vitro studies and can be removed by deletion of a 1 9 kb 25 Xbal fragment. <br><br> The E4 region is concerned with decreasing the host protein synthesis and increasing the DNA replication of the virus <br><br> 30 There are 5 families of late genes and all are initiated from the major late promoter The expression of the late genes includes a very complex post-transcnptional control <br><br> Printed from Mimosa <br><br> WO 99/15684 n9 PCT/GB98/02885 <br><br> mechanism involving RNA splicmg The fibre protem is encoded within the L5 region The adenoviral genome is flanked by the inverted terminal repeat which m Ad5 is 103 bp and is essential for DNA replication 30-40 hours post infection viral production is complete <br><br> 5 <br><br> Adenoviruses may be converted for use as vectors for gene transfer by deleting the El gene, which is important for the induction of the E2, E3 and E4 promoters. The El-replication defective virus may be propagated m a cell line that provides the El polypeptides in trans, such as the human embryonic kidney cell line 293 A therapeutic 10 gene or genes can be inserted by recombination in place of the El gene. Expression of the gene is dnven from either the El promoter or a heterologous promoter <br><br> Even more attenuated adenoviral vectors have been developed by deleting some or all of the E4 open reading frames (ORFs). However, certain second generation vectors appear 15 not to give longer-term gene expression, even though the DNA seems to be maintained. Thus, it appears that the function of one or more of the E4 ORFs may be to enhance gene expression from at least certain viral promoters earned by the virus <br><br> An alternate e approach to making a more defective virus has been to "gut" the virus 20 completely maintaining only the terminal repeats required for viral replication The "gutted" or ' gutless' viruses can be grown to high titres with a first generation helper virus in the 293 cell line but it has been difficult to separate the "gutted" vector from the helper virus. <br><br> 25 Replication-competent adenoviruses can also be used for gene therapy For example, the E1A gene can be inserted into a first generation virus under the regulation of a tumour-specific promoter In thoery, following injection of the virus into a tumour, it could replicated specifically m the tumour but not in the surrounding normal cells. This type of vector could be used either to kill tumour cells directly by lysis or to deliver a "suicide 30 gene" such as the herpes-simplcx-virus thymidine-kinase gene (HSV tk) which can kill infected and bystander cells following treatment with ganciclovir Alternatively, an <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> adenovirus defective only for Elb has been used specifically for antitumour treatment in phase-1 clinical trials. The polypeptides encoded by Elb are able to block p53-mediated apoptosis, preventing the cell from killing itself m response to viral infection Thus, m normal nontumour cells, in the absence of Elb, the virus is unable to block apoptosis and is 5 thus unable to produce infectious virus and spread. In tumour cells deficient in p53, the Elb defective virus can grow and spread to adjacent p53-defective tumour cells but not to normal cells Again, this type of vector could also be used to deliver a therapeutic gene such as HSV tk. <br><br> 10 The adenovirus provides advantages as a vector for gene delivery over other gene therapy vector systems for the following reasons- <br><br> It is a double stranded DNA nonenveloped virus that is capable of in vivo and in vitro transduction of a broad range of cell types of human and non-human origin These cells 15 include respiratory airway epithelial cells, hepatocytes, muscle cells, cardiac myocytes, synoviocytes, primary mammary epithelial cess and post-mitotically terminally differentiated cells such as neurons (with perhaps the important exception of some lymphoid cells including monocytes) <br><br> Adenoviral vectors are also capable of transducing non dividing cells. This is very 20 important for diseases, such as cystic fibrosis, m which the affected cells in the lung epithelium, have a slow turnover rate In fact, several trials are underway utilising adenovirus-mediated transfer of cystic fibrosis transporter (CFTR) into the lungs of afflicted adult cystic fibrosis patients <br><br> 25 Adenoviruses have been used as vectors for gene therapy and for expression of heterologous genes The large (36 kilobase) genome can accommodate up to 8kb of foreign insert DNA and is able to replicate efficiently in complementing cell lines to produce very high titres of up to 1012 Adenovirus is thus one of the best systems to study the expression of genes in pnmary non-rephcative cells , <br><br> 30 <br><br> The expression of viral or foreign genes from the adenovirus genome does not require a <br><br> Printed from Mimosa <br><br> WO 99/15684 Ul PCT/GB98/02885 <br><br> replicating cell Adenoviral vectors enter cells by receptor mediated endocytosis Once inside the cell, adenovirus vcctors rarely integrate into the host chromosome Instead, it functions episomally (independently from the host genome) as a linear genome in the host nucleus Hence the use of recombinant adenovirus alleviates the problems associated with 5 random integration mto the host genome <br><br> There is no association of human malignancy with adenovirus infection. Attenuated adenoviral strains have been developed and have been used in humans as live vaccines <br><br> 10 However, current adenoviral vectors suffer from some major limitations for in vivo therapeutic use These include (i) transient gene expression- the adenoviral vector generally remains episomal and does not replicate so that it is not passed onto subsequent progeny (11) because of its inability to replicate, target cell proliferation can lead to dilution of the vector (in) an immunological response raised against the adenoviral 15 protems so that cells expressing adenoviral proteins, even at a low level, are destroyed and (iv) an inability to achieve an effective therapeutic index since in vivo delivery leads to an uptake of the vector and expression of the delivered genes in only a proportion of target cells. <br><br> 20 If the features of adenoviruses can be combined with the genetic stability of retro/lentiviruses then essentially the adenovirus can be used to transduce target cells to become transient retroviral producer cells that can stably infect neighbouring cells <br><br> The present invention seeks to provide a novel retroviral vector <br><br> 25 <br><br> In particular, the present invention seeks to provide a novel retroviral vector capable of providing efficient expression of a NOI - or even a plurality of NOIs - at one or more desired target sites <br><br> 30 The present invention also seeks to provide a novel system for preparing high titres of vector virion which incorporates safety features for in vivo use and which is capable of <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 122 <br><br> providing efficient expression of a NOI - or even a plurality of NOIs desired target sites <br><br> PCT/GB98/02885 - at one or more <br><br> According to a first aspect of the present invention, there is provided a retroviral vector 5 comprising a functional splice donor site and a functional splice acceptor site, wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of interest ("NOI"), wherein the functional splice donor site is upstream of the functional splice acceptor site; wherein the retroviral vector is derived from a retroviral pro-vector, wherein the retroviral pro-vector comprises a first 10 nucleotide sequence (NS) capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; wherein the first NS is downstream of the second NS, such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector <br><br> 15 According to a second aspect of the present invention, there is provided a retroviral vector wherein the retroviral pro-vector comprises a retroviral packagmg signal; and wherein the second NS is located downstream of the retroviral packagmg signal such that splicmg is preventable at a primary target site <br><br> 20 According to a third aspect of the present invention, there is provided a retroviral vector wherein the second NS is placed downstream of the first NOI such that the first NOI is capable of being expressed at a primary target site. <br><br> According to a fourth aspect of the present invention, there is provided a retroviral 25 vector wherein the second NS is placed upstream of a multiple cloning site such that one or more additional NOIs may be inserted <br><br> According to a fifth aspect of the present invention, there is provided a retroviral vector wherein the second NS is a nucleotide sequence coding for an immunological molecule 30 or a part thereof. <br><br> Printed from Mimosa <br><br> WO 99/15684 123 PCT/GB98/02885 <br><br> According to a sixth aspect of the present invention, there is provided a retroviral vector wherein the immunological molecule is an immunoglobulin. <br><br> According to a seventh aspect of the present invention, there is provided a retroviral 5 vector wherein the second NS is a nucleotide sequence coding for an immunoglobulin heavy cham variable region. <br><br> According to a eight aspect of the present invention, there is provided a retroviral vector wherein the vector additionally compnses a functional intron. <br><br> 10 <br><br> According to a ninth aspect of the present invention, there is provided a retroviral vector wherein the functional mtron is positioned so that it is capable of restricting expression of at least one of the NOIs in a desired target site <br><br> 15 According to a tenth aspect of the present invention, there is provided a retroviral vector wherein the target site is a cell. <br><br> According to a eleventh aspect of the present invention, there is provided a retroviral vector wherein the vector or pro-vector is derivable from a murme oncoretrovirus or a 20 lentivirus <br><br> According to a twelfth aspect of the present invention, there is provided a retroviral vector wherein the vector is derivable from MMLV; MSV, MMTV, HIV-1 or EIAV. <br><br> 25 According to a thirteenth aspect of the present invention, there is provided a retroviral vector wherein the retroviral vector is an integrated provirus. <br><br> According to a fourteenth aspect of the present invention, there is provided a retroviral particle obtamable from a retroviral vector. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 ^24 PCT/GB98/02885 <br><br> According to a fifteenth aspect of the present invention, there is provided a cell transfected or transduced with a retroviral vector. <br><br> According to a sixteenth aspect of the present invention there is provided a retroviral 5 vector or a viral particle or a cell for use m medicine. <br><br> According to a seventeenth aspect of the present mvention there is provided a retroviral vector or a viral particle or a cell for the manufacture of a pharmaceutical composition to deliver one or more NOIs to a target site in need of same. <br><br> 10 <br><br> According to a eighteenth aspect of the present invention there is provided a method comprising transfecting or transducing a cell with a retroviral vector or a viral particle or by use of a cell <br><br> 15 According to a nineteenth aspect of the present invention there is provided a delivery system for a retroviral vector or a viral particle or a cell wherein the delivery system comprises one or more non-retroviral expression vector(s), adenoviruse(s), or plasmid(s) or combinations thereof for delivery of an NOI or a plurality of NOIs to a first target cell and a retroviral vector for delivery of an NOI or a plurality of NOIs to a second 20 target cell <br><br> According to a twentieth aspect of the present mvention there is provided a retroviral pro-vector. <br><br> 25 According to a twenty first aspect of the present mvention there is provided the use of a functional intron to restrict expression of one or more NOIs within a desired target cell. <br><br> According to a twenty second aspect of the present invention there is provided the use of a reverse transcriptase to deliver a first NS from the 3' end of a retroviral pro-vector to 30 the 5' end of a retroviral vector <br><br> Printed from Mimosa <br><br> WO 99/15684 ^5 PCT/GB98/02885 <br><br> Accordmg to a twenty third aspect of the present invention there is provided a hybrid viral vector system for in vivo gene delivery, which system compnses one or more primary viral vectors which encode a secondary viral vector, the pnmary vector or vectors capable of infecting a first target ceil and of expressing therein the secondary viral vector, which 5 secondary vector is capable of transducing a secondary target cell. <br><br> According to a twenty fourth aspect of the present mvention there is provided a hybrid viral vector system wherem the primary vector is obtainable from or is based on a adenoviral vector and/or the secondary viral vector is obtainable from or is based on a 10 retroviral vector preferably a lentiviral vector. <br><br> According to a twenty fifth aspect of the present invention there is provided a hybrid viral vector system wherein the lentiviral vector compnses or is capable of delivering a split-intron configuration <br><br> 15 <br><br> Accordmg to a twenty sixth aspect of the present invention there is provided a lentiviral vector system wherem the lentiviral vector compnses or is capable of delivermg a split-intron configuration. <br><br> 20 According to a twenty seventh aspect of the present mvention there is provided an adenoviral vector system wherem the adenoviral vector comprises or is capable of delivering a split-intron configuration. <br><br> Accordmg to a twenty eighth aspect of the present invention there is provided vectors or 25 plasmids basd on or obtained from any one or more of the entities presented as pElsplA, pCI-Neo, pElRevE, pElHORSE3 1, pElPEGASUS4, pCI-Rab, pElRab. <br><br> Accordmg to a twenty ninth aspect of the present mvention there is provided a retroviral vector capable of differential expression of NOIs in target cells <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> Another aspect of the present invention includes a hybrid viral vector system for in vivo gene delivery, which system compnses a pnmary viral vector which encodes a secondary viral vector, the pnmary vector capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a 5 secondary target cell, wherein the primary vector is obtainable from or is based on a adenoviral vector and the secondary viral vector is obtainable from or is based on a retroviral vector preferably a lentiviral vector. <br><br> Another aspect of the present invention includes a hybrid viral vector system for in vivo 10 gene delivery, which system comprises a pnmary viral vector which encodes a secondary viral vector, the pnmary vector capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell, wherem the primary vector is obtainable from or is based on a adenoviral vector and the secondary viral vector is obtainable from or is based on a 15 retroviral vector preferably a lentiviral vector; wherein the viral vector system comprises a functional splice donor site and a functional splice acceptor site; wherem the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of interest ("NOI"); wherein the functional splice donor site is upstream of the functional splice acceptor site; wherein the retroviral vector is derived from a retroviral pro-vector; 20 wherein the retroviral pro-vector comprises a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; wherein the first NS is downstream of the second NS; such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector <br><br> 25 <br><br> Preferably the retroviral pro-vector comprises a third NS that is upstream of the second nucleotide sequence, wherein the third NS is capable of yielding a non-functional splice donor site. <br><br> 30 Preferably the retroviral vector further comprises a second NOI, wherein the second NOI is downstream of the functional splice acceptor site <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 127 <br><br> PCT/GB98/02885 <br><br> Preferably the retroviral pro-vector comprises the second NOI, wherein the second NOI is downstream of the second nucleotide sequence <br><br> 5 Preferably the second NOI, or the expression product thereof, is or comprises a therapeutic agent or a diagnostic agent. <br><br> Preferably the first NOI, or the expression product thereof, is or comprises any one or more of an agent conferring selectablity (e.g. a marker element), a viral essential 10 element, or a part thereof, or combinations thereof. <br><br> Preferably the first NS is at or near to the 3' end of a retroviral pro-vector; preferably wherem the 3' end comprises a U3 region and an R region, and preferably wherein the first NS is located between the U3 region and the R region. <br><br> 15 <br><br> Preferably the U3 region and/or the first NS of the retroviral pro-vector comprises an NS that is a third NOI, wherem the NOI is any one or more of a transcriptional control element, a coding sequence or a part thereof. <br><br> 20 Preferably the first NS is obtainable from a virus <br><br> Preferably the first NS is an mtron or a part thereof <br><br> Preferably the intron is obtainable from the small t-intron of SV40 virus <br><br> 25 <br><br> Preferably the vector components are regulated. In one preferred aspect of the invention, <br><br> the vector components are regulated by 'Hypoxia <br><br> 30 In another preferred aspect of the invention, the vector components are regulated by tetracycline on/off system. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> Thus, the present mvention provides a delivery system which utilises a retroviral vector. <br><br> The retroviral vector of the delivery system of the present invention compnses a functional splice donor site ("FSDS") and a functional splice acceptor site ("FSAS") 5 which flank a first NOI. The retroviral vector is formed as a result of reverse transcription of a retroviral pro-vector which may comprise a plurality of NOIs. <br><br> When the FSDS is positioned upstream of the FSAS, any intervening sequence(s) are capable of being spliced. Typically, splicing removes intervening or "mtronic" RNA 10 sequences and the remaining "exonic" sequences are ligated to provide continuous sequences for translation <br><br> The splicing process can be pictonally represented as: <br><br> 15 Unspliced Form <br><br> X Y <br><br> FSDS - <br><br> 20 <br><br> Splicing <br><br> -FSAS" <br><br> ~3' <br><br> 25 <br><br> Spliced Form X <br><br> 5' — ~J'~ <br><br> 30 <br><br> In this pictorial representation, Y represents the intervening sequence that is removed as a result of splicmg <br><br> Printed from Mimosa <br><br> WO 99/15684 229 PCT/GB98/02885 <br><br> The natural splicing configuration for retroviral vectors is shown in Figure 27a. The splicing configuration of known vectors is shown m Figure 27b The Splicing configuration according to the present invention is shown in Figure 27c. <br><br> 5 In accordance with the present invention, if the FSDS is downstream of the FSAS, then splicing cannot occur. <br><br> Likewise, if the FSDS is a non-functional splice donor site (NFSDS) and/or the FSAS is a non-functional acceptor acceptor site (NFAS), then splicing cannot occur. <br><br> 10 <br><br> An example of a NFSDS is a mutated FSDS such that the FSDS can no longer be recognised by the splicing mechanism. <br><br> In accordance with the present mvention, each" NS can be any suitable nucleotide 15 sequence. For example, each sequence can be independently DNA or RNA - which may be synthetically prepared or may be prepared by use of recombmant DNA techniques or may be isolated from natural sources or may be combmations thereof The sequence may be a sense sequence or an antisense sequence There may be a plurality of sequences, which may be directly or indirectly joined to each other, or combinations 20 thereof. <br><br> In accordance with the present invention, each NOI can be any suitable nucleotide sequence For example, each sequence can be independently DNA or RNA - which may be synthetically prepared or may be prepared by use of recombinant DNA techniques or 25 may be isolated from natural sources or may be combmations thereof The sequence may be a sense sequence or an antisense sequence There may be a plurality of sequences, which may be directly or indirectly joined to each other, or combinations thereof. <br><br> 30 The first NOI may include any one or more of the following selectable markers which have been used successfully in retroviral vectors, the bacterial neomycm and hygromycm <br><br> Printed from Mimosa <br><br> WO 99/15684 130 PCT/GB98/02885 <br><br> phosphotransferase genes which confer resistance to G418 and hygromycm respectively (Palmer et al 1987 Proc Natl Acad Sci 84' 1055-1059, Yang et al 1987 Mol Cell Biol 7: 3923-3928), a mutant mouse dihydrofolate reductase gene (dhfr) which confers resistance to methotrexate (Miller et al 1985 Mol Cell Biol 5 431-437), the bacterial gpt gene 5 which allows cells to grow in medium containing mycophenohc acid, xanthine and aminopterin (Mann et al 1983 Cell 33 153-159); the bacterial hisD gene which allows cells to grow in medium without histidine but containing histidinol (Danos and Mulligan 1988 Proc Natl Acad Sci 85: 6460-6464), the multidrug resistance gene (mdr) which confers resistance to a variety of drugs (Guild et al 1988 Proc Natl Acad Sci 85' 1595-10 1599; Pastan et al 1988 Proc Natl Acad Sci 85' 4486-4490) and the bacterial genes which confer resistance to puromycin or phleomycin (Morgenstern and Land 1990 Nucleic Acid Res 18 3587-3596). <br><br> All of these markers are dommant selectable markers and allow chemical selection of 15 most cells expressing these genes, p-galactosidase can also be considered a dominant marker; cells expressing p-galactosidase can be selected by using the fluorescence-activated cell sorter. In fact, any cell surface protem can provide a selectable marker for cells not already making the protem. Cells expressing the protem can be selected by using the fluorescent antibody to the protein and a cell sorter Other selectable markers 20 that have been included m vectors mclude the hprt and HSV thymidine kinase which allows cells to grow m medium containing hypoxanthine, amethopterm and thymidine. <br><br> The first NOI could contain non-coding sequences, for example the retroviral packaging site or non-sense sequences that render the second NOI non-functional in the provector 25 but when they are removed by the splicing the vector the second NOI is revealed for functional expression <br><br> The first NOI may also encode a viral essential element such as env encoding the Env protein which can reduce the complexity of production.systems By way of example, in 30 an adenoviral vector, this allows the retroviral vector genome and the envelope to be configured in a single adenoviral vector under the same promoter control thus providing <br><br> Printed from Mimosa <br><br> WO 99/15684 m PCT/GB98/02885 <br><br> a simpler system and leaving more capacity in the adenoviral vector for additional sequences. In one aspect, those additional sequences could be the gag-pol cassette itself. Thus m one adenoviral vector one can produce a retroviral vector particle. Previous studies (Feng et al 1997 Nature Biotechnology 15- 866) have required the use of multiple 5 adenoviral vectors. <br><br> If the retroviral component includes an env nucleotide sequence, then all or part of that sequence can be optionally replaced with all or part of another env nucleotide sequence such as, by way of example, the amphotropic Env protein designated 4070A or the <br><br> 10 influenza haemagglutimn (HA) or the vesicular stomatitis virus G (VSV-G) protein. Replacement of the env gene with a heterologous env gene is an example of a technique or strategy called pseudotyping Pseudotyping is not a new phenomenon and examples may be found in WO-A-98/05759, WO-A-98/05754, WO-A-97/17457, WO-A-96/09400, WO-A-91/00047 and Mebatsion et al 1997 Cell 90, 841-847. <br><br> 15 <br><br> In one preferred aspect, the retroviral vector of the present invention has been pseudotyped In this regard, pseudotyping can confer one or more advantages. For example, with the lentiviral vectors, the env gene product of the HIV based vectors would restrict these vectors to infecting only cells that express a protein called CD4 <br><br> 20 But if the env gene m these vectors has been substituted with env sequences from other RNA viruses, then they may have a broader infectious spectrum (Verma and Somia 1997 Nature 389 239-242). By way of example, workers have pseudotyped an HIV based vector with the glycoprotein from VSV (Verma and Somia 1997 ibid) <br><br> 25 In another alternative, the Env protem may be a modified Env protem such as a mutant or engineered Env protein Modifications may -be made or selected to introduce targetmg ability or to reduce toxicity or for another purpose (Valsesia-Wittman et al 1996 J Virol 70 2056-64, Nilson et al 1996 Gene Therapy 3 280-6; Fielding et al 1998 Blood 9 1802 and references cited therein) <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> Suitable second NOI coding sequences include those that are of therapeutic and/or diagnostic application such as, but are not limited to- sequences encoding cytokines, chemokines, hormones, antibodies, engineered immunoglobuhn-like molecules, a single chain antibody, fusion protems, enzymes, immune co-stimulatory molecules, 5 immunomodulatory molecules, anti-sense RNA, a transdormnant negative mutant of a target protein, a toxin, a conditional toxin, an antigen, a tumour suppressor protein and growth factors, membrane proteins, vasoactive proteins and peptides, anti-viral proteins and ribozymes, and derivatives therof (such as with an associated reporter group). When included, such coding sequences may be typically operatively linked to a suitable 10 promoter, which may be a promoter driving expression of a ribozyme(s), or a different promoter or promoters <br><br> The second NOI coding sequence may encode a fusion protein or a segment of a coding sequence <br><br> 15 <br><br> The retroviral vector of the present mvention may be used to deliver a second NOI such as a pro-drug activating enzyme to a tumour site for the treatment of a cancer. In each case, a suitable pro-drug is used in the treatment of the individual (such as a patient) in combination with the appropnate pro-drug activating enzyme. An appropriate pro-drug 20 is administered m conjunction with the vector Examples of pro-drugs include: etoposide phosphate (with alkaline phosphatase, Senter et al 1988 Proc Natl Acad Sci 85. 4842-4846), 5-fluorocytosine (with cytosme deaminase, Mullen et al 1994 Cancer Res 54 1503-1506); Doxorubicin-N-p-hydroxyphenoxyacetamide (with Pemcillin-V-Amidase, Kerr et al 1990 Cancer Immunol Immunother 31. 202-206); Para-N-bis(2-25 chloroethyl) aminobenzoyl glutamate (with carboxypeptidase G2), Cephalosporm nitrogen mustard carbamates (with P-lactamase), SR4233 (with P450 Reducase); Ganciclovir (with HSV thymidine kinase, Borrelli et al 1988 Proc Natl Acad Sci 85: 7572-7576), mustard pro-drugs with nitroreductase (Friedlos et al 1997 J Med Chem 40, 1270-1275) and Cyclophosphamide (with P450 Chen et al 1996 Cancer Res 56 30 1331-1340) <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> The vector of the present invention may be a delivered to a target site by a viral or a non-viral vector. <br><br> As it is well known m the art, a vector is a tool that allows or faciliates the transfer of an 5 entity from one environment to another By way of example, some vectors used in recombinant DNA techniques allow entities, such as a segment of DNA (such as a heterologous DNA segment, such as a heterologous cDNA segment), to be transferred into a target cell. Optionally, once within the target cell, the vector may then serve to maintain the heterologous DNA within the cell or may act as a unit of DNA replication. 10 Examples of vectors used in recombmant DNA techniques include plasmids, chromosomes, artificial chromosomes or viruses <br><br> Non-viral delivery systems mclude but are not limted to DNA transfection methods. Here, transfection includes a process using a non-viral vector to deliver a gene to a 15 target mammalian cell <br><br> Typical transfection methods include electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection, liposomes, immunoliposomes, <br><br> lipofectm, cationic agent-mediated, cationic facial amphiphiles (CFAs) (Nature 20 Biotechnolog\ 1996 14, 556), and combmations thereof <br><br> Viral deliver} systems include but are not limited to adenovirus vector, an adeno-associated viral (AAV) vector, a herpes viral vector, retroviral vector, lentiviral vector, baculoviral vector Other examples of vectors include ex vivo delivery systems, which 25 mclude but are not limited to DNA transfection methods such as electroporation, DNA biolistics, lipid-mediated transfection, compacted DNA-mediated transfection <br><br> The vector delivery system of the present invention may consist of a primary vector manufactured in vitro which encodes the genes necessary to produce a secondary vector 30 in vivo <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 134 <br><br> The primary viral vector or vectors may be a variety of different viral vectors, such as retroviral, adenoviral, herpes virus or pox virus vectors, or m the case of multiple primary viral vectors, they may be a mixture of vectors of different viral origin In whichever case, the primary viral vectors are preferably defective in that they are 5 incapable of independent replication. Thus, they are capable of entering a target cell and delivenng the secondary vector sequences, but not of replicating so as to go on to infect further target cells. <br><br> In the case where the hybrid viral vector system comprises more than one primary vector 10 to encode the secondary vector, both or all three primary vectors will be used to transfect or transduce a primary target cell population, usually simultaneously. <br><br> Preferably, there is a single primary viral vector which encodes all components of the secondary viral vector. <br><br> 15 <br><br> The preferred smgle or multiple primary viral vectors are adenoviral vectors. <br><br> Adenoviral vectors for use m the mvention may be derived from a human adenovirus or an adenovirus which does not normally mfect humans. Preferably the vectors are 20 derived from adenovirus type 2 or adenovirus type 5 (Ad2 or Ad5) or a mouse adenovirus or an avian adenovirus such as CELO virus (Cotton et al 1993 J Virol 67.3777-3785) The vectors may be replication competent adenoviral vectors but are more preferably defective adenoviral vectors Adenoviral vectors may be rendered defective by deletion of one or more components necessary for replication of the virus. 25 Typically, each adenoviral vector contains at least a deletion m the El region For production of infectious adenoviral vector particles, this deletion may be complemented by passage of the virus m a human embryo fibroblast cell line such as human 293 cell line, containing an integrated copy of the left portion of Ad5, including the El gene. The capacity for insertion of heterologous DNA u?to such vectors can be up to 30 approximately 7kb Thus such vectors are useful for construction of a system accordmg <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> to the invention comprising three separate recombinant vectors each containing one of the essential transcription units for construction of the retroviral secondary vector. <br><br> Alternative adenoviral vectors are known m the art which contain further deletions in 5 other adenoviral genes and these vectors are also suitable for use in the invention. Several of these second generation adenoviral vectors show reduced immunogenicity (eg El + E2 deletions Gorziglia et al 1996 J Virol 70 4173-4178; El + E4 deletions Yeh et al 1996 J Virol 70 559-565) Extended deletions serve to provide additional cloning capacity for the introduction of multiple genes in the vector. For example a 25 kb 10 deletion has been described (Lieber et al 1996 J .Virol 70: 8944-8960) and a cloning vector deleted of all viral genes has been reported (Fisher et al 1996 Virolology 217: 11-22) which permit the introduction of more than 35 kb of heterologous DNA Such vectors may be used to generate an adenoviral primary vector according to the invention encoding two or three transcription units for construction of the retroviral secondary 15 vector <br><br> The secondary viral vector is preferably a retroviral vector The secondary vector is produced by expression of essential genes for assembly and packagmg of a defective viral vector particle, within the primary target cells It is defective in that it is mcapable 20 of independent replication Thus, once the secondary retroviral vector has transduced a secondary target cell, it is incapable of spreading by replication to any further target cells <br><br> The term "retroviral vector" typically includes a retroviral nucleic acid which is capable 25 of infection, but which is not capable, by itself, of replication. Thus it is replication defective A retroviral vector typically comprises one or more NOI(s), preferably of non-retroviral origm, for delivery to target cells A retroviral vector may also comprises a functional splice donor site (FSDS) and a functional splice acceptor site (FSAS) so that when the FSDS is upstream of the FSAS, any intervening sequence(s) are capable of 30 being spliced A retroviral vector may comprise further non-retro viral sequences, such as non-retroviral control sequences in the U3 region which may influence expression of <br><br> Printed from Mimosa <br><br> WO 99/15684 ^ PCT/GB98/02885 <br><br> an NOI(s) once the retroviral vector is integrated as a provirus into a target cell. The retroviral vector need not contain elements from only a smgle retrovirus Thus, in accordance with the present mvention, it is possible to have elements derivable from two of more different retroviruses or other sources <br><br> 5 <br><br> The term "retroviral pro-vector" typically includes a retroviral vector genome as described above but which comprises a first nucleotide sequence (NS) capable of yielding a functional splice donor site (FSDs) and a second NS capable of yielding a functional splice acceptor site (FSAS) such that the first NS is downstream of the second NS so that 10 splicing associated with the first NS and the second NS cannot occur Upon reverse transcription of the retroviral pro-vector, a retroviral vector is formed. <br><br> The term '"retroviral vector particle" refers to the packaged retroviral vector, that is preferably capable of bmding to and entering target cells The components of the 15 particle, as already discussed for the vector, may be modified with respect to the wild type retrovirus. For example, the Env protems m the proteinaceous coat of the particle may be genetically modified in order to alter their targeting specificity or achieve some other desired function. <br><br> 20 The retrovual vector of this aspect of the mvention may be derivable from a murine oncoretrovirus such as MMLV, MSV or MMTV, or may be derivable from a lentivirus such as HFV-1, EIAV; or may be derivable from another retrovirus <br><br> The retroviral vector of the invention can be modified to render the natural splice donor 25 site of the retrovirus non-functional <br><br> The term "modification"' mcludes the silencing or removal of the natural splice donor. Vectors, such as MLV based vectors, which have the splice donor site removed are known in the art An example of such a vector is pBABE (Morgenstern et al 1990 ibid). <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> The secondary vector may be produced from expression of essential genes for retroviral vector production encoded in the DNA of the primary vector. Such genes may include a gag-pol gene from a retrovirus, an env gene from an enveloped virus and a defective retroviral vector containing one or more therapeutic or diagnostic NOI(s). The defective 5 retroviral vector contains in general terms sequences to enable reverse transcnption, at least part of a 5' long terminal repeat (LTR), at least pan of a 3'LTR and a packaging signal. <br><br> If it is desired to render the secondary vector replication defective, that secondary vector 10 may be encoded by a plurality of transcription units, which may be located m a single or in two or more adenoviral or other primary vectors Thus, there may be a transcription unit encoding the secondary vector genome, a transcription unit encoding gag-pol and a transcription unit encodmg env. Alternatively, two or more of these may be combined. For example, nucleic acid sequences encodmg gag-pol and env, or env and the genome, 15 may be combmed in a smgle transcription unit. Ways of achievmg thus are known in the art. <br><br> Transcnption units as described herein are regions of nucleic acid containing coding sequences and the signals for achieving expression of those coding sequences 20 independently of any other coding sequences. Thus, each transcription unit generally compnses at least a promoter, an enhancer and a polyadenylation signal. <br><br> The term "promoter" is used in the normal sense of the art, e.g. an RNA polymerase binding site m the Jacob-Monod theory of gene expression. <br><br> 25 <br><br> The term "enhancer" mcludes a DNA sequence which binds to other protein components of the transcription initiation complex and thus facilitates the initiation of transcription directed by us associated promoter <br><br> 30 The promoter and enhancer of the transcription units encoding the secondary vector are preferably strongly active, or capable of being strongly induced, in the primary target <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 1 Jo cells under conditions for production of the secondary viral vector The promoter and/or enhancer may be constitutively efficient, or may be tissue or temporally restricted in their activity Examples of suitable tissue restricted promoters/enhancers are those which are highly active m tumour cells such as a promoter/enhancer from a MUC1 gene, 5 a CEA gene or a 5T4 antigen gene. Examples of temporally restncted promoters/enhancers are those which are responsive to ischaemia and/or hypoxia, such as hypoxia response elements or the promoter/enhancer of a grp78 or a grp94 gene. One preferred promoter-enhancer combination is a human cytomegalovirus (hCMV) major immediate early (MIE) promoter/enhancer combination. <br><br> 10 <br><br> Other preferred additional components include entities enabling efficient expression of an NOI or a plurality of NOIs. <br><br> In one preferred aspect of the present invention, there is hypoxia or ischaemia 15 regulatable expression of the secondary vector components. In this regard, hypoxia is a powerful regulator of gene expression in a wide range of different cell types and acts by the mduction of the activity of hypoxia-inducible transcription factors such as hypoxia inducible factor-1 (HIF-1; Wang &amp; Semenza 1993 Proc Natl Acad Sci 90:430), which bind to cognate DNA recognition sites, the hypoxia-responsive elements (HREs) on 20 various gene promoters Dachs et al (1997 Nature Med 5. 515) have used a multimeric form of the HRE from the mouse phosphoglycerate kinase-1 (PGK-1) gene (Firth et al 1994 Proc Natl Acad Sci 91 6496-6500) to control expression of both marker and therapeutic genes by human fibrosarcoma cells in response to hypoxia in vitro and within solid tumours in vivo (Dachs et al tbtd). Alternatively, the fact that marked glucose 25 deprivation is also present m ischaemic areas of tumours can be used to activate heterologous gene expression specifically in tumours A truncated 632 base pair sequence of the grp 78 gene promoter, known to be activated specifically by glucose deprivation, has also been shown to be capable of driving high level expression of a reporter gene m murine tumours in vivo (Gazit et al 1995 Cancer Res 55'1660) <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> An alternative method of regulating the expression of such components is by using the tetracycline on/off system described by Gossen and Bujard (1992 Proc Natl Acad Sci 89 5547) as descnbed for the production of retroviral gal, pol and VSV-G protems by Yoshida et al (1997 Biochem Biophys Res Comm 230: 426). Unusually this regulatory 5 system is also used m the present invention to control the production of the pro-vector genome. This ensures that no vector components are expressed from the adenoviral vector in the absence of tetracycline <br><br> Safety features which may be incorporated mto the hybrid viral vector system are 10 described below One or more such features may be present. <br><br> The secondary vector is also advantageous for in vivo use in that incorporated mto it are one or more features which eliminate the possibility of recombination to produce an infectious virus capable of independent replication. Such features were not included in 15 previous published studies (Feng et al 1997 ibid). In particular, the construction of a retroviral vector from three components as described below was not described by Feng et al (ibid) <br><br> Firstly, sequence homology between the sequences encoding the components of the 20 secondary vector may be avoided by deletion of regions of homology. Regions of homology allow genetic recombination to occur. In a particular embodiment, three transcription units are used to construct a secondary retroviral vector The first transcription unit contains a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The second transcription unit contains a retroviral env gene 25 under the control of a non-retroviral promoter and enhancer. The third transcription unit compnses a defective retroviral genome under the control of a non-retroviral promoter and enhancer In the native retroviral genome, the packaging signal is located such that part of the gag sequence is required for proper functioning. Normally when retroviral vector systems are constructed therefrom, the packaging signal, including part of the gag 30 gene, remains in the vector genome In the present case however, the defective retroviral genome contains a minimal packaging signal which does not contain sequences <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 140 <br><br> homologous to gag sequences in the first transcription unit Also, in retroviruses, for example Moloney Murme Leukaemia virus (MMLV), there is a small region of overlap between the 3' end of the pol coding sequence and the 5' end of env The correspondmg region of homology between the first and second transcription units may be removed by 5 altering the sequence of either the 3' end of the pol coding sequence or the 5' end of env so as to change the codon usage but not the ammo acid sequence of the encoded proteins. <br><br> Secondly, the possibility of replication competent secondary viral vectors may be avoided by pseudotyping the genome of one retrovirus with the Env protein of another 10 retrovirus or another enveloped virus so that regions of homology between the env and gag-pol components are avoided. <br><br> In a particular embodiment the retroviral vector is constructed from the following three components The first transcription umt contains a retroviral gag-pol gene under the 15 control of a non-retroviral promoter and enhancer. The second transcription unit contains the env gene from the alternative enveloped virus, under the control of a non-retroviral promoter and enhancer. The third transcription unit compnses a defective retroviral genome under the control of a non-retroviral promoter and enhancer. The defective retroviral genome contains a minimal packaging signal which does not contain 20 sequences homologous to gag sequences in the first transcription unit <br><br> Thirdly, the possibility of replication competent retroviruses can be eliminated by using two transcription umts constructed in a particular way The first transcription umt contains a gag-pol coding region under the control of a promoter-enhancer active m the 25 primary target cell such as a hCMV promoter-enhancer or a tissue restricted promoter-enhancer The second transcription unit encodes a retroviral genome RNA capable of being packaged into a retroviral particle. The second transcription unit contains retroviral sequences necessary for packaging, integration and reverse transcription and also contains sequences coding for an env protem of ap enveloped virus and the codmg 30 sequence of one or more therapeutic genes <br><br> Printed from Mimosa <br><br> WO 99/15684 m PCT/GB98/02885 <br><br> In this example, the transcription of the env and an NOI codmg sequences is devised such that the Env protein is preferentially produced in the pnmary target cell while the NOI expression product is or are preferentially, produced in the secondary target cell <br><br> 5 A suitable intron splicmg arrangement is described later on in Example 5 and illustrated in Figure 17 and Figure 27c Here, a splice donor site is positioned downstream of a splice acceptor site in the retroviral genome sequence delivered by the primary vector to the pnmary target cell. Splicmg will therefore be absent or infrequent in the primary target cell so the Env protem will preferentially be expressed. However, once the vector 10 genome has gone through the process of reverse transcription and integration into the secondary target cell, a functional splice donor sequence will be located in the 5' LTR, upstream of a functional splice acceptor sequence Splicmg occurs to splice out the env sequence and transcripts of the NOI are produced. <br><br> 15 In a second arrangement of this example, the expression of an NOI is restricted to the secondary target cell and prevented from being expressed in the primary target cell as follows. This arrangement is described later on m Example 6 and illustrated in Figure 18 There, a promoter-enhancer and a first fragment of an NOI containing the 5' end of the coding sequence and a natural or artificially denved or derivable splice donor 20 sequence are inserted at the 3' end of the retroviral genome construct upstream of the R-region A second fragment of the NOI which contams all the sequences required to complete the codmg region is placed downstream of a natural or artificially derived or derivable splice acceptor sequence located downstream from the packaging signal m the retroviral genome construct On reverse transcription and integration of the retroviral 25 genome in the secondary target cell, the promoter 5' fragment of the NOI and the functional splice donor sequence are located upstream of the functional splice acceptor and the 3' end of the NOI. Transcription from the promoter and splicmg then permit translation of the NOI m the secondary target cell <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> In a preferred embodiment the hybrid viral vector system accordmg to the invention comprises smgle or multiple adenoviral primary vectors which encodes or encode a retroviral secondary vector <br><br> 5 Preferred embodiments of the present invention described address one of the major problems associated with adenoviral and other viral vectors, namely that gene expression from such vectors is transient. The retroviral particles generated from the primary target cells can transduce secondary target cells and gene expression m the secondary target cells is stably maintained because of the integration of the retroviral vector genome mto 10 the host cell genome. The secondary target cells do not express significant amounts of viral protein antigens and so are less immunogenic than cells transduced with adenoviral vector. <br><br> The use of a retroviral vector as the secondary vector is advantageous because it allows a 15 degree of cellular discrimination, for instance by permitting the targeting of rapidly dividing cells. Furthermore, retroviral integration permits the stable expression of therapeutic genes in the target tissue, including stable expression in proliferating target cells. <br><br> 20 The use of the novel retroviral vector design of the present mvention is also advantageous m that gene expression can be limited to a primary or a secondary target site In this way, smgle or multiple NOIs can be preferentially expressed at a secondary target site and poorly expressed or not expressed at a biologically significant level at a primary target site As a result, the possible toxicity or antigenicity of an NOI may be 25 avoided <br><br> Preferably, the primary viral vector preferentially transduces a certain cell type or cell types <br><br> Printed from Mimosa <br><br> WO 99/15684 J43 PCT/GB98/02885 <br><br> More preferably, the pnmary vector is a targeted vector, that is it has a tissue tropism which is altered compared to the native virus, so that the vector is targeted to particular cells. <br><br> 5 The term "targeted vector" is not necessarily linked to the term "target site" or target cell". <br><br> "Target site" refers to a site which a vector, whether native or targeted, is capable of transfecting or transducing <br><br> 10 <br><br> "Primary target site" refers to a first site which a vector, whether native or targeted, is capable of transfecting or transducing. <br><br> "Secondary target site" refers to a second site which a vector, whether native or 15 targeted, is capable of transfecting or transducing. <br><br> "Target cell" simply refers to a cell which a vector, whether native or targeted, is capable of transfectmg or transducmg. <br><br> 20 "Primary target cell" refers to a first cell which a vector, whether native or targeted, is capable of transfecting or transducing <br><br> "Secondary target cell" refers to a second cell which a vector, whether native or targeted, is capable of transfecting or transducing <br><br> 25 <br><br> The preferred, adenoviral pnmary vector according to the invention is also preferably a targeted vector, in which the tissue tropism of the vector is altered from that of a wild-type adenovirus. Adenoviral vectors can be modified to produce targeted adenoviral vectors for example as described m. Krasnykh et fll 1996 J Virol 70 6839-6846, 30 Wickham et al 1996 J Virol 70' 6831-6838; Stevenson et al 1997 J Virol 71 4782- <br><br> Prmted from Mimosa <br><br> WO 99/15684 ^ PCT/GB98/02885 <br><br> 4790, Wickham et al 1995 Gene Therapy 2 750-756, Douglas et al 1997 Neuromuscul Disord 7 284-298, Wickham et al 1996 Nature Biotechnology 14. 1570-1573. <br><br> Primary target cells for the vector system according to the mvention mclude 5 haematopoietic cells (including monocytes, macrophages, lymphocytes, granulocytes or progenitor cells of any of these); endothelial cells, tumour cells; stromal cells; astrocytes or glial cells; muscle cells; and epithelial cells. <br><br> Thus, a primary target cell according to the mvention, capable of producing the second 10 viral vector, may be of any of the above cell types <br><br> In a preferred embodiment, the primary target cell accordmg to the mvention is a monocyte or macrophage transduced by a defective adenoviral vector containing a first transcription umt for a retroviral gag-pol and a second transcription umt capable of 15 producmg a packageable defective retroviral genome In this case at least the second transcription unit is preferably under the control of a promoter-enhancer which is preferentially active in a diseased location within the body such as an ischaemic site or the micro-environment of a solid tumour <br><br> 20 In a particularly preferred embodiment, the second transcription unit is constructed such that on insertion of the genome into the secondary target cell, an intron is generated which serves to reduce expression of a viral essential element, such as the viral env gene, and permit efficient expression of a therapeutic and/or diagnostic NOI or NOIs <br><br> 25 The packagmg cell may be an in vivo packagmg cell m the body of an individual to be treated or it may be a cell cultured in vitro such as a tissue culture cell line. Suitable cell lmes include mammalian cells such as murme fibroblast derived cell lines or human cell lines Preferably the packaging cell line is a human cell line, such as for example. HEK293, 293-T, TE671, HT1080 <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> Alternatively, the packaging cell may be a cell derived from the individual to be treated such as a monocyte, macrophage, blood cell or fibroblast The cell may be isolated from an individual and the packagmg and vector components administered ex vivo followed by re-administration of the autologous packaging cells Alternatively the 5 packaging and vector components may be administered to the packagmg cell in vivo. Methods for introducing retroviral packaging and vector components mto cells of an individual are known in the art. For example, one approach is to mtroduce the different DNA sequences that are required to produce a retroviral vector particle e.g. the env coding sequence, the gag-pol coding sequence and the defective retroviral genome into 10 the cell simultaneously by transient triple transfection (Landau &amp; Littman 1992 J. Virol. 66, 5110, Soneoka et al 1995 Nucleic Acids Res 23'628-633) <br><br> The secondary viral vectors may also be targeted vectors. For retroviral vectors, this may be achieved by modifying the Env protem The Env protem of the retroviral 15 secondary vector needs to be a non-toxic envelope or an envelope which may be produced in non-toxic amounts within the primary-target cell, such as for example a MMLV amphotropic envelope or a modified amphotropic envelope. The safety feature m such a case is preferably the deletion of regions or sequence homology between retroviral components. <br><br> 20 <br><br> Preferably the envelope is one which allows transduction of human cells Examples of suitable env genes mclude, but are not limited to, VSV-G, a MLV amphotropic env such as the 4070A env, the RD114 feline leukaemia virus env or haemagglutmin (HA) from an influenza virus The Env protein may be one which is capable of binding to a 25 receptor on a limited number of human cell types and may be an engineered envelope containing targetmg moieties The env and gag-pol codmg sequences are transcribed from a promoter and optionally an enhancer active in the chosen packagmg cell line and the transcription unit is terminated by a polyadenylation signal For example, if the packaging cell is a human cell, a suitable promoter-enhancer combination is that from the 30 human cytomegalovirus major immediate early (hCMV-MIE) gene and a polyadenylation <br><br> Printed from Mimosa <br><br> WO 99/15684 H6 PCT/GB98/02885 <br><br> signal from SV40 virus may be used. Other suitable promoters and polyadenylation signals are known m the art <br><br> The secondary target cell population may be the same as the pnmary target cell 5 population. For example delivery of a pnmary vector of the mvention to tumour cells leads to replication and generation of further vector panicles which can transduce further tumour cells. <br><br> Alternatively, the secondary target cell population may be different from the primary 10 target cell population In this case the primary target cells serve as an endogenous factory within the body of the treated individual and produce additional vector particles which can transduce the secondary target cell population For example, the primary target cell population may be haematopoietic cells transduced by the primary vector in vivo or ex vivo The primary target cells are then delivered to or migrate to a sue within 15 the body such as a tumour and produce the secondary vector particles, which are capable of transducing for example mitotically active tumour cells within a solid tumour. <br><br> The retroviral vector particle according to the invention will also be capable of transducing cells which are slowly-dividing, and which non-lentiviruses such as MLV 20 would not be able to efficiently transduce. Slowly-dividing cells divide once m about every three to four days including certain tumour cells Although tumours contam rapidly dividing cells, some tumour cells especially those in the centre of the tumour, divide infrequently Alternatively the target cell may be a growth-arrested cell capable of undergomg ceil division such as a cell in a central portion of a tumour mass or a stem 25 cell such as a haematopoietic stem cell or a CD34-posmve cell. As a further alternative, the target cell may be a precursor of a differentiated cell such as a monocyte precursor, a CD33-positive cell, or a myeloid precursor. As a further alternative, the target cell may be a differentiated cell such as a neuron, astrocyte, glial cell, microglial cell, macrophage, monocyte, epithelial cell, endothelial .cell, hepatocyte, spermatocyte, 30 spermatid or spermatozoa Target cells may be transduced either in vitro after isolation from a human individual or may be transduced directly in vivo. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 147 <br><br> PCT/GB98/02885 <br><br> The mvention permits the localised production of high titres of defective retroviral vector particles in vivo at or near the site at which action of a therapeutic protein or protems is required with consequent efficient transduction of secondary target cells This is more 5 efficient than using either a defective adenoviral vector or a defective retroviral vector alone. <br><br> The invention also permits the production of retroviral vectors such as MMLV-based vectors in non-dividmg and slowly-dividing cells in vivo It had previously been possible 10 to produce MMLV-based retroviral vectors only in rapidly dividing cells such as tissue culture-adapted cells proliferating in vitro or rapidly dividing tumour cells in vivo. Extending the range of cell types capable of producing retroviral vectors is advantageous for delivery of genes to the cells of solid tumours, many of which are dividing slowly, and for the use of non-dividmg cells such as endothelial cells and cells of various 15 haematopoietic lineages as endogenous factories for the production of therapeutic protein products. <br><br> The delivery of one or more therapeutic genes by a vector system according to the present invention may be used alone or m combination with other treatments or 20 components of the treatment. <br><br> For example, the retroviral vector of the present mvention may be used to deliver one or more NOI(s) useful m the treatment of the disorders listed in WO-A-98/05635. For ease of reference, part of that list is now provided, cancer, inflammation or inflammatory 25 disease, dermatological disorders, fever, cardiovascular effects, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, HIV mfection, shock states, graft-versus-host reactions, autoimmune disease, reperfusion mjury, meningitis, migrame and aspirin-dependent anti-thrombosis, tumour growth, invasion and spread, angiogenesis, metastases, malignant, ascites and malignant pleural effusion; 30 cerebral ischaemia, ischaemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, <br><br> Printed from Mimosa <br><br> WO 99/15684 14g PCT/GB98/02885 <br><br> atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis, gingivitis; psoriasis, atopic dermatitis, chronic ulcers, epidermolysis bullosa; corneal ulceration, retinopathy and surgical wound healmg, rhinitis, allergic conjunctivitis, eczema, anaphylaxis; restenosis, congestive heart failure, endometriosis, atherosclerosis 5 or endosclerosis. <br><br> In addition, or in the alternative, the retroviral vector of the present mvention may be used to deliver one or more NOI(s) useful in the treatment of disorders listed in WO-A-98/07859. For ease of reference, part of that list is now provided: cytokine and cell 10 proliferation/differentiation activity; immunosuppressant or immunostimulant activity (e.g. for treating immune deficiency, including infection with human immune deficiency virus; regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or mduce tumour immunity); regulation of haematopoiesis, e.g treatment of myeloid or lymphoid diseases, promoting growth of 15 bone, cartilage, tendon, ligament and nerve tissue, e g for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration, inhibition or activation of follicle-stimulating hormone (modulation of fertility), chemotactic/chemokinetic activity (e.g for mobilising specific cell types to sites of injury or infection), haemostatic and thrombolytic activity (e g for treating haemophilia and stroke), antiinflammatory activity 20 (for treating e g septic shock or Crohn's disease), as antimicrobials; modulators of e g. metabolism or behaviour, as analgesics, treating specific deficiency disorders; m treatment of e g. psoriasis, m human or veterinary medicine <br><br> In addition, or in the alternative, the retroviral vector of the present mvention may be 25 used to deliver one or more NOI(s) useful in the treatment of disorders listed m WO-A-98/09985 For ease of reference, part of that list is now provided- macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity; anti-immune activity, i e inhibitory effects against a cellular and/or humoral immune response, mcludmg a response not associated with inflammation, inhibit the ability of 30 macrophages and T cells to adhere to extracellular matrix components and fibronectm, as well as up-regulated fas receptor expression in T cells; inhibit unwanted immune reaction <br><br> Printed from Mimosa <br><br> wo 99/15684 ^ PCT/GB98/02885 <br><br> and inflammation including arthritis, including rheumatoid arthritis, inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion 5 injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, glomerulonephritis or other renal and urologic diseases, otitis or 10 other oto-rhmo-laryngological diseases, dermatitis or other dermal diseases, periodontal diseases or other dental diseases, orchitis or epididimo-orchitis, infertility, orchidal trauma or other immune-related testicular diseases, placental dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-eclampsia and other immune and/or inflammatory-related gynaecological diseases, posterior uveitis, intermediate uveitis, 15 anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, intraocular inflammation, e g. retinitis or cystoid macular oedema, sympathetic ophthalmia, sclerins, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by mfection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, 20 excessive scarring, e g. following glaucoma filtration operation, immune and/or inflammation reaction against ocular implants and other immune and inflammatory-related ophthalmic diseases, inflammation associated with autoimmune diseases or conditions or disorders where, both m the central nervous system (CNS) or in any other organ, immune and/or inflammation suppression would be beneficial, Parkinson's 25 disease, complication and/or side effects from treatment of Parkinson's disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, inflammatory components of stokes, post-polio syndrome, immune and inflammatory components of psychiatric disorders, myelitis, encephalitis, subacute 30 sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Guillaim-Barre syndrome, Sydenham chora, myasthenia gravis, <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, amyotrophic lateral sclerosis, inflammatory components of CNS compression or CNS trauma or infections of the CNS, mflammatory components of muscular atrophies and dystrophies, and immune and inflammatory related diseases, conditions or disorders of the central and peripheral 5 nervous systems, post-traumatic inflammation, septic shock, infectious diseases, mflammatory complications or side effects of surgery, bone marrow transplantation or other transplantation complications and/or side effects, inflammatory and/or immune complications and side effects of gene therapy, e.g due to infection with a viral carrier, or inflammation associated with AIDS, to suppress or inhibit a humoral and/or cellular 10 immune response, to treat or ameliorate monocyte or leukocyte proliferative diseases, e.g. leukaemia, by reducing the amount of monocytes or lymphocytes, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue <br><br> 15 Further provided according to the invention are methods of controlling production of a therapeutic NOI or NOIs such that the therapeutic NOI or NOIs is/are preferentially expressed in a secondary target cell population and is/are poorly expressed or not expressed at a biologically significant level m a primary target cell. <br><br> 20 The present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of the retroviral vector of the present mvention comprising one or more deliverable therapeutic and//or diagnostic NOI(s) or a viral particle produced by or obtained from same The pharmaceutical composition may be for human or ammal 25 usage. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular individual <br><br> The composition may optionally comprise a pharmaceutical^ acceptable carrier, diluent, 30 excipient or adjuvant The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical <br><br> Printed from Mimosa <br><br> WO 99/15684 151 PCT/GB98/02885 <br><br> practice The pharmaceutical compositions may comprise as - or m addition to - the earner, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system). <br><br> 5 <br><br> Where appropriate, the pharmaceutical compositions can be administered by any one or more of. inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules 10 either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example 15 enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner. <br><br> In a further aspect of the present invention, there is provided a hybrid viral vector system 20 in the general sense (i e not necessarily limited to the aforementioned first aspect of the present mvention as defined above) for in vivo gene delivery, which system compnses one or more pnmary viral vectors which encode a secondary viral vector, the primary vector or vectors capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell. <br><br> 25 <br><br> With this particular embodiment, the genetic vector of the invention is thus a hybrid viral vector system for gene delivery which is capable of generation of defective infectious particles from within a target cell Thus a genetic vector of the invention consists of a primary vector manufactured in vitro which encodes the genes necessary to produce a 30 secondary vector in vivo In use, the secondary vector carries one or more selected genes <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> for insertion into the secondary target cell The selected genes may be one or more marker genes and/or therapeutic genes Marker genes encode selectable and/or detectable proteins. <br><br> More aspects concerning this particular aspect of the present invention now follow - which 5 teachings are also applicable to the aforementioned aspects of the present invention. <br><br> In another aspect the mvention provides target cells infected by the primary viral vector or vectors and capable of producing infectious secondary viral vector particles. <br><br> 10 In a further aspect the mvention provides a method of treatment of a human or non-human mammal, which method compnses administering a" hybrid viral vector system or target cells infected bv the pnmary viral vector or vectors, as descnbed herem. <br><br> The pnmary viral vector or vectors may be a variety of different viral vectors, such as 15 retroviral, adenoviral, herpes virus or pox virus vectors, or m the case of multiple primary viral vectors, they may be a mixture of vectors of different viral ongin In whichever case, the pnmary viral vectors are preferably defective in that they are incapable of independent replication Thus, they are capable of entenng a target cell and delivenng the secondary vector sequences, but not of replicating so as to go on to infect further target cells. <br><br> 20 <br><br> In the case where the hybnd viral vector system compnses more than one pnmary vector to encode the secondary vector, both or all three pnmary vectors will be used to infect a pnmary target cell population, usually simultaneously Preferably, there is a smgle pnmary virai vector which encodes all components of the secondary viral vector. <br><br> 25 <br><br> The preferred smgle or multiple pnmary viral vectors are adenoviral vectors Adenovirus vectors have significant advantages over other viral vectors in terms of the titres which can be obtained from in vitro cultures The adenoviral particles are also comparatively stable compared with those of enveloped viruses and are therefore more readily punfied and 30 stored Howe\ er, current adenoviral vectors suffer from major limitations for in vivo therapeutic use since gene expression from defective adenoviral vectors is only transient. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 153 <br><br> PCT/GB98/02885 <br><br> Because the vector genome does not replicate, target cell proliferation leads to dilution of the vector. Also cells expressing adenoviral proteins, even at a low level, are destroyed by an immunological response raised against the adenoviral proteins. <br><br> 5 The secondary viral vector is preferably a retroviral vector. The secondary vector is produced by expression of essential genes for assembly and packaging of a defective viral vector particle, within the pnmary target cells It is defective in that it is incapable of independent replication Thus, once the secondary retroviral vector has transduced a secondary target cell, it is incapable of spreading by replication to any further target cells. <br><br> 10 <br><br> The secondary vector may be produced from expression of essential genes for retroviral vector production encoded in the DNA of the pnmary vector. Such genes may include a gag-pol gene from a retrovirus, an envelope gene from an enveloped virus and a defective retroviral genome containing one or more therapeutic genes. The defective retroviral 15 genome contains m general terms sequences to enable reverse transcnption, at least part of a 5' long terminal repeat (LTR), at least part of a 3'LTR and a packaging signal. <br><br> Importantly, the secondary vector is also safe for in vivo use m that incorporated into it axe one or more safety features which eliminate the possibility of recombination to produce an 20 infectious virus capable of independent replication <br><br> To ensure that it is replication defective the secondary vector may be encoded by a plurality of transcription units, which may be located m a single or in two or more adenoviral or other pnmary vectors Thus, there may be a transcnption umt encodmg the 25 secondary vector genome, a transcnption umt encoding gag-pol and a transcnption unit encoding env Alternatively, two or more of these may be combined For example, nucleic acid sequences encoding gag-pol and env, or env and the genome, may be combined m a smgle transcnption unit Ways of achieving this are known in the art. <br><br> 30 Transcnption units as descnbed herein are regions of nucleic acid containing coding sequences and the signals for achieving expression of those coding sequences <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 154 <br><br> independently of any other coding sequences Thus, each transcnption unit generally comprises at least a promoter, an enhancer and a polyadenylation signal. The promoter and enhancer of the transcnption units encoding the secondary vector are preferably strongly active, or capable of being strongly induced, in the pnmary target cells under conditions for 5 production of the secondary viral vector. The promoter and/or enhancer may be constitutively efficient, or may be tissue or temporally restncted in their activity. Examples of suitable tissue restncted promoters/enhancers are those which are highly active in tumour cells such as a promoter/enhancer from a MUC1 gene, a CEA gene or a 5T4 antigen gene. Examples of temporally restncted promoters/enhancers are those which 10 are responsive to ischaemia and/or hypoxia, such as hypoxia response elements or the promoter/enhancer of a grp78 or a grp94 gene One prefened promoter-enhancer combination is a human cytomegalovirus (hCMV) major immediate early (MIE) promoter/enhancer combmation. <br><br> 15 Hypoxia or ischaemia regulatable expression of secondary vector components may be particularly useful under certain circumstances. Hypoxia is a powerful regulator of gene expression m a wide range of different cell types and acts by the induction of the activity of hypoxia-inducible transcnption factors such as hypoxia inducible factor-1 (HIF-1, Wang &amp; Semenza (1993) Proc Natl Acad. Sci USA 90'430), which bind to cognate DNA 20 recognition sites, the hypoxia-responsive elements (HREs) on vanous gene promoters Dachs e: al (1997) Nature Med 5. 515.) have used a multimenc form of the HRE from the mouse phosphoglycerate kinase-1 (PGK-1) gene (Firth et al. (1994) Proc Natl Acad. Sci USA 91 6496-6500) to control expression of both marker and therapeutic genes by human fibrosarcoma cells in response to hypoxia in vitro and within solid tumours in vivo (Dachs 25 et al ibid) Alternatively, the fact that marked glucose depnvation is also present in ischaemic areas of tumours can be used to activate heterologous gene expression specifically m tumours A truncated 632 base pair sequence of the grp 78 gene promoter, known to be activated specifically by glucose depnvation, has also been shown to be capable of dnvmg high level expression of a reporter gene m munne tumours in vivo (Gazit 30 G, e/a/(1995) Cancer Res 55 1660). <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> Safety features which may be incorporated into the hybrid viral vector system are described below One or more such features may be present <br><br> Firstly, sequence homology between the sequences encoding the components of the 5 secondary vector may be avoided by deletion of regions of homology Regions of homology allow genetic recombination to occur. In a particular embodiment, three transcnption units are used to construct a secondary retroviral vector. A first transcnption unit contains a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer A second transcnption unit contains a retroviral env gene under the control of a 10 non-retroviral promoter and enhancer. A third transcription unit compnses a defective retroviral genome under the control of a non-retroviral promoter and enhancer. In the native retroviral genome, the packaging signal is located such that pan of the gag sequence is required for proper functioning. Normally when retroviral vector systems are constructed therefore, the packagmg signal, mcludmg part of the gag gene, remains in the 15 vector genome In the present case however, the defective retroviral genome contains a minimal packagmg signal which does not contain sequences homologous to gag sequences m the first transcnption umt. Also, m retroviruses, for example Moloney Munne Leukaemia virus (MMLV), there is a small region of overlap between the 3' end of the pol coding sequence and the 5' end of env The corresponding region of homology between 20 the first and second transcnption units may be removed by altenng the sequence of either the 3' end of the pol codmg sequence or the 5' end of env so as to change the codon usage but not the amino acid sequence of the encoded proteins. <br><br> Secondly, the possibility of replication competent secondary viral vectors may be avoided 25 by pseudotyping the genome of one retrovirus with the envelope protein of another retrovirus or another enveloped virus so that regions of homology between the env and gag-pol components are avoided. In a particular "embodiment the retroviral vector is constructed from the following three components The first transcnption unit contains a retroviral gag-pol gene under the control of a non-retroviral promoter and enhancer. The 30 second transcnption umt contains the env gene from the alternative enveloped virus, under the control of a non-retroviral promoter and enhancer. The third transcription unit <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 156 <br><br> PCT/GB98/02885 <br><br> compnses a defective retroviral genome under the control of a non-retroviral promoter and enhancer. The defective retroviral genome contains a minimal packaging signal which does not contain sequences homologous to gag sequences m the first transcnption umt. <br><br> 5 Pseudotyping may involve for example a retroviral genome based on a lentivirus such as an HIV or equine infectious anaemia virus (EIAV) and the envelope protein may for example be the amphotropic envelope protein designated 4070A. Alternatively, the retroviral genome may be based on MMLV and the envelope protein may be a protem from another virus which can be produced m non-toxic amounts within the pnmary target cell such as an 10 Influenza haemagglutinin or vesicular stomatitis virus-G protem In another alternative, the envelope protem may be a modified envelope protem such as a mutant or engineered envelope protem. Modifications may be made or selected to introduce targeting ability or to reduce toxicity or for another purpose. <br><br> 15 Thirdly, the possibility of replication competent retroviruses can be eliminated by using two transcnption units constructed in a particular way The first transcription umt contains a gag-pol coding region under the control of a promoter-enhancer active m the pnmary target cell such as a hCMV promoter-enhancer or a tissue restricted promoter-enhancer. The second transcnption umt encodes a retroviral genome RNA capable of being packaged 20 into a retroviral particle The second transcnption- umt contains retroviral sequences necessary for packaging, integration and reverse transcnption and also contains sequences codmg for an env protein of an enveloped virus and the coding sequence of one or more therapeutic genes <br><br> 25 In a preferred embodiment the hybnd viral vector system according to the invention compnses single or multiple adenoviral primary vectors which encodes or encode a retroviral secondary vector Adenoviral vectors for use in the invention may be denved from a human adenovirus or an adenovirus which does not normally mfect humans. Preferably the vectors are denved from Adenovirus Type 2 or adenovirus Type 5 (Ad2 or 30 Ad5) or a mouse adenovirus or an avian adenovirus such as CELO virus (Cotton et al 1993 J Virol. 67:3777-3785). The vectors may be replication competent adenoviral vectors but <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 157 <br><br> PCT/GB98/02885 <br><br> are more preferably defective adenoviral vectors Adenoviral vectors may be rendered defective by deletion of one or more components necessary for replication of the virus. Typically, each adenoviral vector contains at least a deletion m the El region. For production of infectious adenoviral vector particles, this deletion may be complemented by 5 passage of the virus in a human embryo fibroblast cell line such as human 293 cell line, containing an integrated copy of the left portion of Ad5, including the El gene. The capacity for insertion of heterologous DNA into such vectors can be up to approximately 7kb. Thus such vectors are useful for construction of a system according to the invention comprising three separate recombinant vectors each containing one of the essential l o transcnption units for construction of the retroviral secondary vector. <br><br> Alternative adenoviral vectors are known m the art which contain further deletions in other adenoviral genes and these vectors are also suitable for use in the invention. Several of these second generation adenoviral vectors show reduced immunogenicity (eg El + E2 15 deletions Goraglia et al 1996 J. Virol. 70: 4173-4178, El + E4 deletions Yeh et al 1996 J. Virol. 70. 559-565) Extended deletions serve to provide additional cloning capacity for the introduction of multiple genes in the vector For example a 25 kb deletion has been descnbed (Lieber et al 1996 J Virol. 70 8944-8960) and a cloning vector deleted of all viral genes has been reported (Fisher et al 1996 Virolology 217. 11-22.) which will permit 20 the introduction of more than 35kb of heterologous DNA Such vectors may be used to generate an adenoviral primary vector accordmg to the invention encodmg two or three transcnption units for construction of the retroviral secondary vector Embodiments of the invention descnbed solve one of the major problems associated with adenoviral and other viral vectors, namely that gene expression from such vectors is 25 transient. The retroviral particles generated from the pnmary target cells can infect secondary target cells and gene expression in the secondary target cells is stably maintained because of the integration of the retroviral vector genome into the host cell genome The secondary target cells do not express significant amounts of viral protein antigens and so are less immunogenic than the cells transduced with adenoviral vector. <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 158 <br><br> PCT/GB98/02885 <br><br> The use of a retroviral vector as the secondary vector is also advantageous because it allows a degree of cellular discrimination, for instance by permitting the targeting of rapidly dividing cells Furthermore, retroviral integration permits the stable expression of therapeutic genes m the target tissue, including stable expression in proliferating target 5 cells <br><br> Preferably, the pnmary viral vector preferentially infects a certain cell type or cell types. More preferably, the pnmary vector is a targeted vector, that is it has a tissue tropism which is altered compared to the native virus, so that the vector is targeted to particular 10 cells The term "targeted vector" is not necessanly linked to the term "target cell". "Target cell" simply refers to a cell which a vector, whether native or targeted, is capable of infecting or transducing. <br><br> The preferred, adenoviral pnmary vector according to the invention is also preferably a 15 targeted vector, in which the tissue tropism of the vector is altered from that of a wild-type adenovirus Adenoviral vectors can be modified to produce targeted adenoviral vectors for example as descnbed m Krasnykh et al. 1996 J Virol 70 6839-6846; Wickham et al 1996 J. Virol 70 6831-6838, Stevenson et al. 1997 J. Virol. 71. 4782-4790, Wickham et al. 1995 Gene Therapy 2. 750-756, Douglas et al 1997 Neuromuscul Disord. 7 284-298, 20 Wickham et al. 1996 Nature Biotechnology 14 1570-1573 <br><br> Primary target cells for the vector system according to the mvention mclude but are not limited to haematopoietic cells (including monocytes, macrophages, lymphocytes, granulocytes or progemtor cells of any of these); endothelial cells; tumour cells; stromal 25 cells, astrocytes or glial cells; muscle cells; and epithelial cells. <br><br> Thus, a pnmary target cell according to the invention, capable of producing the second viral vector, may be of any of the above cell types In a prefened embodiment, the pnmary target cell according to the invention is a monocyte or macrophage infected by a defective 30 adenoviral vector containing a first transcnption unit for a retroviral gag-pol and a second transcnption unit capable of producing a packageable defective retroviral genome. In this <br><br> Printed from Mimosa <br><br> WO 99/15684 159 PCT/GB98/02885 <br><br> case at least the second transcnption unit is preferably under the control of a promoter-enhancer which is preferentially active in a diseased location within the body such as an ischaemic site or the micro-environment of a solid tumour In a particularly preferred embodiment of this aspect of the invention, the second transcnption umt is constructed 5 such that on insertion of the genome into the secondary target cell, an intron is generated which serves to reduce expression of the viral env gene and permit efficient expression of a therapeutic gene. <br><br> The secondary viral vectors may also be targeted vectors For retroviral vectors, this may 10 be achieved by modifying the envelope protein. The envelope protem of the retroviral secondary vector needs to be a non-toxic envelope or-an envelope which may be produced in non-toxic amounts within the pnmary target cell, such as for example a MMLV amphotropic envelope or a modified amphotropic envelope. The safety feature in such a case is preferably the deletion of regions or sequence homology between retroviral 15 components <br><br> The secondary target cell population may be the same as the pnmary target cell population. For example delivery of a pnmary vector of the invention to tumour cells leads to replication and generation of further vector particles which can transduce further tumour 20 cells Alternatively, the secondary target cell population may be different from the pnmary target cell population In this case the pnmary target-cells serve as an endogenous factory within the body of the treated individual and produce additional vector particles which can infect the secondary target cell population. For example, the pnmary target cell population may be haematopoietic cells transduced by the pnmary vector in vivo or ex vivo. The 25 primary target cells are then delivered to or migrate to a site within the body such as a tumour and produce the secondary vector particles, which are capable of transducing for example tumour cells within a solid tumour. <br><br> The invention permits the localised production of high titres of defective retroviral vector 30 particles in vivo at or near the site at which action of a therapeutic protem or proteins is required with consequent efficient transduction of secondary target cells This is more <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 160 <br><br> PCT/GB98/02885 <br><br> efficient than using either a defective adenoviral vector or a defective retroviral vector alone. <br><br> The invention also permits the production of retroviral vectors such as MMLV-based 5 vectors in non-dividing and slowly-dividing cells in vivo It had previously been possible to produce MMLV-based retroviral vectors only m rapidly dividing cells such as tissue culture-adapted cells proliferating in vitro or rapidly dividing tumour cells in vivo. Extending the range of cell types capable of producing retroviral vectors is advantageous for delivery of genes to the cells of solid tumours, many of which are dividing slowly, and 10 for the use of non-dividing cells such as endothelial cells and cells of various haematopoietic lineages as endogenous factories for the production of therapeutic protein products <br><br> The delivery of one or more therapeutic genes by a vector system according to the 15 invention may be used alone or m combination with other treatments or components of the treatment. Diseases which may be treated mclude, but are not limited to- cancer, neurological diseases, inherited diseases, heart disease, stroke, arthritis, viral infections and diseases of the immune system. Suitable therapeutic genes include those codmg for tumour suppressor proteins, enzymes, pro-drug activating enzymes, immunomodulatory 20 molecules, antibodies, engineered immunoglobuhn-like molecules, fusion proteins, hormones, membrane proteins, vasoactive proteins or peptides, cytokines, chemokines, anti-viral proteins, antisense RNA and ribozymes <br><br> In a preferred embodiment of a method of treatment according to the invention, a gene 25 encoding a pro-drug activating enzyme is delivered to a tumour using the vector system of the invention and the individual is subsequently treated with an appropriate pro-drug. Examples of pro-drugs include etoposide phosphate (used with alkaline phosphatase Senter et al., 1988 Proc Natl Acad Sci. 85: 4842-4846), 5-fluorocytosme (with Cytosme deaminase Mullen et al 1994 Cancer Res 54', 1503-1506), Doxorubicin-N-p-30 hydroxyphenoxyacetamide (with Penicilhn-V-Amidase (Kerr et al 1990 Cancer Immunol. Immunother 31: 202-206), Para-N-bis(2-chloroethyl) aminobenzoyl glutamate (with <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 161 <br><br> PCT/GB98/02885 <br><br> Carboxypeptidase G2), Cephalosporin nitrogen mustard carbamates (with b-lactamase); SR4233 (with P450 Reducase), Ganciclovir (with HSV thymidine kinase, Borrelh et al 1988 Proc Natl Acad Sci 85. 7572-7576) mustard pro-drugs with nitroreductase (Friedlos et al. 1997J Med Chem 40' 1270-1275) and Cyclophosphamide or Ifosfamide 5 (with a cytochrome P450 Chen et al 1996 Cancer Res 56: 1331-1340) <br><br> Further provided according to the invention are methods of controlling production of a therapeutic gene such that the therapeutic gene is preferentially expressed in the secondary target cell population and is poorly expressed or not expressed at a biologically significant 10 level m the pnmary target cell. <br><br> In accordance with the invention, standard molecular biology techniques may be used which are within the level of skill in the art Such techniques are fully descnbed in the literature See for example, Sambrook et al (1989) Molecular Cloning; a laboratory 15 manual; Hames and Glover (1985 - 1997) DNA Cloning- a practical approach, Volumes I- IV (second edition), Methods for the engineering of immunoglobulin genes are given in McCafferty et al (1996) "Antibody Engineering1 A Practical Approach". <br><br> In summation, the present invention relates to a novel delivery system suitable for 20 introducing one or more NOIs into a target cell. <br><br> In one broad aspect the present invention relates to a retroviral vector comprising a functional splice donor site and a functional splice acceptor site; wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence 25 of interest ("NOI"), wherein the functional splice donor site is upstream of the functional splice acceptor site, wherein the retroviral vector is derived from a retroviral pro-vector; wherein the retroviral pro-vector comprises a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site, wherem the first NS is downstream of the second NS; 30 such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 162 <br><br> PCT/GB98/02885 <br><br> In a further broad aspect, the present mvention provides a hybrid viral vector system for in vivo gene delivery, which system compnses one or more pnmary viral vectors which encode a secondary viral vector, the pnmary vector or vectors capable of infecting a first 5 target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell <br><br> Preferably the primary vector is obtainable from or is based on a adenoviral vector and/or the secondary viral vector is obtainable from or is based on a retroviral vector 10 preferably a lentiviral vector. <br><br> The invention will now be further described by way of example m which reference is made to the following Figures: <br><br> is Figure 1 which shows the structure of a retroviral proviral genome, <br><br> Figure 2 which shows the addition of a small T splice donor pLTR, <br><br> Figure 3 which shows a diagrammatic representation of pL-SA-N; <br><br> 20 <br><br> Figure 4 which shows a diagrammatic representation of pL-SA-N with a splice donor deletion; <br><br> Figure 5 which shows the sequence of MLV pICUT; <br><br> 25 <br><br> Figure 6 which shows the insertion of a splice donor at CMV/R junction of EIAV LTR plasmid; <br><br> Figure 7 which shows the msertion of a splice acceptor into pEGASUS-1, <br><br> 30 <br><br> Figure 8 which shows the removal of a wild-type splice donor from EIAV vector; <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 163 <br><br> PCT/GB98/02885 <br><br> Figure 10 which provides an outline of a strategy to regulate our hypoxia response promoter via an autoregulatory circuit involving interferon gamma and an IRE, <br><br> 5 Figure 11 shows the nucleotide sequence of the XiaMacIRE sequence that is only active m the presence of hypoxia and interferon gamma; <br><br> Figure 12 is a schematic diagram of a hypoxia regulated lentiviral vector targeted to vascular endothelium by the e-selectm or KDR promoter, <br><br> 10 <br><br> Figure 13 which shows the sequences of the WTPGK and MUTPGK, <br><br> Figure 14 which shows a pictonal representation of a pKAHRE construct; <br><br> 15 Figure 15a shows a schematic map of a retroviral XiaGen-P450 vector compnsing a therapeutic gene under the control of an HRE; <br><br> Figure 15b shows an analysis of the induction of XiaGen-P450 (a Xiavector retrovirus) by hypoxia Cells stain dark when there is induction, <br><br> 20 <br><br> Figure 16a shows a pictonal representation of a plasmid map of pEGASUS; <br><br> Figure 16b shows a pictonal representation of a plasmid map of pONY2 1, <br><br> 25 Figure 16c shows a pictonal representation of a plasmid map of pONYHRELucLac, <br><br> Figure 16d shows a pictonal representation of a plasmid map of pEGHRELacZ, <br><br> Figure 17 is schematics representation ofpSecTSP-1 and pEGHRE-TSP 1, <br><br> 30 Figure 18 shows a pictonal representation of a Pegasus vector expressing LacZ was plated onto cells m culture. Cells were then placed in normoxia or hypoxia. Under hypoxia the <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 164 <br><br> PCT/GB98/02885 <br><br> Figure 21 which shows a pictorial representation of pElRevE construct, <br><br> Figure 22 which shows a pictorial representation of pElHORSE3.1- gagpol construct; <br><br> 5 <br><br> Figure 23 which shows a pictorial representation of pElPEGASUS4-Genome construct; <br><br> Figure 24 which shows a pictorial representation of pCI-Neo construct; <br><br> 10 Figure 25 which shows a pictorial representation of pCI-Rab construct; <br><br> Figure 26 which shows a pictorial representation of pElRab construct, <br><br> Figure 27a is a schematic representation of the natural splicmg configuration m a 15 retroviral vector; <br><br> Figure 27b is a schematic representation of the splicing configuration in known retroviral vectors; <br><br> 20 Figure 27c is a schematic representation of the splicing configuration accordmg to the present invention; and <br><br> Figure 28 is a schematic representation of the dual hybrid viral vector system accordmg to the present mvention <br><br> 25 <br><br> In slightly more detail- <br><br> Figure 1 shows the structure of a retroviral proviral genome. In this regard, the simplest retroviruses such as the murme oncoretroviruses have, three open reading frames, gag, 30 pol and env Frameshift during gag translation leads to pol translation Env expression and translation is achieved by splicmg between the splice donor (SD) and splice acceptor <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 165 <br><br> PCT/GB98/02885 <br><br> (SA) shown The packagmg signal is indicated as Psi and is only contamed m the full length transcripts - not the env expressing sub-genomic transcripts where this signal is removed durmg the splicmg event. <br><br> 5 Figure 2 schematically shows the addition of small T splice donor to pLTR. Here, the small-t splice donor sequence is inserted into an LTR vector downstream of the start of transcription but upstream of R sequence such that upon reverse transcription (m the final construct) the U3-splice donor-R cassette is 'inherited' to 5' end of the proviral vector and RNA transcripts expressed contain a splice donor sequence near their 5' io terminus. <br><br> Figure 3 shows a schematic diagram of pL-SA-N. Both the consensus splice acceptor (T/C)nNC/TAG-G (Mount 1982 Nucleic Acids Res" 10 459-472) and branch point are shown in underline and bold . The arrow mdicates the intron/exon junction. Here, the 15 consensus splice acceptor sequence is inserted into the StullBamHl sites of pLXSN. By such positioning this acceptor will therefore mteract with any upstream splice donor (in the final RNA transcripts) <br><br> Figure 4 shows a schematic diagram for the construction of pL-SA-N with a splice donor 20 deletion The gT to gC change is made by performing a PCR reaction on the pL-SA-N vector with the two oligonucleotides shown below -The resultmg product is then cloned Spel-Ascl into pL-SA-N thus replacing the wild-type splice donor gT with gC. Both Spe 1 and Ascl sites are shown in bold and the mutation in the Spe 1 oligonucleotide shown in captial bold. <br><br> 25 <br><br> Figure 5 shows the sequence of MLV pICUT <br><br> Figure 6 shows a schematic diagram of the insertion of splice donor at CMV/R junction of EIAV LTR plasmid PCR is performed with the two ohgonulceotides outlmed below 30 and the resultmg PCR product cloned Sacl-BamHl into CMVLTR with the equivalent piece removed In the Sac I oligonucleotide the arrow indicates the start of transcription, <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 166 <br><br> PCT/GB98/02885 <br><br> the new insert is shown in capital with splice donor sequence underlined. The start of R is shown in italics <br><br> Figure 7 shows a schematic diagram of the insertion of splice acceptor mto pEGASUS-1. <br><br> 5 Here, the double stranded oligonucleotide described below is inserted into Xho 1-Bpul 102 digested pEGASUS-1 to generate plasmid pEGASUS+SA. Both consensus splice acceptor (T/C)nNC/TAG-G (Mount 1982 ibid) and branch pomt are shown m underline and bold The arrow indicates the intron/exon junction. <br><br> io Figure 8 shows a schematic diagram of the removal of wild-type splice donor from EIAV vector Splice donor sequence removed by overlapping PCR using the oliognucleotides described below and the template pEGASUS+SA. First separate PCR reactions are performed with oligosl+2 and oligos3+4 The resulting amplified products are then eluted and used combined m a third PCR reaction After 10 cycles of <br><br> 15 this third reaction ohgo2 and 4 are then added. The resulting product is then cloned Sacl-Sall into pEGASUS+SA to create the plasmid pEGASUS+SA(noSD). The position of the splice donor (SD) is indicated The pomt mutation changing the wild-type splice donor from GT to GC is shown m bold both in oligol and the complementary oligo3 <br><br> 20 <br><br> Figure 9 shows a schematic diagram of combining pCMVLTR+SD with pEGASUS+SA(noSD) to create pEICUT-1. Here, one mserts the Mlul fragment of pEGASUS+SA(noSD) into the unique Mlul site of pCMV-LTR <br><br> 25 Figure 10 shows a schematic diagram of the construction of pEICUT-LacZ. It is made by the insertion of the Xhol-BpullQl LacZ fragment from pEGASUS-1 and inserting it into the XhoI-BpullQ2 site of pEICUT-1 as outlmed below. <br><br> Figure 11 shows the pEICUT-LacZ sequence. <br><br> 30 Figure 12 shows a schematic diagram of the vector configuration in both transfected and transduced cells. Here, the starting pICUT vector contains no splice donor upstream of <br><br> Printed from Mimosa <br><br> WO 99/16031 <br><br> 167 <br><br> PCT/US98/19756 <br><br> OBHRE 1 is a novel promoter <br><br> The HRE also functions in combination with the promoter elements m retroviral LTRs for example as shown below the MLV LTR <br><br> 5 <br><br> PGK derived enhancer sequences in the context of the MLV retroviral promoter <br><br> PGK tnmer m context of MLV retroviral promoter," forward (natural) onentation This is identical to OB HRE with the sequences placed upstream of the Moloney MLV retroviral 10 promoter instead of SV40 Sequence shown up to transcnption start <br><br> AGCTAGCCTAGCGTCGTGCAGGACGTGACATCTAGTGTCGTGCAGGACGTGAC ATCTAGTGTCGTGCAGGACGTGACATCTAGAGAACCATCAGATGTTTCCAGGG TGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTC 15 GCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCA CAACCCCTCACTCGG <br><br> PGK tnmer in context of MLV retroviral promoter, reverse onentation Sequence shown up to transcnption start <br><br> 20 <br><br> AAGCTAGCTGTCACGTCCTGCACGACACTAGATGTCACGTCCTGCACGACACT AG ATGT C AC GTCCT GC ACG ACT CT AGAGAACC AT C AGAT GTTTCC AGGGT GCC CCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTT CTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAAC 25 CCCTCACTCGG <br><br> The HREs can function m either onentation with respect to the promoter element. <br><br> OBHRE in combination with the MLV promoter <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/16031 <br><br> 168 <br><br> PCT/US98/19756 <br><br> A series of vectors were constructed to analyse the activity of the HRE linked to the MoMLV promoter m a transient assay The HRE and MoMLV promoter were removed from pLNheHRE as an Nhel-Smal fragment and inserted into the MCS of pGL3 basic (Promega) to produce pGLHRE and pGLMUT PGL3 promoter and pGL3 control 5 (Promega) were used as negative and positive controls respectively <br><br> The vectors p5'HRE3'MUT, p5'MUT3'HRE, p5'MUT3'MUT and p5'HRE3'HRE were constructed by digesting pHRE and pMUT with Sacl and ligating the resultmg retroviral genome with linearised pLNheHRE cut with the same enzyme. <br><br> 10 <br><br> The data shown (FIG3) clearly demonstrates that both 5' and 3' HRE are involved in transcnptional regulation and furthermore there is true synergy between the two. These data show that the optimum configuration of a hypoxia regulated vector is one where there is a duplication of the HRE m the 5'and 3' LTRs. This has lead us to design a regulated 15 smgle transcnption umt lentiviral vectors (see later). <br><br> It is important to note that these data can be extrapolated to other non HRE enhancer systems where a similar synergy can be envisaged <br><br> 20 By way of further example other promoters have also been constructed for use in the mvention as shown in Figure 4a. <br><br> The relative strengths of these promoters are shown m Fig 4b. All these sequences confer on the minimal SV40 promoter hypoxia induced expression However what is clear is the 25 different induction ratios and the scale of expression under hypoxia. <br><br> Any of these promoter configurations can be used in the invention and the choice is dictated by the therapeutic gene For example a highly toxic cytokine such as TNF-alpha would benefit from the use of the simple enolase promoter, as basal levels are undetectable 30 in normoxia so guaranteeing that there is no inappropnate expression A less toxic protein such as human cytochrome P450 that is needed m high levels would benefit from using <br><br> Printed from Mimosa <br><br> WO 99/16031 <br><br> 169 <br><br> PCT/US98/19756 <br><br> OBHRE1 where the maximum levels of expression are very high but the basal levels are detectable <br><br> These promoters described above all contain DNA sequence motifs for the classical HRE 5 binding transcnption factor, HIF 1. This is a heterodimer consisting of HIF la and HIF lb, a member of the basic helix-loop-helix (bHLH)/PAS domain protein family (from the founding members of this gene family, Penod, ARNT, and SIM). HIF la was onginally identified as a protem binding to the HRE of the erythropopietin gene in hepatoma cells (Wang et al 1995, J Biol Chem 270, 1230) but has since been implicated in the regulation 10 of an expanding family of genes that are regulated by hypoxia m most cell types. Database searching of expressed cDNA sequences have identified a further bHLH/PAS family member that is closely related to HIF 1, termed EPAS-1 (endothelial PAS domain protem) or HRF (HIF-related factor) (Ema et al 1997, Proc Natl Acad Sci USA 94, 4273; Flamme et al 1997, Mech Dev 63, 51, Tian et al 1997, Genes Dev 11, 72) Unlike HIF 1, EPAS-1 15 is expressed predominantly in endothelial cells- and its expression appears to be significantly regulated dunng development. As predicted from the conservation of the DNA binding domain of the two protems, EPAS -1 appears to bind to the same consensus sequence (defined as the HRE) as HIF-1 Published data have however indicated that EPAS expression is restncted to endothelial cells We now show (Figure 5) that, 20 surpnsingly, m macrophages it is not possible to detect the HEF-1 protein even under normoxia and yet the OBHRE promoter (PGK) is activated in these cells when they are placed in hypoxic conditions (Figure 6). We have analysed macrophages under the two conditions using antibodies that are specific for HIF-1 and EPAS We could not detect HIF-1 in macrophages but we could detect EPAS. This is the first time that EPAS has been 25 found outside of epithelial cells Thus the induction of OB HRE 1 in macrophages is either principally or entirely mediated by EPAS-1 and as such represents an EPAS responsive enhancer <br><br> It follows from these observations that there may be many factors, known or not yet 30 discovered that mediate a transcnptional response under ischaemic conditions Any piece <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 170 <br><br> PCT/GB98/02885 <br><br> Example 2 Construction of a split-intron Lentivector. <br><br> Construction of initial EIAV lentiviral expression vector (also see patent application GB 9727135 7) <br><br> 5 <br><br> For the construction of a split-function lentiviral vector the starting point is the vector named pEGASUS-1 (see patent application GB 9727135 7). This vector is derived from infectious proviral EIAV clone pSPEIAV19 (accession number. U01866; Payne et al 1994) Its construction is outlined as follows- First; the EIAV LTR, amplified by PCR, 10 is cloned into pBluescript II KS+ (Stratagene). The MlullMlul (216/8124) fragment of pSEIAV19 is then inserted to generate a wild"-type proviral clone (pONY2) in pBluescript II KS+ (Figure 1). The env region is then deleted by removal of the Hind Ill/Hind III fragment to generate pONY2-H. In addition, a BgUl/Ncol fragment within pol (1901/4949) is deleted and a (3-galactosidase gene driven by the HCMV IE IS enhancer/promoter inserted in its place. This is designated pONY2AOnlsLacZ. To reduce EIAV sequence to 759 base pairs and to drive primary transcript off a CMV promoter: First, sequence encompassing the EIAV polypurine tract (PPT) and the 3'LTR are PCR amplified from pONY2AOLacZ using primers- <br><br> 20 PPTEIAV + (Y8198) G A CT A CG A CT A GTGT AT GTTT A GAA A A AC AAGG. <br><br> and <br><br> 3' NEGSpeI( Y 8199) CT AGGCTACTAGT ACTGTAGGATCTCGAACAG. <br><br> 25 The PCR product is then cloned mto the Spe 1 site of pBS II KS + , orientated such that U5 is proximal to Notl in the pBlueScript II KS <br><br> Next, for the reporter gene cassette, a CMV promoter/LacZ from pONY 2 lOnlsLacZ is removed by Pstl digest and cloned mto the Pstl site of pBS 3'LTR orientated such that 30 LacZ gene is proximal to the 3'LTR, this vector is named pBS CMVLacZ.3'LTR. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 171 <br><br> PCT/GB98/02885 <br><br> The 5'region of the EIAV vector is constructed in the expression vector pCIEneo which is derivative of pClneo (Promega)-modified by the inclusion of approximately 400 base pairs derived from the 5'end of the full CMV promoter as defined previously. This 400 base pair fragment is obtained by PCR amplification using primers <br><br> VS AT 1: C OGGCT AT ATG A G ATCTT GA AT A AT A A AATGTGT) and <br><br> VSAT2 fT ATT A AT A ACT AGT^ and <br><br> 10 pHIT60 (Soneoka et al 1995 Nucleic Acids Res 23: 628-633) as template. The product is digested with Bgl\I and Spel and cloned mto the BglR/Spel sites of yCIE-Neo. <br><br> A fragment of the EIAV genome running from the R region to nt 150 of the gag coding region (nt 268 to 675) is amplified from pSEIAV with primers. <br><br> 15 <br><br> CMV5'EIAV2: <br><br> C7.0&lt;;q 1 vgpta rnr a gaggtgGTTTAGTGA aCCGGGCACTCAGATTCTG (sequences underlined anneals to the EIAV R region) and <br><br> 20 <br><br> 3'PSI.NEG fGCTGA GCTCTA GA GTCCTTTT CTTTT AC A AAGTT GG) <br><br> The resulting PCR product is flanked by Xbal and Sacl sites. This is then cut and cloned mto the pCIE-Neo Xbal-Sacl sites. The resulting plasmid, termed 25 pCIE/ieo5'EIAV now contains the start of the EIAV R region at the transcriptional start point of the CMV promoter. The CMVLacZBLTR cassette is then inserted into the pCIE/zeo5'EIAV plasmid by taking the Apal to Not I fragment from pBS.CMVLacZ 3LTR and cloning it into the Sall-Notl digested pCIE/teo.5'EIAV (the Sal 1 and Apal sites is T4 "polished" to create blunt.the ends prior to the vector and 30 insert respective Not 1 digests) The resulting plasmid is named pEGASUS-1 <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 172 <br><br> PCT/GB98/02885 <br><br> For use as a gene delivery vector pEGASUS-1 requires both gag/pol and env expression provided in trans by a packagmg cell For the source of gag/pol an EIAV gagpol expression plasmid (pONY3) is made by inserting the Mlu IIMlu I fragment from pONY2-H mto the mammalian expression plasmid pCl-neo (Promega) such that the gag-5 pol gene is expressed from the hCMV-MIE promoter-enhancer and contains no LTR sequences. For the source of env; the pRV583 VSV-G expression plasmid is routinely used. These three vectors are used in a three plasmid co-transfection as described for MLV-based vectors (Soneoka et al 1995 Nucl. Acids Res. 23:628-633) the resulting virus routinely titres at between 104 and 105 lacZ forming units per ml on D17 10 fibroblasts <br><br> Construction of a EIAV lentiviral version vector of pICUT; named pEICUT <br><br> To construct pEICUT firstly pEGASUS-1 the Xmal-SexAl fragment is removed from 15 pEGASUS-1 and the ends 'blunted' with T4 polymerase and plasmid re-ligated to create a plasmid contamg only the CMV-R-U5 part of pEGASUS-1 which retains the SV40-Neo cassette m the backbone This plasmid is named CMVLTR To insert a splice donor at the CMV-R border PCR is carried out with the two oligonucleotides shown below in Figure 6 and as outlmed in the Figure 6 legend. The resultmg plasmid is 20 named pCMVLTR+SD. The same immunoglobulin based consensus splice acceptor as for MLV pICUT (see earlier) is used in the EIAV version This is inserted using oligonucleotides described m Figure 7 into the Xhol-Bpull02 site of pEGASUS-1 to create the plasmid pEGASUS+SA. The wild-type splice donor of EIAV is removed by carrying out overlapping PCR with the ohgonulceotides and methodology as described in 25 Figure 8, using pEGASUS+SA as a template to generate the plasmid pEGASUS+SA(noSD) To then create pEICUT-1, the Mlul-Mlul fragment from pEGASUS+SA(noSD) is then inserted mto the unique Mlul site of pCMVLTR+SD to generate pEICUT-1 (see Figure 9) LacZ can be then-transferred from pEGASUS-1 mto pEICUT-1 by Xhol-BpullOl digest and insertion to create pEICUT-Z (see Figure 10; 30 for sequence data see Figure 11) <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 173 <br><br> PCT/GB98/02885 <br><br> Both the MLV and EIAV pICUT vectors contain a strong splice acceptor upstream of the splice donor and therefore no functional intron (nitrons require splice donors positioned 5' of splice acceptors). For this reason, when the vector is transfected into producer cells the resulting transcripts generated will not be spliced. Thus the packaging signal 5 will not be lost and as a consequence maximal packaging is achievable (see Figure 12). <br><br> However because of the unique way by which retroviruses replicate, upon transduction, transcripts generated from the integrated pICUT vector will differ from those of transfected cells described above This is because during replication the 3'U3 promoter 10 (up to the 5'start of R) is copied and used as the 5' promoter in transduced cells. For this reason transcripts generated from integrated pICUT will now contain a strong splice donor 5' of a strong splice acceptor, both of which being located upstream of the neo ORF. Such transcripts will therefore contain a functional nitron m the 5'UTR (untranslated region) and thus be maximally spliced and translated. <br><br> 15 <br><br> Another advantage of such vectors described above is that because the intron is created only upon transduction it is possible to limit gene expression to either packaged or transduced cells One example of how this is achieved is outlmed in Figures 13. The strategy entails the clonmg of a second gene (in this example hygromycm) upstream of 20 the splice acceptor This is achieved by taking out the hygromycm cDNA on a Sail fragment from SelctaVector Hygro (Ingemus, Oxfordshire, UK), and clonmg this into a Xho 1 site (located upstream of the splice acceptor) of pICUT. This vector selectively expresses hygromycin in the transfected cells and neomycin in transduced cells The reason for this is that m any one mRNA transcript only the first gene is translated by the 25 ribsome without the aid of internal ribosome binding sites (IRESs). In the transfected cell this gene will be hygromycin However in the transduced cells because the hygromycm open readmg frame (ORF) is contained within a functional intron this gene will now be removed from mature mRNA transcripts thus allowing neo ORF translation. <br><br> 30 Vectors with such cell specific gene expression maybe of clinical use for a variety of reasons; By way of example, expression of resistance markers can be restricted to <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 174 <br><br> PCT/GB98/02885 <br><br> producer cells- where they are required and not in transduced cells where they may be immunogenic. By way of another example, expression of toxic genes such as ricin and dominant negative signalling proteins could be restricted to transduced cells where they may be required to optionally arrest cell growth or kill cells but not in producer cells-5 where such features would prevent high titre virus production. Figure 14 shows a Neo-p450 MLV pICUT construct such that only Neo is expressed in producer cells and the pro-drug p450 2B6 isoform expressed m transduced cells. <br><br> Another benefit of creatmg an intron upon transduction is that any essential elements 10 required for vector function can now be placed mside a functional intron, which is created upon transduction, and be removed from transduced cell transcnpts. By way of example, with both the MLV and the lentivector pICUT vectors, the viral transcript contamed the functional Psi packaging signal (see Bender et al 1987 for the position of Psi m MLV, see patent application GB 9727135.7 for position of Psi in EIAV) within an 15 mtron which was created upon transduction and removed from the transduced cell transcripts <br><br> The benefits from such an arrangement include: <br><br> 20 (i) Enhanced translation from resulting transcripts because ribosomes may "stutter" in the presence of a Psi secondary structure- if present (Krall et al 1996 ibid and reference therein) <br><br> (II) In the absence of the packagmg signal, transcript packaging by endogenous 25 retroviruses is prevented. <br><br> (III) Unwanted premature translation initiation is prevented when viral essential elements such as gag (and other potential ATG translation start sites) are removed from the transcripts expressed m transduced cells. This is of particular benefit when packaging <br><br> 30 signals extend into gag as is the case for both the EIAV and MLV pICUT vectors. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 175 <br><br> PCT/GB98/02885 <br><br> (iv) Promoter, enhancers and suppressors may be placed within an mtron created upon transduction thus mimicking other transcript arrangements like those generated from CMV that contain such entities within introns (Chapman et al 1991 ibid) <br><br> 5 In summation the novel pICUT vector system descnbed in the present invention facilitates the following arrangments: <br><br> (I) Maximal packaging and reduced translation of transcripts in producer cells. <br><br> 10 (ii) Maximal splicmg and therefore intron enhanced translation of transcripts in transduced cells <br><br> (iii) Restriction of gene and/or viral essential element expression to either producer or transduced cells. <br><br> 15 <br><br> Example 3 Construction of an MMLV amphotropic env gene with minimal homology to the pol gene and a gag-pol transcription cassette <br><br> In the Moloney murme leukaemia virus (MMLV), the first approximately 60 bps of the 20 env codmg sequence overlap with sequences at the 3' end of the pol gene The region of homology between these two genes was removed to prevent the possibility of recombmation between them m cells expressing both genes <br><br> The DNA sequence of the first 60 bps of the coding sequence of env was changed while 25 retaining the ammo acid sequence of the encoded protein as follows. A synthetic oligonucleotide was constructed to alter the codon usage of the 5'-end of env (See Figure 15) and inserted mto the remainder of env as follows. <br><br> The starting plasmid for re-construction of the 5' end of the 4070A gene was the pCI 30 plasmid (Promega) mto which had previously been cloned the Xbal-Xbal fragment containing the 4070A gene from pHIT456 (Soneoka et al 1995 ibid) to form pCI-4070A. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 176 <br><br> PCT/GB98/02885 <br><br> A PCR reaction was performed with primers A and B (Figure 15) on pCI-4070A to produce a 600 base pair product This product was then cloned between the Mel and Xhol sites of pCI-4070A The resultmg construct was sequenced across the Nhel/Xhol region Although the ammo acid sequence of the resultmg gene is the same as the 5 original 4070A, the region of homology with the pol gene is removed. <br><br> The complete sequence of the modified env gene m4070A is given in Figure 16. This sequence is inserted into the expression vector pCI (Promega) by standard techniques. The CMV gag-pol transcription unit is obtaind from pHIT60 (Soneoka et al 1995 ibid) <br><br> i <br><br> 10 <br><br> Example 4 Deletion of gag sequences from the retroviral packaging signal. <br><br> A DNA fragment containing the LTR and minimal functional packagmg signal is obtained from the retroviral vector MFG (Bandara et al 1993 Proc Natl Acad Sci 90. 15 10764-10768) or MMLV proviral DNA by PCR reaction using the following oligonucleotide primers: <br><br> HindtnR GC ATT A A AGCTTTGCTCT <br><br> 20 L523 GCCTCGAGCAAAAATTCAGACGGA - <br><br> This PCR fragment contains MMLV nucleotides +1 to +523 and thus does not contam gag codmg sequences which start at +621 (numbering based on the nucleotide sequence of MMLV Shinnick et al 1981 Nature 293: 543-548). <br><br> 25 The PCR fragment can be used to construct a retroviral genome vector by digestion using HindHl and Xhol restriction enzymes and sub-clomng using standard techniques. Such vectors contam no homology with gag codmg sequences. <br><br> Example 5 Construction of defective retroviral genome <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 177 <br><br> PCT/GB98/02885 <br><br> The transcription unit capable of producing a defective retroviral genome is shown in Figure 17 It contains the following elements a hypoxia regulated promoter enhancer comprising 3 copies of the PGK - gene HRE and a SV40 promoter deleted of the 72bp-repeat enhancer from pGL3 (Promega); a MMLV sequence containing R, U5 and the 5 packaging signal, the coding sequence of m4070A (Example 3), a splice acceptor, a cloning site for insertion of a coding sequence for a therapeutic protein; the polypyriroidine tract from MMLV; a second copy of the HRE-contaimng promoter-enhancer; a splice donor site; and a second copy of R, U5. <br><br> 10 On reverse transcription and mtegration of the vector into the secondary target cell, the splice donor is introduced upstream of the env gene causing it to be removed from mRNA by splicing and thereby permitting efficient expression of the therapeutic gene only in the secondary target cell (See Figure 17) <br><br> 15 Example 6 Construction of a conditional expression vector for Cytochrome P450 <br><br> Figure 18 shows the structure of retroviral expression vector cDNA codmg sequences from the cytochrome P450 gene in two halves such that only upon transduction is the correct splicing achieved to allow P450 expression This therefore restricts expression 20 to transduced cells. <br><br> 1) The starting plasmid for the construction of this vector is pLNSX (Miller and Rosman 1989 BioTechniques 7 980-990). The natural splice donor (...agGTaag ..) contained within the packagmg signal of pLNSX (position 781/782) is mutated by PCR 25 mutagenesis using the ALTERED SITES II mutageneisis kit (Promega) and a synthetic oligonucleotide of the sequence. <br><br> 5' -caaccaccgggagGCaagctggccagcaactta-3' <br><br> 30 2) A CMV promoter from the pCI expression vector (Promega) is isolated by PCR using the following two oligonucleotides. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 178 <br><br> PCT/GB98/02885 <br><br> Primer 1: 5'-atcggctagcagatcttcaatattggccattagccatat-3' <br><br> Primer 2 5'-atcgagatctgcggccgcttacctgcccagtgcctcacgaccaa-3' <br><br> 5 <br><br> This produces a fragment containing the CMV promoter with a 5'Nhel site (Primer 1) and a 3' No/1 and Xbal site (Primer 2). It is cut with Nhel and Xbal and cloned into pLNSX from which an Nhel-Nhel fragment has been removed. <br><br> 10 3) The 5' end of a cytochrome P450 cDNA codmg sequence is isolated by RT-PCR from human liver RNA (Clontech) with the following primers: <br><br> Primer 3. 5' -atcggcggccgcccaccatggaactcagcgtcctcctcttccttgcaccctagg-3' <br><br> 15 Primer 4 • 5' -atcggcggccgcacttacCtgtgtgccccaggaaagtatttcaagaagccag-3' <br><br> This amplifies the 51 end of the p450 from the ATG to residue 693 (numbering from the translation initiation site Yamano et al 1989 Biochem 28'7340-7348). Contained on the 5' end of the fragment (denved from Primer 3) is also a Notl site and an optimised 20 "Kozak" translation initiation signal. Contained on the 3' end of the sequence (derived from primer 4) is another Notl site and a consensus splice donor sequence (also found in pCI and originally denved from the human beta giobin gene) with the GT splice donor pair located flush against residue 704 of P450 (the complementary residue is shown in uppercase in Primer 4) This fragment is digested with Notl and cloned into the Notl 25 digested plasmid generated in step 2. <br><br> 4) The Nhel-Nhel fragment removed during the cloning of step 2 is then re-introduced mto the plasmid of step 3. This creates a retroviral vector as described in Figure 17 but missing the 3' end P450. <br><br> Printed from Mimosa <br><br> WO 99/15684 PCT/GB98/02885 <br><br> 179 <br><br> 5) The 3' of the P450 codmg sequence is isolated by RT-PCR amplification from human liver RNA (Clontech) using the following primers <br><br> Primer 5 actgtgatcataggcacctattggtcttactgacatccactttctctccacagGcaagtttacaaaacctgc 5 aggaaatcaatgcttacatt-3' <br><br> Primer 6 actgatcgatttccctcagccccttcagcggggcaggaagc-3' <br><br> This generates the PCR amplified 3' end of P450 from residue 705 (in uppercase primer 10 5) and extends past the translation termination codon Contained within the 5' end of this product and generated by primer 5 is a Bell restriction site and a consensus splice acceptor and branch point (also found m pCI and originally from an immunoglobulin gene) upstream of residue 705. Contained at the 3' end of this product downstream of the stop codon and generated by primer 6 is a Clal site. This PCR product is then 15 digested with Bell and Clal and cloned mto the vector of step 3 with the Bcll-Clal fragment removed to generate the retroviral vector as shown in Figure 18. <br><br> The following examples desenbe the construction of .an adenolentiviral system that can be used for the transient production of lentivirus in vitro or in vivo <br><br> 20 <br><br> First Generation Recombinant Adenovirus <br><br> The first generation adenovirus vectors consist of a deletion of the El and E3 regions of the virus allowing insertion of foreign DNA, usually into the left arm of the virus adjacent to 25 the left Inverted Terminal Repeat (ITR). The viral packaging signal (194-358 nt) overlaps with the Ela enhancer and hence is present in most El deleted vectors. This sequence can be translocated to the nght end of the viral genome (Hearing &amp; Shenk,1983 Cell 33: 59-74) Therefore, in an El deleted vector 3 2 kb can be deleted (358-3525 nt) <br><br> 30 Adenovirus is able to package 105% length of the genome, thus allowing for addition of an extra 2.1 kb Therefore, in an E1/E3 deleted viral vector the cloning capacity becomes 7-8 kb (2 1 kb + 1.9 kb (removal of E3) + 3 2 kb (removal of El) Since the recombinant <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 180 <br><br> PCT/GB98/02885 <br><br> adenovirus lacks the essential El early gene it is unable to replicate in non-El complementing cell lines. The 293 cell line was developed by Graham et al. (1977 J Gen Virol 36 59-74) and contains approximately 4 kb from the left end of the Ad5 genome including the ITR, packaging signal, Ela, Elb and pIX The cells stably express Ela and 5 Elb gene products, but not the late protein IX, even though pIX sequences are within Elb. In non-complementing cells the El deleted virus transduces the cell and is transported to the nucleus but there is no expression from the El deleted genome <br><br> First Generation Adenovirus Production System <br><br> I, <br><br> 10 Microbix Biosystems - nbl Gene Sciences <br><br> The diagram m Figure 19 shows the general strategy used to create recombinant adenoviruses using the microbix system <br><br> 15 The general strategy involves cloning the foreign DNA into an El shuttle vector, where the El region from 402-3328 bp is replaced by the foreign DNA cassette. The recombinant plasmid is then co-transfected mto 293 cells with the pJM17 plasmid. pJM17 contains a deletion of the E3 region and an insertion of the prokaryotic pBRX vector (including the ampicillin resistance and bacterial on sequences) mto the El region at 3.7 map units. This 20 40 kb plasmid is therefore too large to be packaged into adeno nucleocapsids but can be propagated m bacteria Intracellular recombination in 293 cells results m replacement of the ampr and on sequences with the insert of foreign DNA <br><br> Example 7 Construction of Transfer plasmids for the creation of Adenoviruses 25 containing EIAV Components <br><br> In order to produce lentiviral vectors four adenovirus need to be made: genome, gagpol, envelope (rabies G) and Rev The lentiviral components are expressed from heterologous promoters they contain introns where needed (for high expression of gagpol, Rev and 30 Rabies envelope) and a polyadenylation signal. When these four viruses are transduced into Ela minus cells the adenoviral components will not be expressed but the heterlogous <br><br> Printed from Mimosa <br><br> WO 99/16031 181 PCT/US98/19756 <br><br> The general strategy involves cloning the foreign DNA into an El shuttle vector, where the El region from 402-3328 bp is replaced by the foreign DNA cassette. The recombinant plasmid is then co-transfected mto 293 cells with the pJM17 plasmid pJM17 contains a deletion of the E3 region and an insertion of the prokaryotic pBRX vector (including the 5 ampicilhn resistance and bacterial on sequences) mto the El region at 3 7 map units This 40 kb plasmid is therefore too large to be packaged into adeno nucleocapsids but can be propagated m bactena Intracellular recombination- in 293 cells results in replacement of the ampr and on sequences with the insert of foreign DNA. <br><br> 10 In the examples quoted herein two transfer vectors have been used. The first obtained from Microbix is called pElsplA and the second obtained from Quantum Biotechnologies is called pADBN The pADBN plasmid has the advantage that the new (foreign) DNA can be inserted in either onentation This places the insert m a different spatial relationship with the resident adenoviral genes which can in some cases adversely affect expression. In 15 both cases the second DNA is a defective version of the adenoviral genome, either as a plasmid for example pJM17 or as a part of the viral DNA for example the so-called right arm of Ad5 Homologous recombination generates the final gene transfer vector <br><br> The construction of the ischaemia regulated adenoviral vector is descnbed below <br><br> 20 <br><br> The luciferase gene m OB37 (Figure 2) was replaced by the bactenal b-galactosidase encodmg gene via an Neo l-Xba I fragment swap from the pONY2.1 vector (Figure 16b). <br><br> The resultmg OB HRE LacZ cassette was removed from the OB 3 7 vector as a Kpnl-SaR 25 fragment and cloned mto the Quantum Biotechnologies™ pAdBN transfer vector producing AdenoOBHRElacZ. <br><br> The recombmant AdenoOBHRElacZ transfer veGtor was lineansed (Ase I) and co-transfected mto 293 cells along with the punfied nght arm of the Ad5 virus (from the Cla I site) to allow in vivo homologous recombination to occur resulting m the formation of the 30 desired recombinant adenovirus. This is outlined in Figure 22 Adenoviral vectors <br><br> Printed from Mimosa <br><br> WO 99/16031 <br><br> 182 <br><br> PCT/US98/19756 <br><br> containing the HRE are referred to as AdHRE followed by the inserted gene, for example AdHRE-lacZ has the bacterial p-galactosidase gene expressed by the OBHRE promoter <br><br> A range of different cell lines have been transduced with AdHRE-LacZ After a 6 hour 5 transduction the virus is removed and replaced with fresh medium and the cells are split into two separate plates for overnight incubation m either normoxia or hypoxia (0.1% oxygen) The results (Figure 23) demonstrate the hypoxic mducibihty of the LacZ reporter gene within the adenoviral vector in Chiang Liver and the MCF-7 human breast cancer cell line. <br><br> 10 <br><br> In addition, 7-14 day old pnmary human macrophages have similarly been transduced with AdHRE-LacZ. This result not only demonstrates the transducibility but also the utility of using a HRE regulated recombinant adenovirus in cells in the haematopoietic lineage. <br><br> 15 The inserted DNA construct present m the adenoviral transfer vector is in the form of an autonomous expression cassette containing the OBHRE promoter, the LacZ coding sequence and the SV40 polyadenylation signal (splice sites can also be included if necessary). In the system descnbed for the construction of AdHRE (Quantum Biotech) we observed that a high level of protein expression was obtained if the expression cassette was 20 directed m the onentation of the El genes <br><br> Alternative hypoxia response elements may also be used as descnbed earlier. <br><br> The HREs may be present m multiple copies both 5' and 3' to the gene to further increase 25 the level of hypoxic induction <br><br> In addition, the HRE could be combined with tissue specific promoter elements to restrict expression to specific tissue types or diseased tissue For example, the OBHRE could be used in combination with the XiaMac promoters to regulate/increase expression 30 specifically m macrophages <br><br> Printed from Mimosa <br><br> WO 99/16031 <br><br> 183 <br><br> PCT/US98/19756 <br><br> AdHRE vectors have been configured to contain therapeutic genes. <br><br> An example is descnbed below for the construction of AdHRE-2B6 and AdCMV-2B6 recombinant adenoviral vectors using the Microbix Biosystems construction system. 5 Plasmids are shown in Figure 24 and they are as follows pElHREPG - The transfer vector engineered to contain the HRE driven 2B6 expression casssette <br><br> 10 Using the Elspl A transfer plasmid from Microbix the transfer vector PElHREPG <br><br> The EMCV IRES GFP Xbal fragment from pCPGHRE is cloned into the Xbal site 3' to the 2B6 coding sequence m the pGL3OBHRElp450 vector. The complete expression cassette is cloned into the Microbix transfer vector pAElsplB as Mlul-PshAl fragment to 15 give pElHREPG (Figure 25b) <br><br> pElCMVPG - The transfer vector engineered to contain the CMV driven 2B6 expression cassette (Figure 25c) <br><br> 20 The Bglll-Nael CMV2B6 fragment from pCI-2B6 is cloned into the BamHl-EcoRV site of pAElsplB. The EMCV IRES GFP Xbal fragment from pCPGHRE is cloned into the Xbal site 3' to the 2b6 coding sequence in the resultmg plasmid to create pElCMVPG (Figure 25c). <br><br> Note. The use of the ires GFP reporter allows easier plaque punfication of the recombinant 25 adenovirus and provides viable cell marker for studying gene expression dunng different physiological conditions. <br><br> Any of the therapeutic genes outlined above can be inserted mto the hypoxia regulated adenoviral vectors <br><br> 30 <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 184 <br><br> PCT/GB98/02885 <br><br> claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrymg out the invention which are obvious to those skilled in molecular biology or related fields are mtended to be within the scope of the following claims. <br><br> Printed from Mimosa <br><br> WO 99/15684 <br><br> 185 <br><br> PCT/GB98/02885 <br><br></p> </div>

Claims (41)

  1. <div class="application article clearfix printTableText" id="claims">
    <p lang="en">
    CLAIMS<br><br>
    1 A retroviral vector comprising a functional splice donor site and a functional splice acceptor site, wherem the functional splice donor site and the functional splice<br><br>
    5 acceptor site flank a first nucleotide sequence of interest ("NOI"); wherein the functional splice donor site is upstream of the functional splice acceptor site; wherein the retroviral vector is denved from a retroviral pro-vector; wherein the retroviral pro-vector comprises a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; 10 wherem the first NS is downstream of the second NS; such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector.<br><br>
  2. 2 A retroviral vector according to claim 1 wherein the retroviral pro-vector comprises a third NS that is upstream of the second nucleotide sequence; wherem the<br><br>
    15 third NS is capable of yieldmg a non-functional splice donor site.<br><br>
  3. 3 A retroviral vector according to claim 1 or claim 2 wherein the retroviral vector further compnses a second NOI, wherein the second NOI is downstream of the functional splice acceptor site.<br><br>
    20<br><br>
  4. 4 A retroviral vector according to claim 3 wherem the retroviral pro-vector comprises the second NOI; wherem the second NOI is downstream of the second nucleotide sequence.<br><br>
    25
  5. 5 A retroviral vector accordmg to claim 3 or claim 4 wherem the second NOI, or the expression product thereof, is or comprises a therapeutic agent or a diagnostic agent.<br><br>
  6. 6 A retroviral vector accordmg to any one of the preceding claims wherem the first NOI, or the expression product thereof, is or comprises any one or more of an agent 30 conferring selectablity (e g. a marker element), a viral essential element, or a part thereof, or combinations thereof<br><br>
    Printed from Mimosa<br><br>
    WO 99/15684<br><br>
    186<br><br>
    PCT/GB98/02885<br><br>
  7. 7 A retroviral vector according to any one of the preceding claims wherein the first NS is at or near to the 3' end of a retroviral pro-vector, preferably wherem the 3' end compnses a ,U3 region and an R region, and preferably wherem the first NS is located 5 between the U3 region and the R region.<br><br>
  8. 8. A retroviral vector according to claim 7 wherein the U3 region and/or the first NS of the retroviral pro-vector comprises an NS that is a third NOI; wherein the NOI is any one or more of a transcriptional control element, a coding sequence or a part 10 thereof.<br><br>
  9. 9 A retroviral vector accordmg to any one of the preceding claims wherem the first NS is obtainable from a virus.<br><br>
    15
  10. 10. A retroviral vector according to claim 9 wherein the first NS is an intron or a part thereof.<br><br>
  11. 11 A retroviral vector accordmg to claim 10 wherem the intron is obtainable from the small t-intron of SV40 virus.<br><br>
    20<br><br>
  12. 12 A retroviral vector accordmg to any one of the preceding claims wherem the retroviral pro-vector comprises a retroviral packaging signal, and wherein the second NS is located downstream of the retroviral packaging signal such that splicmg is preventable at a primary target site.<br><br>
    25<br><br>
  13. 13. A retroviral vector accordmg to any one of the preceding claims wherein the second NS is placed downstream of the first NOI such that the first NOI is capable of bemg expressed at a primary target site<br><br>
    Printed from Mimosa<br><br>
    WO 99/15684<br><br>
    187<br><br>
    PCT/GB98/02885<br><br>
  14. 14. A retroviral vector according to any one of the preceding claims wherein the second NS is placed upstream of a multiple clonmg site such that one or more additional NOIs may be inserted.<br><br>
  15. 5 15 A retroviral vector according to any one of the preceding claims wherein the second NS is a nucleotide sequence codmg for an immunological molecule or a part thereof.<br><br>
  16. 16. A retroviral vector accordmg to claim 15 wherem the immunological molecule is an io immunoglobulin.<br><br>
  17. 17. A retroviral vector accordmg to claim 16 wherein the second NS is a nucleotide sequence codmg for an immunoglobulin heavy chain variable region<br><br>
  18. 15 18. A retroviral vector according to any one of the preceding claims wherein the vector additionally comprises a functional intron.<br><br>
  19. 19. A retroviral vector according to claim 18 wherein the functional mtron is positioned so that it is capable of restnctmg expression of at least one of the NOIs in a 20 desired target site<br><br>
  20. 20 A retroviral vector accordmg to claim 19 wherem the target site is a cell.<br><br>
  21. 21 A retroviral vector according to any one of the preceding claims wherein the 25 vector or pro-vector is derivable from a murine oncoretrovirus or a lentivirus<br><br>
  22. 22 A retroviral vector according to claim 21 wherein the vector is derivable from MMLV, MSV, MMTV, HIV-1 or EIAV<br><br>
    30
  23. 23. A retroviral vector as defined in any one of the preceding claims wherein the retroviral vector is an integrated provirus<br><br>
    Printed from Mimosa<br><br>
    WO 99/15684<br><br>
    188<br><br>
    PCT/GB98/02885<br><br>
  24. 24 A retroviral particle obtainable from a retroviral vector according to any one of the preceding claims.<br><br>
    5
  25. 25. A cell transfected or transduced with a retroviral vector accordmg to any one of claims 1-23 or a retroviral particle accordmg to claim 24<br><br>
  26. 26. A retroviral vector accordmg to any one of claims 1-23 or a viral particle according to claim 24 or a cell according to claim 25 for use in medicine<br><br>
    10
  27. 27 Use of a retroviral vector in any one of claims 1 to 23 or a viral particle according to claim 24 or a cell accordmg to claim 25 for the manufacture of a pharmaceutical composition to deliver one or more NOIs to a target site in need of same.<br><br>
  28. 28 A method comprising transfecting or transducing a cell with a retroviral vector 15 according to any one of claims 1 to 23 or a viral particle accordmg to claim 24 or by use of a cell accordmg to claim 25<br><br>
  29. 29 A delivery system for a retroviral vector accordmg to any one of claims 1 to 23 or a viral particle accordmg to claim 24 or a cell according to claim 25 wherein the<br><br>
    20 delivery system comprises one or more non-retroviral expression vector(s), adenoviruse(s), or plasmid(s) or combinations thereof for delivery of an NOI or a plurality of NOIs to a first target cell and a retrovural vector for delivery of an NOI or a plurality of NOIs to a second target cell.<br><br>
    25
  30. 30. A retroviral pro-vector as defined in any one of the preceding claims.<br><br>
  31. 31 Use of a functional intron to restrict expression of one or more NOIs within a desired target cell.<br><br>
    30
  32. 32 Use of a reverse transcriptase to deliver a first NS from the 3' end of a retroviral pro-vector to the 5' end of a retroviral vector<br><br>
    Printed from Mimosa<br><br>
    WO 99/15684 189 PCT/GB98/02885<br><br>
  33. 33. A hybnd viral vector system for in vivo gene delivery, which system compnses one or more pnmary viral vectors which encode a secondary viral vector, the pnmary vector or vectors capable of infecting a first target cell and of expressing therein the secondary viral 5 vector, which secondary vector is capable of transducing a secondary target cell.<br><br>
  34. 34 A hybrid viral vector system accordmg to claim 33 wherem the primary vector is obtainable from or is based on a adenoviral vector and/or the secondary viral vector is obtainable from or is based on a retrovural vector preferably a lentiviral vector.<br><br>
    10<br><br>
  35. 35. Use of a hybrid viral vector system accordmg to claim 33 and 34 wherein the lentiviral vector has a split-intron configuration.<br><br>
  36. 36 A hybrid viral vector system wherein the lentiviral vector comprises or is capable 15 of delivering a split-mtron configuration.<br><br>
  37. 37. A lentiviral vector system wherein the lentiviral vector comprises or is capable of delivering a split-mtron configuration.<br><br>
  38. 20 38. An adenoviral vector system wherein the adenoviral vector compnses or is capable of delivering a split-mtron configuration<br><br>
  39. 39. Vectors or plasmids basd on or obtained from any one or more of the entities presented as pElsplA, pCI-Neo, pElRevE, pElHORSE3.1, pElPEGASUS4, pCI-Rab,<br><br>
    25 pElRab.<br><br>
  40. 40. A hybnd viral vector system for in vivo gene delivery, which system compnses a primary viral \ ector which encodes a secondary viral vector, the pnmary vector capable of infecting a first target cell and of expressing therein the secondary viral vector, which<br><br>
    30 secondary vector is capable of transducing a secondary target cell, wherein the pnmary<br><br>
    Printed from Mimosa<br><br>
    WO 99/15684<br><br>
    190<br><br>
    PCT/GB98/02885<br><br>
    vector is obtainable from or is based on a adenoviral vector and the secondary viral vector is obtainable from or is based on a retroviral vector preferably a lentiviral vector.<br><br>
  41. 41 A hybnd viral vector system for in vivo gene delivery, which system comprises a 5 pnmary viral vector which encodes a secondary viral vector, the primary vector capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell, wherem the primary vector is obtainable from or is based on a adenoviral vector and the secondary viral vector is obtainable from or is based on a retroviral vector preferably a lentiviral vector;<br><br>
    10 wherein the viral vector system comprises a functional splice donor site and a functional splice acceptor site; wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of mterest ("NOI"), wherein the functional splice donor site is upstream of the functional splice acceptor site, wherem the retroviral vector is derived from a retroviral pro-vector; wherem the retroviral pro-vector<br><br>
    15 comprises a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; wherem the first NS is downstream of the second NS; such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector<br><br>
    20 42 A retroviral vector capable of differential expression of NOIs in target cells substantially as described herem.<br><br>
    Printed from Mimosa<br><br>
    WO 99/16031<br><br>
    191<br><br>
    PCT/US98/19756<br><br>
    vector is obtainable from or is based on a adenoviral vector and the secondary viral vector is obtamable from or is based on a retroviral vector preferably a lentiviral vector.<br><br>
    41 A hybnd viral vector system for in vivo gene delivery, which system comprises a 5 primary viral vector which encodes a secondary viral vector, the pnmary vector capable of infecting a first target cell and of expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell, wherem the primary vector is obtamable from or is based on a adenoviral vector and the secondary viral vector is obtamable from or is based on a retroviral vector preferably a lentiviral vector;<br><br>
    10 wherem the viral vector system comprises a functional splice donor site and a functional splice acceptor site, wherem the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of mterest ("NOI"); wherem the functional splice donor site is upstream of the functional splice acceptor site; wherem the retroviral vector is derived from a retroviral pro-vector; wherem the retroviral pro-vector<br><br>
    15 comprises a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; wherein the first NS is downstream of the second NS; such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector.<br><br>
    20 42 A retroviral vector capable of differential expression of NOIs in target cells substantially as described herein<br><br>
    Printed from Mimosa<br><br>
    WO 99/16031<br><br>
    192<br><br>
    PCT/US98/19756<br><br>
    ANNEX ABSTRACT VECTOR<br><br>
    5 A retroviral vector is descnbed The retroviral -vector compnses a functional splice donor site and a functional splice acceptor site, wherein the functional splice donor site and the functional splice acceptor site flank a first nucleotide sequence of mterest ("NOI"), wherein the functional splice donor site is upstream of the functional splice acceptor site; wherein the retroviral vector is derived from a retroviral pro-vector;<br><br>
    10 wherein the retroviral pro-vector compnses a first nucleotide sequence ("NS") capable of yielding the functional splice donor site and a second NS capable of yielding the functional splice acceptor site; wherein the first NS is downstream of the second NS; such that the retroviral vector is formed as a result of reverse transcription of the retroviral pro-vector<br><br>
    15<br><br>
    20<br><br>
    Printed from Mimosa<br><br>
    192<br><br>
    50<br><br>
    3<br><br>
    CLAIMS<br><br>
    1. A modified haematopoeitic stem cell (MHSC) comprising one or more nucleotide sequences of interest (NOI) wherein the or each NOI is operably linked to one or more ischaemia like response elements (ILRE).<br><br>
    2. A MHSC compnsing a responsive element operable in a macrophage wherein the responsive element compnses at least one ILRE and at least one transcriptional regulatory element.<br><br>
    3 A MHSC according to claim 1 or claim 2 in combination with one or more agents that are capable of differentiating the MHSC.<br><br>
    4. A modified differentiated HSC (preferably a terminally differentiated cell) compnsing at least one expressable nucleotide sequence of interest (NOI) wherein the or each NOI is operably linked to one or more responsive element(s) active in that differentiated cell wherein the responsive element comprises at least one ILRE and at least one transcnptional regulatory element.<br><br>
    5. A modified differentiated HSC according to claim 4 wherein the modified differentiated HSC is a macrophage.<br><br>
    6. A MHSC according to claim 2 or claim 3 or a modified differentiated HSC according to claim 4 or claim 5 wherein the transcriptional regulatory element is a promoter, preferably a CMV promoter.<br><br>
    7. A MHSC according to claim 1 or claim 6 or a modified differentiated HSC according to any one of claims 4-6 wherein the NOI encodes a pro-drug activation enzyme, preferably a p450 enzyme, preferably a p450CYP2B6 enzyme.<br><br>
    INTELLECTUAL PROPERTY OFFICE OF N.Z.<br><br>
    - 9 OCT 2001 received<br><br>
    A MHSC comprising a responsive element accordmg to claim 2 or claim 3 or claim 6 or claim 7 or a modified differentiated HSC according to any one of claims 4-7 and an NOI; wherein the MHSC or the modified differentiated HSC is prepared by the transduction of a HSC with one or more viral vector; wherein at least one of the viral vectors comprises the NOI and/or the responsive element; and optionally exposing the MHSC with a differentiating agent to provide a modified differentiated HSC.<br><br>
    An in vitro method of regulating the expression of one or more NOIs in an ischaemic environment wherein the method comprises: providing an MHSC according to claim 2 or claim 3 or any one of claims 6-8 or a modified differentiated HSC according to any one of claims 4-8; and expressing the one or more NOIs from the MHSC or the modified differentiated HSC in the ischaemic environment.<br><br>
    A pharmaceutical composition comprising a MHSC according to claim 2 or claim 3 or any one of claims 6-8 or a modified differentiated HSC according to any one of claims 4-8; optionally admixed with a pharmaceutically acceptable diluent, excipient or carrier..<br><br>
    An MHSC according to any one of claims 1-3 or any one of claims 6-8 or a modified differentiated HSC according to any one of claims 4-8 for use m medicine.<br><br>
    Use of an MHSC according to any one of claims 1-3 or any one of claims 6-8 or a modified differentiated HSC according to any one of claims 4-8 or a pharmaceutical composition according to claim 10 in the preparation of a medicament for the treatment of a condition associated with or caused by ischaemia.<br><br>
    INTELLECTUAL PROPERTY OFFICE OF N.Z.<br><br>
    ~ 9 OCT 2001<br><br>
    Received<br><br>
    194<br><br>
    13. Use according to claim 12 wherein the ischaemic disease is selected from the group consisting of cardiovascular disease, peripheral arterial disease, cancer and arthritis.<br><br>
    14. A hybrid viral vector system for in vivo gene delivery, which system comprises one or more primary viral vectors which encode a secondary viral vector, wherein the primary vector or vectors is capable of infecting a first target cell and expressing therein the secondary viral vector, which secondary vector is capable of transducing a secondary target cell, wherein the primary viral vector and/or the secondary viral vector comprises one or more ILREs.<br><br>
    15. A hybrid viral vector system according to claim 14 wherein the primary vector is obtainable from or is based on a adenoviral vector and/or the secondary viral vector is obtainable from or is based on a retroviral vector, preferably a lentiviral vector.<br><br>
    16. A lentiviral vector comprising an ILRE and at least one NOI wherein the NOI is operably linked to the ILRE and wherem the NOI has low basal activity in normal tissue but wherein the expression of the NOI is strongly induced under ischaemic conditions.<br><br>
    17. A combination of an adenoviral vector and a lentiviral vector comprising an ILRE and at least one NOI wherein the NOI is operably linked to the ILRE and wherein the NOI has low basal activity in normal tissue but wherein the expression of the NOI is strongly induced under ischaemic conditions.<br><br>
    18. A host cell comprising a vector according to claim 17 or claim 18.<br><br>
    19. A host cell according to claim 18 wherein the host cell is an MHSC.<br><br>
    20. A vector according to claim 17 or claim 18 for use in medicine.<br><br>
    S3 1 O'2<br><br>
    ^ » jfij O o 1^1<br><br>
    rn c~&gt; m o<br><br>
    -n<br><br>
    I -<br><br>
    195<br><br>
    &amp; V<br><br>
    f<br><br>
    * \<br><br>
    f. )&gt;<br><br>
    21. Use of an adenoviral vector in the preparation of a medicament to deliver an ILRE regulated NOI to a MHSC or a modified differentiated HSC for the treatment of a disease associated with or caused by ischaemia.<br><br>
    22. Use of a retroviral vector m the preparation of a medicament to deliver an ILRE regulated NOI to a MHSC or a modified differentiated HSC for the treatment of a disease associated with or caused by ischaemia.<br><br>
    23. Use of a lentiviral vector in the preparation of a medicament to deliver an ILRE regulated NOI to a MHSC or a modified differentiated HSC for the treatment of a disease associated with or caused by ischaemia.<br><br>
    24. Use of a combination of an adenoviral vector and a lentiviral vector in the in the preparation of a medicament to deliver an ILRE regulated NOI to a MHSC or a modified differentiated HSC for the treatment of a disease associated with or caused by or caused by ischaemia.<br><br>
    Use according to any one of claims 21-24 wherein the NOI encodes a prodrug activation enzyme, preferably a p450 enzyme, preferably a p450CYP2B6 enzyme.<br><br>
    Use according to any one of claims 21-25 wherein the ILRE comprises a promoter, preferably a CMV promoter.<br><br>
    27. Use according to any one of claims 21-26 wherein the ischaemic disease is selected from the group consisting of cardiovascular disease, peripheral arterial disease, cancer and arthritis.<br><br>
    25.<br><br>
    26.<br><br>
    28. A pharmaceutical composition compnsing a vector according to any one of claims 21-27 and a pharmaceutically acceptable diluent.<br><br>
    INTELLECTUAL PROPERTY OFFICE OF N.Z.<br><br>
    - 9 OCT 2001<br><br>
    received<br><br>
    196<br><br>
    29. Vectors or plasmids based on or obtained from any one or more of the entities presented as pElsplA, pCI-Neo, pElRevE, pElHORSE3.1, pElPEGASUS4, pCI-Rab, pElRab.<br><br>
    30. A regulated lentiviral vector comprising an NOI wherein the expression of the NOI is regulated in response to a physiological signal or an agent that mimics a physiological signal.<br><br>
    31. An MHSC, or a modified differentiated HSC or a vector substantially as described herein and with reference to the accompanying Figures.<br><br>
    END OF CLAIMS<br><br>
    </p>
    </div>
NZ503318A 1997-09-23 1998-09-23 Modified haemopoietic stem cell comprised of a spliced upstream with a nucleotide sequence of interest to be used as in gene therapy NZ503318A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9720216.2A GB9720216D0 (en) 1997-09-23 1997-09-23 Delivery of therapeutic genes to haematopoietic stem cells
GBGB9720465.5A GB9720465D0 (en) 1997-09-25 1997-09-25 Dual-virus vectors
PCT/GB1998/002885 WO1999015684A2 (en) 1997-09-23 1998-09-23 Expression of genes in hematopoietic stem cells in hischaemic conditions

Publications (1)

Publication Number Publication Date
NZ503318A true NZ503318A (en) 2001-11-30

Family

ID=26312300

Family Applications (1)

Application Number Title Priority Date Filing Date
NZ503318A NZ503318A (en) 1997-09-23 1998-09-23 Modified haemopoietic stem cell comprised of a spliced upstream with a nucleotide sequence of interest to be used as in gene therapy

Country Status (11)

Country Link
EP (1) EP1017838A2 (en)
JP (1) JP2001517453A (en)
KR (1) KR20010052076A (en)
CN (1) CN1303442A (en)
AU (1) AU747609B2 (en)
CA (1) CA2303663A1 (en)
GB (1) GB2345063B (en)
IL (1) IL134897A0 (en)
NO (1) NO20001487L (en)
NZ (1) NZ503318A (en)
WO (1) WO1999015684A2 (en)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1115877B1 (en) * 1998-09-23 2009-01-14 Oxford Biomedica (UK) Limited Polynucleotide constructs and uses thereof
GB0400443D0 (en) 2004-01-09 2004-02-11 Oxford Biomedica Ltd Cascade
US7148035B1 (en) 1998-11-18 2006-12-12 Oxford Biomedica (Uk) Limited Polypeptide
JP4907767B2 (en) 1998-11-18 2012-04-04 オックスフォード バイオメディカ（ユーケー）リミテッド Polypeptide
GB9906615D0 (en) * 1999-03-22 1999-05-19 Oxford Biomedica Ltd Vector
AU2001240078A1 (en) * 2000-03-07 2001-09-17 St. Jude Children's Research Hospital Highly efficient gene transfer into human repopulating stem cells by rd114 pseudotyped retroviral vector particles
US6849454B2 (en) 2000-03-07 2005-02-01 St. Jude Children's Research Hospital Highly efficient gene transfer into human repopulating stem cells by RD114 pseudotyped retroviral vector particles
GB0009760D0 (en) 2000-04-19 2000-06-07 Oxford Biomedica Ltd Method
GB0024550D0 (en) * 2000-10-06 2000-11-22 Oxford Biomedica Ltd
US6573092B1 (en) * 2000-10-10 2003-06-03 Genvec, Inc. Method of preparing a eukaryotic viral vector
GB0203420D0 (en) 2002-02-13 2002-04-03 Oxford Biomedica Ltd Peptide
GB0203419D0 (en) 2002-02-13 2002-04-03 Oxford Biomedica Ltd Peptide
EP1523496B1 (en) 2002-07-18 2011-06-29 Merus B.V. Recombinant production of mixtures of antibodies
WO2004106375A1 (en) 2003-05-30 2004-12-09 Merus Biopharmaceuticals B.V. I.O. Fab library for the preparation of anti vegf and anti rabies virus fabs
US20100069614A1 (en) 2008-06-27 2010-03-18 Merus B.V. Antibody producing non-human mammals
JP4572320B2 (en) * 2004-02-23 2010-11-04 財団法人大阪産業振興機構 Recombinant human cell and method for evaluating at least one of induction of drug metabolizing enzyme and drug metabolism using the recombinant human cell
EP1888634A2 (en) 2005-05-13 2008-02-20 Oxford Biomedica (UK) Limited Mhc class i and ii peptide antigens derived from tumour antigen 5t4
KR101445337B1 (en) 2006-05-17 2014-11-03 코그네이트 세러퓨틱 인크. Isolation and purification of hematopoietic stem cells from post-liposuction lipoaspirates
SG10201607371UA (en) 2012-04-20 2016-10-28 Merus Nv Methods and means for the production of ig-like molecules
WO2017108931A1 (en) * 2015-12-22 2017-06-29 INSERM (Institut National de la Santé et de la Recherche Médicale) Improved hybrid dual recombinant aav vector systems for gene therapy
CN113699146A (en) * 2020-05-22 2021-11-26 深圳市深研生物科技有限公司 Promoter element, retroviral genome transcription cassette comprising the same, and vector

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2113990A1 (en) * 1991-07-26 1993-02-18 Frederick L. Moolten Cancer therapy utilizing malignant cells
FR2709309B1 (en) * 1993-08-25 1995-11-10 Centre Nat Rech Scient Cellular compositions, preparation and therapeutic uses.
GB9402857D0 (en) * 1994-02-15 1994-04-06 Isis Innovation Targeting gene therapy
WO1995029704A1 (en) * 1994-04-28 1995-11-09 Scott Freeman Cell lines obtained by in vivo migration and by fusion with autoimmune cells
US5834306A (en) * 1994-12-23 1998-11-10 Sri International Tissue specific hypoxia regulated therapeutic constructs
NZ334312A (en) * 1996-10-09 2000-10-27 Oxford Biomedica Ltd Use of mononuclear phagocytes and a binding agent in therapeutic drug delivery

Also Published As

Publication number Publication date
JP2001517453A (en) 2001-10-09
AU9356298A (en) 1999-04-12
WO1999015684A2 (en) 1999-04-01
GB2345063B (en) 2002-07-24
GB0006993D0 (en) 2000-05-10
EP1017838A2 (en) 2000-07-12
AU747609B2 (en) 2002-05-16
GB2345063A (en) 2000-06-28
WO1999015684A3 (en) 1999-06-10
CA2303663A1 (en) 1999-04-01
NO20001487L (en) 2000-05-23
NO20001487D0 (en) 2000-03-22
CN1303442A (en) 2001-07-11
WO1999015684A8 (en) 1999-08-12
WO1999015684A9 (en) 1999-09-16
KR20010052076A (en) 2001-06-25
IL134897A0 (en) 2001-05-20

Similar Documents

Publication Publication Date Title
EP1017837B1 (en) Retroviral vectors comprising a functional splice donor site and a functional splice acceptor site
AU747609B2 (en) Expression of genes in hematopoietic stem cells in hischaemic conditions
EP1504108B1 (en) Lentiviral vector
EP1895010B1 (en) Equine infectious anaemia virus (eiav) based vectors
EP1218528A1 (en) Producer cell for the production of retroviral vectors
US20040234505A1 (en) Polynucleotide constructs and uses thereof
US9932597B2 (en) Vectors for transgene expression
EP1115877B1 (en) Polynucleotide constructs and uses thereof
US6238858B1 (en) Transgenomic viruses
AU3312800A (en) Retroviral vectors comprising functional and non-functional splice donor and splice acceptor sites
CA2343324A1 (en) Polynucleotide constructs and uses thereof
ZA200101494B (en) Polynucleotide contructs and uses therof.
GB2356200A (en) Hybrid viral vectors
US20050106732A1 (en) Vector system

Legal Events

Date Code Title Description
PSEA Patent sealed
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)