WO2002064805A2

WO2002064805A2 - Replication competent non-mammalian retroviral vectors

Info

Publication number: WO2002064805A2
Application number: PCT/EP2002/001223
Authority: WO
Inventors: Matthias Renner; Walter GÜNZBURG
Original assignee: Institut für Virologie Teilrechtsfähiges Institut an der Veterinärmedizinischen Universität Wien
Priority date: 2001-02-09
Filing date: 2002-02-06
Publication date: 2002-08-22
Also published as: WO2002064805A3

Abstract

The present invention relates to a retroviral vector, which is derived from a non-mammalian retrovirus and which is replication competent in mammalian cells. Said vector comprises a transport element, which mediates in the target cell nuclear export of RNA transcribed from the provirus. In addition, the vector comprises all genes, required for replication of the retrovirus in a target cell, wherein expression of said genes is controlled by a heterologous regulatory sequence. The controlled amplification of the retroviral vector makes the vector very safe and highly efficient for gene transfer. Consequently, the vector is highly suitable for in vivo gene therapy in mammals including humans and especially for the treatment of tumors.

Description

Replication competent non-mammalian retroviral vectors

Background of the invention

Gene therapy is of major interest for the treatment of numerous diseases such as cancer and HIV. For gene therapy a sequence of interest such as a therapeutic gene is introduced into the host cell. Transfer of the sequence of interest may be performed using a vector, i.e. a DNA- sequence, in which the sequence of interest is included and which facilitates the introduction of the sequence of interest into the host cell. Viruses efficiently enter a cell, thereby transferring their own genome and the sequence of interest into the target cell. Viruses are therefore highly suitable as vectors for gene therapy. Depending on the virus used as a vector, the sequence of interest can be expressed transiently, i.e. only for a short period of time or stably, i.e. over a long period of time. In most cases of gene therapy a stable expression is required. Such a stable expression can be achieved using retroviral vectors: During the life cycle of a retrovirus the retroviral particle infects a target cell, thereby releasing the retroviral RNA genome. Then, the RNA is reverse transcribed into DNA and the DNA- form of the retrovirus, the so-called "provirus", is stably integrated into the genome of the infected cell. Subsequently, the retroviral genome is transcribed into RNA, the RNA is exported out of the nucleus and translated into the retroviral proteins. Then, the RNA is packaged and new retroviral particles are produced. A sequence of interest included in a retroviral vector follows exactly the same steps of reverse transcription, integration, and expression. Hence, the sequence of interest can be efficiently integrated into the genome of a cell with the help of a retroviral vector and is stably expressed in this cell. Consequently, the use of retroviral vectors is currently the method of choice for the transfer of therapeutic genes in a variety of approved protocols both in the USA and in Europe (Kotani, H., P.B. Newton, S. Zhang, Y.L. Chiang, E. Otto, L. Weaver, R.M. Blaese, W.F.

Anderson, and G.J. McGarrity. 1994, Human Gene Therapy 5: 19-28).

The infection of one cell of a host organism with a replication competent retrovirus results in the amplification of the retrovirus i.e. more retroviral particles are produced which again infect cells. However, during replication the retroviral sequence integrates into the target cell genome and possibly results in the inactivation of a host cell gene or changes the regulation of a host cell gene (insertional mutagenesis and/or carcinogenesis). In order to minimize said risk, in vitro gene therapy was developed. In this case, target cells of a patient are isolated, treated with a retroviral vector, tested for safety, e.g. for the absence of viral particles, and finally reintroduced into the patient. Hence, the patient is never in direct contact with the therapeutically used retrovirus. However, this method is time- and cost-consuming and most cell types, e.g. nerve cells, can hardly be isolated for treatment. Consequently, an in vivo approach is urgently needed. However, in this case retroviral vectors are directly administered to the patient. To minimize the risk of mutagenesis or carcinogenesis replication deficient retroviral vectors are used, which infect only one target cell but can not form new retroviral particles. All retroviral vectors currently used for gene therapy are replication-deficient in the target cell.

However, the lack of replication has also severe disadvantages. Since the retrovirus does not amplify in the host, each retrovirus infects in maximum one host cell (single hit kinetik). In addition, replication deficient retroviruses can only be produced in specialized cell lines at only very low titers. Furthermore, retroviral particles are partially inactivated by the immune system before they reach the target cells. Consequently, only a small number of cells is finally transduced, i.e. gene transfer using replication-deficient retroviral vectors results in very low transduction efficiencies. However, for most applications the infection of a small number of cells is not sufficient to achieve a therapeutical effect. For example, for the treatment of tumors with distant metastasis, all or at least most of the tumor cells must be infected. However, this is not possible using a replication-deficient retroviral vector. Even when several injections of the replication-deficient retroviral vector are performed, the transduction efficiencies are low. In fact, clinical trials for gene therapy of a highly malignant brain tumor with replication deficient retroviral vectors did not give satisfying results (Culver et al., Science 1992, 256: 1550-1552).

In order to increase the transduction levels, packaging cells producing replication-deficient retroviral particles were transplanted into the patient. For example, cells of the virus packaging cell line PA 317 were injected into the brain tumors to constitutively produce retrovirus vectors carrying the HSV-tk gene (Oldfield et al., Human Gene Therapy 1993, 4:39-69). However, the viral vector did not diffuse far enough from the site of initial injection, resulting in a transduction efficiency of less than 1 % of the tumor cell mass. Hence, even when virus-producing cells are transplanted into the host, the number of transduced target cells is not sufficient for most applications.

In conclusion, the transduction efficiencies of the currently used replication- deficient retroviral vectors are not sufficient for most applications specifically for in vivo gene therapy, and are especially not suitable for treatment of metastasized malignant diseases.

Object of the invention

It is an object of the present invention to provide a safe retroviral vector for efficient transduction of target cells also in vivo. Particularly, this vector should be useful for the treatment of cancer with distant metastasis.

Detailed description of the invention

To achieve the foregoing and other objects, the present invention provides a retroviral vector, which is derived from a non-mammalian retrovirus and which is replication competent in mammalian cells. Said vector comprises a transport element, which mediates in the target cell nuclear export of RNA transcribed from the provirus. In addition, the vector comprises all genes required for replication of the retrovirus in a target cell, wherein expression of said genes is controlled by a heterologous regulatory sequence. The expression of the retroviral genes in a target cell results in the amplification of the retroviral vector and in the formation of a large number of retroviral particles. These retroviral particles infect new cells, where the process is repeated. Hence, with the vector according to the present invention high transduction efficiencies are achieved in vivo.

In contrast to the wild-type retroviruses, the expression of retroviral genes included in the vector according to the present invention is strictly controlled by a heterologous regulatory sequence such as a promoter, enhancer and/or silencer. Control by a heterologous regulatory sequence has extremely important consequences from a safety point of view, since the degree of amplification and the type of tissue, in which the vector i s amplified, is tightly controlled. Preferably the regulatory sequence is also itself regulated, i.e. for example only active, when a specific substance i s present (inducer) or absent (repressor) in the infected target cell. Hence, advantageously, the amplification of the vector can be controlled by the presence and/or absence of said inducer and/or repressor. Most preferably, the regulatory sequence is target cell specific so that the vector is only amplified in said specific target cells. Consequently, the vector according to the present invention allows the selective targeting of a specific cell type, such as e.g. tumor cells. Again, this is very important from the safety point of view, since the amplification of the vector is restricted to a limited number of preselected cells, whereas all other cells are not affected.

Regulatory sequences preferred for the expression of the retroviral genes comprise but are not limited to one or more elements of the group consisting of Whey Acidic Protein (WAP), Mouse Mammary Tumor Virus (MMTV), β-lactoglobulin, lactalbumine and casein specific regulatory elements and promoters which may be used to target human mammary tumors. In addition, pancreas specific regulatory elements and promoters, such as carbonic anhydrase promoter, glucokinase promoter and phosphoglycerate kinase promoter, lymphocyte specific regulatory elements and promoters including human immunodeficiency virus (HIV), immunoglobulin and MMTV lymphocytic specific regulatory elements and promoters and MMTV. specific regulatory elements and promoters such as ^MMT p2 _conf_errj_ng responsiveness to glucocorticoid hormones or directing expression to the mammary gland, T-cell specific regulatory elements and promoters such as T-cell receptor gene and CD4 receptor promoter, B-cell specific regulatory elements and promoters such as immunoglobulin promoter or mb1 and tumor specific promoters such as the tissue factor promoter, the carcino embryonic antigen (CEA) promoter and the vascular endothelial growth factor (VEGF) promoter are preferred.

In vertebrate cells about 1 % of the cellular genome is similar to a retroviral genome forming the so-called "endogenous viruses". Since homologous sequences can recombine, i.e. similar sequences can be exchanged, sequences of endogeneous viruses may recombine with similar retroviral sequences such as sequences of the retroviral vector. However, by said recombination potentially pathogenic viruses are formed. Obviously, a vector for gene therapy needs a safeguard against said formation of potentially pathogenic retroviral vectors. Therefore, in replication-deficient retroviral vectors, more than one factor required for recombination is deleted or mutated, so that even after replacement of one of the defect sequences of the vector the other defects would prevent the replication of the vector. However, this safeguard can not be used in the vector according to the present invention, since the vector must be replication-competent, i.e. all sequences required for replication must be functional. Hence, a different safeguard is required in the vector to prevent the formation of potentially pathogenic retroviral vectors. According to the present invention the vector is derived from a non-mammalian retrovirus, preferably an avian retrovirus and used for gene transfer in mammalian, preferably human cells. Since retroviral sequences in a mammalian cell, such as endogenous retroviruses, are derived from mammalian retroviruses, the sequence similarity between the non-mammalian retroviral vector and retroviral sequences in the transduced host cell is very low or even absent. Since considerable sequence similarity is however required for recombination, the non-mammalian retroviral vector according to the present invention does not undergo recombination with endogenous retroviruses in the mammalian cell. This, of course, has extremely important consequences from a safety point of view, since no potentially pathogenic viruses are produced. But even if, unexpectedly, the non-mammalian retroviral vector and a mammalian retroviral sequence would recombine, the mammalian regulatory sequence, obtained from the mammalian retroviral sequence by the assumed recombination event could not function efficiently in the context of the structurally and functionally very different non-mammalian retroviral vector. Hence, even after an assumed recombination event the non-mammalian vector could not amplify efficiently. Consequently, according to the present invention a retroviral vector derived from a non- mammalian, preferably avian retrovirus such as spleen necrosis virus (SNV), reticulo endotheliosis virus (REV) or reticulo endotheliosis virus (ES4), and more preferably derived from RSV (Rous sarcoma virus), and most preferably from RSV strain Schmidt-Rupin A, is used.

In conclusion, the present invention provides a retroviral vector, which i s extremely safe especially for applications such as in vivo gene therapy due to the tight control of amplification by a heterologous regulatory sequence and the origin from a non-mammalian retrovirus. Naturally occurring non-mammalian retroviruses can not amplify in mammalian cells. Consequently, if a conventional non-mammalian retroviral vector is introduced into a mammalian cell, no retroviral particles are produced, and, hence the desired high transduction efficiency is not achieved. However, the inventors surprisingly showed that the inclusion of a transport element, mediating the nuclear export of RNA transcribed from the provirus, results in the formation of infectious retroviral particles in mammalian cells. Consequently, the non-mammalian retroviral vector according to the present invention comprises not only all genes required for replication under the control of a heterologous regulatory sequence but also, in addition said transport element.

Preferably, a Constitutive Transport Element (CTE) derived from a mammalian virus is included in the vector. A CTE is a cis-acting element that promotes nuclear export of unspliced or incompletely spliced mRNA, wherein the function of the CTE is independent of a factor encoded by a viral genome. For most CTEs nuclear export depends on factors encoded by the host cell genome. Other CTEs, which are also called Post- transcriptional Regulatory Elements (PREs), are probably independent of any proteins and simply stabilize the unspliced RNA. The specific factors of the host cell genome, the way of function of the CTEs, and the structure of the CTEs are largely unknown and different for different viruses. For example for avian retroviruses it is known that a direct repeat element functions as a CTE, and that said avian CTE is not functional in mammalian cells. Due to the little knowledge about CTEs of mammalian viruses and the large differences between mammalian viruses and non- mammalian viruses, it was expected that the CTE of a mammalian virus would not function in the environment of an avian retrovirus in a mammalian cell. However, the inventors surprisingly showed that the vector according to the present invention is amplified in mammalian cells and that, thus, a transport element derived from a mammalian virus can mediate nuclear export of retroviral RNA into the cytoplasm of the cell. According to a preferred embodiment of the invention at least one CTE of a mammalian virus such as the MPMV (Mason-Pfizer monkey virus), SRV-2 (simian retrovirus 2), or the WHV-PRE (woodchuck hepatitis virus-PRE) is introduced into the non-mammalian, preferably avian retroviral vector. Most preferably, the CTE of the mammalian virus is inserted into the direct repeat of an avian retroviral vector and/or replaces said direct repeat.

Surprisingly, in this case, infectious retroviral particles are not only formed in mammalian cells but also in avian cells, although the direct repeat element is interrupted and/or deleted and hence the CTE function of the direct repeat of the avian retrovirus is supposably inactivated.

In the context of the present invention, the term "heterologous" is used for any combination of DNA sequences that is not normally found intimately associated in nature.

"Transduction" describes in general a process, wherein a virus or a viral vector transfers a nucleic acid sequence, which is heterologous to said virus or viral vector, into a cell.

"Transfection" basically means introduction of a foreign, more or less protein-free DNA molecule into a cell.

"Infection" of a cell with a virus basically means that a nucleic acid sequence and proteins are introduced into a cell. The term "regulatory sequence" describes any nucleic acid sequence, which influences the transcription and/or translation of another nucleic acid sequence, e.g. of a gene. Examples for said regulatory sequences are promoter, enhancer and silencer sequences.

"Replication competent retroviral vector" basically means that the vector can integrate into the genome of a suitable target cell, that at least a part of the vector sequence is expressed and that new retroviral particles are formed.

"Transport element" in this application describes in general an element capable of mediating the transport of RNA transcribed from a provirus out of the nucleus into the cytoplasm.

"Constitutive Transport Element" (CTE) describes a cis-acting element that promotes nuclear export of unspliced or incompletely spliced mRNA, wherein the function of the CTE is independent of factors encoded by a viral genome.

"Coding sequence" means a nucleic acid sequence, which can be transcribed into RNA.

Retroviral vectors are based on a retroviral genome. The retroviral genome consists of an RNA molecule with the basic structure R-U5-gag-pol-env- U3-R. During the process of reverse transcription, the U5 region is duplicated and placed at the right hand end of the generated DNA molecule, whilst the U3 region is duplicated and placed at the left hand end of the generated DNA molecule. The resulting structure U3-R-U5 is called LTR (Long Terminal Repeat) and is thus identical and repeated at both ends of the DNA structure or provirus. The U3 region at the left-hand end of the provirus harbors the promoter. This promoter drives the synthesis of an RNA transcript initiating at the boundary between the left-hand U3 and R regions and terminating at the boundary between the right hand R and U5 region. This RNA is packaged into retroviral particles and transported into the target cell to be infected. In the target cell the RNA genome is again reverse transcribed as described above.

The retroviral vector according to the present invention comprises two LTRs - a 5^' and a 3^' LTR - and an insertion site for a heterologous coding sequence in between of the LTRs in the body of the vector. Furthermore, the vector according to the present invention carries all retroviral genes, which are necessary for retroviral replication, wherein these genes are preferably located in the body of the vector. The heterologous regulatory sequence, controlling the expression of said retroviral genes, can be inserted into the body of the vector as well. However, preferably, the regulatory sequence is inserted into an LTR, more preferably into the US- region of an LTR. Most preferably, the retroviral vector is a promoter conversion (ProCon) vector (see PCT/EP95/03445).

In the promoter conversion vector the right hand U3 region is altered, but the normal left hand U3 structure is maintained; the vector can be normally transcribed into RNA utilizing the normal retroviral promoter located within the left hand U3 region. However, the generated RNA will only contain the altered right hand U3 structure. In the infected target cell, after reverse transcription, this altered U3 structure will be placed at both ends of the retroviral structure.

The altered region carries a polylinker instead of the U3 region. Thus, any regulatory sequence, including those directing tissue specific expression can be easily inserted. This promoter is then utilized exclusively in the target cell for expression of linked genes carried by the retroviral vector.

According to this embodiment of the invention, the retroviral vector comprising the retroviral genes required for replication under the control of the heterologous regulatory sequence can be produced as follows: In a ProCon vector the retroviral genes are included in the body of the vector and the heterologous regulatory sequence is inserted into the U3 region of the 3^'-LTR. Subsequently, the resulting vector is transfected into a suitable producer cell. According to the ProCon principle, in this producer cell the expression of the retroviral vector is regulated by the normal unselective retroviral promoter contained in the U3 region of the 5^'-LTR and the resulting RNA is packaged into a retroviral particle. However, when a target cell of a mammal is infected with said retroviral particles, promoter conversion occurs, and the expression of the retroviral genes is regulated by the heterologous regulatory sequence. Accordingly, not only virtually any tissue specific promoter can be included in the system, providing for the selective targeting of a wide variety of different cell types, but additonally, following the conversion event, the structure and properties of the retroviral vector no longer resemble that of a virus. This, of course, has extremely important consequences from a safety point of view, since other retroviral vectors may undergo genetic recombination with the endogenous retroviruses producing potentially pathogenic viruses. Promoter conversion vectors do not resemble retroviruses because they no longer carry U3 retroviral promoters after conversion thus reducing the chances of genetic recombination. Hence, the replication-competent non-mammalian retroviral vectors based on the ProCon principle even increase the safety of the already very safe vectors according to the present invention. Preferably, in the ProCon vector the heterologous regulatory sequence is inserted within the U3 region of the 3' LTR, more preferably wholly or partially replacing the U3 region. Nevertheless, the regulatory sequence can also be inserted between U3 and the R region of the 3' LTR.

The ProCon vector comprises two regulatory sequences, one in the 3^'- LTR, which is preferably a regulated promoter, and the promoter of the U3 region of the 5^'-LTR. As described above, in the producer cell the expression of genes of the ProCon vector is driven by the U3 region of the 5^'-LTR. Consequently, the efficiency of retroviral particle formation largely depends on the activity of said promoter located in the U3 region of the 5^'- LTR. However, some of the promoters of retroviral vectors are not very active and/or not suitable for a selected producer cell. For example, the promoter of a non-mammalian retrovirus is often methylated and thereby downregulated or even inactivated, when the retroviral vector is transferred into a mammalian cell. Consequently, according to a preferred embodiment of the invention, the U3 region of the 5^'-LTR may also be replaced by a heterologous regulatory sequence. Preferably, said second regulatory sequence is a constitutively and ubiquitously active promoter. In this case the expression of the retroviral genes in the producer cell is driven by the constitutively active promoter of the 5^'-LTR. Most preferably, a promoter of a mammalian cell and/or of a virus infecting mammalian cells is used as a regulatory sequence, when the producer cell is of mammalian origin. However, after infection of the target cell with said retroviral particles, promoter conversion takes place so that the selective regulatory sequence originally located only in the U3 region of the 3^'-LTR is also included in the U3 region of the 5^'-LTR. Accordingly, said e.g. target cell specific regulatory sequence subsequently drives the expression of the retroviral genes in the target cells. According to the present invention the vector comprises all retroviral genes required for the formation of retroviral particles, such as gag, pol, and env. When retroviral particles assemble, the gag protein needs to be packaged into the retroviral particle. In simple retroviruses with mammalian tropism the packaging of gag is facilitated by targeting the gag protein to the membrane. The targeting is achieved by myristylation of the gag protein, i.e. the fatty acid myristilate is provided by the target or producer cell and bound to the Gag protein. However, non-mammalian retroviruses don^'t have a myristilation signal at the gag gene and are consequently not myristylated.

Hence, in a preferred embodiment of the invention, the gag gene is mutated to create a myristilation signal preferably at the 5^'-end of the gag gene. More preferably a single base pair mutation, most preferably directly after the gag ATG initiation codon is created, resulting preferably in a gag protein with a glycin next to the initiating amino acid methionine. This is the first time, that it was shown that a myristilation signal can be inserted into a replication competent retroviral vector to target the gag protein to the membrane.

According to another preferred embodiment of the invention, the env gene of the non-mammalian retroviral vector is replaced by an env, which is specific for certain target cells. Furthermore, said env is preferably amphotropic, i.e. allows the infection of cells of different species. Preferably, env is selected from Vesicular Stromatitis Virus-G (VSV-G) protein, cat endogenous retrovirus RD1 14 env and/or gibbon ape leukemia virus (GALV) 10A1 env. Most preferably MLV 4070A env is used.

It has been shown that the exchange of the pol gene of one virus type by the pol gene of a different virus type can increase the virus production in certain cells. For example, the insertion of the pol gene of the Bryan High Titer RSV strain (BHTP) increases virus production in avian cells by a factor of five. Consequently, according to a preferred embodiment of the invention, a heterologous pol gene may be included in the retroviral vector preferably completely or partially replacing the homologous pol gene of the retroviral vector and resulting in an increase of virus production preferably in mammalian cells. Preferably said heterologous pol gene is selected from an avian retrovirus such as RSV bratislava, RSV Bryan standard, RSV Prague or RSV Schmidt-Ruppin. Most preferably, the pol gene is of BHTP.

According to a further embodiment of the invention, the retroviral vector comprises in addition a heterologous coding sequence. The heterologous coding sequence is preferably selected from one or more elements of the group consisting of marker genes, therapeutic genes, anti-tumor genes and/or sequences encoding antisense RNA. The marker and therapeutic genes are preferably selected from one or more elements of the group consisting of β-galactosidase gene, neomycin gene, hygromycin gene, puromycin gene, luciferase gene, green fluorescent protein (gfp) gene, and/or fluorescence marker genes like blue fluorescent protein (bfp) and yellow fluorescent protein (yfp) gene. More preferably the heterologous gene is an antitumor gene such as e.g. Herpes Simplex Virus thymidine kinase gene, cytosine deaminase gene, and most preferably cytochrome P450 gene.

The heterologous sequence of interest is inserted into a sequence of the retroviral vector, which is not required for replication of the retrovirus, such as an oncogenic sequence e.g. v-src of SRV. Preferably, the sequence, which is not required for replication, is partially or more preferably completely deleted. Consequently, when a heterologous coding sequence is inserted into said vector, the overall length of the vector is not or only minimally increased compared to the retroviral genome. Advantageously, a vector with a sequence length close to the length of the retroviral genome is very stable and easily packaged into the retroviral particles.

Sequences, which are not required for replication such as v-src of RSV are sometimes flanked by a direct repeat on both sides. Due to the homology of the upstream and the downstream direct repeats recombination events occur frequently which result in the loss of the sequence in between of the two repeat elements. If a heterologous sequence is inserted in place of a sequence flanked by direct repeats the heterologous sequence is also frequently lost. Hence, according to a preferred embodiment of the invention, a direct repeat element is deleted and the heterologous sequence is inserted into said deletion site. Most preferably, a vector based on RSV is used, wherein v-src and one direct repeat are deleted and the sequence of interest is inserted into said deletion site.

According to another preferred embodiment, the expression of the coding sequence is regulated by the same regulatory sequence as the expression of the retroviral genes. In a preferred embodiment, the retroviral genes are expressed in the target cell by a target cell specific regulatory sequence. Hence, both, the retroviral particles and the product of the coding sequence, are only produced within the specific target cells. Advantageously, non-target tissue is free from side effects associated with non-specific expression of the heterologous coding sequence.

The vector according to the present invention is highly suitable for tumor therapy, especially for the treatment of cancer with distant metastasis. In this case, the heterologous regulatory sequence is only active in tumor cells and drives the expression of the retroviral genes and an antitumor gene. The antitumor gene is preferably a suicide gene, i.e. a gene coding for a protein, which kills the cell. The antitumor gene may also encode cytochrome P450, which catalyzes the conversion of a prodrug, such as ifosfamid, into active metabolites, which kill tumor cells. In the tumor cell not only the heterologous coding sequence, but also at the same time the retroviral genes are expressed, and thus all proteins required for generation of new retroviral particles are produced. Hence, before the tumor cell is killed by the suicide gene or by a converted chemotherapeutic agent retroviral particles are formed and released from the tumor cell. The freshly produced retroviral particles infect new tumor cells, in which the suicide mechanism and also the process of generation of retroviral particles are repeated. Advantageously, the suicide mechanism and process of generation of new retroviral particles is also functional in metastases, finally resulting in the elimination of the tumor and its metastases. Since the virus can not be amplified in any non-tumor cell, the retroviral vector is also eliminated as soon as the tumor cells are eliminated. Consequently, an infection with the vector according to the present invention is self-limiting. In conclusion, the vector according to the present invention is safe and efficient for the treatment of tumors.

After transduction of a target cell with the retroviral vector according to the present invention, the vector is incorporated into the cellular genome, forming the so-called "provirus". Subsequently, the genes included in the vector are expressed and finally new retroviral particles are formed.

Consequently, the present invention includes also a retroviral provirus, mRNA of said retroviral provirus, any RNA resulting from a retroviral vector according to the invention, cDNA thereof and retroviral particles comprising the vector according to the present invention, as well as host cells infected with this retroviral particle.

A further embodiment of the invention provides a method for introducing homologous and/or heterologous nucleic acid sequence into a target cell, comprising transfecting a target cell with a vector according to the present invention and/or infecting a target cell population in vivo and/or in vitro with recombinant retroviral particles produced according to the present invention. The nucleotide sequence is selected from one or more elements of the group consisting of genes or parts of genes encoding proteins, regulatory sequences and promoters.

Furthermore, the retroviral vector, the retroviral provirus, an infected host cell, retroviral particles and/or RNA thereof can be used for producing a pharmaceutical composition for in vivo and in vitro gene therapy in mammals including humans.

According to another embodiment of the invention a method for the analysis of the function and/or activity of a nucleic acid sequence included in the vector is provided. According to said method cells of a non-human animal are transfected with the vector according to the present invention or infected with a retroviral particle according to the present invention. Subsequently, the animal is maintained under suitable conditions allowing the production of viral particles in cells of said animal, and finally the cells, in which viral particles are produced, are detected. Advantageously, viral particles produced in cells of said animal infect new target cells and the process is repeated. Hence, a snowball effect is launched resulting in the production of a large number of viral particles, which infect new cells. However, viral particles will only be produced in cells which can be infected by the retroviral particle and in which also the retroviral proteins are produced. Consequently, a large number of cells in tissues, in which the retroviral vector can amplify are infected, whereas no virus is produced in all other cells and tissues. Due to said enhancement virus-producing cells can easily be detected. Hence, the method according to the present invention allows the easy and fast analysis of the function of sequences within the vector such as the tissue specificity obtained by the inclusion of a specific env gene.

Preferably, the function of a heterologous regulatory sequence, which drives the expression of the retroviral genes, more preferably of a target cell specific regulatory sequence is analyzed. In this case, the target cell specific regulatory sequence expresses the retroviral proteins only in specific target cells and consequently, retroviral particles are only produced in said target cells. Hence, the method according to the present invention allows the easy and fast detection of tissues, in which a regulatory sequence of interest is active and thereby to study the tissue specificity of a regulatory sequence.

Summary of the invention

The invention inter alia comprises the following, alone or in combination:

A retroviral vector, being replication competent in a mammalian target cell, said vector being derived from a non-mammalian retrovirus and comprising a transport element mediating nuclear export of RNA transcribed from the provirus and the retroviral genes required for replication of the retrovirus, wherein expression of said genes in the target cell is regulated by a heterologous regulatory sequence.

The retroviral vector as above, wherein the vector is derived from an avian retrovirus.

The retroviral vector as above, wherein the vector is derived from Rous

Sarcoma Virus (RSV).

The retroviral vector as above, wherein the regulatory sequence is target cell specific.

The retroviral vector as above, wherein the transport element is derived from a mammalian virus.

The retroviral vector as above, wherein the transport element is a Constitutive Transport Element (CTE).

The retroviral vector as above, wherein the CTE is selected from the group comprising a CTE of woodchuck hepatitis virus (WHV), simian retrovirus-2 (SRV-2) and/or Mason-Pfizer monkey virus (MFMV).

The retroviral vector as above, wherein one of the two avian CTEs is replaced by a CTE as above.

The retroviral vector as above, wherein the gag gene comprises a myristilation signal.

The retroviral vector as above, wherein the myristilation signal is located at the 5^'-end of the gag encoding sequence.

The retroviral vector as above, wherein the myristilation signal is obtained by mutation of the gag gene. The retroviral vector as above, wherein the env encoding sequence is replaced by a heterologous env encoding sequence.

The retroviral vector as above, wherein the env encoding sequence is derived from a mammalian retrovirus.

The retroviral vector as above, wherein the env encoding sequence encodes an amphotropic env.

The retroviral vector as above, wherein the env encoding sequence is derived from MLV.

The retroviral vector as above, wherein the pol encoding sequence is replaced by a heterologous pol encoding sequence.

The retroviral vector as above, wherein the pol gene is derived from the Bryan High Titer strain of RSV.

The retroviral vector as above, wherein said retroviral vector is based on a promoter conversion vector.

The retroviral vector as above, wherein expression of the retroviral genes is regulated by a heterologous regulatory sequence before promoter conversion occurs.

The retroviral vector as above, wherein said regulatory sequence is different from the regulatory sequence, which regulates the expression of the retroviral genes in the target cell.

The retroviral vector as above, wherein said regulatory sequence is constitutively and ubiquitously active. The retroviral vector as above, comprising in addition a heterologous coding sequence.

The retroviral vector as above, wherein said heterologous coding sequence is a therapeutic gene, an anti-tumor gene and/or a marker gene.

The retroviral vector as above, wherein the antitumor gene is a gene encoding cytochrome P 450.

The retroviral vector as above, wherein expression of the coding sequence is regulated by the same heterologous regulatory sequence, which regulates the expression of the retroviral genes.

A retroviral particle comprising the vector as above.

The retoviral particle as above, obtainable by transfecting a producer cell with the retroviral vector as above.

A retroviral provirus obtainable by infecting a cell with the retroviral particle as above or by transfecting the cell with the vector as above.

mRNA of the retroviral provirus as above.

RNA of the retroviral vector as above.

A host or producer cell transfected with a retroviral vector as above and/or infected with a retroviral particle as above.

A pharmaceutical composition containing a therapeutically effective amount of a recombinant retroviral vector as above and/or of a recombinant retroviral particle as above and/or a cell as above.

A method for the analysis of the function and/or activity of a nucleic acid sequence within the retroviral vector as above, wherein a non-human animal is transfected with the retroviral vector as above and/or infected with the retroviral particle as above, maintained under suitable conditions, and wherein subsequently retroviral particles produced by the cells of the non- human animal are detected.

The method as above, wherein the activity and/or specificity of the regulatory sequence is analyzed.

The method as above, wherein the specificity of env is analysed.

A method for introducing a nucleic acid sequence into a target cell comprising transfecting said target cell with the retroviral vector as above and/or infecting the target cell with a retroviral particle as above.

The vector as above and/or the retroviral particle as above and/or the cell as above for use as a medicament.

The vector as above and/or the retroviral particle as above and/or the cell as above for use in the treatment of cancer, preferably of cancer with distant metastases.

Use of the retroviral vector as above, the retroviral particle as above and/or the cell as above for producing a pharmaceutical composition for the treatment of any relevant disorder or disease.

The use as above for producing a pharmaceutical composition for the treatment of cancer, preferably of cancer with distant metastases.

A method for the treatment of a genetic defect, cancer, viral disease or any other relevant disorder or disease comprising administration to a subject in need thereof a therapeutically effective amount of the retroviral vector as above and/or a retroviral particle as above and/or the cell as above. The above-described method for the treatment of a genetic defect for the treatment of cancer with distant metastasis.

Figure legends

Figure 1 : Northern analysis of cytoplasmic RNA extracted from 293 cells transfected with RSV-based vector plasmids. The control plasmid pRCASeGFP originates from plasmid pRCASBP-M2C(4070A), containing the eGFP gene in the unique Clal cloning site. The Northern blot was hybridized using an eGFP specific probe which binds to all splicing permutations, lane 1 : pRCASeGFPMPMV+ddr; lane 2: empty 293 cells; lane 3: pRCASeGFP. Positions marked on the autoradiography: A, genomic length RNA; B, env-spliced RNA; C, eGFP-spliced RNA.

Examples

The following examples will illustrate the present invention. They will be well understood by a person skilled in the art that the provided examples in no way may be interpreted in a way that limits the applicability of the technology provided by the present invention to these examples.

Construction of an RSV-based, tissue specific, replication competent retroviral vector expressing a reporter (eGFP) or therapeutic (cytochrome P450 2B1 (CYP2B1)) gene

The replication competent retroviral vectors

RCASMBP(4070A)myrMPMVeGFP and RCASeGFPCTE+ddr were constructed via multiple cloning steps. The abbreviation CTE in RCASeGFPCTE+ddr refers generally to any CTE or CTE-like element; in the specific constructs of this example section the CTE from the Mason- Pfizer-Monkey-Virus (MPMV) and the Simian Retrovirus (SRV) 2, and the Woodchuck Hepatitis Virus (WHV) posttranscriptional regulatory element (PRE) are used. The resulting specific retroviral vectors are named accordingly, e.g. RCASeGFPMFW+ddr, RCASeGFPSRV+ddr and RCASeGFPWPRE+ddr, respectively. The detailed cloning strategy is described in the following.

The Rous sarcoma virus-based retroviral vector plasmid pRCASBP- M2C(4070A) contains the env region from an amphotropic MLV, the pol region from the Bryan High Titre strain of RSV, a unique Clal restriction site in place of the v-src gene, and a deletion of the upstream direct repeat element which promotes the stability of heterologous sequences which are placed in the unique Clal site (Barsov and Hughes, J. Virol. 70, 3922-3929.)

The U3 of this plasmid was removed in a long template PCR process. Primers bound to the 5'-end of the U3-region (primer RSVU3cPmel, 5^'- gcggtttaaacacaagagtattgcataaga-3^') and to the 3'-end of the U3-region

(primer RSVU3Pmel, 5'-gaggtttaaacgtgcctagctcgatacaa-3^'). The primers were designed to introduce a unique Pmel site. PCR products were run on a gel, extracted, digested with Pmel, precipitated and ligated overnight at 14 °C, creating plasmid pRCASBP(4070A)-U3.

To allow gag protein to be properly processed in mammalian cells, the amino terminus of the gag gene was mutated to create a myristilation signal in order that the gag protein is myristilated to allow targeting to the plasma membrane necessary for virus assembly. A long template PCR was performed using primers which bind just downstream of the first AUG of the gag gene (primer myrbsiwibwd, 5^'- gcagaacgtacgcaggccgaccaaagac-3') and just upstream of the gag gene in an untranslated region (primer myrbsiwifwd, 5^'- gtattacgtacgcggataagcatgggagccgtcatt-3'). The PCR product was phenol and chloroform/isopropanol purified, digested with the enzyme BsiWI, and ligated overnight at 14 °C. The resulting vector plasmid was named pRCASBP(4070A)myr-U3.

To allow adequate transport of full-length viral RNA from the nucleus into the cytoplasm, a mammalian CTE was cloned into a unique Spel restriction site created by long-template PCR deletion of the downstream direct repeat element using the primers which bound just upstream (primer ddrbwd, 5^'-cgctcggactagtgtcgactatcgatgccacagtggt-3^') and just downstream (primer ddrfwd, 5^'-gcgactgactagtgtcgactgcatagggagggggaaat-

3^') of this element. The PCR product was phenol and chloroform/isopropanol purified, digested with Spel and ligated overnight at 14 °C. The resulting vector plasmid was named pRCASBP(4070A)myr- ddrU3.

Three different constructs were made: in one construct the CTE from Mason-Pfizer-Monkey-Virus (MPMV) was used (NCBI ref. 001 550, base pairs 8006 to 8240), in a second construct the CTE from Simian Retrovirus (SRV) 2 was used (NCBI ref. 000 865, base pairs 7561 to 7734), and in a third construct the CTE-like Post Transcriptional Regulatory Element

(PTRE) from Woodchuck Hepatitis Virus (WHV) was used (NCBI ref. J02442, base pairs 959 to 1698) The resulting vector plasmids were called pRCASBP(4070A)myrMPMV-U3, pRCASBP(4070A)myrSRV-U3, and pRCASBP(4070A)myrWPRE-U3, respectively. To introduce heterologous promoters into the deleted 3^'-LTR U3 region, promoter fragments can be taken from existing plasmids, blunt ended and ligated into the unique Pmel site created during deletion of the U3 region. For example, the MMTV promoter was taken from plasmid pMMTV-BAG

(Sailer et al., J. Virol.72, 1699-1703) by digesting with enymes Sacll and Mlul, extracting the 1211 bp MMTV promoter fragment on a 1% agarose gel and blunt ending with T4 DNA polymerase (Life Technologies). This fragment was then ligated at 14 °C overnight with the plasmid pRCASBP(4070A)myrMPMV-U3 which had been digested with Pmel and dephosphorylated using CIAP (Life Technologies). The resulting vector plasmid was named pRCASMBP(4070A)myrMPMV.

To introduce a heterologous marker or therapeutic gene into the unique Clal site, the above mentioned vectors can be cut with Clal and blunt ended using T4 DNA polymerase. Any blunt ended fragment can then be easily ligated into this site.

For example, the marker gene eGFP was cut from plasmid pLXSNeGFP (Klein et al., Gene Therapy 4, 1256-1260) was digested with Agel and Notl and the 734 bp fragment was blunt ended using T4 DNA polymerase and ligated into the blunted Clal site in the plasmid pRCASMBP(4070A)myrMPMV. The resulting vector plasmid was named pRCASMBP(4070A)myrMPMVeGFP. Retroviral vectors can be obtained by transfecting the obtained vector plasmids in a suitable cell line such as DF- 1 (ATCC CRL-1708) according to methods known to the person skilled in the art. The retroviral vector resulting from the transfection of cells with plasmid pRCASMBP(4070A)myrMPMVeGFP is termed

RCASMBP(4070A)myrMPMVeGFP. Alternative cloning strategy:

To allow adequate transport of full-length viral RNA from the nucleus into the cytoplasm, a mammalian CTE was introduced into the RSV genome.

To facilitate easy cloning, an eGFP-CTE cassette was created as follows. The eGFP gene was cut out from plasmid pEGFP-1 (Clontech) using restriction enzyme Hpal and cloned into the unique EcoRV restriction site in pCDNA3 (Invitrogen), creating plasmid pCDNA3eGFP. Subsequently, a mammalian CTE was cloned into the unique BamHI site of plasmid pCDNA3eGFP, just downstream of the eGFP gene, creating plasmid pCDNA3eGFPCTE.

Subsequently, the eGFP-CTE cassette was cut out of plasmid pCDNA3eGFP using restriction enzymes Ecl136ll and BsrBI, and ligated into the unique Clal site of plasmid RCASBP-M2C(4070A), creating plasmid pRCASeGFPCTE+ddr.

Three different constructs were made: in one construct the CTE from Mason-Pfizer-Monkey-Virus (MPMV) was used (NCBI ref. 001 550, base pairs 8006 to 8240), in a second construct the CTE from Simian Retrovirus (SRV) 2 was used (NCBI ref. 000 865, base pairs 7561 to 7734), and in a third construct the CTE-like Post Transcriptional Regulatory Element (PTRE) from Woodchuck Hepatitis Virus (WHV) was used (NCBI ref. J02442, base pairs 959 to 1698) The resulting vectors were called pRCASeGFPMPMV+ddr, pRCASeGFPSRV+ddr and pRCASeGFPWPRE+ddr, respectively.

Northern-blot analysis of cytoplasmic RNA from 293 cells transfected with vector pRCASeGFPMPMV+ddr revealed that inclusion of a mammalian CTE in the vector causes downregulation of eGPF-spliced RNA with a concommitant upregulation of et -spliced and genomic length RNA in the cytoplasm of transfected mammalian cells (Fig.1 ).

To allow RSV gag protein to be properly processed in mammalian cells, the amino terminus of the gag gene was mutated to create a myristilation signal in order that the gag protein is myristilated to allow targeting to the plasma membrane necessary for virus assembly.

Overlap Extension PCR Mutagenesis was used to change a single base pair in the 5' terminal of the gag gene (the second base pair following the first ATG) from A to G in the reading frame. To allow good primer binding specificity, a fragment of the plasmid pRCASeGFPCTE+ddr containing the gag gene was cut out using restriction enzymes Sacl and Sacll and ligated into the Sacl/Sacll-backbone of plasmid pLXSNeGFP, creating plasmid plxgagpcr. Outside primers mutmyrδ' (5^'-cagctgttccgcaatgatag-3^') and mutmyr3' (5^'-agtcggatgcaactgca aga-3^'), and inside primers mutmyrA (5^'- taatgacggctcccatgcttgatcc gcaggc-3^') and mutmyrB (5^'- atcaagcatgggagccgtcattaaggtgatttcg-3^') were used on plasmid plxgagpcr to create the single base pair mutation in the gag gene, which creates a new NlalV restriction enzyme site. The resulting mutated gag gene fragment was then cut with BamHI and Apal and the resulting 260 bp fragment was ligated to the 3980 bp BamHI/Apal-fragment of plasmid plxgagpcr, resulting plasmid plxgmyr. The mutated gag gene fragment in plasmid plxgmyr was then cut out using Sacl and Sacll and ligated into the pRCASeGFPCTE+ddr, from which the original, non-mutated gag gene region had been cut out by a Sacl/Sacll-digest.

The 3' U3 of this plasmid was removed in a long template PCR process. Primers bound to the 5'-end of the 3' U3-region (primer RSVU3cPmel, 5^'- gcggtttaaacacaagagtattgcataaga-3^') and to the 3'-end of the 3' U3-region (primer RSVU3Pmel, 5^'-gaggtttaaacgtgcct agctcgatacaa-3^'). To facilitate primer binding specificity, the plasmid pRCASeGFPCTE+ddr was cut with the restriction enzyme Mlul, resulting in two fragments. The fragment containing the 3' U3 region and the ampicillin resistance backbone was then self-ligated to create plasmid p4.2(3'U3). Long template PCR using the above mentioned primers was carried out on this plasmid. The primers were designed to introduce a unique Pmel site in place of the 3' U3 region. PCR products were run on a gel, extracted, digested with Pmel, precipitated and ligated overnight at 14 °C, creating plasmid p4.2(-3'U3). This plasmid was then cut with restriction enzyme Mlul and the resulting

4062 bp fragment was ligated to the 8618 bp Mlul-fragment of plasmid pRCASeGFPCTE+ddr, resulting in the new plasmid pRCASeGFPCTE+ddr- U3.

To introduce heterologous promoters into the deleted 3^'-LTR U3 region, promoter fragments can be taken from existing plasmids, blunt ended and ligated into the unique Pmel site created during deletion of the U3 region. For example, the MMTV promoter was taken from plasmid pMMTV-BAG (Sailer et al., J. Virol.72, 1699-1703) by digesting with enymes Sacll and Mlul, extracting the 121 1 bp MMTV promoter fragment on a 1 % agarose gel and blunt ending with T4 DNA polymerase (Life Technologies). This fragment was then ligated at 14 °C overnight with the plasmid pRCASeGFPCTE+ddr-U3 which had been digested with Pmel and dephosphorylated using CIAP (Life Technologies). The resulting vector was named pRCASeGFPCTE+ddrMMTV.

To introduce a different heterologous marker or therapeutic gene into the vector pRCASeGFPCTE+ddrMM , the eGFP gene can be cut out with unique restriction enzymes Agel and Spel, and blunt ended using T4 DNA polymerase. Any blunt ended fragment can then be easily ligated into this site.

Testing of the described vectors in vitro was carried out in QT6 (ATCC CRL-

1708), DF-1 (ATCC CRL-12203), SL-29 (ATCC CRL-1590), HeLa (ATCC CCL-2), NIH/3T3(CRL-1658) 293 (ATCC CRL-1573) and COS-7 (ATCC CRL-1651) cells. After transfection of these cells (in particular DF-1 cells) with the above described plasmids the corresponding retroviral vectors are produced.

3cm dishes of 80 % confluent cells were transfected with 10 μg of plasmid using a calcium phosphate transfection kit (Amersham Pharmacia Biotech). After 48 hours to allow expression of virus, supernatant was collected and used to infect 80 % confluent target cells in the presence of 8 μg/ml Polybrene. Infected cells were subsquently passaged to allow complete spread of virus. Transfection and infection events were observed using fluorescence microscopy to observe EGFP expression. Efficiency and titre was calculated using FACS analysis.

In summary, the cloning steps resulted in the following achievements:

To allow the RSV gag protein to be properly processed in mammalian cells, the amino terminus of the gag gene was mutated to create a myristilation signal in order that the gag protein is myristilated to allow targeting to the plasma membrane necessary for virus assembly.

To allow adequate transport of full length viral RNA from the nucleus to the cytoplasm of mammalian cells, the downstream direct repeat of RSV was replaced by a mammalian CTE, or the mammalian CTE was added directly upstream of the downstream direct repeat.

To achieve tissue specificity of the vector, the patented ProCon system (PCT/EP95/03445) is used, whereby the U3 region of the wild-type 3^'-LTR is deleted and replaced by a unique restriction enzyme site, which can then be used to introduce a promoter sequence of choice. During infection and integration of the vector into a cell, promoter conversion takes place, which ensures that gene expression from the provirus is under exclusive control of the heterologous promoter.

Claims

C l a i m s

1. A retroviral vector, being replication competent in a mammalian target cell, said vector being derived from a non-mammalian retrovirus and comprising

- a transport element mediating nuclear export of RNA transcribed from the provirus;

- the retroviral genes required for replication of the retrovirus, wherein expression of said genes in the target cell is regulated by a heterologous regulatory sequence.

2. The retroviral vector according to claim 1 , wherein the vector is derived from an avian retrovirus.

3. The retroviral vector according to claim 2, wherein the vector is derived from Rous Sarcoma Virus (RSV).

4. The retroviral vector according to claims 1 to 3, wherein the regulatory sequence is target cell specific.

5. The retroviral vector according to anyone of the preceding claims, wherein the transport element is derived from a mammalian virus.

6. The retroviral vector according to claim 5, wherein the transport element is a Constitutive Transport Element (CTE).

7. The retroviral vector according to claim 6, wherein the CTE is selected from the group comprising a CTE of woodchuck hepatitis virus (WHV), simian retrovirus-2 (SRV-2) and/or Mason-Pfizer monkey virus (MFMV).

8. The retroviral vector according to claim 2 or 3, wherein one of the two avian CTEs is replaced by a CTE according to claim 6 or 7.

9. The retroviral vector according to anyone of the preceding claims, wherein the gag gene comprises a myristilation signal.

10. The retroviral vector according to claim 9, wherein the myristilation signal is located at the 5^'-end of the gag encoding sequence.

11. The retroviral vector according to claim 9 or 10, wherein the myristilation signal is obtained by mutation of the gag gene.

12. The retroviral vector according to anyone of the preceding claims, wherein the env encoding sequence is replaced by a heterologous env encoding sequence.

13. The retroviral vector according to claim 12, wherein the env encoding sequence is derived from a mammalian retrovirus.

14. The retroviral vector according to claims 12 or 13, wherein the env encoding sequence encodes an amphotropic env.

15. The retroviral vector according to claims 12 to 14, wherein the env encoding sequence is derived from MLV.

16. The retroviral vector according to anyone of the preceding claims, wherein the pol encoding sequence is replaced by a heterologous pol encoding sequence.

17. The retroviral vector according to claim 16, wherein the pol gene is derived from the Bryan High Titer strain of RSV.

18. The retroviral vector according to anyone of the preceding claims, wherein said retroviral vector is based on a promoter conversion vector.

19. The retroviral vector according to claim 18, wherein expression of the retroviral genes before promoter conversion is regulated by a heterologous regulatory sequence.

20. The retroviral vector according to claim 19, wherein said regulatory sequence is different from the regulatory sequence, which regulates the expression of the retroviral genes in the target cell.

21. The retroviral vector according to claim 20, wherein said regulatory sequence is constitutively and ubiquitously active.

22. The retroviral vector according to anyone of the preceding claims, comprising in addition a heterologous coding sequence.

23. The retroviral vector according to claim 22, wherein said heterologous coding sequence is a therapeutic gene, an anti-tumor gene and/or a marker gene.

24. The retroviral vector according to claim 23, wherein the antitumor gene is a gene encoding cytochrome P 450.

25. The retroviral vector according to claims 22 to 24, wherein expression of the coding sequence is regulated by the same heterologous regulatory sequence, which regulates the expression of the retroviral genes.

26. A retroviral particle comprising the vector according to anyone of the preceding claims.

27. The retoviral particle according to claim 26, obtainable by transfecting a producer cell with the retroviral vector according to claims 1 to 25.

28. A retroviral provirus obtainable by infecting a cell with the retroviral particle according to claim 26 or 27 or by transfecting the cell with the vector according to claims 1 to 25.

29. mRNA of the retroviral provirus according to claim 28.

30. RNA of the retroviral vector according to claims 1 to 25.

31. A host or producer cell transfected with a retroviral vector according to claims 1 to 25 and/or infected with a retroviral particle according to claim 26 or 27.

32. A pharmaceutical composition containing a therapeutically effective amount of a recombinant retroviral vector according to claims 1 to 25 and/or of a recombinant retroviral particle according to claim 26 or 27 and/or a cell according to claim 31.

33. A method for the analysis of the function and/or activity of a nucleic acid sequence within the retroviral vector according to claims 1 to 25, wherein a non-human animal is transfected with the retroviral vector according to claims 1 to 25 and/or infected with the retroviral particle according to claim 26 or 27, maintained under suitable conditions, and wherein subsequently retroviral particles produced by the cells of the non-human animal are detected.

34. The method according to claim 33, wherein the activity and/or specificity of the regulatory sequence is analyzed.

35. The method according to claim 33, wherein the specificity of env is analysed.

36. A method for introducing a nucleic acid sequence into a target cell comprising transfecting said target cell with the retroviral vector according to claims 1 to 25 and/or infecting the target cell with a retroviral particle according to claim 26 or 27.

37. The vector according to claims 1 to 25 and/or the retroviral particle according to claim 26 or 27 and/or the cell according to claim 31 for use as a medicament.

38. Use of the retroviral vector according to claims 1 to 25, the retroviral particle according to claims 26 or 27 and/or the cell according to claim 31 for producing a pharmaceutical composition for the treatment of any relevant disorder or disease.

39. The vector according to claims 1 to 25 and/or the retroviral particle according to claim 26 or 27 and/or the cell according to claim 31 for use in the treatment of cancer, preferably of cancer with distant metastases.

40. A method for the treatment of a genetic defect, cancer, viral disease or any other relevant disorder or disease comprising administration to a subject in need thereof a therapeutically effective amount of the retroviral vector according to claims 1 to 25 and/or a retroviral particle according to claim 26 or 27 and/or the cell according to claim 31.

41. The method according to claim 40 for the treatment of cancer with distant metastasis.