KR19990064068A - Multifunctional hematopoietic receptor agonist - Google Patents

Abstract

A novel multifunctional hematopoietic receptor agonist protein, DNA encoding a multifunctional hematopoietic receptor agonist protein, a method for producing a multifunctional hematopoietic receptor agonist protein, and a method for using a multifunctional hematopoietic receptor agonist protein are described.

Description

Multifunctional hematopoietic receptor agonist

Colony-forming stimulating factors (CSFs) that stimulate the differentiation and / or proliferation of bone marrow cells have generated a great deal of attention due to the therapeutic effect of restoring the weakened levels of blood stem cell-derived cells. In both humans and mice, CSFs have been identified and distinguished by their activity. For example, granulocyte-CSF (G-CSF) and macrophage-CSF (M-CSF) stimulate in vitro formation of neutrophil granulocyte and macrophage colony respectively and GM-CSF and interleukin- It has extensive activity and stimulates both the formation of two colonies of macrophages, neutrophils and acidophilic granulocytes. IL-3 also stimulates the formation of mast, megakaryocytes, and pure and mixed erythroid colonies.

U.S.A. 4,877,729 and U.S. Pat. 4,959,455 describes human IL-3 and gibbous IL-3 cDNAs and the protein sequences they encode. The described hIL-3 has serine instead of proline at position 8 of the protein sequence.

International Patent Application (PCT) WO 88/00598 describes gibbon- and human-like IL-3. hIL-3 is Ser ⁸ - include> Pro ⁸ replacement. It has been proposed to break the disulfide bond to replace Cys with Ser, and to replace one or more amino acids at the glycosylation site.

U.S.A. 4,810,643 describes DNA sequences encoding human G-CSF.

WO 91/02754 describes fusion proteins consisting of GM-CSF and IL-3 with increased biological activity relative to GM-CSF or IL-3 alone. Non-glycosylated IL-3 and GM-CSF analog proteins have also been described as components of multifunctional hematopoietic receptor agonists.

WO 92/04455 discloses a fusion protein consisting of IL-3 fused to lymphokine selected from the group consisting of IL-3, IL-6, IL-7, IL-9, IL-11, EPO and G- ≪ / RTI >

WO 95/21197 and WO 95/21254 describe fusion proteins capable of a wide variety of multifunctional hematopoietic properties.

GB 2,285,446 appears to affect the replication, differentiation and maturation of megakaryocytes and megakaryocyte precursors, and relates to c-mpl ligands (thrombopoietin) and various forms of thrombopoietin used in the treatment of thrombocytopenia.

EP 675,201 A1 relates to a c-mpl ligand attached to a water-soluble polymer such as c-mpl ligand megakaryocyte growth and development factor (MGDF), allelic variants of c-mpl ligand and polyethylene glycol.

WO 95/21920 provides murine and human c-mpl ligands and polypeptide fragments thereof. The protein is useful for in vivo and in vitro treatment to stimulate platelet production.

Rearrangement of protein sequences

In evolution, rearrangement of the DNA sequence provides an important role in generating the diversity of protein structure and function. Gene redundancy and exon blending provide an important mechanism for rapid development of diversity, thereby providing competitive advantages to organisms, particularly because the underlying mutation rates are low (Doolittle, Protein Science 1: 191-200, 1992).

The development of recombinant DNA methods enabled the study of sequence transposition effects on protein folding, structure and function. The method used for the production of the new sequence is in common with that of a naturally occurring pair of proteins, which is related by the linear reordering of the amino acid sequence (Cunningham, et al . , Proc. Natl. Acad. Sci. USA 76: 3218 . -3222, 1979; Teather & Erfle , J. Bacteriol 172: 3837-3841, 1990; Schimming etc., Eur J. Biochem 204: 13-19, 1992; Yamiuchi and Minamikawa, FEBS Lett 260:... 127-130 , 1991; MacGregor et al . , FEBS Lett. 378: 263-266). The first in vitro application of rearrangement of this type of protein has been described by Goldengerg and Creighton ( J. Mol. Biol. 165: 407-413, 1983). The new N-terminus is selected from the original internal sequence (breakpoint) of the original sequence, and the new sequence is deleted from the breakpoint until it reaches the amino acid at or near the original C- . At this point, the new sequence is linked to the amino acid at or near the original N-terminus, either directly or through the sequence of the additional portion (linker), and the new sequence is the N-terminus of the N- Terminus until it reaches a point at or near the amino acid that was the terminus, and this residue forms the new C-terminus of the chain.

This method has been applied to proteins ranging in size from 58 to 462 amino acids (Goldenberg & Creighton, J. Mol. Biol. 165: 407-413, 1983; Li & Coffino, Mol. Cell. Biol. 13: 2377-2383, 1993). The proteins tested were? -Helices (interleukin-4; Kreitman et al., Cytokine 7: 311-318, 1995),? -Sheets (interleukin-1; Horlick et al . , Protein Eng. 5: 427-431, 1992) (Yeast phosphoribosyl anthranilate isomerase; Luger et al., Science 243: 206-210, 1989). A broad category of protein function is shown in these sequence rearrangement studies:

enzyme

The results of these studies were very diverse. In many cases, substantially low activity, solubility or thermodynamic stability was observed (including E. coli dihydrofolate reductase, aspartate transcarbamoylase, phospholybosilanthranilate isomerase, glycine 3-phosphate dehydrogenase, ornithine dicarboxylase, omp A, yeast phosphoglycerate dehydrogenase). In other cases, the rearranged protein appeared to have many of the same properties as its natural counterparts (basic pancreatic trypsin inhibitor, T4 lysozyme, ribonuclease T1, bacillus beta -glucanase, interleukin- 1?,? -Spectrin SH3 domain, pepsinogen, interleukin-4). In exceptional cases, surprising improvements over several properties of the native sequence have been observed, including, for example, the solubility and refolding rate of the rearranged a-spectrin SH3 domain sequence, and the transfected interleukin- Receptor affinity and anticancer activity of Pseudomonas exotoxin fusant molecules (Kreitman et al . , Proc Natl Acad Sci USA 91: 6889-6893, 1994; Kreitman et al . , Cancer Res. 55: 3357-3363, 1995) .

The primary motivation for these studies was to study the role of a narrow range and wide range of interactions in protein folding and stability. This type of sequence rearrangement also converts a subset of interactions that are broad in the original sequence to narrow range interactions in the new sequence and vice versa. The fact that most of these sequence rearrangements are capable of obtaining at least some active structures is a convincing evidence that protein folding occurs with multiple folding pathways (Viguera, et al . , J. Mol. Biol. 247: 670-681, 1995). In the case of the SH3 domain of a-spectrin, choosing a new tail at the position corresponding to the? -headin turn could not be folded, although it resulted in a protein with slightly less stability.

The positions of the internal breakpoints used in the studies quoted here are observed only on the surface of the protein and are dispersed throughout the linear sequence without deviating only to the end or middle (relative to the original N-terminus to the breakpoint The variation in distance is about 10 to 80% of the entire sequence length). The linkers connecting the original N- and C-termini in these studies range from 0 to 9 residues. A portion of the sequence was deleted from the original C-terminal segment and the original N- (2'-C-terminal) was removed from the truncated C-terminus (Yang & Schachman, Proc. Natl. Acad. Sci. USA 90: 11980-11984, 1993) The connection to the end was made. Flexible hydrophilic moieties such as Gly and Ser are frequently used in linkers. Viguera, et al. ( J. Mol. Biol. 247: 670-681, 1995) compared the binding of the original N- and C-termini to 3- or 4-residue linkers, . Protasova et al. ( Protein Eng. 7: 1373-1377, 1994) used a 3- or 5-residue linker to link the original N-terminus of the E. coli dihydrofolate reductase, The protein was produced in good yield.

Summary of the Invention

The novel hematopoietic protein of the present invention is represented by the following formula:

R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁

Wherein R ₁ and R ₂ are independently selected from the group consisting of (I), (II), (III), (IV) or (V)

Wherein L ₁ is a linker that can be connected to R ₁ to R _2;

With the proviso that at least R ₁ or R ₂ is selected from the polypeptides of formula (I), (II), or (III); And

The hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ).

(I) a polypeptide comprising a modified human G-CSF amino acid sequence of the formula:

In the above sequence

Xaa in position 1 is Thr, Ser, Arg, Tyr or Gly;

Xaa of position 2 is Pro or Leu;

Xaa at position 3 is Leu, Arg, Tyr or Ser;

Xaa at position 13 is Phe, Ser, His, Thr or Pro;

Xaa at position 16 is Lys, Pro, Ser, Thr or His;

Xaa at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr or Arg;

Xaa at position 18 is Leu, Thr, Pro, His, He or Cys;

Xaa at position 22 is Arg, Tyr, Ser, Thr or Ala;

Xaa at position 24 is Ile, Pro, Tyr or Leu;

Xaa at position 27 is Asp or Gly;

Xaa at position 30 is Ala, Ile, Leu or Gly;

Xaa at position 34 is Lys or Ser;

Xaa at position 36 is Cys or Ser;

Xaa at position 42 is Cys or Ser;

Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu;

Xaa at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr;

Xaa at position 46 is Glu, Arg, Phe, Arg, Ile or Ala;

Xaa of position 47 is Leu or Thr;

Xaa at position 49 is Leu, Phe, Arg or Ser;

Xaa at position 50 is Leu, Ile, His, Pro or Tyr;

Xaa at position 54 is Leu or His;

Xaa at position 64 is Cys or Ser;

Xaa at position 67 is Gln, Lys, Leu or Cys;

Xaa at position 70 is Gln, Pro, Leu, Arg or Ser;

Xaa at position 74 is Cys or Ser;

Xaa at position 104 is Asp, Gly or Val;

Xaa at position 108 is Leu, Ala, Val, Arg, Trp, Gln or Gly;

Xaa at position 115 is Thr, His, Leu or Ala;

Xaa at position 120 is Gln, Gly, Arg, Lys or His;

Xaa at position 123 is Glu, Arg, Phe or Thr;

Xaa at position 144 is Phe, His, Arg, Pro, Leu, Gln or GIu;

Xaa at position 146 is Arg or Gln;

Xaa at position 147 is Arg or Gln;

Xaa at position 156 is His, GIy or Ser;

Xaa at position 159 is Ser, Arg, Thr, Tyr, Val or Gly;

Xaa at position 162 is Glu, Leu, Gly or Trp;

Xaa at position 163 is Val, Gly, Arg or Ala;

Xaa at position 169 is Arg, Ser, Leu, Arg or Cys;

Xaa at position 170 is His, Arg or Ser;

Wherein optionally 1-11 amino acids from the N-terminus and 1-5 amino acids from the C-terminus may be deleted;

Wherein the N-terminus can be linked directly to the C-terminus, or the N-terminus can be linked to the C-terminus and through the linker which may have new C- and N-termini in the following amino acids.

(II) a polypeptide comprising a modified hIL-3 amino acid sequence of the following;

Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg;

Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln;

Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys;

Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala;

Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;

Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;

Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg;

Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu;

Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala;

Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp;

Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala;

Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;

Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val;

Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys;

Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln;

Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu;

Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu;

Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;

Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val;

Xaa at position 36 is Asp, Leu or Val;

Xaa at position 37 is Phe, Ser, Pro, Trp or Ile;

Xaa of position 38 is Asn or Ala;

Xaa at position 40 is Leu, Trp or Arg;

Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro;

Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;

Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;

Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;

Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;

Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;

Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His;

Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;

Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp;

Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;

Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His;

Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr;

Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met;

Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;

Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly;

Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;

Xaa at position 57 is Asn or Gly;

Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys;

Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg;

Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr;

Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser;

Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile;

Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val;

Xaa at position 64 is Ala, Asn, Pro, Ser or Lys;

Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser;

Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser;

Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His;

Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His;

Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu;

Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala;

Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn;

Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp;

Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg;

Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;

Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu;

Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp;

Xaa at position 77 is Ile, Ser, Arg, Thr or Leu;

Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg;

Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp;

Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg;

Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys;

Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;

Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met;

Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val;

Xaa at position 85 is Leu, Asn, Val or Gln;

Xaa at position 86 is Pro, Cys, Arg, Ala or Lys;

Xaa at position 87 is Leu, Ser, Trp or Gly;

Xaa at position 88 is Ala, Lys, Arg, Val or Trp;

Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser;

Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met;

Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His;

Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;

Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg;

Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;

Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;

Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr;

Xaa at position 97 is Ile, Val, Lys, Ala or Asn;

Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;

Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His;

Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro;

Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln;

Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr or Pro;

Xaa at position 103 is Asp or Ser;

Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly;

Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His;

Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro;

Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;

Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly;

Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp;

Xaa at position 111 is Leu, Ile, Arg, Asp or Met;

Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe;

Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asp;

Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu;

Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met;

Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile;

Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro;

Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr;

Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg;

Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln;

Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;

Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys;

Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu;

Wherein 1 to 14 amino acids may optionally be deleted from the N-terminus and / or 1 to 15 amino acids may be deleted from the C-terminus; 0 to 44 of the amino acid represented by Xaa is different from the corresponding amino acid of natural (1 - 133) human interleukin-3;

Wherein the N-terminus is linked directly to the C-terminus or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have a new C-terminus and an N-terminus in the following amino acids;

A polypeptide comprising a modified human c-mpl ligand amino acid sequence of (III) below;

In the above sequence

Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met;

Xaa at position 113 is deleted or Pho, Phe, Ala, Val, Leu, Ile, Trp or Met;

Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met;

Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn;

Wherein the N-terminus can be linked directly to the C-terminus, or the N-terminus can be linked to the C-terminus and through the linker (L ₂ ) which may have new C- and N-terminus in the following amino acids;

A polypeptide comprising a modified hIL-3 amino acid sequence of (IV)

(SEQ ID NO: 2)

Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg;

Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln;

Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys;

Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala;

Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;

Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly;

Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg;

Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu;

Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala;

Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp;

Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala;

Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;

Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val;

Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys;

Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln;

Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu;

Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu;

Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met;

Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val;

Xaa at position 36 is Asp, Leu or Val;

Xaa at position 37 is Phe, Ser, Pro, Trp or Ile;

Xaa of position 38 is Asn or Ala;

Xaa at position 40 is Leu, Trp or Arg;

Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro;

Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;

Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;

Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro;

Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His;

Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;

Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His;

Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn;

Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp;

Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lsy, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln;

Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His;

Xaa at position 52 is Asn, His, Arg, Leu, GLy, Ser or Thr;

Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met;

Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;

Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly;

Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys;

Xaa at position 57 is Asn or Gly;

Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys;

Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg;

Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr;

Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser;

Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile;

Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val;

Xaa at position 64 is Ala, Asn, Pro, Ser or Lys;

Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser;

Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser;

Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His;

Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His;

Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu;

Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala;

Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn;

Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp;

Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg;

Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;

Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu;

Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp;

Xaa at position 77 is Ile, Ser, Arg, Thr or Leu;

Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg;

Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp;

Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg;

Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys;

Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val;

Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met;

Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val;

Xaa at position 85 is Leu, Asn, Val or Gln;

Xaa at position 86 is Pro, Cys, Arg, Ala or Lys;

Xaa at position 87 is Leu, Ser, Trp or Gly;

Xaa at position 88 is Ala, Lys, Arg, Val or Trp;

Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser;

Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met;

Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His;

Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;

Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg;

Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;

Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;

Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr;

Xaa at position 97 is Ile, Val, Lys, Ala or Asn;

Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro;

Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His;

Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro;

Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln;

Xaa at position 102 is Gly, Leu, Glu, Lys, Set, Tyr or Pro;

Xaa at position 103 is Asp or Ser;

Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly;

Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His;

Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro;

Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;

Xaa at position 109 is Arg, Thr, Por, Glu, Tyr, Leu, Ser or Gly;

Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp;

Xaa at position 111 is Leu, Ile, Arg, Asp or Met;

Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe;

Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asn;

Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu;

Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met;

Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile;

Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro;

Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr;

Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg;

Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln;

Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly;

Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys;

Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu;

Wherein 1 to 14 amino acids may optionally be deleted from the N-terminus and / or 1 to 15 amino acids may be deleted from the C-terminus; 0 to 44 of the amino acid represented by Xaa is different from the corresponding amino acid of natural (1 - 133) human interleukin-3;

(V) Colony-forming stimulating factor.

A more preferred break point in said polypeptide (I), wherein a new C-terminus and an N-terminus can be made; 38-39, 39-40, 40-41, 41-42, 48-49, 53-54, 54-55, 55-56, 56-57, 57-58, 58-59, 59-60, 60- 61, 61-62, 62-63, 64-65, 65-66, 66-67, 67-68, 68-69, 69-70, 96-97, 125-126, 126-127, 127-128, 128-129, 129-130, 130-131, 131-132, 132-133, 133-134, 134-135, 135-136, 136-137, 137-138, 138-139, 139-140, 140- 141 and 141-142.

The most preferred breakpoint in the above polypeptide (I) in which new C-terminus and N-terminus can be made is; 38-39, 48-49, 96-97, 125-126, 132-133 and 141-142.

A more preferred break point in the polypeptide (II), at which new C-terminus and N-terminus can be made, is; 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-39, 39-40, 66- 67, 67-68, 68-69, 69-70, 70-71, 84-85, 85-86, 86-87, 87-88, 88-89, 89-90, 90-91, 98-99, 99-100, 100-101, and 101-102.

The most preferred break point in the polypeptide (II), at which new C-terminus and N-terminus can be made; 34-35, 69-70 and 90-91.

A more preferred break point in the amino acid sequence of the polypeptide (III) or SEQ ID NO: 256, at which new C-terminus and N-terminus can be made; 80-81, 81-82, 82-83, 83-84, 84-85, 85-86, 86-87, 108-109, 109-110, 110-111, 111-112, 112-113, 114, 114-115, 115-116, 116-117, 117-118, 118-119, 119-120, 120-121, 121-122, 122-123, 123-124, 124-125, 125-126, 126-127.

The most preferred break point in the amino acid sequence of polypeptide (III) or SEQ ID NO: 256, at which new C-terminus and N-terminus can be made; 81-82, 108-109, 115-116, 119-120, 122-123, and 125-126.

The multifunctional receptor agonist of the present invention may also be represented by the following formula.

(T ¹ ) _a - (L ¹ ) _b -X ¹ - (L) _c -X ² - (L ² ) _d - (T ² ) _e

X ¹ - (L) _c -X ² - (L) -Y ¹ - (L) _c -Y ²

Wherein:

X ¹ is a peptide comprising an amino acid corresponding to the sequence n + 1 to J of the original protein having a consecutive number of amino acid residues from 1 to J having an amino terminus at residue 1;

L is any linker;

X ² is a peptide comprising the amino acid sequence from residue 1 to n of the original protein;

Y ¹ is a peptide comprising an amino acid corresponding to a residue n = 1 to K of the original protein having a consecutive number of amino acid residues from 1 to K having an amino terminus at residue 1;

Y ² is a peptide comprising the amino acid sequence from residue 1 to n of the original protein;

L ¹ and L ² are arbitrary peptide spacers;

n is an integer ranging from 1 to J-1;

b, c and d are each independently 0 or 1;

a and e are 0 or 1, provided that neither a nor e can be both 0; And

T ¹ and T ² are proteins.

In addition, the present invention relates to a recombinant expression vector comprising a nucleotide sequence encoding a multifunctional hematopoietic receptor agonist, an associated microbial expression system, and a method for producing a multifunctional hematopoietic receptor agonist. The invention also relates to pharmaceutical compositions containing multifunctional hematopoietic receptor agonists and methods of using the multifunctional hematopoietic receptor agonists.

In addition to the in vivo use of the multifunctional hematopoietic receptor agonists of the invention, in vitro use is expected to include the ability to stimulate the activation and growth of bone marrow cells and blood cells prior to injection into the patient.

The present invention relates to a multifunctional hematopoietic receptor agonist.

Figure 1 schematically illustrates sequence rearrangement of proteins. The N-terminal (N) and the C-terminal (C) of the native protein are linked or directly linked through a linker. The protein opens at a breakpoint producing a new N-terminus (new N) and a new C-terminus (new C) resulting in a protein with a new linear amino acid sequence. The rearranged molecule is newly synthesized as a linear molecule and does not proceed to the step of connecting the original N-terminus to the C-terminus and to the step of opening the protein at the break point.

Figure 2 shows a schematic diagram of a new protein production method I in which the original N-terminus and C-terminus of the native protein are linked by a linker and other N-terminus and C-terminus of the protein are produced. In the example shown, the sequence rearrangement comprises a new N-terminus produced in amino acid 97 of the original protein, the original C-terminus linked to amino acid 11 (aa 1-10 being deleted) through the linker moiety, and the amino acid of the original sequence Lt; RTI ID = 0.0 > C-terminal < / RTI >

Figure 3 shows a schematic diagram of a new protein production method II in which the original N-terminus and C-terminus of the native protein are linked without a linker and the other N-terminus and C-terminus of the protein are produced. In the example shown, the sequence rearrangement is a new N-terminal produced in the amino acid 97 of the original protein, the original C-terminal (aa 174) linked to the original N-terminus, and a new Brings a new gene encoding the protein with the C-terminus.

Figure 4 shows a schematic diagram of a new protein production method III in which the original N-terminus and C-terminus of the native protein are linked by a linker and the other N-terminus and C-terminus of the protein are produced. In the example shown, the sequence rearrangement comprises a new N-terminal produced in the amino acid 97 of the original protein, the original C-terminal (aa 174) linked to amino acid 1 through the linker moiety, and the amino acid 96 of the original sequence Brings a new gene encoding a protein with a new C-terminus.

The present invention includes a multifunctional hematopoietic receptor agonist formed of covalently coupled polypeptides, wherein each of the polypeptides acts through different and specific cell receptors to initiate complementary biological activity. Hematopoiesis requires a complex series of cellular events, in which the hepatocytes continuously produce large populations of cells that mature into all major lineages. They are generally at least 20 known regulators with hematopoietic activity. Most of these proliferative regulators are only able to stimulate one or another form of colony formation in vitro, and the exact pattern of colony formation stimulated by each regulator is very unique. The two regulators do not stimulate exactly the same colony formation pattern, as assessed by the number of colonies or, more importantly, by the lineage and maturation pattern of the cells that make up the resulting colonies. Proliferative responses can be most easily analyzed with a simplified in vitro culture system. Three very different parameters can be distinguished: colony size change, colony number change and cell lineage. Two or more factors act on the precursor cells to induce the formation of large numbers of offspring, thereby increasing colony size. Since there is a distinct subset of precursor cells that exclusively respond to one factor or some precursor requires stimulation by two or more factors before they can respond, Allowing the number of progenitor cells to proliferate. Activation of additional receptors on cells by the use of two or more factors appears to enhance the mitotic signal, since it initially incorporates other signal pathways into a common final pathway to the nucleus (Metcalf, Nature 339: 27, 1989). Other mechanisms may explain synergism. For example, if one signaling path is limited by the intermediate action of the additional signaling pathway by the second factor, this leads to an additive response. In some cases, activation of one receptor form can lead to enhanced expression of other receptors (Metcalf, Blood 82: 3515-3523, 1993). More than one factor results in a cell line that differs from that of a single factor. The use of multifunctional hematopoietic receptor agonists has potential clinical advantages resulting from proliferative responses that are not possible by any single factor. The receptors for hematopoietic and other growth factors include two distinct types of related proteins: (1) epidermal growth factor, M-CSF (Sherr, Blood 75: 1, 1990) and SCF (Yarden et al., EMBO J. 6: 3341, 1987 ); And (2) hematopoietic receptors that do not contain the tyrosine kinase domain and exhibit distinct homology within their extracellular domain (Bazan, PNAS USA 87: 6934-6938, 1990) have. (Kitamura et al., Cell 66: 1165, 1991), GM-CSF (Gearing et al., EMBO J. 8: 3667, 1989), erythropoietin (EPO) (D'Andrea et al., Cell 57: G-CSF (Fukunaga, etc., J. Bio Chem 265:.. 14008-15, 1990), IL-4 (Harada , etc., PNAS USA 87: 857, 1990 ), IL-5 (Takaki , etc., EMBO J. 9: IL-7 (Goodwin et al., Cell 60: 941-51, 1990), LIF (Gearing et al., EMBO J. 10: 2839, 1991), IL-6 (Yamasaki et al., Science 241: ) And IL-2 (Cosman et al., Mol . Immunol. 23: 935-94, 1986) are included in the latter group. Most of the latter groups of receptors are present as heterodimers in the form of high affinity. After ligand binding, certain [alpha] -chains are bound to at least one other receptor chain ([beta] -chain, [gamma] -chain). Most of these factors share common receptor subunits. The α-chain for GM-CSF, IL-3 and IL-5 shares the same β-chain (Kitamura et al., Cell 66: 1165, 1991) (Takaki et al., EMBO J. 10: 2833-8, , Receptor complexes for IL-6, LIF and IL-11 share the common? -Chain (gp130) (Taga et al., Cell 58: 573-81, 1989; Gearing et al., Science 255: 1434-7, 1992) . Receptor complexes of IL-2, IL-4, IL-7, IL-9 and IL-15 have been shown to be more potent than the general? -Chain (Kondo et al., Science 262: 1874, 1993; Russell et al., Science 266: 1042-1045, 1993; Noguchi et al., Science 262: 1877, 1993; Giri et al., EMBO J. 13: 2822-2830, 1994).

The use of complexly acting hematopoietic factors also has the potential benefit of reducing the requirement for factor producing cells and their induction systems. If there is a limit to the ability of a cell to produce an agent, it is useful to reduce the requirement for an agent-producing cell by lowering the required concentration of each agent and using them in combination. The use of complexly functioning hematopoietic agents lowers the need for the agent and possibly reduces the likelihood of adverse side effects.

The novel compounds of the present invention are represented by the formula selected from the group consisting of

R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , and R ₂ -R ₁

Wherein R ₁ and R ₂ are as defined above.

Preferably, R < ₂ > is a colony-forming stimulating factor that is different from R < ₁ > but has complementary activity. Complementary activity refers to an activity that enhances or alters the response to another cell modulator. The R ₁ polypeptide is linked to the R ₂ polypeptide either directly or through a linker segment. The term " direct " means that in a multifunctional hematopoietic receptor agonist a polypeptide is linked without a peptide linker. Thus, L ₁ means a chemical bond or a polypeptide segment to which both R ₁ and R ₂ are connected in a frame, most commonly L ₁ is a linear peptide and the carboxy terminus of R ₁ is linked to the amino terminus of L ₁ connection and is connected by an amide bond to the carboxy terminus of L ₁ to the amino terminus of the R _2, R ₁ and R ₂ is attached to the linear peptide. &Quot; Linked within a frame " means that there is no translation termination or interruption between the reading frames of the DNA encoding R ₁ and R ₂ .

Non-limiting list of other growth factors, i.e., colony forming stimulating factors (CSFs), are cytokines, lymphokines, interleukins, hematopoietic growth factors and they can be linked to (I), (II) , G-CSF, c-mpl ligand (also known as TPO or MGDF), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL-2, IL- , IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, LIF, flt3 / flk2 ligand, human growth hormone, B-cell differentiation factor, eosinophil factor and hepatocyte factor (SCF) (also known as steel factor or c-kit ligand). In addition, the invention includes the use of modified R ₁ or R ₂ molecules or the use of mutated or modified DNA sequences encoding these R ₁ or R ₂ molecules. The present invention also includes a multifunctional hematopoietic receptor agonist wherein R ₁ or R ₂ is a hIL-3 mutant, a c-mpl ligand mutant, or a G-CSF mutant. " hIL-3 variants " are intended to encompass hIL-3 variants having a portion of hIL-3 substituted and / or deleted as described in WO 94/12638, WO 94/12639 and WO 95/00646, 3 molecule. " c-mpl ligand variant " is defined as a c-mpl ligand molecule having a portion of an amino acid substituted and / or deleted c-mpl ligand as described in U.S. Serial No. 08 / 383,035, as well as other variants known in the art . A "G-CSF variant" is defined as a G-CSF molecule having a portion of G-CSF amino acid substituted and / or deleted as described herein, as well as other variants of the present technology.

Linker (L1) is generally a polypeptide of 1 to 500 amino acids in length. The linker linking the two molecules preferably does not (1) tend to fold the two molecules and act independently of each other, (2) develop an ordered secondary structure that can collide with the functional domains of the two proteins , (3) a functional protein having at least the hydrophobic nature of which can function domain and cross, and (4) R ₁ and R ₂ has three dimensions of R ₁ and R ₂ to act at the same time mutually for their corresponding receptor and single cells Separation. Surface amino acids in the flexible protein moiety typically include Gly, Asn, and Ser. In fact, any exchange of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above standard for linker sequences. Other neutral amino acids such as Thr and Ala are also used as linker sequences. Additional amino acids may be included in the linker by the addition of unique restriction sites within the linker sequence to facilitate the construction of the multifunctional hematopoietic receptor agonist.

Preferred L < _{1 >} linkers of the present invention comprise a sequence selected from the group of the following formulas:

(Gly ³ Ser) ⁿ

(Gly ⁴ Ser) ⁿ

(Gly ⁵ Ser) ⁿ

(Gly ⁿ Ser) ⁿ

or

(AlaGlySer) ⁿ

One example of a highly flexible linker is the glycine and serine-rich spacer portion present in the pIII protein of fibroblast bacteriophage, such as bacteriophage M13 or fd (Schaller et al., PNAS USA 72: 737-741, 1975). These moieties provide a long, flexible spacer moiety between the two domains of the pIII surface protein. The spacer portion consists of the following amino acid sequence:

The present invention also encompasses linkers containing endopeptidase recognition sequences. Such cleavage sites are useful for isolating the individual components of the multifunctional hematopoietic receptor agonist and determining whether they are properly folded and in vitro. Examples of various endopeptidases include, but are not limited to, plasmin, enterokinase, calicaine, urokinase, tissue plasminogen activator, clostrifine, chymosin, collagenase, Russell's serotonergic protease, post-proline cleavage enzyme, V8 protease, Thrombin, and factor Xa.

The peptide linker segment from the hinge portion of the heavy chain immunoglobulin IgG, IgA, IgM, IgD or IgE provides an angled relationship between the attached polypeptides. These hinge portions replaced by cysteine serine are particularly useful. A preferred linker of the present invention comprises a sequence derived from a mouse IgG gamma 2b hinge portion which has been changed to cysteine serine. These linkers also include endopeptidase cleavage sites. Examples of such linkers include the following sequences:

And

However, the present invention is not limited to the type, size or number of linker sequences used, and the requirement of the linker merely does not functionally conflict with the folding and function of the individual molecules of the multifunctional hematopoietic receptor agonist.

Linker L ₂ Determination of

R ₁ and / or the length of the amino acid sequence of the linker L ₂ to be used in the R ₂ may be by the guide from the configuration information or empirically, or using a combination of the two methods is selected.

When the structural information is not available, the design is diversified so that its length ranges from 0 to 50 Å, and the sequence is selected to match the surface exposures (hydrophilicity, Hopp & Woods, Mol. Immunol. 20: 483-489, 1983, .. Kyte & Doolittle, J. Mol Biol 157: 105-132; the surface area exposed to the solvent, Lee & Richards, J. Mol Biol 55:.. 379-400, 1971) and R ₁ or disrupt the structure of R ₂ A small series of linkers can be fabricated for testing using the ability to adopt the required structure without the use of the required structure (structurally flexible; Karplus & Schulz, Naturwissenschaften 72: 212-213, 1985). Assuming that the average of translation is 2.0 to 3.8 A per residue, this would mean that the length to be tested is 0 to 30 residues, preferably 0 to 15 residues. An example of such an empirical series may be repeated n times

Gly-Gly-Gly-Ser

(Where n is 1, 2, 3 or 4) to construct a linker. Those of ordinary skill in the art will recognize that there are many such sequences of varying lengths or compositions that can be provided as linkers with primary requirements that are not excessively long or short (compare Sandhu, Critical Rev. Biotech. 12: 437-462, 1992); If they are too long, the entropy effect will make the 3D folding unstable, and also make the folds dynamically inoperable, and if they are too short, they will probably be unstable due to twist or steric distortion .

One skilled in the art of analyzing protein structure information will be used to define the length of the sequence to be used, defined as the distance between chain ends, defined as the distance between c-alpha carbons, or at least to limit the number of possibilities that should be tested in the empirical selection of the linker As will be appreciated by those skilled in the art. They also often find that the position of the end of the polypeptide chain is misidentified in a structural model derived from x-ray diffraction or nuclear magnetic resonance spectroscopy data, and when this is true, Will need to be considered in order to estimate. Two residues near the end of the chain are selected from these well-defined residues and the distance between their c-alpha carbons is used to calculate the approximate length for the linker between them. Using the calculated length as a guide, a linker (calculated using 2 to 3.8 A per residue) with a range of residue numbers is selected. These linkers are original sequence, short or long as necessary, and the additional residues when extended are selected to be flexible and hydrophilic as described above; Optionally, the original sequence is replaced by a series of linkers for use (such as the Gly-Gly-Gly-Ser (SEQ ID NO: 12) cassette method described above); Or, optionally, a combination of the original sequence and a new sequence having an appropriate total length.

R _One And R ₂ Of amino and carboxyl ends

The sequences of R ₁ and R ₂ , which can be folded into a biologically active state, can be obtained by selecting the starting (amino terminal) and terminal (carboxyl terminal) positions from the original polypeptide chain using the linker sequence L ₂ as described above Can be manufactured. The amino and carboxyl ends are selected from among the common stretches of the sequence referred to as breakpoint portions, using the following guides. Thus, novel amino acid sequences are produced by selecting amino and carboxyl ends in the same breakpoint moiety. In many cases, a new terminus is chosen such that the original position of the carboxyl terminus comes immediately prior to that of the amino terminus. However, those skilled in the art will recognize that the selection of the term will function anywhere in the sequence and will effectively lead to deletion, deletion, or addition to the amino or carboxyl portion of the new sequence.

The central idea of molecular biology is that the primary amino acid sequence of a protein directs it to fold into a three-dimensional structure necessary for the expression of its biological function. Methods for obtaining and interpreting three-dimensional structural information using x-ray diffraction of single protein crystals or nuclear magnetic resonance spectroscopy of protein solutions are known to those skilled in the art. Examples of structural information related to the identification of the breakpoint portion include position and shape of the protein secondary structure (alpha and 3-10 helix, parallel and antiparallel beta sheets, chain inversion and rotation, and loop; Kabsch & Sander, Biopolymers 22: (Chothia, Ann. Rev. Biochem. 53: 537-572, 1984), and the structure along the polypeptide chain, in terms of the degree of solvent exposure of the amino acid residues, Distribution (Alber & Mathews, Methods Enzymol. 154: 511-533, 1987). In some cases, additional information is known about solvent exposure of residues, such as the site of post-translational attachment of carbohydrates on the surface of the protein. It is also useful to analyze primary amino acid sequences to predict protein tertiary and secondary structure, solvent contact, and the occurrence of rotations and loops when experimental structural information is unavailable or unavailable. Biochemical methods can often be applied to empirically measure surface exposures when direct structural methods are impractical; (Gentile & Salvatore, Eur. J. Biochem. 218: 603-621, 1993) to infer surface exposures following, for example, identification of chain cleavage sites. Therefore, the amino acid sequence of the amino acid sequence was examined using an experimentally derived structural information or prediction method (for example, Srinivisan & Rose Proteins: Struct., Funct. & Genetics, 22: 81-99, The parts were distinguished according to whether it is necessary or not to maintain the tertiary structure. The presence of a sequence within a region known to be contained in a cyclic secondary structure (alpha and 3-10 helix, parallel and antiparallel beta sheets) is the portion to be avoided. Similarly, the amino acid sequence portion that is observed or predicted to have a low degree of solvent exposure is more likely to be part of the hydrophobic core of the so-called protein, and should also be avoided for the choice of amino and carboxyl end. Conversely, moieties that are known or predicted to be within the surface rotation or loop, and particularly those that are known not to be required for biological activity, are preferred sites at the terminal end of the polypeptide chain. Continuous stretches of the preferred amino acid sequence based on the above criteria are referred to as breakpoint portions.

Non-covalent multifunctional hematopoietic growth factor

An alternative method for linking two hematopoietic growth factors is by non-covalent interactions. Such a complex protein can be described by one of the following formulas:

R ₁ -C ₁ + R ₂ -C ₂ ; Or C ₁ -R ₁ + C ₂ -R ₂ ; C ₁ -R ₁ + R ₂ -C ₂ ; Or C ₁ -R ₁ + R ₂ -C ₂ .

R ₁ and R ₂ are as described above. The domains C ₁ and C ₂ are typically proteinaceous, identical or not identical chemical structures capable of forming non-covalent, specific bonds. The complex between C ₁ and C ₂ results in a one-to-one stoichiometric relationship between R ₁ and R ₂ for each complex. Examples of related domains are the " leucine zipper " domain of transcription factors, the dimerization domain of the bacterial transcriptional repressor and the immunoglobulin constant domain. Covalent bonds link R ₁ and C ₁ , and R ₂ and C ₂ , respectively. As indicated in the formula, domains C ₁ and C ₂ may be present at the N-terminus or at the C-terminus of the corresponding hematopoietic growth factor (R). These multimerization domains (C ₁ and C ₂ ) are derived from the bZIP family of proteins (Abel et al ., Nature 341: 24-25, 1989; Landshulz et al., Science 240: 1759-1764, 1988; Pu et al. , Nuc. . Acid Res 21: 4348-4355, 1993 ; Kozarides etc., Nature 336: 646-651, 1988), as well as of the protein helix-helix domain of the multi meohwa group (such as Abel, Nature 341-loop: 24-25, 1989 ; Murre et al., Cell 56: 777-783, 1989; Tapscott et al., Science 242: 405-411, 1988; Fisher et al., Genes & Dev. 5: 2342-2352, 1991). A preferred multifunctional hematopoietic receptor agonist of the present invention comprises a colony forming stimulating factor dimerized by a combination thereof as a translation multifunctional hematopoietic receptor agonist with the leucine zipper dimerization domain of the bZIP family proteins Fos and Jun. Jun's RyuSin zipper domain can interact with the same domain. Also, the Fos' leucine zipper domain interacts with the Jun Ryu zipper domain, but does not interact with other Fos leech zipper domains. The Fos and Jun mixtures predominantly form Fos-Jun heterodimers. Consequently, when bound to a colony-forming stimulating factor, the Jun domain can be used to drive the formation of homo- or heterodimers. If one of the colony forming stimulus factor partners is treated to have a Jun leucine zipper domain and the other is treated to have a Fos zipper, preferential formation of a heterodimer can be achieved.

Additional peptide sequences may be added to facilitate purification or identification of a multifunctional hematopoietic receptor agonist protein (e. G. Poly-His). Highly antigenic peptides may be added to enable rapid analysis and easy purification of multifunctional hematopoietic receptor agonist proteins by specific monoclonal antibodies.

A "mutant amino acid sequence", "mutant protein", "mutant protein", "mutein" or "mutant polypeptide" refers to an amino acid sequence that differs from a natural sequence by amino acid deletion, substitution, Refers to a polypeptide having an amino acid sequence that is encoded by a nucleotide sequence of a variant that has been designed. &Quot; Natural sequence " refers to the same amino acid or nucleic acid sequence as a wild-type or natural form of a gene or protein.

Hematopoietic growth factors can be characterized by their ability to stimulate colony formation by human hematopoietic precursor cells. Colonies formed include erythroide, granulocyte, megakaryocyte, granulocyte macrophage and mixtures thereof. In studies initially conducted in primates, and later in humans, most of the hematopoietic growth factors showed the ability to restore bone marrow function and peripheral blood cell populations to therapeutically beneficial levels. Most or all of these biological activities of hematopoietic growth factors include signal transduction and high affinity receptor binding. The multifunctional hematopoietic receptor agonists of the present invention exhibit useful properties or a combination of these properties, such as having the same or greater biological activity compared to a single factor, or having an improved half-life or reduced adverse side effects.

A multifunctional hematopoietic receptor agonist with little or no agonist activity is an antagonist and can be used as an antigen for the production of antibodies for use in immunology or immunotherapy, as a gene probe, or to construct other useful hIL-3 muteins ≪ / RTI >

The biological activity of the multifunctional hematopoietic receptor agonist protein of the present invention can be measured by DNA synthesis in factor dependent cell lines or by counting colony forming units in in vitro bone marrow analysis.

The multifunctional hematopoietic receptor agonists of the present invention have an improved therapeutic profile as compared to single acting hematopoietic agonists. For example, some multifunctional hematopoietic receptor agonists of the present invention have the same or greater growth factor activity than other hematopoietic agonists without a similar or corresponding increase in side effects.

The present invention also relates to a DNA sequence encoding a multifunctional hematopoietic receptor agonist protein, a DNA sequence that substantially performs similar and substantially identical functions, a DNA sequence encoding a multifunctional hematopoietic receptor agonist of the present invention, It contains different DNA sequences due to degeneracy. The invention also encompasses oligonucleotide intermediates used for assembling mutant DNA and polypeptides encoded by these oligonucleotides.

Genetic engineering techniques currently established in the art (US Patent 4,935,233 and Sambrook et al., &Quot; Molecular Cloning A Laboratory Manual & quot ;, Cold Spring Harbor Laboratory, 1989) are used to assemble the DNA sequences of the present invention. One such method is cassette mutagenesis (Wells et al., Gene 34: 315-323, 1985) in which a portion of the coding sequence in the plasmid is replaced with a synthetic oligonucleotide encoding the desired amino acid substituent in the portion of the gene between the two restriction sites do.

A pair of complementary synthetic oligonucleotides that encode the desired gene can be made and annealed to each. The DNA sequence of the oligonucleotide will encode the sequence for the amino acid of the desired gene, except those that are substituted and / or deleted from the sequence.

Plasmid DNA can be treated with the selected restriction endonucleases followed by ligation to annealed oligonucleotides. The ligation mixture can be used to transform appropriate JM101 cells with appropriate antibiotic resistance. Plasmid DNA was tested by restriction analysis and / or DNA sequencing to collect single colonies and identify plasmids carrying the desired gene.

Cloning of DNA sequences of novel multifunctional hematopoietic agonists wherein at least one of them has a DNA sequence of other colony-forming stimulating factors can be achieved by the use of an intermediate vector. Instead, one gene can be cloned directly into a vector containing another gene. Linkers and adapters can be used to link DNA sequences as well as to replace missing sequences, where restriction sites are internal to the region of interest. Thus, a genetic material (DNA) encoding one polypeptide, a peptide linker, and other polypeptides is inserted into a suitable expression vector used to transform bacterial, yeast, insect, or mammalian cells. The transformed organisms are grown and proteins are separated by standard techniques. The resulting product is therefore a novel protein with a colony forming stimulating factor linked to a second colony forming stimulating factor by the linker moiety.

Another aspect of the present invention provides a plasmid DNA vector for use in the expression of these novel multifunctional hematopoietic receptor agonists. These vectors contain the novel DNA sequences coding for the novel polypeptides of the invention. An appropriate vector capable of transforming a microorganism capable of expressing a multifunctional hematopoietic receptor agonist is an expression vector containing a nucleotide sequence encoding a multifunctional hematopoietic receptor agonist linked to a transcriptional and translational control sequence selected according to the host cell used Vector.

A vector comprising the modified sequence as described above is included in the present invention and is useful for the production of a multifunctional hematopoietic receptor agonist polypeptide. The vector used in the method also contains the selected regulatory sequence in an operative binding having the DNA coding sequence of the present invention, and the regulatory sequence may direct its transcription and expression in the selected host cell.

In another aspect of the present invention, a method for producing a novel multifunctional hematopoietic receptor agonist is provided. The methods of the invention include culturing a suitable cell or cell line transformed with a vector containing a DNA sequence encoding the expression of a novel multifunctional hematopoietic receptor agonist. Suitable cells or cell lines are bacterial cells. For example, various strains of E. coli are known as host cells in the field of biotechnology. Examples of such strains include E. coli strain JM101 (Yanish-Perron et al., Gene 33: 103-119, 1985) and MON105 (Obukowicz et al., Applied Environmental Microbiology 58: 1511-1523, 1992). Expression of a multifunctional hematopoietic receptor agonist protein using a chromosomal expression vector for E. coli based on bacteriophage Mu is also included in the present invention (Weinberg et al., Gene 126: 25-33, 1993). Various strains of B. subtilis are also used in the present invention. Many strains of yeast cells known to those skilled in the art are also useful as host cells for expression of the polypeptides of the present invention. When expressed in the E. coli cytoplasm, the gene coding for the multifunctional hematopoietic receptor agonist of the present invention also includes a codon at the 5 'end of the gene, resulting in Met- ^2- Ala- ¹ at the N- Met < RTI ID = 0.0 > ^-1 . ≪ / RTI > The N-terminus of the protein produced in the cytoplasm of E. coli is affected by post-translational treatment with methionine aminopeptidase (Ben Bassat et al., J. Bac. 169: 751-757, 1987) and / or other peptidases, Methionine is cleaved from the N-terminus. The multifunctional hematopoietic receptor agonist of the present invention comprises a multifunctional hematopoietic receptor agonist polypeptide having Met- ¹ , Ala- ¹ or Met- ^2- Ala- ¹ at the N-terminus. These mutant multifunctional hematopoietic receptor agonists are also expressed in E. coli by fusing the secretion signal peptide to the N-terminus. These signal peptides are cleaved from the polypeptide as part of the secretion process.

In addition, mammalian cells such as Chinese hamster ovary cells (CHO) are suitable for use in the present invention. The general expression of foreign genes in mammalian cells was reviewed by Kaufman, RJ (1987, Genetic Engineering, Principles and Methods, Vol. 9, JK Setlow, editor, Plenum Press, New York). A strong promoter operable in mammalian cells constitutes an expression vector that induces the transcription of the eukaryotic secretion signal peptide coding portion, which is translationally linked to the coding portion for a multifunctional hematopoietic receptor agonist. For example, plasmids such as pcDNA I / Neo, pRc / RSV, and pRc / CMV (purchased from Invitrogen Corp., San Diego, Calif.) Can be used. The eukaryotic secretion signal peptide coding portion may be from the gene itself or from another secreted mammalian protein (Bayne, ML et al . , Proc. Natl. Acad. Sci. USA 84: 2638-2642, 1987) . After assembly of the vector containing the gene, vector DNA was transfected into the mammalian cells. Such cells may be, for example, COS7, HeLa, BHK, CHO, or mouse L-line. The cells can be cultured, for example, in DMEM medium (JRH Scientific). Polypeptides secreted into the medium can be recovered by standard biochemical methods following transfection of cells or by transient expression for 24-72 hours after establishment of a stable cell line following selection for antibiotic resistance. Selection of suitable mammalian host cells and methods of transformation, culture, amplification, screening and product production and purification are well known in the art. For example, Gething and Sambrook, Nature, 293: 620-625, 1981, or alternatively, Kaufman et al . , Mol. Cell. Biol. , 5 (7): 1750-1759, 1985 or Howly et al., U.S. Patent 4,419,446. Another suitable mammalian cell line is the monkey COS-1 cell line. A similar useful mammalian cell line is the CV-1 cell line.

If desired, insect cells are used as host cells in the methods of the invention. See, for example, Miller et al., Genetic Engineering, 8: 277-298 (Plenum Press 1986) and references cited therein. Furthermore, the general method of expression of foreign genes in insect cells using Baculovirus vectors is described below: Summers, MD and Smith, GE, 1987) - A Manual of methods for Baculovirus vectors and insect cell culture procedures, Texas Agricultural Experiment Station Bulletin No. < RTI ID = 0.0 > 1555. A bactlovirus carrier protein (such as a polyhedron promoter) that induces the transcription of a eukaryotic secretion signal peptide coding region that is translationally linked to a coding region for a multifunctional hematopoietic receptor agonist Is assembled. For example, the plasmid pVL1392 (purchased from Invitrogen Corp., San Diego, Calif.) Can be used. After assembly of the vector with the gene encoding the multifunctional hematopoietic receptor agonist polypeptide, 2 micrograms of this DNA were mixed with 1 microgram of baculovirus DNA (see Summers & Smith, 1987) into insect cells, co-transfected into strain SF9 . Pure recombinant baculoviruses with multifunctional hematopoietic receptor agonists are used, for example, to infect cultured cells in Excell 401 serum-free medium (JRH Biosciences, Lenexa, Kansas). Multifunctional hematopoietic receptor agonists secreted into the medium can be recovered by standard biochemical methods. The supernatant from mammalian or insect cells expressing the multifunctional hematopoietic receptor agonist protein can first be concentrated using any of a number of commercial concentrating units.

The multifunctional hematopoietic receptor agonists of the present invention are useful in the treatment of diseases characterized by reduced levels of hematopoietic bone marrow, red blood cells, lymph, or megakaryocytes, or a combination thereof. They are also used to activate mature bone marrow and / or lymphoid cells. Of the conditions that can be treated by the polypeptides of the present invention, there is a decrease in the number of circulating white cells in the peripheral blood, that is, leukopenia. Leukopenia is induced by exposure to certain viruses or to radiation. It is often a side effect of various forms of cancer treatment, such as exposure to chemotherapy drugs or radioactivity, and infection or intracerebral hemorrhage. The therapeutic treatment of leukopenia by these multifunctional hematopoietic receptor agonists of the present invention avoids undesirable side effects from treatment with currently available drugs.

The multifunctional hematopoietic receptor agonists of the present invention are useful for the treatment of neutropenia and for the treatment of neutropenia including, for example, aplastic anemia, recurrent neutropenia, idiopathic neutropenia, Chediak-Higashi syndrome, systemic lupus erythematosus (SLE), leukemia, It is useful for the treatment of conditions such as fibrosis.

The multifunctional hematopoietic receptor agonist of the present invention is useful for the treatment or prevention of thrombocytopenia. Currently, the only treatment for thrombocytopenia is a costly platelet transfusion with significant risk of infection (HIV, HBV) and allogeneic immunity. Multifunctional hematopoietic receptor agonists alleviate or reduce the need for platelet transfusions. Severe thrombocytopenia leads to genetic defects such as Fanconi's anemia, Wiscott-Aldrich, or May Hegglin syndrome. Acquired thrombocytopenia is caused by auto- or homologous antibodies such as immune thrombocytopenic purpura, systemic lupus erythematosus, hemolytic anemia, or fetal maternal non-compliance. In addition, spontaneous, infectious intravascular coagulation, thrombotic thrombocytopenic purpura, infection, or an artificial heart valve results in thrombocytopenia. Severe thrombocytopenia is also caused by chemotherapy and / or radiation therapy or cancer. Thrombocytopenia is also caused by bone marrow invasion by cancer, lymphoma, leukemia or fibrosis.

The multifunctional hematopoietic receptor agonist of the present invention is useful for circulating hematopoietic precursor and hepatocyte in peripheral blood. Peripheral blood derived from precursors has been shown to be effective in restoring patients to the environment of autologous bone marrow transplantation. Hematopoietic growth factors including G-CSF and GM-CSF have been shown to increase the number of circulating precursors and hepatocytes in peripheral blood. This reduces the number of required peresis, simplifying the procedure for harvesting peripheral hepatocytes and dramatically reducing the cost of the procedure. Multifunctional hematopoietic receptor agonists were useful for the distribution of hepatocytes and enhanced the efficiency of peripheral hepatocyte transplantation.

In addition, the multifunctional hematopoietic receptor agonist of the present invention is useful for in vitro expansion of hematopoietic precursor cells and hepatocytes. Colony-forming stimulating factors (CSFs) such as hIL-3 may be administered alone or in combination with other CSFs to treat neutropenia and thrombocytopenia, often resulting from such treatment, following high dose chemotherapy, or In combination with bone marrow transplantation. However, the frequency of severe neutropenia and thrombocytopenia is not completely eliminated. Bone marrow, consisting of monocytes (macrophages), granulocytes (including neutrophils), and megakaryocytes, are important in preventing life-threatening infections and bleeding. Neutropenia and thrombocytopenia may also be the result of many therapeutic treatments such as disease, genetic disorders, drugs, toxins, radiation and conventional oncological therapy.

Bone marrow transplantation has been used to treat these patient populations. However, some problems have been linked to the use of bone marrow to restore an endangered hematopoietic system, including: 1) limited numbers of hepatocytes in bone marrow, spleen, or peripheral blood, 2) transplantation versus host disease, 3 ) Transplant rejection and 4) possible contamination of tumor cells. Hepatocytes produce a very low percentage of nucleated cells in bone marrow, spleen, and peripheral blood. There is clearly a dose response that allows a large number of hepatocytes to enhance hematopoietic recovery. Therefore, in vitro expansion of hepatocytes should enhance hematopoietic recovery and patient survival. Bone marrow derived from an allogeneic immune donor has been used to provide bone marrow for transplantation. However, transplantation versus host disease and graft rejection limit bone marrow transplantation, even in recipients with HLA-matched offspring donors. An alternative to allogeneic bone marrow transplantation is autologous bone marrow transplantation. In autologous bone marrow transplantation, some of the patient's bone marrow is harvested prior to, for example, high dose chemotherapy, myeloablative treatment, and then transplanted back to the patient. Autotransplantation removes the risk of graft versus host disease and transplant rejection. However, autologous bone marrow transplantation is problematic in terms of possible contamination by a limited number of hepatocytes and tumor cells within the bone marrow. A limited number of hepatocytes can be overcome by in vitro expansion of hepatocytes. In addition, to reduce tumor cell contamination of bone marrow transplant tissue, hepatocytes can be specifically isolated based on the presence of certain surface antigens such as CD34 +.

The following patents further encompass the use of cells for hepatocyte, CD34 + cell isolation, cell culture with hematopoietic factors, cells for the treatment of patients with hematopoietic disorders and the use of hematopoietic factors for cell expansion and gene therapy.

5,061,620 relates to a composition containing human hematopoietic stem cells obtained by isolating hepatocytes from the provided cells.

5,199,942 relates to a method of autologous hematopoietic cell transplantation comprising: (1) obtaining hematopoietic precursor cells from a patient; (2) in vitro expansion of cells by growth factors selected from the group consisting of IL-3, flt3 ligand, c-kit ligand, GM-CSF, IL-1, GM-CSF / IL-3 fusion protein and combinations thereof; (3) administering a cytoprotective agent to the patient.

5,240, 856 relates to a cell separator comprising an apparatus for automatically regulating the method of cell separation.

WO 91/16116 describes an apparatus and method for selectively isolating and isolating a target cell from a cell mixture.

WO 91/18972 describes a method for in vitro culture of bone marrow by incubating a suspension of bone marrow cells using a hollow bioreactor.

WO 92/18615 relates to a method for maintaining and expanding bone marrow cells for use in transplantation in a medium containing a specific mixture of cytokines.

WO 93/08268 discloses a method of selectively expanding hepatocytes, comprising (a) separating CD34 + hepatocytes from other cells, and (b) selectively allowing hepatocytes to be expanded by incubating the isolated cells in a selection medium Describe the method.

WO 93/18136 describes a method for in vitro support of mammalian cells derived from peripheral blood.

WO 93/18648 relates to a composition containing human neutrophil precursor cells and a high content of bone marrow aspirate and botulinum toxin for the treatment of genetic or acquired neutropenia.

WO 94/08039 describes a method for enriching human hematopoietic stem cells by selection of cells expressing c-kit protein.

WO 94/11493 describes CD34 + and small-scale hepatocyte populations isolated using reverse-flow-type mutagenesis.

WO 94/27698 relates to a combination of immunoaffinity separation and continuous flow centrifugation to selectively isolate heterogeneous cell populations of nuclei from heterogeneous cell mixtures.

WO 94/25848 describes a cell separation device for collection and manipulation of target cells.

Long-term culture of highly enriched CD34 + precursors of hematopoietic precursor cells from human bone marrow in cultures containing IL-1a, IL-3, IL-6 or GM-CSF is described by Brandt et al. Invest. 86: 932-941, 1990.

One aspect of the present invention provides a selective in vitro expansion method of hepatocytes. The term " hepatocyte " also refers to premature precursor and progenitor cells that can be isolated from the bone marrow, spleen or peripheral blood as well as the ovarian hematopoietic stem cells. The term " expansion " refers to differentiation and proliferation of cells. The present invention provides a selective in vitro expansion method of hepatocytes, which comprises the steps of: (a) separating hepatocytes from other cells, (b) contacting the hepatocytes with the multifunctional hematopoietic receptor agonist protein (s) Culturing the separated hepatocytes with selective medium; and (c) harvesting the hepatocytes. The aforementioned progenitor cells, which are intended to be neutrophils, erythrocytes, platelets, etc. as well as hepatocytes, can be identified by the presence or absence of certain precursor marker antigens such as CD34 present on the surface of these cells, and / It differs from most other cells. Although the phenotype for highly enriched human hepatocyte fraction is reported as CD34 +, Thy-1 + and lin-, it is understood that the present invention is not limited to the expansion of this hepatocyte population. CD34 + enriched human hepatocyte fractions can be separated by a number of reported methods, including affinity columns or beads, magnetic beads or flow cytometry using antibodies against surface antigens such as CD34 +. It is also possible to enrich the hematopoietic precursor using physical separation methods such as counterflow gradient. CD34 + precursors are heterogeneous and are subdivided into several subpopulations characterized by the presence or absence of coexpression of cell surface-associated molecules in different lineages. Most immature progenitor cells do not express any known lineage-related markers such as HLA-DR or CD38, but they express CD90 (thy-1). Other surface antigens such as CD33, CD38, CD41, CD71, HLA-DR or c-kit can also be used to selectively isolate hematopoietic precursors. The isolated cells can be cultured in culture flasks, sterile bags, or selected media in hollow fibers. Various colony stimulating factors are used to selectively expand the cells. Representative factors used for in vivo expansion of bone marrow include c-kit ligand, IL-3, G-CSF, GM-CSF, IL-1, IL-6, IL-11, flt-3 ligand or combinations thereof. do. The proliferation of hepatocytes can be monitored by standard techniques (eg, blood count calculator, CFU, LTCIC), by counting hepatocytes and other cells, or by flow cell counts before and after incubation.

Several methods for in vitro expansion of hepatocytes have been reported, using a number of selection methods and extensions using various colony-forming stimulating factors, including: c-kit ligands (Brandt et al., Blood 83: 1507-1514 [1994], McKenna, etc., Blood 86: 3413-3420 [1995] ), IL-3 (Brandt , etc., Blood 83: 1507-1514 [1994] , Sato , etc., Blood 82: 3600-3609 [1993] ), G-CSF (Sato, etc., Blood 82: 3600-3609 [1993] ), GM-CSF (Sato , etc., Blood 82: 3600-3609 [1993] ), IL-1 (Muench , etc., Blood 81: 3463- 3473 [1993]), IL- 6 (Sato , etc., Blood 82: 3600-3609 [1993] ), such as IL-11 (Lemoli, Exp Hem 21:.. 1668-1672 [1993], Sato , etc., Blood 82: (Brandt et al., Blood 83: 1507-1514 [1994], Haylock et al., Blood 80 (1993)), flt-3 ligand (McKenna et al. Blood 86: 3413-3420 : 1405-1412 [1992], Koller, etc., Biotechnology 11: 358-363 [1993] , (Lemoli etc., Exp Hem 21:.. 1668-1672 [1993], (McKenna , etc. Blood 86: 3413-3420 [1995] ), (Muench et al., Blood 81: 3463-3473 [1993]), Patchen, etc., Biotherapy 7: 13-26 [1994] , Sato , etc., Blood 82: 3600-3609 [1993] ), Smith , etc., Exp Hem 21:.. 870-877 [1993], Steen , etc. Stem Cells 12: 214-224 [1994], Tsujino et al . , Exp. Hem. 21: 1379-1386 [1993]). Of the individual colony forming stimulants, hIL-3 appears to be one of the most powerful in the expansion of peripheral blood CD34 + cells (Sato et al., Blood 82: 3600-3609 [1993]), Kobayashi et al., Blood 73: 1836-1841 1989). However, no single factor appeared to be more effective than a combination of multiple factors. The present invention provides a method for in vitro expansion using a multifunctional hematopoietic receptor agonist that is more effective as a single agent.

Another aspect of the present invention is a stromal cell line (WO 96/02662, Roecklein and Torok-Strob, Blood 85: 997-1105, 1995) such as HS-5 supplemented with a multifunctional hematopoietic receptor agonist of the invention, And culturing the cells in a culture vessel containing a culture medium which has been subjected to a pre-treatment and /

We also planned the clinical use of growth factors for in vitro activation of hematopoietic precursors and hepatocytes for gene therapy. Due to the long lifespan of hematopoietic precursor cells and the distribution of their offspring throughout the body, hematopoietic progenitor cells are good candidates for in vitro gene transfection. It is necessary to stimulate cell division and DNA replication to combine the gene of interest into the hematopoietic precursor or hepatocyte. Hematopoietic stem cells have a very low frequency of cycle, meaning that the growth factor is useful for gene transduction and thereby enhances the clinical outlook for gene therapy. Possible applications of gene therapy (review Crystal, Science 270: 404-410 [1995]) include: 1) the treatment of many congenital metabolic disorders and immune deficiencies (Kay and Woo, Trends Genet. 10: 253-257 [ 1994), 2) neurological disorders (Friedmann, Trends Genet. 10: 210-214 [1994]), 3) cancer (Culver and Blaese, Trends Genet. 10: 174-178 [1994]) and 4) (Gilboa and Smith, Trends Genet. 10: 139-144 [1994]).

There are a variety of methods known to those skilled in the art for introducing genetic material into a host cell. Many vectors, both viral and nonviral, have been developed to carry therapeutic genes into primary cells. Virus-based vectors include the following; 1) replication deficient recombinant retrovirus (Boris-Lawrie and Temin, Curr. Opin. Genet. Dev. 3: 102-109 [1993], Boris-Lawrie and Temin, Annal. New York Acad. Sci. [1994], Miller, Current Top Microbiol Immunol 158:... 1-24 [1992]) , and replication defective recombinant adenoviruses (Berkner, BioTechniques 6:.. 616-629 [1988], Berkner, Current Top Microbiol Immunol. 158: 39-66 [1992], Brody and Crystal, Annal. New York Acad. Sci. 716: 90-103 [1994]). Vectors of non-viral bases include: Protein / DNA complexes (Cristiano et al . , PNAS USA 90: 2122-2126 [1993], Curiel et al., PNAS USA 88: 8850-8854 [1991], Curiel, Annal. New York Acad. Sci. 716: 36-58 [ 1994), the transport of electrophoresis and liposome intermediates, such as cationic liposomes (Farhood et al. Annal. New York Acad. Sci. 716: 23-35 [1994]).

The present invention provides a method of using a multifunctional hematopoietic receptor agonist protein having improved biological activity including invisible activity by a single colony forming stimulating factor, Provides improvements to existing methods.

Many drugs cause bone marrow suppression or hematopoietic deficiency. Examples of such drugs include antibiotics such as AZT, DDI, alkylating agents and antimetabolites used in chemotherapy, chloramphenicol, penicillin, gancyclovir, daunomycin and sulfadrug, psychostimulants such as meflobamate Analgesics such as aminopyrine and dipyrone, antispasmodics such as phenytoin or carbamazepine, antithyroid substances such as propylthiouracil and methimazole, and diuretics. The multifunctional hematopoietic receptor agonists of the present invention are useful for preventing or treating bone marrow suppression or hematopoietic deficiency often occurring in patients treated with these drugs.

Hematopoietic deficiency can also occur as a result of viral, microbial or parasitic infections and as a result of treatment of kidney disease or renal failure such as dialysis. The multifunctional hematopoietic receptor agonists of the present invention are useful for the treatment of such hematopoietic deficiency.

Treatment of hematopoietic deficiency comprises administering to the patient a pharmaceutical composition comprising a multifunctional hematopoietic receptor agonist. In addition, the multifunctional hematopoietic receptor agonists of the present invention are useful for the activation and amplification of hematopoietic precursors by in vitro treatment of these cells with the multifunctional hematopoietic receptor agonist protein of the present invention before injecting the cells into the patient.

For example, various immunodeficiencies in T and / or B lymphocytes or immunodeficiencies such as rheumatoid arthritis may be beneficially affected by treatment with the multifunctional hematopoietic receptor agonists of the present invention. Immunodeficiency is the result of viral infections such as, for example, HTLVI, HTLVII, HTLVIII, severe exposure to radiation, cancer treatment or other medical treatment. The multifunctional hematopoietic receptor agonists of the present invention may also be used alone or in combination with other colony forming stimulants to treat other blood cell defects, including platelet hypoplasia (platelet defects), or anemia. Another use for these novel polypeptides is in the in vivo and in vitro treatment of patients recovering from bone marrow transplantation and in the development of monoclonal and polyclonal antibodies produced by standard methods for diagnostic or therapeutic use .

Another aspect of the present invention is a method and therapeutic composition for the treatment of such conditions. Such compositions contain, in the form of a mixture with a pharmaceutically acceptable carrier, a therapeutically effective amount of one or more of the inventive multifunctional hematopoietic receptor agonists. Such compositions may be administered orally, intravenously or subcutaneously. For administration, the therapeutic composition for use in the present invention is preferably in the form of an orally acceptable aqueous solution without a heat source. The preparation of such an orally acceptable protein solution taking into account pH, isotonicity, stability and the like is within the skill of the art.

The dosage regimen that is included in the treatment of such conditions will be determined by the attending physician in consideration of, for example, the patient's condition, weight, sex and diet, severity of the infection, timing of administration and other clinical factors. Generally, the daily regimen is a multifunctional hematopoietic receptor agonist protein ranging from 0.2 to 150 μg / kg body weight per kilogram. The dosage will be adjusted in relation to the activity of a given multifunctional hematopoietic receptor agonist protein and the dosage regimen will not be unreasonable to include a low dosage of 0.1 microgram per kilogram of body weight per day and a high dosage of 1 milligram . There may also be special circumstances in which it is regulated above or below the range of 0.2 to 150 micrograms per kilogram of body weight. These include co-administration with other colony-forming stimulating factors or IL-3 variants or growth factors; Co-administration with a chemotherapeutic drug and / or radiation; The use of glycosylated multifunctional hematopoietic receptor agonist proteins; And various patient-related issues mentioned earlier in this section. Also as indicated above, the therapeutic methods and compositions comprise co-administration with other human factors. A non-limiting list of other suitable colony-forming stimulating factors (CSFs), cytokines, lymphokines, hematopoietic growth factors and interleukins for simultaneous or sequential co-administration with the polypeptides of the invention include GM-CSF, G-CSF, IL-5, IL-6, IL-7, IL-10, IL-10, IL-12, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-16, LIF, flt3 / flk2 ligand, And eosinophil factor, hepatocyte factor (SCF) (also known as steel factor or c-kit ligand), or a combination thereof. The above listed dosages will be adjusted to supplement these additional components in the therapeutic composition. The progression of the treated patient can be observed by a periodic evaluation such as a hematological profile, for example, differential cell count.

Materials and methods

Unless otherwise noted, all specialty chemicals were obtained from Sigma, Co. (St. Louis, Mo.). Restriction endonuclease and T4 DNA ligase were obtained from New England Biolabs (Beverly, MA) or Boehringer Mannheim (Indianaplis, IN).

E. coli Transformation of a strain

E. coli strains such as DH5? ^TM (Life Technologies, Gaithersburg, MD) and TG1 (Amersham Corp., Alington Heights, IL) are used for transformation of the ligation reaction and a source of plasmid DNA for transfecting mammalian cells do. E. coli strains such as MON105 (Obukowicz, et al., Appl. And Envir. Micr. , 58: 1511-1523, 1992) and JM101 (Yanisch-Perron, et al., Gene , 33: Can be used to express multifunctional hematopoietic receptor agonists in the cytoplasm or the surrounding cytoplasmic space.

MON105 ATCC # 55204: F-, lambda-, IN (rrnD, rrE) 1, rPOd +, rPOH358

^{DH5α TM: F-, phi80dlaczdeltaM15, delta} (lacZYA-argF) U169, deoR, recA1, endA1, hsdR17 (rk-, mk +), phoA, supE44lamda-thi-1, gyrA96, relA1

TG1: delta (lac-pro), supE, thi-1, hsdD5 / F (traD36, proA + B +, lacIq, lacZdeltaM15)

JM101 ATCC # 33876: delta (pro lac), supE, thi, F '(traD36, proA + B +, lacIq, lacZdeltaM15)

DH5α ^TM Subcloning Efficacy Cells are purchased as competent cells and the transformed cells are prepared using the manufacturer's protocol, while the E. coli strains TG1 and MON105 are made competitively and the DNA is inserted using the CaCl ₂ method. Typically, 20-50 mL cells were seeded at approximately 1.0 (at 600 nm), measured with a Baush & Lomb Spectronic spectrophotometer (Rochester, NY) in L13 medium (1% bacto-tryptone, 0.5% bacto-yeast extract, 150 mM NaCl) Of the optical density unit (OD600). Cells are harvested by centrifugation and resuspended in 1/5 culture volume of CaCl ₂ solution (50 mM CaCl ₂ , 10 mM Tris-Cl, pH 7.4) and kept at 4 ° C for 30 minutes. The cells are collected again by centrifugation and resuspended in a 1/10 culture volume of CaCl ₂ solution. The ligation DNA is added to 0.2 mL of this cell and the sample is kept at 4 DEG C for 30-60 minutes. The sample is heated to 42 ° C for 2 minutes, 1.0 mL of LB is added, and the sample is shaken at 37 ° C for 1 hour. Cells from this sample were treated with either ampicillin (100 micrograms / mL, / / mL) when ampicillin-resistant transformants were selected or spectinomycin (75 쨉 g / mL when choosing spectinomycin-resistant transformants) / mL) (LB medium and 1.5% bacto-agar). Incubate the plates overnight at 37 ° C.

Colonies are taken and grown at 37 ° C with shaking in LB and the appropriate antibiotic (100 μg / mL ampicillin or 75 μg / mL streptomycin).

Method for producing new N-terminal / C-terminal gene

Method I. Generation of new N-terminal / C-terminal gene containing linker moiety (L ₂ )

A new N-terminal / C-terminal gene containing a linker portion (L ₂ ) that separates the original C-terminus and the N-terminus is essentially a LS Mullins, et al J. Am. Chem. Soc. 116, < / RTI > 5529-5533, 1994. Multi-step polymerase chain reaction (PCR) amplification is used to rearrange the DNA sequence encoding the first amino acid sequence of the protein. The steps are shown in Fig.

In the first step, the first primer set ("New Start" and "Linker Start") is ligated from the original gene sequence to the new N-terminal portion of the new protein followed by the C- Is used to produce and amplify a DNA fragment containing the sequence encoding the linker (L ₂ ) ("Fragment Start"). In the second step, the second primer set ("New Stop" and "Linker Stop") is a DNA fragment ("Fragment Stop") coding for the same linker as used in the original gene sequence followed by a new C- Lt; RTI ID = 0.0 > and / or < / RTI > The " New Start " and " New Stop " primers are designed to include appropriate restriction sites to clone a new gene into an expression plasmid. Typical PCR conditions consist of 1 cycle of 95 ° C melting for 2 minutes; 94 [deg.] C denaturation for 1 minute, annealing at 50 [deg.] C for 1 minute and elongation at 25 [deg.] C for 1 minute 25 cycles; And 72 ° C elongation for 7 minutes. Use the Perkin Elmer GeneAmp PCR Core Reagent kit. 100 占 퐇 Reaction product was prepared by mixing 100 pmol of each primer and 1 占 퐂 of template DNA; And 1 × PCR buffer, 200 μM dGTP, 200 μM dATP, 200 μM dTTP, 200 μM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl ₂ . The PCR reaction is performed in a Model 480 DNA column cycler (Perkin Elmer Corporation, Norwalk, Conn.).

The "Fragment Start" and "Fragment Stop" sequences having a complementary sequence at the linker portion and a coding sequence for both amino acids at both linkers are ligated together in the third PCR step to create a full-length gene encoding the new protein. DNA fragments "Fragment Start" and "Fragment Stop" are digested on 1% TAE gel, stained with ethidium bromide and isolated using Qiaex Gel Extraction Kit (Qiagen). These fragments are combined in equimolar amounts, heated at 70 ° C for 10 minutes, slowly cooled and annealed through their shared sequence at "Linker Start" and "Linker Stop". In the third PCR step primers " New Start " and " Linker Stop " are added to the annealed fragment to generate and amplify full-length new N-terminal / C-terminal genes. Typical PCR conditions consist of 1 cycle of 95 ° C melting for 2 minutes; 94 [deg.] C denaturation for 1 min, 60 [deg.] C annealing for 1 min and 72 [deg.] C elongation for 1 min; And 72 ° C elongation for 7 minutes. Use the Perkin Elmer GeneAmp PCR Core Reagents kit. 100 [mu] l of the reaction mixture contained 100 pmol of each primer and about 0.5 [mu] g of DNA; And 1 × PCR buffer, 200 μM dGTP, 200 μM dATP, 200 μM dTTP, 200 μM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl ₂ . The PCR reaction is purified using Wizard PCR Preps kit (Promega).

Method II. Production of a gene with novel N-terminal / C-terminal without linker moiety

A novel N-terminal / C-terminal gene without a linker linking the original N-terminus and C-terminus can be generated using two steps of PCR amplification and blunt end ligation. This step is shown in Fig. In the first step, primer sets (" New Start " and " P-bl Start ") contain, from the original gene sequence, a DNA fragment containing the sequence encoding the new N- Is used to produce and amplify. In the second step, a primer set ("New Stop" and "P-bl Stop") is produced from the gene sequence and a DNA fragment containing the sequence encoding the new C-terminal portion of the new protein ("Fragment Stop" . The " New Start " and " New Stop " primers are designed to include appropriate restriction sites to clone a new gene into an expression vector. Typical PCR conditions consist of 1 cycle of 95 ° C melting for 2 minutes; 94 [deg.] C denaturation for 1 minute, annealing at 50 [deg.] C for 45 seconds and elongation at 72 [deg.] C for 45 seconds. Deep Vent polymerase (New England Biolabs) is used to reduce the occurrence of protrusions under conditions suggested by the manufacturer. Phosphorylation of the "P-bl Start" and "P-bl Stop" primers at the 5 'end aids in ligation to "Fragment Start" and "Fragment Stop" respectively at the next blunt end. 100 μl of the reaction mixture contained 150 pmol of each primer and 1 μg of template DNA; And 1 × Vent buffer (New England Biolabs), 300 μM dGTP, 300 μM dATP, 300 μM dTTP, 300 μM dCTP, and 1 unit Deep Vent polymerase. The PCR reaction is performed in a Model 480 DNA column cycler (Perkin Elmer Corporation, Norwalk, Conn.). The PCR reaction products are purified using Wizard PCR kit (Promega).

The primers are designed to include appropriate restriction sites for cloning the new gene into an expression vector. Typically, "Fragment Start" is designed to generate NcoI restriction sites and "Fragment Stop" is designed to generate HindIII restriction sites. The restriction digestion reagent is purified using the Magic DNA Clean-up System Kit (Promega). Fragments Start and Stop are digested on 1% TAE gel, stained with ethidium bromide and isolated using Qiaex Gel Extraction Kit (Qiagen). These fragments are combined and annealed at the end of the ~3800 base pair NcoI / HindIII vector fragment of pMON 3934 by heating at 50 [deg.] C for 10 minutes and slow cooling. Three fragments are ligated together using T4 DNA ligase (Boehringer Mannheim). The result is a plasmid containing a full-length new N-terminal / C-terminal gene. A portion of the ligation reaction is used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, Md.). The plasmid DNA is purified and the sequence is confirmed as follows.

Method III. New N-terminal / C-terminal gene production by serial redundancy method

The new N-terminal / C-terminal gene can be made based on the method described in R. A. Horlick, et al 5: 427-431, Polymerase chain reaction (PCR) amplification of new N-terminal / C-terminal genes is performed using duplicate template DNA in series. These steps are shown in FIG.

The serially replicated template DNA contains two copies of the gene, generated by cloning and separated by a DNA sequence encoding a linker that links the original C- and N-termini of two copies of the gene. A specific set of primers is used to produce and amplify full-length new N-terminal / C-terminal genes from duplicated template DNA in series. This primer is designed to include appropriate restriction sites that allow cloning of the new gene into an expression vector. Typical PCR conditions consist of 1 cycle of 95 ° C melting for 2 minutes; 94 [deg.] C denaturation for 1 minute, annealing at 50 [deg.] C for 1 minute and elongation at 25 [deg.] C for 1 minute 25 cycles; And 72 ° C elongation for 7 minutes. Perkin Elmer GeneAmp PCR Core Reagents kit (Perkin Elmer Corporation, Norwalk, Conn.) Is used. 100 μl of the reaction mixture was prepared by mixing 100 pmole of each primer and 1 μg of template DNA; And 1 × PCR buffer, 200 μM dGTP, 200 μM dATP, 200 μM dTTP, 200 μM dCTP, 2.5 units AmpliTaq DNA polymerase and 2 mM MgCl ₂ . The PCR reaction is performed in a Model 480 DNA column cycler (Perkin Elmer Corporation, Norwalk, Conn.). The PCR reaction is purified using Wizard PCR Preps kit (Promega).

Cloning of novel N-terminal / C-terminal genes into multifunctional receptor agonist expression vectors

The new N-terminal / C-terminal gene is digested with restriction endonuclease to produce an end suitable for insertion into an expression vector containing another colony-forming factor gene. The expression vector is also digested with restriction endonuclease to form a compatible end. After purification, the gene and vector DNAs are combined and ligated using T4 DNA ligase. A portion of the ligation reaction is used to transform E. coli . The plasmid DNA is purified and then sequenced to identify the correct insert. The correct clone is grown for protein expression.

DNA isolation and characterization

Plasmid DNA can be isolated in a number of different ways and by using commercially available kits known to those skilled in the art. Here are some of those methods. Plasmid DNA is isolated using the Promega Wizard ^™ Miniprep kit (Madison, WI), the Qiagen QIAwell Plasmid isolation kit (Chatsworth, CA) or the Qiagen Plasmid Midi kit. These kits follow the same general plasmid DNA isolation method. Briefly, the cells are pelleted by centrifugation (5000 × g) and the plasmid DNA is released with a series of NaOH / acid treatments and centrifuged (10000 × g) to remove cellular debris. The supernatant (containing the plasmid DNA) is loaded onto a column containing the DNA-binding resin, the column is washed and the plasmid DNA is eluted with TE. After screening colonies with plasmids of interest, E. coli cells are grown overnight in an air incubator at 37 ° C with shaking, inoculated with 50-100 mls of LB and appropriate antibiotics. Purified plasmid DNA is used for DNA sequencing, further restriction digestion, additional subcloning of DNA fragments and transfection into mammals, E. coli or other cells.

Sequence identification

The purified plasmid DNA was quantified by resuspending in dH ₂ O and measuring the absorbance at 260/280 nm on a Bausch and Lomb Spectronic 601 UV spectrometer. The ABI PRISM ^TM DyeDeoxy ^TM Perkin Elmer Corporation, Lincoln City, Calif. Kit according to the manufacturer's proposed protocol, which is usually denatured by addition of 5% DMSO to the DNA sequencing mixture, Or 402078). Sequencing reactions are performed in a Model 480 DNA column cycler (Perkin Elmer Corporation, Norwalk, Conn.) According to the amplification conditions provided. Samples are purified with a Centri-Sep ^TM spin column (Princeton Separations, Adelphia, NJ) to remove excess dye terminator and freeze-dried. The fluorescent dye-labeled sequencing reaction is resuspended in deionized formamide and sequenced on a 4.75% polyacrylamide-8M urea gel denaturing using an ABI Model 373A automated DNA sequencer. The overlapping DNA sequence fragments were analyzed using Squencher v2.1 DNA analysis software (Gene Codes Corporation, Ann Arbor, MI) and assembled into master DNA contig.

Expression of multifunctional receptor agonists in mammalian cells

Mammalian cell transfection / production of conditioned media

BHK-21 cell line can be obtained from ATCC (Rockville, Md.). Cells are cultured in Dulbecco's denatured Eagle medium (DMEM / high glucose) supplemented with 2 mM (mM) L-glutamine and 10% fetal bovine serum (FBS). This preparation is referred to as a BHK growth broth. The selection medium is BHK growth medium supplemented with 453 units / mL hygromycin B (Calbiochem, San Diego, Calif.). The BHK-21 cell line was previously stably transfected with the HSV active transfer protein VP16, which activates the IE110 promoter found on the plasmid pMON3359 (see Hippenmeyer et al., Bio / Technology , pp.1037-1041, 1933). The VP16 protein induces the expression of the inserted gene after the IE110 promoter. BHK-21 cells expressing the active transfer protein VP16 are referred to as BHK-VP16. Plasmid pMON1118 (see Highkin et al., Poultry Sci ., 70: 970-981, 1991) expresses the hygromycin resistance gene from the SV40 promoter. Similar plasmids are available from ATCC, pSV2-hph.

BHK-VP16 cells to be transfected are seeded in to 24 hours prior to 60 millimeters (mm) to 3 × 10 ⁵ cells per dish, a tissue culture dish. Plasmid containing a gene of interest, which DNA per dish 10㎍, hygromycin resistance plasmid, pMON1118 3㎍, and Gibco-BRL in ^{"LIPOFECTAMINE" TM "OPTIMEM" TM} (Gibco-BRL, Gaithersburg, MD) containing 16 3mL Cells are transfected for a period of time. Subsequently, the medium is aspirated and replaced with a 3 mL growth medium. The medium was harvested from each dish at 48 hours post-transfection and assayed for activity (transient conditioned medium). The cells are removed from the dish by trypsin-EDTA, diluted 1:10 and transferred to a 100 mm tissue culture dish containing 10 mL of selective medium. After about 7 days in selective medium, resistant cells grow into colonies of several millimeters in diameter. The colonies are removed from the dishes with filter paper (cut to approximately the same size as the colonies and soaked in trypsin / EDTA) and transferred to each well of a 24 well plate containing 1 mL of selective medium. After the clones have grown and become compacted, the conditioned medium is reanalyzed and positive clones are applied to the propagation medium.

E. coli Expression of Multifunctional Receptor Agonists in Rats

E. coli strains MON105 or JM101 containing the plasmid of interest are grown in M9 and cassamino acid medium at 37 DEG C while shaking in an air incubator model G25 from New Brunswick Scientific (Edison, New Jersey). Growth is monitored at OD600 until a value of 1.0 is reached, where Nalidixic acid (10 mg / mL) in 0.1 N NaOH is added to a final concentration of 50 [mu] g / mL. The culture is then shaken at 37 DEG C for 3 to 4 more hours. Maintain a high degree of aeration throughout the incubation period to achieve maximum production of the desired gene product. The cells are examined under the light microscope for the presence of the inclusion bodies (IB). To analyze the protein content by boiling the pelleted cells, 1 mL culture supernatants are taken and treated with reducing buffer and electroporated through SDS-PAGE (Maniatis et al., Molecular Cloning: A Laboratory Manual, 1982). Centrifuge the culture (5000 × g) and pellet the cells.

E. coli Inclusion, refolding, dialysis, DEAE chromatography, and characterization of multifunctional hematopoietic receptor agonists accumulating as inclusion bodies

Isolation of inclusion body:

Cell pellets from 330 mL of E. coli culture were resuspended in sonication buffer (10 mM 2-amino-2- (hydroxymethyl) 1,3-propanediol hydrochloride (Tris-HCL), pH 8.0 + 1 mM ethylenediamine tetraacetic acid (EDTA)). The resuspended cells are sonicated using a Sonicator Cell Disruptor microtip probe (Model W-375, Heat System-Ultrasonics, Inc., Farmingdale, New York). After sonication three times in ultrasound buffer, the cells are ruptured by centrifugation and the inclusion body (IB) is washed. The first round of ultrasound treatment was a one minute rupture after three minutes of rupture and one minute of ultrasound treatment of the last two times.

Extraction and refolding of protein from inclusion body pellets:

After the final centrifugation step, the IB pellet was resuspended in 10 mL of 50 mM Tris-HCl, pH 9.5, 8 M urea and 5 mM dithiothreitol (DTT) and stirred at room temperature for about 45 minutes to cause denaturation of the expressed protein do.

The extract solution is transferred to a beaker containing 70 mL of 5 mM Tris-HCl, pH 9.5 and 2.3 M urea and gently agitated and exposed to air at 18 [deg.] C for 48 hours to refold the protein. Refolding is monitored by analysis on a Vydac (Hesperia, Ca.) C18 reverse phase high pressure liquid chromatography (RP-HPLC) column (0.46 x 25 cm). Refolding is observed using a linear gradient of 40% to 65% acetonitrile containing 0.1% trifluoroacetic acid (TFA). This gradient is developed at a flow rate of 1.5 mL per minute over 30 minutes. The denatured protein generally elutes later in the gradient than the refolded protein.

refine:

After refolding, the contaminated E. coli protein is removed by acid precipitation. The pH of the refolding solution is titrated from pH 5.0 to pH 5.2 using 15% (v / v) acetic acid (HOAc). The solution is stirred at 4 ° C for 2 hours and then centrifuged at 12,000 × g for 20 minutes to pellet all insoluble proteins.

The supernatant from the acid precipitation step is dialyzed using a Spectra / Por 3 membrane (MWCO) blocking the molecular weight of 3,500 daltons. And dialyzed twice with 4 liters (50-fold excess) of 10 mM Tris-HCl, pH 8.0 for a total of 18 hours. Dialysis reduces the conductivity of the sample and allows urea to be removed prior to DEAE chromatography. The sample is then centrifuged (12,000 x g for 20 min) to pellet all subsequent insoluble proteins by dialysis.

A Bio-Rad Bio-Scale DEAE2 column (7 x 52 mm) is used for ion exchange chromatography. The column is equilibrated in buffer containing 10 mM Tris-HCl, pH 8.0 and the proteins are eluted using a 0-500 mM sodium chloride (NaCl) gradient in equilibrium buffer over 45 column volumes. A flow rate of 1.0 mL per minute is used throughout the run. Column fragments (2.0 mL per fragment) are collected over a gradient and analyzed by RP HPLC on a Vydac (Hesperia, Ca.) C18 column (0.46 x 25 cm). A linear gradient of 40% to 65% acetonitrile containing 0.1% trifluoroacetic acid (TFA) is used. This gradient is developed at a flow rate of 1.5 mL per minute over 30 minutes. The collected fractions Then twice dialyzed changed 10mM ammonium acetate (NH ₄ Ac), pH 4.0 in 4 liters (50 to 500 fold excess) for 18 hours. Dialysis is performed using a Spectra / Por 3 membrane of MWCO of 3,500 Daltons. Finally, the sample is aseptically filtered using a 0.22 μm syringe filter (μStar LB syringe filter, Costar, Cambrige, Ma.) And stored at 4 ° C.

In some cases, the folded protein can be affinity purified by using affinity reagents such as mAbs or receptor subunits attached to appropriate matrices. Alternatively (or in addition) the purification can be accomplished by using any of several chromatographic methods such as ion exchange, gel filtration or hydrophobic chromatography or reverse phase HPLC.

Such or other protein purification methods are described in detail in Methods in Enzymology, Volume 182, 'Guide to Protein Purification' edited by Murray Deutscher, Academic Press, San Diego, CA (1990).

Protein characterization

Purified proteins are analyzed by RP-HPLC, electronic scatter mass spectrometry, and SDS-PAGE. Protein quantification is performed by amino acid composition, RP-HPLC, and Bradford protein crystals. In some cases trypsin peptide mapping is performed in conjunction with electron spray mass spectrometry to identify protein identity.

AML proliferation assay for bioactive human interleukin-3

The factor dependent cell line AML 193 was obtained from the American Type Culture Collection (ACCC, Rockville, Md.). This cell line established from patients with acute myelogenous leukemia is a growth factor dependent cell line that exhibits enhanced growth in GM-CSF supplemented medium (Lange, B., et al., Blood 70: 192, 1987; Valtieri, M., et al., J. Immunol . 138: 4042, 1987). The ability of AML 193 cells to proliferate in the presence of human IL-3 has also been documented (Santoli, D., et al., J. Immunol. 139: 348, 1987). The cell line mutant, AML 193 1.3, was used to cleave growth factors and adapt cytokine-dependent AML193 cells to growth factors for prolonged growth in IL-3 by starving for 24 hours. Then, the cell refers to 100 U / mL IL-3 1 × 10 5 cells / well in 24-well plates in the medium ash containing. It took about two months for the cells to grow rapidly in IL-3. The cells are then maintained as AML 193 1.3 by replenishing the tissue culture medium (see below) with human IL-3.

AML 193 1.3 cells are centrifuged at 250 x g for 10 min and washed six times in cold Hanks balanced salt solution (HBSS, Gibco, Grand Island, NY) following supernatant. The pelleted cells are resuspended in HBSS and the process is repeated until the six wash cycles are complete. Suspended thereby reproduced in tissue culture medium at a density of the three cells 2 × 10 ⁵ to 5 × 10 ⁵ of living range of cell / mL to six times by this method. This medium is prepared by supplementing with Iscove's denatured Dulbecco's Medium (IMDM, Hazelton, Lenexa, KS) with albumin, transferrin, lipid and 2-mercaptoethanol. Bovine albumin (Boehringer-Mannheim, Indianapolis, Ind.) Was added at 500 ug / mL; Human transferrin (Boehringer-Mannheim, Indianapolis, Ind.) Was added at 100 μg / mL; Soybean lipid (Boehringer-Mannheim, Indianapolis, IN) was added at 50 ug / mL; Then, 2-mercaptoethanol (Sigma, St. Louis, MO) is added at 50 × 10 ^-5 M.

A series of dilutions of human interleukin-3 or multifunctional hematopoietic receptor agonist protein is made in three rows in a supplemented tissue culture medium as described above in a 96 well Costar 3596 tissue culture plate. One serial dilution of each well containing 50 [mu] l of medium containing interleukin-3 or multifunctional hematopoietic receptor agonist protein is completed. Control standard wells contained tissue culture medium (negative control). 50 ((2.5 x 10 ⁴ cells) of the AML 193 1.3 cell suspension prepared as described above is added to each well by pipette. Tissue culture plates are incubated for 3 days at 37 [deg.] C with 5% CO _{2 in} humidified air. On the third day, 0.5 μCi ³ H-thymidine (2 Ci / mM, New England Nuclear, Boston, Mass.) Is added to 50 μl of tissue culture medium. The cultures are incubated at 37 [deg.] C with 5% CO _{2 in} humidified air for 18-24 hours. Cellular DNA is harvested on glass filter mats (Pharmacia LKB, Gaithersburg, MD) using a TOMTEC cell harvester (TOMTEC, Orange, CT) with a 70% ethanol wash cycle after a water wash cycle. The filter mat is air dried and then placed in a sample bag to which a scintillation fluid (Scintiverse II, Fisher Scientific, St. Louis, MO or BetaPlate Scintillation Fluid, Pharmacia LKB, Gaithersburg, MD) is added. Beta release of the sample from each tissue culture well was counted in a LKB BetaPlate Model 1205 scintillation counter (Pharmacia LKB, Gaithersburg, MD) and the data were expressed as the coefficient per minute of ³ H-thymidine incorporated into the cell from each tissue culture well do. The activity of each human interleukin-3 product or multifunctional hematopoietic receptor agonist protein product was determined by measuring cell proliferation ( ³ H-thymidine incorporation) induced by graded concentrations of interleukin-3 or multifunctional hematopoietic receptor agonists . Typical concentrations ranging from 0.05 pM to 10 ⁵ pM are quantified in this assay. The activity was determined by measuring the activity of 50% of the maximal proliferation (EC ₅₀ = 0.5 x (the maximum mean coefficient per minute of ³ H-thymidine incorporated per well in ³ well cultures of all concentrations of interleukin-3 - no interleukin- 3 < / RTI > or multifunctional hematopoietic receptor agonist protein that provides a basal proliferation value as measured by the ³ H-thymidine incorporation observed in the ³ -vessel culture). The EC ₅₀ value is also equivalent to 1 unit of bioactivity for. All assays can be performed with negative interleukin-3 as a reference standard to impart an inactive level.

Typically, multifunctional hematopoietic receptor agonist proteins were tested in the range of 2000 pM to 0.06 pM titrated in a series of 2x dilutions.

The activity for each sample was determined by the concentration providing 50% of maximal response by fitting a four-parameter low-jaw model to the data. It was observed that the upper flat part (maximum response) of the sample and the comparative standard did not differ. Thus, the decomposition calculations for each sample are determined from the EC ₅₀ evaluation of the samples and standards as indicated above. AML 193 1.3 cells proliferate in response to hIL-3, hGM-CSF and hG-CSF. Thus, the following additional analysis was performed on several samples to demonstrate that the G-CSF receptor agonist portion of the multifunctional hematopoietic receptor agonist protein is active. The proliferation assay was performed on the hIL-3 receptor agonist moiety as a multifunctional hematopoietic receptor agonist with and without a monoclonal antibody. In addition, the fused molecule on the factor Xa cleavage site was cleaved and then purified, and half of the molecules were analyzed for proliferative activity. This experiment shows that the two components of the multifunctional hematopoietic receptor agonist protein are active.

TF1 c-mpl ligand dependent proliferation assay

c-mpl ligand proliferation activity can be analyzed using a multipotent human cell line TF1 (Kitamura et al., J. Cell Physiol 140: 323-334 [1989]). TF1 cells are maintained in h-IL3 (100 U / mL). A subculture medium containing 10% supernatant from BHK cells transfected with the gene (pMON26448) expressing 1-153 type of c-mpl ligand to establish a sub-clone responsive to c-mpl ligand . Most cells die but a subset of cells survive. After dilution cloning, a c-mpl ligand reactive clone is selected and the cells are separated into subculture media at a density of 0.3 x ¹⁰⁶ cells / mL the day before starting the assay. The subculture medium for this cell was RPMI 1640 (Gibco), 10% c-mpl ligand supernatant from transfected BHK cells, 1 mM sodium pyruvate (Gibco), 2 mM glutamine (Gibco), and 100 / / ML penicillin-streptomycin (Gibco). The next day the cells are harvested and washed twice in PRMI or IMDM medium, the last wash being done in ALT, or in the assay medium. ALT medium consisted of: 1000 mL of IMDM (Gibco) per ALT, 500 μg / mL of bovine serum albumin, 100 μg / mL of human transferrin, 50 μg / mL of bean lipid, 4 × 10 ^-8 M Beta-mercaptoethanol and 2 mL of A9909 (Sigma, antibody solution). Cells are diluted in assay media to a final density of 0.25 x 106 cells / mL in 96-well low evaporation plates (Coster) to a final volume of 50 ul. The transient supernatant (conditioned medium) from the transfected colonies is added as a two-beak sample with a final concentration of 50% in a volume of 50 [mu] l and diluted 3-fold to 1.8% final dilution. A three-bead sample of the dose curve of the IL-3 variant pMON13288 starting at 1 μg / mL and diluted using a 3-fold dilution to 0.0014 μg / mL is included as a positive control standard. Process the plate in a 5% CO ₂ and warmed at 37 ℃. On the 6th day of incubation, the plates are pulsed with 0.5 Ci 3H / well (NEN) in a volume of 20 μl / well and incubated for 4 hours at 5% CO ₂ and 37 ° C. Plates are harvested and counted on a Betaplate counter.

Other in vitro cell substrate proliferation assay

Other in vitro cell assays known to those skilled in the art are also useful for determining the activity of a multifunctional hematopoietic receptor agonist that relies on a molecule of factors in a similar manner as described in AML 193.1.3 cells. Examples of other useful analyzes include:

TF1 proliferation assay: TF1 is a multipotent human cell line that responds to hIL-3 (Kitamura et al., J. Cell Physiol 140: 323-334. [1989]).

32D proliferation assay: 32D is a murine and IL-3 dependent cell line that responds to non-human G-CSF but not to human IL-3.

Baf / 3 proliferation assay: Baf / 3 is a murine and IL-3 dependent cell line that does not respond to human IL-3 or human c-mpl ligand but responds to non-restricted human G-CSF.

T1165 proliferation assay: T1165 cells are IL-6-dependent mouse cell lines (Nordan et al., 1986) that respond to IL-6 and IL-11.

Human plasma clotting meg-CSF assay: used to analyze megakaryocyte colony forming activity (Mazur et al., 1981).

Transfected cell lines:

Cell lines such as mouse and Baf / 3 cell lines may be transfected with colony stimulating factor receptors such as human G-CSF receptor or human c-mpl receptor, which do not have a cell line. This transfected cell line can be used to determine the activity of the ligand that the receptor is transfected into the cell line.

A transfected Baf / 3 cell line was made by cloning cDNA encoding c-mpl from a library made from the c-mpl reaction cell line and cloned into the multicloning site of the plasmid pcDNA3 (Invitrogen, San Diego Ca.). Baf / 3 cells were transfected with the plasmid via electroporation. Cells were grown in Wehi-conditioned medium in the presence of mouse IL-3 under G418 selection. Clones were established through limited dilution.

In a similar manner, human G-CSF receptors can be transfected with the Baf / 3 cell line and used to determine the bioactivity of a multifunctional hematopoietic receptor agonist.

Analysis of c-mpl ligand proliferative activity

Way

1. Myeloproliferative Analysis

a. CD34 + cell purification:

Bone marrow aspirate (15-20 mL) was obtained after consent from a normal allogeneic bone marrow supplier. Cells were diluted 1: 3 in phosphate buffered saline (PBS, Gibco-BRL) and 30 mL was layered on 15 mL Histopaque-1077 (Sigma) and centrifuged at 300 RCF for 30 minutes. The mononuclear layer was collected and washed in PBS. CD34 + cells were enriched from unicellular cell preparations using an affinity column as directed by the manufacturer (CellPro, Inc, Bothell WA). After enrichment, the purity of CD34 + cells was an average of 70% as determined by using flow cytometric assays using anti-CD34 monoclonal antibodies conjugated to fluorescein and anti-CD38 conjugated to picoeritrin (Becton Dickinson , San Jose).

Cells were resuspended in X-Vivo 10 medium (Bio-Whittaker, Walkersville, MD) at 40,000 cells / mL and 1 mL was plated in a 12-well tissue culture plate (Coastar). This growth factor rhIL-3 was added to several wells at 100 占 퐂 / mL (pMON5873). The hIL3 variant was used at 10 / / mL to 100 / / mL. Conditioned medium from BHK cells transfected with a plasmid encoding a coded m -pl ligand or a multifunctional hematopoietic receptor agonist was prepared by adding 100 [mu] l of supernatant added to 1 ml of culture (about 10% dilution) . Cells were warmed at 37 ° C for 8-14 days at 5% CO ₂ in a 37 ° C humidified incubator.

b. Cell harvesting and analysis:

At the end of the incubation period, total cell counts were obtained for each condition. Cells were resuspended in megakaryocyte buffer (MK buffer, 13.6 mM sodium citrate, 1 mM theophylline, 2.2 袖 PGEl, 11 mM glucose, 3% w / v BSA, pH 7.4 in PBS (Tomer et al., Blood 70 : 1735-1742, 1987) and resuspended in 500 μl of MK buffer containing anti-CD41a FITC antibody (1: 200, AMAC, Westbrook, ME) and washed in MK buffer. For DNA analysis, the cells were transferred to MK buffer containing 0.5% Tween-20 (Fisher, Fair Lawn NJ) on ice for 20 minutes, and then incubated in 0.5% Tween 20 and 1% paraformaldehyde (Fisher Chemical) After fixation, the cells were incubated with propidium iodide (Calbiochem, La Jolla Ca) (50 μg / mL) for 1-2 hours with RNA-ase (400 U / mL) in 55% v / v MK buffer (200 mOsm) . Cells were analyzed on a FACScan or Vantage flow cytometer (Becton Dickinson, San Jose, Calif.). Green fluorescence (CD41a-FITC) was collected with linear log signals for red fluorescence (PI) to determine DNA purity. All cells were harvested to determine the presence of CD41 + cells. Data analysis was performed using software by LYSIS (Becton Dickinson, San Jose, CA). Percentage of cells expressing CD41 antigen was obtained from flow cytometric analysis (percent). The absolute number (ABS) of CD41 + cells / mL was calculated as follows: (Abs) = (cell count) * (percent) / 100.

2. Analysis of megakaryocytic skin lining

Population-rich CD34 + was isolated as described above. Cells were treated with 0.3% BSA, 0.4 mg / mL apo-transferrin, 6.67-μM FeCl2, 25 μg / mL CaCl ₂ , 25 μg / mL L-aracyline, 500 μg / mL epsilon- Streptomycin was suspended at 25,000 cells / mL with or without cytokines in media consisting of primary Iscoves MIDM medium supplemented with streptomycin. Thrombin was added to the initial clot formation (0.25 units / mL) before being plated on 35 mm plates. Cells were incubated at 37 [deg.] C for 13 days in 5% CO ₂ in a humidified 37 ° C incubator.

At the end of the incubation period, the plates were fixed with methanol: acetone (1: 3), air dried and stored at -200 ° C. until staining. Peroxidase immunocytochemistry (Zymed, Histostain-SP, San Francisco, Calif.) Was used for the cocktail of the first monoclonal antibody consisting of anti-CD41a, CD42 and CD61. Were classified as negative CFU-MK (small colonies, 1-2 foci less than about 25 cells), BFU-NK (more than 25 and more multi-foci colonies) or mixed colonies (mixture of both positive and negative colonies).

Methyl cellulose analysis

This assay reflects the ability of colony-forming stimulating factors to stimulate normal bone marrow cells to elicit other forms of hematopoietic colonies in vivo [Bradleyl et al., Aust. Exp . Biol. Sci. 44: 287-300,1966 Pluznik et al., J. Cell Comp. Physio 66: 319-324, 1965).

Way

Approximately 30 mL of fresh, normal, healthy bone marrow aspirate is obtained from a human after obtaining consent. Under aseptic conditions, samples are diluted 1: 5 in 1X PBS (# 14040.059 Life Technologies, Gaithersburg, MD.) In 50 mL conical tubes (# 25339-50 Corning, Corning MD). Ficoll (Histopaque 1077 Sigma H-8889) is layered below the diluted sample and centrifuged at 300 x g for 30 minutes. Monoclonal cell populations are washed twice in 1X PBS and once in 1% BSA PBS (CellPro Co., Bothel, WA). Monoclonal cells are counted and CD34 + cells are selected using the Ceprate LC (CD34) Kit (CellPro Co., Bothel, WA) column. This nucleation is performed because all hepatocytes and progenitor cells in the bone marrow express the CD34 surface antigen.

The cultures are started in triplicate in a final volume of 1.0 mL in a 35 x 10 mm Petri dish (Nunc # 174926). The culture medium is purchased from Terry Fox Labs. (HCC-4230 medium (Yerr Fox Labs, Vancouver, BC, Canada)) and erythropoietin (Amgen, Thousand Oaks, CA.) is added to the culture medium. Add 3,000-10,000 CD34 + cells per dish. From mammalian cells or E. coli , and mammalian cells purified or transfected from a multifunctional hematopoietic receptor agonist protein in a conditioned medium from transfected mammalian cells, or purified recombinant ILs from conditioned medium from E. coli -3 is added to give a final concentration range of .001 nM to 10 nM. Recombinant hIL-3, GM-CSF, c-mpl ligand and multifunctional hematopoietic receptor agonist are provided to the house. G-CSF (Neupogen) is from Amgen (Thousand Oaks Calf.). The culture is resuspended using 3 cc shing and 1.0 mL is dispensed per dish. Control standards (baseline response) cultures did not accommodate colonization stimulating factors. Positive control standard cultures accommodate conditioned media (PHA stimulated human cells: Terry Fox Lab. H2400). The cultures are incubated at 37 ° C in 5% CO ₂ in humidified air. Hematopoietic colonies defined as larger than 50 cells are counted on a peak response day (10-11 days) using a Nikon on-field microscope combined with a 40x objective. Cells containing less than 50 cells are called clusters. Alternatively, colonies can be identified and dyed by spreading on a slide, or it can be taken and resuspended and rotated for dyeing on a cytospin slide.

Human cord blood hematopoietic growth factor analysis

Bone marrow cells are conventionally used for in vivo analysis of hematopoietic colony stimulating factor (CSF) activity. However, human bone marrow is not always available and there is considerable diversity among donors. Umbilical cord blood is similar to bone marrow as a source of hematopoietic stem cells and precursors (Broxmeyer et al., PNAS USA 89: 4109-113, 1992; Mayani et al., Blood 81: 3252-3258, 1993). Contrary to bone marrow, cord blood can be more useful as a regular source of supply. It is also possible to reduce the diversity of assays by fusing freshly obtained cells from several donors, or to make banks of cryopreserved cells for this purpose. Macrophage colony (CFU-GM), megakaryocyte CSF activity, or high proliferating latent colony forming cells (HPP-GM) by analysis of specific markers for the population and / CFC) activity.

Way

Mononuclear molecules (MNC) are isolated from the cord blood within 24 hours of collection using a standard density gradient (1.077 g / mL Histopaque). In addition, cord blood MNCs were used for CD14-, immuno-magnetic selection for CD34 + cells; Panning for the SBA-, CD34 + portion using a coated flask from Applied Immune Science (Santa Clara, CA); And CD34 + selection using the CellPro (Bothell, WA) abidin column to enrich hepatocytes and progenitor cells. Freshly isolated or cryopreserved CD34 + cell-rich portions are used for analysis. Two-well cultures for each serial dilution of the sample (concentration range from 1 pM to 1204 pM) are made in 1 x 10 4 cells in 1 ml of 0.9% AP ticellulose containing medium without the additionally proliferating DLSWK (Stem Cell Technologies, Vancouver, BC Methocult < / RTI > H4230). In some experiments, Methocult H4330 containing erythropoietin (EPO) was used instead of Methocult H4230, or Stem Cell Factor (SCF) and 50 ug / mL (Biosource International, Camarillo, CA) was added. After incubation for 7-9 days, count colonies containing> 30 cells. Record the analysis on the blinds to exclude subjective bias from the record.

Further details of recombinant DNA methods that can be used to produce variants and to express them in bacteria, mammalian cells or insect cells, purification and refolding of the desired protein and methods for determining the bioactivity of the protein can be found here In the co-filed applications WO 95/00646, WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, WO 95/21254 and US 08 / 383,035, Can be found.

Further, the detailed techniques known to those skilled in the art can be found in T. Maniatis, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory, 1982 and references cited therein, Can be found in references cited in J. Sambrook, et al., Molecular Cloning, A Laboratory Manual , 2nd edition, Cold Spring Harbor Laboratory, 1989, and references cited therein.

Table 1

Oligonucleotide

c-mplNcoI ACGTCCATGGCNTCNCCNGCNCCNCCTGCTTGTGCACTCCGAGTC

N = A, C, G, or T

Ecompl ATGCACGAATTCCCTGACGCAGAGGGTGGA

c-mplHindIII TGACAAGCTTACCTGACGCAGAGGGTGGACCCT

4L-5 'AATTCGGCAA

AL-3 'CATGTTGCCG

5L-5 'AATTCGGCGGCAA

5L-3 'CATGTTGCCGCCG

8L-5 'AATTCGGCGGCAACGGCGGCAA

8L-3 'CATGTTGCCGCCGTTGCCGCCG

31-5 'CGATCCATGGAGGTTCACCCTTTGCCT

31-3 'GATCAAGCTTATGGGCACTGGCTCAGTCT

35-5 'CGATACATGTTGCCTACACCTGTCCTG

35-3 'GATCAAGCTTAAGGGTGAACCTCTGGGCA

39-5 'CGATCCATGGTCCTGCTGCCTGCTGTG

39-3 'GATCAAGCTTAAGGTGTAGGCAAAGGGTG

43-5 'CGATCCATGGCTGTGGACTTTAGCTTGGGA

43-3 'GATCAAGCTTAAGGCAGCAGGACAGGTGT

45-5 'CGATCCATGGACTTTAGCTTGGGAGAA

45-3 'GATCAAGCTTACACAGCAGGCAGCAGGAC

49-5 'CGATCCATGGGAGAATGGAAAACCCAG

49-3 'GATCAAGCTTACAAGCTAAAGTCCACAGC

82-5 'CGATCCATGGGACCCACTTGCCTCTCA

82-3 'GATCAAGCTTACAGTTGTCCCCGTGCTGC

109-5 'CAGTCCATGGGAACCCAGCTTCCTCCA

109-3 'GATCAAGCTTAAAGGAGGCTCTGCAGGGC

116-5 'CGATCCATGGGCAGGACCACAGCTCAC

116-3 'GATCAAGCTTACTGTGGAGGAAGCTGGGTT

120-5 'CGATCCATGGCTCACAAGGATCCCAATGCC

120-3 'GATCAAGCTTATGTGGTCCTGCCCTGTGG

123-5 'CGATCCATGGATCCCAATGCCATCTTCCTG

123-3 'GATCAAGCTTACTTGTGAGCTGTGGTCCT

126-5 'CGATCCATGGCCATCTTCCTGAGCTTCCAA

126-3 'GATCAAGCTTAATTGGGATCCTTGTGAGCTGT

Llsyn.for GTTACCCTTG AGCAAGCGCA GGAACAACAG GGTGGTGGCT CTAACTGCTC TATAATGAT

Llsyn.rev CGATCATTAT AGAGCAGTTA GAGCCACCAC CCTGTTGTTC CTGCGCTTGC TCAAGG

35start.seq GATCGACCAT GGCTCTGGAC CCGAACAACC TC

34rev.seq CTCGATTACG TACAAAGGTG CAGGTGGT

70start.seq GATCGACCAT GGCTAATGCA TCAGGTATTG AG

69rev.seq CTCGATTACG TATTCTAAGT TCTTGACA

91start.seq GATCGACCAT GGCTGCACCC TCTCGACATCCE

90rev.seq CTCGATTACG TAGGCCGTGG CAGAGGGC

101start.seq GATCGACCAT GGCTGCAGGT GACTGGCAAG AA

100rev.seq CTCGATTACG TACTTGATGA TGATTGGA

L-llstart.seq GCTCTGAGAG CCGCCAGAGC CGCCAGAGGG CTGCGCAAGG TGGCGTAGAA CGCG

L-llstop.seq CAGCCCTCTG GCGGCTCTGG CGGCTCTCAG AGCTTCCTGC TCAAGTCTTT AGAG

P-blstart.seq GGGCTGCGCA AGGTGGCG

P-blstop.seq ACACCATTGG GCCCTGCCAG C

39start.seq GATCGACCAT GGCTTACAAG CTGTGCCACC CC

38stop.Seq CGATCGAAGC TTATTAGGTG GCACACAGCT TCTCCT

97start.seq GATCGACCAT GGCTCCCGAG TTGGGTCCCA CC

96stop.Seq CGATCGAAGC TTATTAGGAT ATCCCTTCCA GGGCCT

126start.seq GATCGACCAT GGCTATGGCC CCTGCCCTGC AG

125stop.Seq CGATCGAAGC TTATTATCCC AGTTCTTCCA TCTGCT

133start.seq GATCGACCAT GGCTACCCAG GGTGCCATGC CG

132stop.seq CGATCGAAGC TTATTAGGGC TGCAGGGCAG GGGCCA

142start.seq GATCGACCAT GGCTTCTGCT TTCCAGCGCC GG

141stop.Seq CGATCGAAGC TTATTAGGCG AAGGCCGGCA TGGCAC

GLYXA1 GTAGAGGGCG GTGGAGGCTC C

GLYXA2 CCGGGGAGCC TCCACCGCCC TCTAC

lGGGSfor TTCTACGCCA CCTTGCGCAG CCCGGCGGCG GCTCTGACAT GTCTACACCA TTG

lGGGSrev CAATGGTGTA GACATGTCAG AGCCGCCGCC GGGCTGCGCA AGGTGGCGTA GAA

Table 2

Gene sequence

pMON30304

pMON26458

pMON28548

pMON28500

pMON28501

pMON28502

Syntanl

Syntan3

pMON31104

pMON31105

pMON31106

pMON31107

pMON31108

pMON31109

pMON31110

pMON31111

pMON13182

pMON13183

pMON13184

pMON13185

pMON13186

pMON13187

pMON13188

pMON13189

pMON13190

pMON13191

pMON13192

pMON13193

pMON25190

pMON25191

pMON13194

pMON13195

pMON13196

pMON13197

pMON13198

pMON13199

pMON31112

pMON31113

pMON31114

pMON31115

pMON28505

pMON28506

pMON28507

pMON28508

pMON28509

pMON28510

pMON28511

pMON28512

pMON28513

pMON28514

pMON28515

pMON28516

pMON28519

pMON28520

pMON28521

pMON28522

pMON28523

pMON28524

pMON28525

pMON28526

pMON28527

pMON28528

pMON28529

pMON28530

pMON28533

pMON28534

pMON28535

pMON28536

pMON28537

pMON28538

pMON28539

pMON28540

pMON28541

pMON28542

pMON28543

pMON28544

pMON28545

pMON15981

pMON15982

pMON15965

pMON15966

pMON15967

pMON15960

PMON32132

PMON32133

pMON32134

Pmon13181

Pmon13180.Seg

Table 3

Protein sequence

pMON26458pep

pMON28548pep

pMON28500

pMON28501

pMON28502

13182.Pept

13183.Pept

13184.Pept

13185.Pept

13186.Pept

13187.Pept

13188.Pept

13189.Pept

13190.Pept

13191.Pept

13192.Pept

13193.Pept

25190.Pept

pMON25191.Pep

13194.Pept

13195.Pept

13196.Pept

13197.Pept

13198.Pept

13199.Pept

31104.Pep

31105.Pept

31106.Pep

31107.Pep

31108.Pep

31109.Pep

31110.Pep

31111.Pep

pMON15981

pMON15982

pMON15965

pMON15966

pMON15967

pMON31112.pep

pMON31113.pep

pMON31114.pep

pMON31115.pep

pMON28505

pMON28506

pMON28507

pMON28508

pMON28509

pMON28510

pMON28511

pMON28512

pMON28513

pMON28514

pMON28515

pMON28516

pMON28519

pMON28520

pMON28521

pMON28522

pMON28523

pMON28524

pMON28525

pMON28526

pMON28527

pMON28528

pMON28529

pMON28530

pMON28533

pMON28534

pMON28535

pMON28536

pMON28537

pMON28538

pMON28539

pMON28540

pMON28541

pMON28542

pMON28543

pMON28544

pMON28545

pMON32132

PMON32133

PMON32134

The following examples illustrate the invention in more detail but it will be understood that it is not limited to these specific examples.

Example 1

Assembly of pro-BHK expression vector

A. Removal of the AflIII site from the mammalian expression plasmid

The new mammalian expression vector was assembled to accommodate the NcoI-HindIII or AflII-HindIII gene fragment in frame and the 3 'and mouse IgG2b linker fragments to the hIL-3 receptor agonist pMON13146 (WO 94/12638) gene. First, the single AflIII site was removed from pMON3934, a derivative of pMON3359. pMON3359 is a pUC18-based vector containing mammalian expression cassettes. Cassettes include the SV40 late poly-adenylated (poly-A) signal subcloned with the pox18 polylinker and the human IL-3 signal peptide sequence following the simple shingles virus promoter IE110 (-800 to +120) (Hippenmeyer et al., Bio / Technology, 1993, pp. 1037-1041). The denatured human IL-3 signal sequence, which promotes the secretion of the gene product to the cell periphery, is located on the 5'-terminal BamHI site and the only NocI side on the 3'-terminal. The unique HindIII site is at 3 'for the NcoI site and 5' for the poly-A sequence. The DNA sequence coding for the signal peptide is shown below (restriction enzyme sites are shown above). The ATG (methionine) codon in the NcoI site is in the initiator ATG (underlined) of the in-frame signal peptide.

The signal AflIII site was removed from pMON3934 by digestion with AflII and then filled into the protrusions by addition of DNA polymerase and nucleotides.The digested DNA fragment was purified through Magic PCR Clean up kit (Promaga) and T4 DNA ligase ligation . Transformed with the ligation reaction into DH5α ^TM and the cells were plated on LB- Agar with ampicillin. Each colony was screened for the loss of the AflIII site by restriction analysis with AflIII and HindIII that resulted in a single fragment if the AfllIII site was removed. The resulting plasmid was designated pMON30275.

B. Transfer of the hIL-3 receptor agonist pMON13416 / IgG2b cassette to pMON30275

The NcoI-HindIII fragment (ca. 425 bp) from pMON30245 was ligated to the NcoI-HindIII fragment (ca. 3800 bp) of pMON30275. pMON30245 (WO 94/12638) contains the gene coding for the hIL-3 receptor agonist pMON13416 linked to the mouse IgG2b hinge fragment. 3 ' for the IgG2b hinge and 5 ' for the HindIII site in close contact. The gene can be cloned into the AflIII-HindIII site as a NcoI-HindIII or AflIII-HindIII fragment in the frame with the hIL-3 mutant pMON13416 / IgG2b hinge to produce a new chimera. The NcoI and AflIII sites have conformity protrusions and will ligation but lose both recognition sites. PMON30304, a plasmid containing the DNA sequence of SEQ ID NO: 78 coding for the hIL-3 variant pMON13416 linked to the mouse IgG2b hinge region, was the result of this cloning.

Example 2

Assembly of intermediate plasmids containing one copy of the c-mpl ligand (1-153) gene of the dimeric template

The gene was isolated by reverse transcriptase / polymerase chain reaction (RT / PCR) to generate plasmid DNA as the coding sequence for the unique EcoRI restriction site following the c-mpl (1-153) ligand. Human fetus (lot # 38130) and adult (lot # 46018) A + RNA were obtained from Clontech (Palo Alto, CA) for the source of c-mpl ligand messenger RNA (mRNA). The first strand cDNA reaction was performed using the cDNA Cycle ^TM Kit from Invitrogen (San Diego, Calif.). In the RT reaction, arbitrary primers and oligo dT primers were used to generate cDNA from a combination of human and fetal mRNA. For amplification of the c-mpl ligand gene fragment encoding amino acid 1-153, the RT product was used as a template for PCR with primer combination: forward primer: c-mplNcoI of SEQ ID NO: 13 and reverse primer: Ecompl. The c-mplNcoI primer was annealed to a base # 279-311 based on the c-mpl ligand sequence (gene bank deposit # L33410 or de Sauvage et al., Nsture 369: 533-538 (1994) Which encodes the Nco I restriction site in close contact with the 5 'to the first codon (Ser + 1) of the c-mpl ligand. The Nco I restriction site encodes for the methionine and alanine codons before Ser + 1 and includes codon degeneration for the Ala codon and the first four codons (Ser, Pro, Ala, and Pro) of the c-mpl ligand. The Ecompl primer was annealed to base # 720-737 of the c-mpl ligand, which codes for the EcoRI site (GAATTC) with the following c-mpl ligand gene clinging to Arg-153 in the frame. The EcoRI site generates the Glu and Phe codons after Arg-153. ca. The 480 bp PCR product was purified, digested with NcoI and EcoRI, and ligated into the NcoI-EcoRI vector fragment of pMON3993 (ca. 4550 bp). pMON3993 was a derivative of pMON3359 (described in Example 1). The human IL-3 signal peptide sequence subcloned into the unique BamHI site between the IE110 promoter and the poly-A signal as a BamHI fragment contains the NcoI site at its 3 'end and then the unique EcoRI site. The plasmid pMON26458 containing the DNA sequence of SEQ ID NO: 79 coding for the c-mpl ligand amino acid 1-153 of SEQ ID NO: 161 was the product of this cloning.

Example 3

Assembly of the parent plasmid containing the second gene of the dimeric template

For amplification of the c-mpl ligand gene fragment starting at amino acid 1 (Ser) with the following termination codon at amino acid 153 (ARG), the RT reaction from Example 2 was combined with the following primers: c-mplNcoI of SEQ ID NO: 13 Primer) and c-mplHindIII (reverse primer) of SEQ ID NO: 15 as a template for PCR. The c-mplNcoI primer of SEQ ID NO: 13 is described in Example 2. [ The c-mplHindlll primer of SEQ ID NO: 15 annealed to base # 716-737 of the c-mpl ligand is added with all of the following Hindlll restriction sites attached to the end codon and Arg ¹⁵³ as the last codon.

Two types of PCR products were generated from RT cDNA samples lacking codons for amino acids 112-115 and those lacking this codon. The c-mpl ligand PCR product (ca. 480 bp) was digested with NcoI and HindIII restriction enzymes to transfer to the mammalian expression vector pMON3934. pMON3934 was digested with NcoI and HindIII (ca. 3800 bp), which will accommodate the PCR product.

PMON32132 of SEQ ID NO: 242, which is a plasmid coding for the c-mpl ligand amino acid 1-153 of SEQ ID NO: 252, was the result of this cloning. PMON32134 of SEQ ID NO: 253, which is a plasmid coding for the c-mpl ligand amino acid 1-153, was the result of this cloning. PMON32133 of SEQ ID NO: 251, which is a plasmid coding for c-mpl ligand amino acid 1-153 lacking codon 112-115 (? 112-115) of SEQ ID NO: 254, was also the result of this cloning.

Example 4

Generation of 5 L of PCR dimer template lacking Δ 112-115 in the second c-mpl ligand gene

A PCR template for generating a new form of c-mpl ligand was prepared from pMON32133 (lacking amino acids 112-115) with 5L-5 'of SEQ ID NO: 18 and 5L-3'of SEQ ID NO: 18 of the EcoRI / AflIII 5L synthetic oligonucleotide linker Of the 3.7 Kbp Bst X I / Eco RI fragment of pMON26458 was ligated to the 1 Kbp Nco I / Bst X I fragment of pMON26458.

The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32133 and the restriction site will not retain ligation. The Bst X I site of pMON32133 and pMON26458 will also ligate. The plasmid pMON28548 is the result of the cloning and contains the amino acid 1-153 c-mpl ligand without the amino acid 112-115 of SEQ ID NO: 162 and the DNA of SEQ ID NO: 80 encoding the amino acid 1-153 c-mpl ligand fused through the GluPheGlyGlyAsnMetAla linker of SEQ ID NO: Lt; / RTI >

Example 5

Generation of PCR dimer template 4L

A PCR template for generating a new form of c-mpl ligand was ligated with 1 Kbp NcoI / BstXI fragment from pMON32132 with 4L-5 'of SEQ ID NO: 16 and 4L-3'of SEQ ID NO: 17 of the EcoRI / AflIII 4L synthetic oligonucleotide linker Lt; / RTI > fragment of pMON26458 by ligation.

The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32132 and the restriction site will not be ligation maintained. The Bst X I site of pMON26458 and pMON32132 will also ligate. The plasmid pMON28500 is the result of the cloning and contains the DNA sequence of SEQ ID NO: 82 encoding the amino acid 1-153 c-mpl ligand fused to the amino acid 1-153 c-mpl ligand of SEQ ID NO: 163 via the GluPheGlyAsnMetAla linker (4L) do.

Example 6

Generation of PCR dimer template 5L

The PCR template for generating a new form of c-mpl ligand was ligated with the 1 Kbp NcoI / BstXI fragment from pMON32132 along with 5L-5 'of SEQ ID NO: 18 and 5L-3'of SEQ ID NO: 19 of the EcoRI / AflIII 5L synthetic oligonucleotide linker Lt; / RTI > fragment of pMON26458 by ligation.

The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflIII end of the linker will ligate to the NcoI site of pMON32132 and the restriction site will not be ligation maintained. The Bst X I site of pMON26458 and pMON32132 will also ligate. The plasmid pMON28501 is the result of the cloning and contains the DNA sequence of SEQ ID NO: 82 encoding the amino acid 1-153 c-mpl ligand fused to the amino acid 1-153 c-mpl ligand of SEQ ID NO: 164 through the GluPheGlyGlyAsnMetAla linker (5L) do.

Example 7

Generation of PCR dimer template 8L

A PCR template for generating a new form of c-mpl ligand was constructed by ligating 1 Kbp NcoI / BstXI fragment from pMON32134 with 8L-5 'of SEQ ID NO: 20 and 8L-3'of SEQ ID NO: 21 of the EcoRI / AflIII 8L synthetic oligonucleotide linker Lt; / RTI > fragment of pMON26458 by ligation.

The EcoRI end of the linker will ligate to the EcoRI end of pMON26458. The AflII end of the linker will ligate to the NcoI site of pMON32134 and the restriction site will not retain the ligation. The Bst X I sites of pMON26458 and pMON32134 will also ligate. The plasmid pMON28502 is the result of the cloning containing the DNA sequence of SEQ ID NO: 83, which contains the amino acid 1-153 c-mpl ligand fused through the GluPheGlyGlyAsnGlyGlyAsnMetAla linker (8L) of SEQ ID NO: 224 to the amino acid 1-153 c- ≪ / RTI >

Examples 8-44

Generation of new c-mpl ligand genes with new N-terminal and C-terminal

A. PCR generation of a gene encoding a novel c-mpl ligand receptor agonist

Genes encoding new c-mpl ligand receptor agonists were generated using Metchod III (Horlick et al., Prot. Eng. 5: 427-433, 1992). PCR reaction was performed with a set of one of the dimeric templates, pMONs 28500, 28501 28502 or 28548, and the following set of primer primers (the first number refers to the position of the first amino acid in the original sequence, for example 31-5 ' -3 'refers to a 5' and 3 'oligo primer for sequences starting at the codon corresponding to residue 31 of the original sequence.

(SEQ ID NO: 22) 35-3 '(SEQ ID NO: 26) 39-5' and (SEQ ID NO: 27) 39-3 ' (SEQ ID NO: 28) 43-5 'and (SEQ ID NO: 29) 43-3' (SEQ ID NO: 30) 45-5 'and (SEQ ID NO: 31) 45-3' 3 '(SEQ ID NO: 34) 82-5' and (SEQ ID NO: 35) 82-3 '(SEQ ID NO: 36) 109-5' -3 '(SEQ ID NO: 40) 120-5' and (SEQ ID NO: 41) 120-3 '(SEQ ID NO: 42) 123-5' 126-3 '

B. Subcloning of the new c-mpl receptor agonist gene product into a mammalian expression vector for the generation of chimeras

The c-mpl receptor agonist gene PCR product was digested with NcoI and HindIII or AflIIII and HindIII restriction enzymes (ca. 470 bp) to transfer to mammalian expression vectors. The expression vector, pMON30304, was digested with NcoI and HindIII (ca. 4200 bp), which contains the NcoI-HindIII or AflIII-HindIII fragment as a PCR product. The restriction digests of the PCR products and the resulting plasmids are shown in Table 4.

Example # PCR template PCR product primer set PCR product restriction digestion Linker The resulting plasmid pMON Breakpoints in c-mpl ligands Example 8 pMON28501 31 NcoI / HindIII 5L 28505 30-31 Example 9 pMON28501 35 AflIII / HindIII 5L 28506 34-35 Example 10 pMON28501 39 NcoI / HindIII 5L 28507 38-39 Example 11 pMON28501 43 NcoI / HindIII 5L 28508 42-43 Example 12 pMON28501 45 NcoI / HindIII 5L 28509 44-45 Example 13 pMON28501 49 NcoI / HindIII 5L 28510 48-49 Example 14 pMON28501 82 NcoI / HindIII 5L 28511 81-82 Example 15 pMON28501 109 NcoI / HindIII 5L 28512 108-109 Example 16 pMON28501 116 NcoI / HindIII 5L 28513 115-116 Example 17 pMON28501 120 NcoI / HindIII 5L 28514 119-120 Example 18 pMON28501 123 NcoI / HindIII 5L 28515 122-123 Example 19 pMON28501 126 NcoI / HindIII 5L 28516 125-126 Example 20 pMON28500 31 NcoI / HindIII 4L 28519 30-31 Example 21 pMON28500 35 AflIII / HindIII 4L 28520 34-35 Example 22 pMON28500 39 NcoI / HindIII 4L 28521 38-39 Example 23 pMON28500 43 NcoI / HindIII 4L 28522 42-43 Example 24 pMON28500 45 NcoI / HindIII 4L 28523 44-45 Example 25 pMON28500 49 NcoI / HindIII 4L 28524 48-49 Example 26 pMON28500 82 NcoI / HindIII 4L 28525 81-82 Example 27 pMON28500 109 NcoI / HindIII 4L 28526 108-109 Example 28 pMON28500 116 NcoI / HindIII 4L 28527 115-116 Example 29 pMON28500 120 NcoI / HindIII 4L 28528 119-120 Example 30 pMON28500 123 NcoI / HindIII 4L 28529 122-123 Example 31 pMON28500 126 NcoI / HindIII 4L 28530 125-126 Example 32 pMON28502 31 NcoI / HindIII 8L 28533 30-31 Example 33 pMON28502 35 AflIII / HindIII 8L 28534 34-35 Example 34 pMON28502 39 NcoI / HindIII 8L 28535 38-39 Example 35 pMON28502 43 NcoI / HindIII 8L 28536 42-43

Example # PCR template PCR product primer set PCR product restriction digestion Linker The resulting plasmid pMON Breakpoints in c-mpl ligands Example 36 pMON28502 45 NcoI / HindIII 8L 28537 44-45 Example 37 pMON28502 49 NcoI / HindIII 8L 28538 48-49 Example 38 pMON28502 82 NcoI / HindIII 8L 28539 81-82 Example 39 pMON28502 109 NcoI / HindIII 8L 28540 108-109 Example 40 pMON28502 116 NcoI / HindIII 8L 28541 115-116 Example 41 pMON28502 120 NcoI / HindIII 8L 28542 119-120 Example 42 pMON28502 123 NcoI / HindIII 8L 28543 122-123 Example 43 pMON28502 126 NcoI / HindIII 8L 28544 125-126 Example 44 pMON28548 123 NcoI / HindIII 5L 28545 122-123

Example 45

Assembly of pMON15960

The new assembly of the N- terminus and pMON15960 is an intermediate plasmid used for assembling a plasmid containing a DNA sequence cloned G-CSF SeR ¹⁷ having a C- terminal. Plasmid pACYC177 (Chang, ACY and Cohen, SN J. Bacteriol . 134: 1141-1156, 1978) DNA was digested with restriction enzymes HindIII and BamHI which induce 3092 bp HindIII, BamHI fragment. The plasmid pMON13037 (WO 95/21254), DNA was digested with 616 base pairs Bgl II, Bgl II and Fsp I resulting in Fsp I fragment. The plasmid pMON13037, a second sample of DNA, was digested with NcoI and HindIII to generate a 556 base pair NcoI, HindIII fragment. 1GGSfor of SEQ ID NO: 76 of the synthetic DNA oligonucleotide and 1GGGSrev of SEQ ID NO: 77 were each annealed and then digested with AflIIII and FspI which resulted in a 21 base pair AflIII, FspI fragment. The restriction fragment was ligated and the ligation reaction mixture was transferred to E. coli K -12 < / RTI > strain JM101. Transgenic bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis to identify the appropriate insert.

Example 46

Assembly of pMON15981

Assembly of pMON15981, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist. The plasmid pMON15960, the DNA was digested with restriction enzyme SmaI and used as a template in the PCR reaction using 38 Start of SEQ ID NO: 65 and 39 Start of SEQ ID NO: 64 as a primer to cause amplification of a 576 base pair DNA fragment. The amplified fragment was digested with restriction enzymes HindIII and NcoI, which resulted in a 558 bp HindIII, NcoI fragment. The plasmid pMON13181 and the DNA were digested with HindIII and AfIIIII to generate 4068 base pairs HindIII and AfIIIII fragment. Restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transgenic bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis and sequenced to identify suitable inserts. The plasmid pMON15981 contains the DNA sequence of SEQ ID NO: 155 encoding the following amino acid sequence:

(SEQ ID NO: 195)

Example 47

Assembly of pMON15982

Assemble pMON15982, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist. The plasmid pMON15960, DNA was digested with restriction enzyme SmaI and used as a template in the PCR reaction using 97Start of SEQ ID NO: 67 and 97Start of SEQ ID NO: 66 as a primer for amplification of a 576 base pair DNA fragment. The amplified fragment was digested with restriction enzymes HindIII and NcoI, which resulted in a 558 bp HindIII, NcoI fragment. The plasmid pMON13181 and the DNA were digested with HindIII and AfIIIII to generate 4068 base pairs HindIII and AfIIIII fragment. Restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transgenic bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis and sequenced to identify suitable inserts. The plasmid pMON15982 contains the DNA sequence of SEQ ID NO: 157 which encodes the following amino acid sequence:

(SEQ ID NO: 196)

Example 48

Assembly of pMON15965

Assemble pMON15965, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist. The plasmid pMON15960, DNA was digested with restriction enzyme SmaI and used as a template in the PCR reaction using 142 Start of SEQ ID NO: 73 and 141 Start of SEQ ID NO: 72 as a primer to cause amplification of a 576 base pair DNA fragment. The amplified fragment was digested with restriction enzymes HindIII and NcoI, which resulted in a 558 bp HindIII, NcoI fragment. The plasmid pMON13181 and the DNA were digested with HindIII and AfIIIII to generate 4068 base pairs HindIII and AfIIIII fragment. Restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transgenic bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis and sequenced to identify suitable inserts. The plasmid pMON15965 contains the DNA sequence of SEQ ID NO: 157 which encodes the following amino acid sequence:

(SEQ ID NO: 196)

Example 49

Assembly of pMON15966

Assemble pMON15966, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist. The plasmid pMON15960, DNA was digested with restriction enzyme SmaI and used as a template in a PCR reaction using 126 Start of SEQ ID NO: 68 and 125 Start of SEQ ID NO: 69 as a primer to cause amplification of a 576 base pair DNA fragment. The amplified fragment was digested with restriction enzymes HindIII and NcoI, which resulted in a 558 bp HindIII, NcoI fragment. The plasmid pMON13181 and the DNA were digested with HindIII and AfIIIII to generate 4068 base pairs HindIII and AfIIIII fragment. Restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transgenic bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis and sequenced to identify suitable inserts. The plasmid pMON15966 contains the DNA sequence of SEQ ID NO: 158 encoding the following amino acid sequence:

(SEQ ID NO: 198)

Example 50

Assembly of pMON15967

Assemble pMON15967, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist. The plasmid pMON15960, DNA was digested with restriction enzyme SmaI and used as a template in the PCR reaction using 132 Start of SEQ ID NO: 71 and 133 Start of SEQ ID NO: 70 as a primer that caused amplification of a 576 base pair DNA fragment. The amplified fragment was digested with restriction enzymes HindIII and NcoI, which resulted in a 558 bp HindIII, NcoI fragment. The plasmid pMON13181 and the DNA were digested with HindIII and AfIIIII to generate 4068 base pairs HindIII and AfIIIII fragment. Restriction fragments were ligated and the ligation reaction mixture was used to transform E. coli K-12 strain JM101. Transgenic bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis and sequenced to identify suitable inserts. The plasmid pMON15967 contains the DNA sequence of SEQ ID NO: 159 encoding the following amino acid sequence:

Example 51

The assembly of pMON13180, an intermediate plasmid used to assemble plasmids containing DNA sequences encoding multifunctional hematopoietic receptor agonists

Plasmid pMON13046 (WO 95/21254), DNA digested with restriction endonuclease XmaI and SnaBI resulted in a 4018 base pair vector fragment. The 4018 base pair XmaI-SnaBI fragment was purified using a Magic DNA Clean-up System kit (Promega, Madison, WI) in which the 25 base pair XmaI-SnaBI insert was not retained. The glyxal of SEQ ID NO: 74 and glyxa2 of SEQ ID NO: 75, which are complementary pairs of synthetic oligonucleotides, were designed to eliminate sequences encoding the Factor Xa cleavage site. When properly assembled, these oligonucleotides also become XmaI and SnaBI ends. The primers glyxal and glyxa2 were heated for 10 minutes at 70 ° C and annealed in annealing buffer (20 mM Tris-HCl pH 7.5, 10 mM MgCl ₂ , 50 mM NaCl) and slowly cooled. The 4018 base pair XmaI-SnaBI fragment from pMON13046 was ligated with assembled oligonucleotides using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated from the transgenic plants and analyzed by PCR analysis. Plasmid DNA from selected transgenic lines was sequenced to identify correct inserts of oligonucleotides. The resulting plasmid was designated pMON13180 and contains the DNA sequence of sequence **.

Example 52

The assembly of pMON13181, an intermediate plasmid used to assemble plasmids containing DNA sequences encoding multifunctional hematopoietic receptor agonists

The plasmid pMON13047 (WO 95/21254), DNA was digested with restriction endonuclease XmaI and SnaBI, resulting in a 4063 base pair vector fragment. The 4063 base pair XmaI-SnaBI fragment was purified using a Magic DNA Clean-up System kit (Promega, Madison, WI) in which the 25 base pair XmaI-SnaBI insert was not retained. The glyxal of SEQ ID NO: 74 and glyxa2 of SEQ ID NO: 75, which are complementary pairs of synthetic oligonucleotides, were designed to eliminate sequences coding for the Factor Xa cleavage site. When properly assembled, these oligonucleotides also become XmaI and SnaBI ends. glyxa1 and glyxa2 were annealed in annealing buffer by heating at 70 DEG C for 10 minutes and then slowly cooled. The 4063 base pair XmaI-SnaBI fragment from pMON13047 was ligated with assembled oligonucleotides using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated from transgenic plants and analyzed using PCR-based assays. Plasmid DNA from selected transgenic lines was sequenced to identify correct inserts of oligonucleotides. The resulting plasmid was designated pMON13181 and contains the DNA sequence of sequence **.

Example 53

Assembly of pMON13182

Method I described in Materials and Methods was used to produce a new N-terminal / C-terminal gene in pMON13182. The primer set 39 start of SEQ ID NO: 64 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A short stop was produced from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 38 stop of SEQ ID NO: 65 and the L-11 stop of SEQ ID NO: 61 and amplified. The full-length new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was generated and amplified from the annealed fragment start and stop using primers 39 start and 38 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid, pMON13180, was digested with restriction endonuclease HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13182.

E. coli strain JM101 was transformed with pMON13182 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13182 contains the DNA sequence of SEQ ID NO: 94 encoding the following amino acid sequence:

(SEQ ID NO: 166)

Example 54

Assembly of pMON13183

A new N-terminal / C-terminal gene in pMON13183 was produced using Method I described in Materials and Methods. A " fragment start " sequence was generated and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 39 primers set SEQ ID NO: 64 start and L-11 start SEQ ID NO: A short stop was produced from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 38 stop of SEQ ID NO: 65 and the L-11 stop of SEQ ID NO: 61 and amplified. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 39 start and 38 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13183.

E. coli strain JM101 was transformed with pMON13183 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13183 contains the DNA sequence of SEQ ID NO: 95 encoding the following amino acid sequence:

(SEQ ID NO: 167)

Example 55

Assembly of pMON13184

A new N-terminal / C-terminal gene in pMON13184 was produced using Method I described in Materials and Methods. The primer set 97 start of SEQ ID NO: 66 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 96 stop of SEQ ID NO: 67 and the L-11 stop of SEQ ID NO: 61 and amplified. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 97 start and 96 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13184.

E. coli strain JM101 was transformed with pMON13184 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13184 contains the DNA sequence of SEQ ID NO: 96 encoding the following amino acid sequence:

(SEQ ID NO: 168)

Example 56

Assembly of pMON13185

A new N-terminal / C-terminal gene in pMON13185 was produced using Method I described in Materials and Methods. The primer set 97 start of SEQ ID NO: 66 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 96 stop of SEQ ID NO: 67 and the L-11 stop of SEQ ID NO: 61 and amplified. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 97 start and 96 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13185.

E. coli strain JM101 was transformed with pMON13185 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13185 contains the DNA sequence of SEQ ID NO: 67 encoding the following amino acid sequence:

(SEQ ID NO: 169)

Example 57

Assembly of pMON13186

A new N-terminal / C-terminal gene in pMON13186 was produced using Method I described in Materials and Methods. The primer set 126 start of SEQ ID NO: 68 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A short stop was produced and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 125 stop of SEQ ID NO: 69 and L-11 stop of SEQ ID NO: 61. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 126 start and 125 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13186.

E. coli strain JM101 was transformed with pMON13186 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13186 contains the DNA sequence of SEQ ID NO: 98 encoding the following amino acid sequence:

(SEQ ID NO: 170)

Example 58

Assembly of pMON13187

A new N-terminal / C-terminal gene in pMON13187 was produced using Method I described in Materials and Methods. The primer set 126 start of SEQ ID NO: 68 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A short stop was produced and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 125 stop of SEQ ID NO: 69 and L-11 stop of SEQ ID NO: 61. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 126 start and 125 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13187.

E. coli strain JM101 was transformed with pMON13187 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13187 contains the DNA sequence of SEQ ID NO: 99 encoding the following amino acid sequence:

(SEQ ID NO: 171)

Example 59

Assembly of pMON13188

A new N-terminal / C-terminal gene in pMON13188 was produced using Method I described in Materials and Methods. The primer set 133 start of SEQ ID NO: 70 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using 132 stop of SEQ ID NO: 71 and L-11 stop of SEQ ID NO: 61 and amplified. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 133 start and 132 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13188.

E. coli strain JM101 was transformed with pMON13188 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13188 contains the DNA sequence of SEQ ID NO: 100 encoding the following amino acid sequence:

(SEQ ID NO: 172)

Example 60

Assembly of pMON13189

A new N-terminal / C-terminal gene in pMON13189 was produced using Method I described in Materials and Methods. The primer set 133 start of SEQ ID NO: 70 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using 132 stop of SEQ ID NO: 71 and L-11 stop of SEQ ID NO: 61 and amplified. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 133 start and 132 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13189.

E. coli strain JM101 was transformed with pMON13189 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON13189 contains the DNA sequence of SEQ ID NO: 101 encoding the following amino acid sequence:

(SEQ ID NO: 173)

Example 61

Assembly of pMON13190

A new N-terminal / C-terminal gene in pMON13190 was produced using Method I described in Materials and Methods. The primer set 142 start of SEQ ID NO: 72 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. The short stop was generated and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 141 stop of SEQ ID NO: 73 and L-11 stop of SEQ ID NO: 61. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 142 start and 141 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13190.

E. coli strain JM101 was transformed with pMON13190 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13190 contains the DNA sequence of SEQ ID NO: 102 encoding the following amino acid sequence:

(SEQ ID NO: 174)

Example 62

Assembly of pMON13191

A new N-terminal / C-terminal gene in pMON13191 was produced using Method I described in Materials and Methods. The primer set 142 start of SEQ ID NO: 72 and L-11 start of SEQ ID NO: 60 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. The short stop was generated and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 141 stop of SEQ ID NO: 73 and L-11 stop of SEQ ID NO: 61. The new full-length N-terminal / C-terminal G-CSF Ser ¹⁷ gene was produced and amplified from annealed fragment start and stop using 142 start and 141 stop.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and HindIII and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON13191.

E. coli strain JM101 was transformed with pMON13191 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON13191 contains the DNA sequence of SEQ ID NO: 103 encoding the following amino acid sequence:

(SEQ ID NO: 175)

Example 63

Assembly of pMON13192

A new N-terminal / C-terminal gene in pMON13192 was produced using Method II described in Materials and Methods. The primer set 39 start of SEQ ID NO: 64 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. 38 stop of SEQ ID NO: 65 and P-bl stop of SEQ ID NO: 63 were used to produce and amplify a short stop from the G-CSF Ser ¹⁷ sequence in pMON13037. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13192.

E. coli strain JM101 was transformed with pMON13192 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON13192 contains the DNA sequence of SEQ ID NO: 104 encoding the following amino acid sequence:

13192.Pept

(SEQ ID NO: 176)

Example 64

Assembly of pMON13193

A new N-terminal / C-terminal gene in pMON13193 was produced using Method II described in Materials and Methods. The primer set 39 start of SEQ ID NO: 64 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. 38 stop of SEQ ID NO: 65 and P-bl stop of SEQ ID NO: 63 were used to produce and amplify a short stop from the G-CSF Ser ¹⁷ sequence in pMON13037. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13193.

E. coli strain JM101 was transformed with pMON13193 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13193 contains the DNA sequence of SEQ ID NO: 105 encoding the following amino acid sequence:

(SEQ ID NO: 177)

Example 65

Assembly of pMON25190

A new N-terminal / C-terminal gene in pMON25190 was produced using Method II described in Materials and Methods. The primer set 97 start of SEQ ID NO: 66 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 96 stop of SEQ ID NO: 67 and the P-bl stop of SEQ ID NO: 63, and amplified. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON25190.

E. coli strain JM101 was transformed into pMON25190 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON25190 contains the DNA sequence of SEQ ID NO: 106 encoding the following amino acid sequence:

(SEQ ID NO: 178)

Example 66

Assembly of pMON25191

A new N-terminal / C-terminal gene in pMON25191 was produced using Method II described in Materials and Methods. The primer set 97 start of SEQ ID NO: 66 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using a primer set 96 stop of SEQ ID NO: 98 and a P-bl stop of SEQ ID NO: 63 and amplified. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON25191.

E. coli strain JM101 was transformed with pMON25191 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON25191 contains the DNA sequence of SEQ ID NO: 107 encoding the following amino acid sequence:

(SEQ ID NO: 179)

Example 67

Assembly of pMON13194

A new N-terminal / C-terminal gene in pMON13194 was produced using Method II described in Materials and Methods. The primer set 126 start of SEQ ID NO: 68 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A stop stop was generated from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 125 stop of SEQ ID NO: 67 and the P-bl stop of SEQ ID NO: 63 and amplified. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13194.

E. coli strain JM101 was transformed with pMON13194 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON13194 contains the DNA sequence of SEQ ID NO: 108 encoding the following amino acid sequence:

(SEQ ID NO: 180)

Example 68

Assembly of pMON13195

A new N-terminal / C-terminal gene in pMON13195 was produced using Method II described in Materials and Methods. The primer set 126 start of SEQ ID NO: 68 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A short stop was produced and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 125 stop of SEQ ID NO: 69 and P-bl stop of SEQ ID NO: 63. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above-mentioned intermediate plasmid contained a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13195.

E. coli strain JM101 was transformed with pMON13195 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13195 contains the DNA sequence of SEQ ID NO: 109 encoding the following amino acid sequence:

(SEQ ID NO: 181)

Example 69

Assembly of pMON13196

A new N-terminal / C-terminal gene in pMON13196 was produced using Method II described in Materials and Methods. The primer set 133 start of SEQ ID NO: 70 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF sequence in pMON13037. A short stop was produced and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 132 stop of SEQ ID NO: 71 and P-bl stop of SEQ ID NO: 63. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13196.

E. coli strain JM101 was transformed with pMON13196 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13196 contains the DNA sequence of SEQ ID NO: 110 encoding the following amino acid sequence:

(SEQ ID NO: 182)

Example 70

Assembly of pMON13197

A new N-terminal / C-terminal gene in pMON13197 was produced using Method II described in Materials and Methods. The primer set 133 start of SEQ ID NO: 70 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. A short stop was produced and amplified from the G-CSF Ser ¹⁷ sequence in pMON13037 using 132 stop of SEQ ID NO: 71 and P-bl stop of SEQ ID NO: 63. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13197.

E. coli strain JM101 was transformed with pMON13197 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON13197 contains the DNA sequence of SEQ ID NO: 111 encoding the following amino acid sequence:

(SEQ ID NO: 183)

Example 71

Assembly of pMON13198

A new N-terminal / C-terminal gene in pMON13198 was produced using Method II described in Materials and Methods. The primer set 142 start of SEQ ID NO: 72 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. The short stop was produced from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 141 stop of SEQ ID NO: 73 and the P-bl stop of SEQ ID NO: 63 and amplified. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13180 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4023 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13198.

E. coli strain JM101 was transformed with pMON13198 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13198 contains the DNA sequence of SEQ ID NO: 112 encoding the following amino acid sequence:

(SEQ ID NO: 184)

Example 72

Assembly of pMON13199

A new N-terminal / C-terminal gene in pMON13199 was produced using Method II described in Materials and Methods. The primer set 142 start of SEQ ID NO: 72 and P-bl start of SEQ ID NO: 62 were used to generate and amplify the fragment start from the G-CSF Ser ¹⁷ sequence in pMON13037. The short stop was produced from the G-CSF Ser ¹⁷ sequence in pMON13037 using the primer set 141 stop of SEQ ID NO: 73 and the P-bl stop of SEQ ID NO: 63 and amplified. The fragment start was digested with restriction endonuclease NcoI, and the short stop was digested with restriction endonuclease HindIII. After purification, the digested fragment start and stop were combined with approximately 3800 base pairs of pMON3934 NcoI-HindIII vector fragments and ligated.

The above intermediate plasmid contained the new N-terminal / C-terminal G-CSF Ser ¹⁷ gene of the whole length and digested with restriction endonuclease NcoI and HindIII. Digested DNA was dissolved in 1% TAE gel, stained with ethidium bromide and a new N-terminal / C-terminal G-CSF Ser ¹⁷ gene was isolated using Geneclean (Bio101, Vista, Calif.). The intermediate plasmid pMON13181 was digested with restriction endonucleases HindIII and AflIII, resulting in a 4068 base pair vector fragment and purified using the Magic DNA Clean-up System kit (Promega, Madison, Wis.). The purified restriction fragments were combined and ligated using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). A portion of the ligation reaction was used to transform E. coli strain DH5a cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert of the new gene. The resulting plasmid was designated pMON13199.

E. coli strain JM101 was transformed with pMON13199 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON13199 contains the DNA sequence of SEQ ID NO: 113 encoding the following amino acid sequence:

(SEQ ID NO: 185)

Example 73

Assembly of Syntan1, a tandemly-duplicated plasmid template

In order to produce syntan1, a serially-redundant hIL-3 receptor agonist pMON13416 template, three DNAs were ligated by T4 DNA ligase (Boehringer Mannheim). The three DNAs are: 1) pMON13046 containing the hIL-3 receptor agonist pMON13416 and digested with BstEII and SnaBI; 2) an annealed complementary pair of synthetic oligonucleotides containing a sequence encoding a linker connecting the C-terminal and N-terminal ends of the original protein and a small amount of surrounding pMON13416 sequence and, when properly assembled, to the BstEII and C1aI ends L1syn.for of SEQ ID NO: 48 and L1syn.rev of SEQ ID NO: 49; 3) pMON13046 is part of the hIL-3 receptor agonist pMON13416, which is C1aI (DNA is grown in dam-cell DM1 (Life Technologies)) and SnaBI. The digested DNA was dissolved in 0.9% TAE gel, stained with ethidium bromide and separated using Geneclean (Bio101).

A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Miniprep DNA was isolated from transgenic plants and the transformants were screened using PCR-based assays. Plasmid DNA from selected transgenic lines was sequenced to obtain the correct template. The resulting plasmid was designated syntan1 and contains the DNA sequence of SEQ ID NO: 84.

Example 74

Assembly of syntan3, a series of redundant templates

In order to produce syntan3, a serially-redundant hIL-3 receptor agonist pMON13416 template, three DNAs were ligated by T4 DNA ligase (Boehringer Mannheim). The three DNAs are: 1) pMON13046 containing the hIL-3 receptor agonist pMON13416 and digested with BstEII and SnaBI; 2) an annealed complementary pair of synthetic oligonucleotides containing a sequence encoding a linker connecting the C-terminus and the N-terminus of the original protein and a small amount of surrounding pMON13416 sequence and, when properly assembled, to the BstEII and SnaBI ends L3syn.for SEQ ID NO: 50 and L3Syn in SEQ ID NO: 51. rev; 3) pMON13046 is part of the hIL-3 receptor agonist pMON13416, which is C1aI (DNA is grown in dam-cell DM1 (Life Technologies)) and SnaBI. The digested DNA was dissolved in 0.9% TAE gel, stained with ethidium bromide and separated using Geneclean (Bio101).

A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Miniprep DNA was isolated from transgenic plants and the transformants were screened using PCR-based assays. Plasmid DNA from selected transgenic lines was sequenced to obtain the correct template. The resulting plasmid was designated syntan3 and contains the DNA sequence of SEQ ID NO: 85.

Example 75

Assembly of pMON31104

Methods III described in Materials and Methods were used to produce new N-terminal / C-terminal genes in pMON31104. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan1 using 35 start of primer set SEQ ID NO: 52 and 34 rev of SEQ ID NO:

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31104.

E. coli strain JM101 was transformed with pMON31104 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON31104 contains the DNA sequence of SEQ ID NO: 86 encoding the following amino acid sequence:

(SEQ ID NO: 186)

Example 76

Assembly of pMON31105

Methods III described in Materials and Methods were used to generate new N-terminal / C-terminal genes in pMON31105. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntanl using 70 start of primer set SEQ ID NO: 54 and 69 rev of SEQ ID NO:

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pairs vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31105.

E. coli strain JM101 was transformed with pMON31105 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON31105 contains the DNA sequence of SEQ ID NO: 87 encoding the following amino acid sequence:

(SEQ ID NO: 187)

Example 77

Assembly of pMON31106

Method III as described in Materials and Methods was used to produce a new N-terminal / C-terminal gene in pMON31106. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan1 using 91 start of primer set SEQ ID NO: 56 and 90 rev of SEQ ID NO: 57.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31106.

E. coli strain JM101 was transformed with pMON31106 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON31106 contains the DNA sequence of SEQ ID NO: 80 encoding the following amino acid sequence:

(SEQ ID NO: 188)

Example 78

Assembly of pMON31107

Methods III described in Materials and Methods were used to generate new N-terminal / C-terminal genes in pMON31107. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan1 using 101 start of primer set SEQ ID NO: 58 and 100 rev of SEQ ID NO: 59.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31107.

E. coli strain JM101 was transformed with pMON31107 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON31107 contains the DNA sequence of SEQ ID NO: 89 encoding the following amino acid sequence:

(SEQ ID NO: 189)

Example 79

Assembly of pMON31108

A new N-terminal / C-terminal gene in pMON31108 was produced using Method III described in Materials and Methods. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan3 using 35 start of primer set SEQ ID NO: 52 and 34 rev of SEQ ID NO:

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31108.

E. coli strain JM101 was transformed with pMON31108 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON31108 contains the DNA sequence of SEQ ID NO: 90 encoding the following amino acid sequence:

(SEQ ID NO: 190)

Example 80

Assembly of pMON31109

Method III described in Materials and Methods was used to produce a new N-terminal / C-terminal gene in pMON31109. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan3 using 70 start of primer set SEQ ID NO: 54 and 69 rev of SEQ ID NO:

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31109.

E. coli strain JM101 was transformed with pMON31109 for protein expression and protein isolation from inclusion bodies.

The plasmid pMON31109 contains the DNA sequence of SEQ ID NO: 91 encoding the following amino acid sequence:

(SEQ ID NO: 191)

Example 81

Assembly of pMON31110

A new N-terminal / C-terminal gene in pMON31110 was produced using Method III described in Materials and Methods. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan3 using 91 start of primer set SEQ ID NO: 56 and 90 rev of SEQ ID NO:

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31110.

E. coli strain JM101 was transformed with pMON31110 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON31110 contains the DNA sequence of SEQ ID NO: 92 encoding the following amino acid sequence:

(SEQ ID NO: 192)

Example 82

Assembly of pMON31111

Methods III described in Materials and Methods were used to produce new N-terminal / C-terminal genes in pMON31111. The full N-terminal / C-terminal gene of the hIL-3 receptor agonist pMON13416 was produced and amplified from the intermediate plasmid Syntan3 using 101 start of primer set SEQ ID NO: 58 and 100 rev of SEQ ID NO: 59.

The resulting DNA fragment containing the new gene was digested with restriction endonucleases NcoI and SnaBI. The digested DNA fragments were dissolved in 1% TAE gel, stained with ethidium bromide, and separated using Geneclean (Bio101, Vista, CA). The purified and digested DNA fragment was ligated to the expression vector pMON13189 using T4 DNA ligase (Boehringer Mannheim, Indianapolis, Ind.). The pMON13189 DNA was pre-digested with NcoI and SnaBI to remove the hIL3 receptor agonist pMON13416 coding sequence and after dissolution on 0.8% TAE gel, 4254 base pair vector fragments were isolated using Geneclean (Bio101, Vista, Calif.) and dissolved in ethidium bromide Lt; / RTI > A portion of the ligation reaction was used to transform E. coli strain DH5 [alpha] cells (Life Technologies, Gaithersburg, MD). Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and sequenced to identify the correct insert. The resulting plasmid was designated pMON31111.

E. coli strain JM101 was transformed with pMON31111 for protein expression and protein isolation from the inclusion bodies.

The plasmid pMON31111 contains the DNA sequence of SEQ ID NO: 93 encoding the following amino acid sequence:

(SEQ ID NO: 193)

Example 83

Assembly of pMON31112

assembly of pMON31112, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist that activates the hIL-3 receptor and the G-CSF receptor. Plasmid pMON13189 DNA was digested with restriction enzymes NcoI and XmaI to obtain NcoI and XmaI vector fragments. The fragments were separated from 0.8% agarose gel and purified. DNA from the second plasmid pMON13222 (WO 94/12639, US serial # 08 / 411,796) was digested with NcoI and EcoRI to obtain a 281 base pair NcoI and EcoRI fragment. This fragment was separated from 1.0% agarose gel and purified. SYNNOXA1.REQ of two oligonucleotide sequences 240 and SYNNOXA2.REQ of SEQ ID NO: 241 were annealed and ligated to the DNA vector fragment from pMON13189 with a 281 base pair DNA fragment from pMON13222. A portion of the ligation mixture was transformed with E. coli K-12 strain JM101. Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis to demonstrate the presence of the EcoRV fragment and sequenced to identify the correct insert.

The plasmid, pMON31112, contains the DNA sequence of SEQ ID NO: 114 encoding the following amino acid sequence:

(SEQ ID NO: 199)

Assembly of pMON31113

assembly of pMON31113, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist that activates the hIL-3 receptor and the G-CSF receptor. Plasmid pMON13197 DNA was digested with restriction enzymes NcoI and XmaI to obtain NcoI and XmaI vector fragments. The fragments were separated from 0.8% agarose gel and purified. DNA from the second plasmid pMON13239 (WO 94/12639, US serial # 08 / 411,796) was digested with NcoI and EcoRI, resulting in 281 base pair NcoI and EcoRI fragments. This fragment was separated from 1.0% agarose gel and purified. Two oligonucleotide sequences 240, SYNNOXA1.REQ and SEQ ID NO: 241, SYNNOXA2.REQ were annealed and ligated to a DNA vector fragment from pMON13197 with a 281 base pair DNA fragment from pMON13239. A portion of the ligation mixture was transformed with E. coli K-12 strain JM101. Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis to demonstrate the presence of the EcoRV fragment and sequenced to identify the correct insert.

The plasmid, pMON31113, contains the DNA sequence of SEQ ID NO: 115 encoding the following amino acid sequence:

(SEQ ID NO: 200)

Example 85

Assembly of pMON31114

assembly of pMON31114, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist that activates the hIL-3 receptor and the G-CSF receptor. Plasmid pMON13189 DNA was digested with restriction enzymes NcoI and XmaI to obtain NcoI and XmaI vector fragments. The fragments were separated from 0.8% agarose gel and purified. DNA from the second plasmid pMON13239 (WO 94/12639, US serial # 08 / 411,796) was digested with NcoI and EcoRI, resulting in 281 base pair NcoI and EcoRI fragments. This fragment was separated from 1.0% agarose gel and purified. The SYNNOXA1.REQ of two oligonucleotide sequences 240 and SYNNOXA2.REQ of SEQ ID NO: 241 were annealed and ligated to a DNA vector fragment from pMON13189 with a 281 base pair DNA fragment from pMON13239. A portion of the ligation mixture was transformed with E. coli K-12 strain JM101. The transformed primary bacteria were selected on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis to demonstrate the presence of the EcoRV fragment and sequenced to identify the correct insert.

The plasmid, pMON31114, contains the DNA sequence of SEQ ID NO: 116 encoding the following amino acid sequence:

(SEQ ID NO: 201)

Example 86

Assembly of pMON31115

Assemble pMON31115, a plasmid containing a DNA sequence encoding a multifunctional hematopoietic receptor agonist that activates the hIL-3 receptor and the G-CSF receptor. Plasmid pMON13197 DNA was digested with restriction enzymes NcoI and XmaI to obtain NcoI and XmaI vector fragments. The fragments were separated from 0.8% agarose gel and purified. DNA from the second plasmid pMON13222 was digested with NcoI and EcoRI to obtain a 281 base pair NcoI and EcoRI fragment. This fragment was separated from 1.0% agarose gel and purified. The SYNNOXA1.REQ of two oligonucleotide sequences 240 and SYNNOXA2.REQ of SEQ ID NO: 241 were annealed and ligated to a DNA vector fragment from pMON13197 with a 281 base pair DNA fragment from pMON13222. A portion of the ligation mixture was transformed with E. coli K-12 strain JM101. Transformant bacteria were screened on ampicillin-containing plates. Plasmid DNA was isolated and analyzed by restriction analysis to demonstrate the presence of the EcoRV fragment and sequenced to identify the correct insert.

The plasmid, pMON31115, contains the DNA sequence of SEQ ID NO: 117 encoding the following amino acid sequence:

(SEQ ID NO: 202)

Example 87

Measurement of In Vitro Activity of Multifunctional Hematopoietic Agonist Protein

The protein concentration of the multifunctional hematopoietic receptor agonist protein can be measured using a sandwich ELISA based on affinity purified polyclonal antibodies. Alternatively, the protein concentration can be measured by amino acid composition analysis. The bioactivity of multifunctional hematopoietic receptor agonists can be measured by a number of in vitro assays. For example, a multifunctional hematopoietic receptor agonist that binds the hIL-3 receptor and the G-CSF receptor can be analyzed by cell proliferation assay using a hIL-3 and / or G-CSF receptor expressing cell line. One such analysis is the AML-193 cell proliferation assay. AML-193 cells respond to IL-3 and G-CSF to allow for the combined bioactivity of the IL-3 / G-CSF multifunctional hematopoietic receptor agonist to be measured. Another such assay is the TF1 cell proliferation assay.

In addition, other factor dependent cell lines, such as the murine IL-3 dependent cell line M-NFS-60 (ATCC. CRL1838) or 32D can be used. The activity of IL-3 is species specific, whereas G-CSF is not, and therefore the autobiographical activity of the G-CSF component of the IL-3 / G-CSF multifunctional hematopoietic receptor agonist can be measured independently. A cell line such as BHK or murine Baf / 3 that does not express the receptor for a given ligand can be transfected with a plasmid containing the gene encoding the desired receptor. An example of such a cell line is Baf3 transfected with the hG-CSF receptor (BaF3 / hG-CSF). The activity of multifunctional hematopoietic receptor agonists in these cell lines can be compared with hIL-3 or G-CSF, respectively, or together. The viable bioactivity of the multifunctional hematopoietic receptor agonist of the present invention analyzed by BaF3 / hG-CSF cell proliferation and TF1 cell proliferation assay is shown in Tables 5 and 6. The bioactivity of the multifunctional hematopoietic receptor agonist is shown as the relative activity compared to the standard protein pMON13056 (WO 95/21254). The abiotic activities of the examples of the multifunctional hematopoietic receptor agonists of the present invention analyzed by BaF3 / c-mpl cell proliferation and TF1 cell proliferation assay are shown in Tables 7 and 8.

The cell proliferative activity of IL-3 / G-CSF receptor agonist pMON BaF3 / hG-CSF receptor cell proliferation assay Relative activity ^* TF1 cell proliferation assay Relative activity ^* 13182 0.015 1.1 13183 0.02 nd 13184 0.01 0.3 13185 0.023 0.36 13186 0.36 0.45 13187 0.07 0.26 13188 0.64 1.3 13189 0.58 1.37 13190 0.045 1.2 13191 0.14 2.7 13192 0.09 2.2 13193 0.06 3.0 25190 nd nd 25191 0.43 1.2 13194 nd nd 13195 1.3 4.3 13196 0.66 0.5 13197 0.6 0.77 13198 0.6 0.5 13199 nd nd 15982 0.7 1.9 15981 0.068 1.2 15965 0.7 0.82 15966 0.36 1.48 15967 0.62 1.37 nd = not obtained ^{* The} bioactivity of the multifunctional hematopoietic receptor agonist is shown as the relative activity compared to the standard protein pMON 13056. n = 3 or more

The cell proliferative activity of IL-3 / G-CSF receptor agonist pMON BaF3 / hG-CSF receptor cell proliferation assay Relative activity TF1 cell proliferation assay Relative activity 31104 + + 31105 + + 31106 + + 31107 nd nd 31108 + + 31109 + + 31110 nd nd 31111 nd nd 31112 + + 31113 + + 31114 + + 31115 + + 31116 nd nd 31117 nd nd nd = not available † The bioactivity (n = 1 or 2) of the multifunctional hematopoietic receptor agonist is shown as relative activity compared to the standard protein pMON 13056. "+" indicates that the molecule is similar to pMON 13056 box.

Cell proliferation activity pMON Baf3 / c-mpl receptor cell proliferation assay activity ^* TF1 cell proliferation assay activity 28505 - + 28506 - + 28507 - + 28508 - + 28509 - + 28510 - + 28511 + + 28512 + + 28513 + + 28514 + + 28519 - + 28520 - + 28521 - + 28522 - + 28523 - + 28524 - + 28525 + + 28526 + + 28533 - + 28534 - + 28535 - + 28536 - + 28537 - + 28538 - + 28539 + + 28540 + + 28541 + + 28542 + + 28543 + + 28544 + + 28545 + + ^* Activity measured on baf3 cell line transfected with c-mpl receptor for c-mpl ligand (1-153) † Activity measured for pMON13056

Similarly, other factor dependent cell lines known to those skilled in the art can be used to measure the bioactivity of the desired multifunctional hematopoietic receptor agonist. Methylcellulose assay can be used to measure the effect of multifunctional hematopoietic receptor agonists on the expansion of hematopoietic progenitor cells and aspects of different types of in vitro hematopoietic colonies. Because the frequency of precursors per 100,000 injected cells is measured, an assessment of the precursor frequency can be obtained by methylcellulose assay. Long-term epileptic-dependent cultures were used to represent early hematopoietic precursor and hepatocytes. This assay can be used to determine whether a multifunctional hematopoietic receptor agonist stimulates the expansion of very early precursors and / or hepatocytes. In addition, a limiting dilution culture can be performed that indicates the frequency of the initial precursor stimulated with the multifunctional hematopoietic receptor agonist.

pMON # IL-3 agonist activity (AML cell proliferation assay) c-mol receptor agonist activity (Baf / 3-c-mpl cell proliferation assay) 28505 + - 28506 + - 28507 + - 28508 + - 28509 + - 28510 + - 28511 + + 28512 + + 28513 + + 28514 + + 28515 + + 28519 + - 28520 + - 28521 + - 28522 + - 28523 + - 28524 + - 28525 + + 28526 + + 28527 + + 28528 + + 28529 + +

28535 + - 28539 + + 28540 + + 28541 + + 28542 + + 28545 + + 28551 + + 28571 + +

Example 88

G-CSF variants containing single or multiple amino acid substitutions were prepared using the PCR mutagenesis technique described in WO 94/12639 and WO 94/12638. These and other variants (i.e., amino acid substitutions, insertions, deletions and N-terminal or C-terminal extension) can also be used to synthesize or induce site-specific mutagenesis (Taylor et al., Nucl. Acids Res., 13: Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, pp. 8785 [1985]; Kunkel et al., Proc. Natl. Acad. Sci. USA, 82: 488-492 , Cold Spring Harbor, NY, [1989], (WO 94/12639) and (WO 94/12638)). These substitutions may be performed separately or in combination with other amino acid substitutions, deletions, and / or insertions and / or extensions. After identifying the sequence of the change, the plasmid DNA can be transfected into suitable animal cells, insect cells or bacterial strains such as E. coli for production. Known variants of active G-CSF include: 1 (Thr to Ser, Arg or Gly), 2 (Pro to Leu), 3 (Leu to Arg or Ser) and 17 (Cys to Ser) And amino acids 1-11 (Kuga et al. Biochemical and Biophysical Research Comm. 159: 103-111 (1989)). These G-CSF amino acid substitution mutants can be used as a template for producing G-CSF receptor agonists in which new N-terminal and new C-terminal are produced. Examples of G-CSF amino acid substitution variants are shown in Table 9.

Example 89

Measurement of the bioactivity of G-CSF amino acid substitution mutants

G-CSF amino acid substitution mutants can be analyzed for cell proliferative activity using a Baf / 3 cell line transfected with human G-CSF receptor. The abiotic activity of G-CSF amino acid substitution mutants is presented in Table 9 for native human G-CSF. The " + " indicates a similar activity to the native amino acid and the " - " indicates that there is no significant decrease or measurable activity.

Cell proliferative activity of G-CSF mutant in BAF3 cell line transfected with human G-CSF receptor aa location Original aa Mutant aa Active ^* 13 Phe Ser + 13 Phe His + 13 Phe Thr + 13 Phe Pro + 16 Lys Pro + 16 Lys Ser + 16 Lys Thr + 16 Lys His + 18 Leu Pro + 18 Leu Thr + 18 Leu His + 18 Leu Cys + 18 Leu Ile + 19 Glu Ala - 19 Glu Thr - 19 Glu Arg - 19 Glu Pro - 19 Glu Leu - 19 Glu Ser - 22 Arg Tyr + 22 Arg Ser + 22 Arg Ala + 22 Arg Thr + 24 Ile Pro + 24 Ile Leu + 24 Ile Tyr +

aa location Original aa Mutant aa activation 27 Asp Gly + 30 Ala Ile + 30 Ala Leu + 34 Lys Ser + 43 His Gly + 43 His Thr + 43 His Val + 43 His Lys + 43 His Trp + 43 His Ala + 43 His Arg + 43 His Cys + 43 His Leu + 44 Pro Arg + 44 Pro Asp + 44 Pro Val + 44 Pro Ala + 44 Pro His + 44 Pro Gln + 44 Pro Trp + 44 Pro Gly + 44 Pro Thr + 46 Glu Ala + 46 Glu Arg + 47 Leu Thr + 49 Leu Phe + 49 Leu Arg + 49 Leu Ser + 50 Leu His + 54 Leu His +

aa location Original aa Mutant aa activation 67 Gln Lys + 67 Gln Leu + 67 Gln Cys + 70 Gln Pro + 70 Gln Leu + 70 Gln Arg + 70 Gln Ser + 104 Asp Gly + 104 Asp Val + 108 Leu Ala + 108 Leu Val + 108 Leu Arg + 108 Leu Gly + 108 Leu Trp + 108 Leu Gln + 115 Thr His + 115 Thr Leu + 115 Thr Ala + 144 Phe His + 144 Phe Arg + 144 Phe Pro + 144 Phe Leu + 144 Phe Glu + 146 Arg Gln + 147 Arg Gln + 156 His Asp - 156 His Ser + 156 His Gly +

aa location Original aa Mutant aa activation 159 Ser Arg + 159 Ser Thr + 159 Ser Tyr + 159 Ser Val + 159 Ser Gly + 162 Glu Gly - 162 Glu Trp + 162 Glu Leu + 163 Val Arg + 163 Val Ala + 163 Val Gly + 165 Tyr Cys nd 169 Ser Leu + 169 Ser Cys + 169 Ser Arg + 170 His Arg + 170 His Ser + ^* Activity on original hG-CSF .nd = Not obtained

Without further study, one skilled in the art can, using the teachings provided above, fully utilize the invention. The following preferred detailed embodiments are therefore to be construed as merely illustrative of the remainder of the disclosure, and are not to be construed as limiting.

More detailed information on molecular biology techniques, protein purification and biological analysis, which can be found in WO 94/12639, WO 94/12638, WO 95/20976, WO 95/21197, WO 95/20977, WO 95/21254, As a reference.

All references, patents or applications cited herein are incorporated by reference in their entirety as if set forth herein.

After reading this disclosure, various other examples will be apparent to those skilled in the art without departing from the spirit and scope of the invention. All such other examples falling within the scope of the appended claims.

Sequence List

(1) General information

(i) the applicant

(A) Name: G.D. Tallow And Comfani

(B) Distance: P. Oh. Box 5110

(C) City: Chicago

(D) State: Illinois

(E) Country: United States

(F) Postal code (ZIP): 60680

(G) Tel: (708) 470-6501

(H) Fax (708) 470-6881

(A) Name: Monsanto Company

(B) Distance: Nous Lindberg Blue Barr 800

(C) City: St. Louis

(D) Note: Missouri

(E) Country: United States

(F) Postal code (ZIP): 63167

(G) Phone: (314) 647-3131

(H) Fax: (314) 694-5435

(ii) Title of the invention: Multifunctional hematopoietic receptor agonist

(iii) Number of sequences: 258

(iv) Computer-readable form:

(A) Media type: floppy disk

(B) Computer: IBM PC compatible type

(C) Operating system: PC-DOS / MS-DOS

(D) Software: PatentIn Release # 1.0, Version # 1.30 (EPO)

(v) Current application data:

Application Number: US 2910

(vi) Pre-filing data:

(A) Application Number: US 60 / 004,834

(B) Filing date: 1995.10. 5.

(2) Information on Sequence 1

(i) Sequence characteristics:

(A) Length: 174 amino acids

(B) Type: Amino acid

(C) Strand Form: unknown

(D) Form: unknown

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key:

(B) Location: 1

(D) Other information: / Note = "In position 1, Xaa is Thr, Ser, Arg, Tyr or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 2

(D) Other information: / Note = "In position 2 Xaa is Pro or Leu;"

(ix) Features:

(A) Name / Key:

(B) Location: 3

(D) Other information: / Note = "At position 3 Xaa is Leu, Arg, Tyr or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 13

(D) Other information: / Note = "At position 13 Xaa is Phe, Ser, His, Thr or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 16

(D) Other information: / Note = "At position 16 Xaa is Lys, Pro, Ser, thr or His;

(ix) Features:

(A) Name / Key:

(B) Location: 17

(D) Other information: / Note = "At position 17 Xaa is Cys, Ser, Gly, Ala, Ile, Tyr or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 18

(D) Other information: / Note = "At position 18 Xaa is Leu, Thr, Pro, His, Ile or Cys;

(ix) Features:

(A) Name / Key:

(B) Location: 22

(D) Other information: / Note = "at position 22 Xaa is Arg, Tyr, Ser, Thr or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 24

(D) Other information: / Note = "At position 24 Xaa is Ile, Pro, Tyr or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 27

(D) Other information: / Note = "At position 27 Xaa is Asp or Gly;"

(ix) Features:

(A) Name / Key:

(B) Location: 30

(D) Other information: / Note = "At position 30 Xaa is Ala, Ile, Leu or Gly; (ix) Features:

(A) Name / Key:

(B) Location: 34

(D) Other information: / Note = "At position 34 Xaa is Lys or Ser;"

(ix) Features:

(A) Name / Key:

(B) Location: 36

(D) Other information: / Note = "At position 36 Xaa is Cys or Ser;"

(ix) Features:

(A) Name / Key:

(B) Location: 42

(D) Other information: / Note = "At position 42 Xaa is Cys or Ser;"

(ix) Features:

(A) Name / Key:

(B) Location: 43

(D) Other information: / Note = "Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 44

(D) Other information: / Note = "At position 44 Xaa is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr;

(ix) Features:

(A) Name / Key:

(B) Location: 46

(D) Other information: / Note = "At position 46 Xaa is Glu, Arg, Phe, Arg, Ile or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 47

(D) Other information: / Note = "In position 47 Xaa is Leu or Thr;"

(ix) Features:

(A) Name / Key:

(B) Location: 49

(D) Other information: / Note = "At position 49 Xaa is Leu, Phe, Arg or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 50

(D) Other information: / Note = "At position 50 Xaa is Leu, Ile, His, Pro or Tyr;

(ix) Features:

(A) Name / Key:

(B) Location: 54

(D) Other information: / Note = "At position 54 Xaa is Leu or His;"

(ix) Features:

(A) Name / Key:

(B) Location: 64

(D) Other information: / Note = "At position 64 Xaa is Cys or Ser;"

(ix) Features:

(A) Name / Key:

(B) Location: 67

(D) Other information: / Note = "At position 67 Xaa is Gln, Lys, Leu or Cys;

(ix) Features:

(A) Name / Key:

(B) Location: 70

(D) Other information: / Note = "At position 70 Xaa is Gln, Pro, Leu, Arg or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 74

(D) Other information: / Note = "At position 74 Xaa is Cys or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 104

(D) Other information: / Note = "At position 104 Xaa is Asp, Gly or Val;"

(ix) Features:

(A) Name / Key:

(B) Location: 108

(D) Other information: / Note = "At position 108 Xaa is Leu, Ala, Val, Arg, Trp, Gln or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 115

(D) Other information: / Note = "At position 115 Xaa is Thr, His, Leu or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 120

(D) Other information: / Note = "At position 120 Xaa is Gln, GLy, Arg or His;"

(ix) Features:

(A) Name / Key:

(B) Location: 123

(D) Other information: / Note = "At position 123 Xaa is Glu, Arg, Phe or Thr;

(ix) Features:

(A) Name / Key:

(B) Location: 144

(D) Other information: / Note = "At position 144 Xaa is Phe, His, Arg, Pro, Leu, Gln or Glu;

(ix) Features:

(A) Name / Key:

(B) Location: 146

(D) Other information: / Note = "At position 146, Xaa is Arg, or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 147

(D) Other information: / Note = "At position 147 Xaa is Arg or Gln;"

(ix) Features:

(A) Name / Key:

(B) Location: 156

(D) Other information: / Note = "At position 156 Xaa is His, Gly or Ser;"

(ix) Features:

(A) Name / Key:

(B) Location: 159

(D) Other information: / Note = "At position 159 Xaa is Ser, Arg, Thr, Tyr, Val or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 162

(D) Other information: / Note = "At position 162 Xaa is Glu, Leu, Gly or Trp;

(ix) Features:

(A) Name / Key:

(B) Location: 163

(D) Other information: / Note = "At position 163 Xaa is Val, GLy, Arg or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 169

(D) Other information: / Note = "at position 169 Xaa is Arg, Ser, Leu, Arg or Cys;

(ix) Features:

(A) Name / Key:

(B) Location: 170

(D) Other information: / Note = "At position 170 Xaa is His, Arg or Ser;"

(xi) Sequence description: Sequence 1

(2) Information on SEQ ID NO: 2

(i) sequence characteristics

(A) Length: 133 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key:

(B) Location: 17

(D) Other information: / Note = "Xaa at position 17 is Ser, Lys, Gly, Asp, Met, Gln or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 18

(D) Other information: / Note = "At position 18 Xaa is Asn, His, Leu, Ile, Phe, Arg or Gln;

(ix) Features:

(A) Name / Key:

(B) Location: 19

(D) Other information: / Note = "At position 19 Xaa is Met, Phe, Ile, Arg, Gly, Ala or Cys;

(ix) Features:

(A) Name / Key:

(B) Location: 20

(D) Other information: / Note = "At position 20 Xaa is Ile, Cys, Gln, Glu, Arg, Pro or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 21

(D) Other information: / Note = "Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val;

(ix) Features:

(A) Name / Key:

(B) Location: 22

(D) Other information: / Note = "Xaa at position 22 is Glu, Trp, Pro, Ser Ala, His, Asp, Asn, Gln, Leu, Val or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 23

(D) Other information: / Note = "Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 24

(D) Other information: / Note = "Xaa at position 24 is Ile, Gly, Val, Arg, Ser, Phe, Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 25

(D) Other information: / Note = "at position 25 Xaa is Thr, His, Gly, Gln, Arg, Pro or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 26

(D) Other information: / Note = "At position 26 Xaa is His, Thr, Phe, Gly, Arg, Ala, Trp;

(ix) Features:

(A) Name / Key:

(B) Location: 27

(D) Other information: / Note = "At position 27 Xaa is Leu, Gly, Arg, Thr, Ser or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 28

(D) Other information: / Note = "At position 28 Xaa is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp;

(ix) Features:

(A) Name / Key:

(B) Location: 29

(D) Other information: / Note = "At position 29 Xaa is Gln, Asn, Leu, Pro, Arg or Val;

(ix) Features:

(A) Name / Key:

(B) Location: 30

(D) Other information: / Note = "At position 30 Xaa is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or L ..."

(ix) Features:

(A) Name / Key:

(B) Location: 31

(D) Other information: / Note = "at position 31 Xaa is Pro, Asp, Gly, Ala, Arg, Leu or Gln;

(ix) Features:

(A) Name / Key:

(B) Location: 32

(D) Other information: / Note = "At position 32 Xaa is Leu, Val, Arg, Gln, Asn, Gly, Ala or Glu;

(ix) Features:

(A) Name / Key:

(B) Location: 33

(D) Other information: / Note = "At position 33 Xaa is Pro, Leu, Gln, Ala, Thr or Glu;

(ix) Features:

(A) Name / Key:

(B) Location: 34

Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met at position 34;

(ix) Features:

(A) Name / Key:

(B) Location: 35

(D) Other information: / Note = "At position 35 Xaa is Leu, Ala, Gly, Asn, Pro, Gln or Val;

(ix) Features:

(A) Name / Key:

(B) Location: 36

(D) Other information: / Note = "At position 36 Xaa is Asp, Leu or Val;"

(ix) Features:

(A) Name / Key:

(B) Location: 37

(D) Other information: / Note = "At position 37 Xaa is Phe, Ser, Pro, Trp or Ile;

(ix) Features:

(A) Name / Key:

(B) Location: 38

(D) Other information: / Note = "At position 38 Xaa is Asn or Ala;"

(ix) Features:

(A) Name / Key:

(B) Location: 40

(D) Other information: / Note = "At position 40 Xaa is Leu, Trp or Arg;"

(ix) Features:

(A) Name / Key:

(B) Location: 41

(D) Other information: / Note = "At position 41 Xaa is Asn, Cys, Arg, Leu, His, Met or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 42

(D) Other information: / Note = "At position 42 Xaa is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 43

(D) Other information: / Note = "Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 44

Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro at position 44; (D)

(ix) Features:

(A) Name / Key:

(B) Location: 45

(D) Other information: / Note = "At position 45 Xaa is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; "

(ix) Features:

(A) Name / Key:

(B) Location: 46

(D) Other information: / Note = "At position 46 Xaa is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 47

(D) Other information: / Note = "Xaa at position 47 is Ile, Gly, Val, Ser, Arg, Pro or His;

(ix) Features:

(A) Name / Key:

(B) Location: 48

Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn at position 48;

(ix) Features:

(A) Name / Key:

(B) Location: 49

(D) Other information: / Note = "At position 49 Xaa is Met, Arg, Ala, Gly, Pro, Asn, His or Asp;

(ix) Features:

(A) Name / Key:

(B) Location: 50

Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln at position 50;

(ix) Features:

(A) Name / Key:

(B) Location: 51

(D) Other information: / Note = "At position 51 Xaa is Asn, Arg, Met, Pro, Ser, Thr or his;

(ix) Features:

(A) Name / Key:

(B) Location: 52

(D) Other information: / Note = "In position 52 Xaa is Asn, His, Arg, Leu, Gly, Ser or Thr;

(ix) Features:

(A) Name / Key:

(B) Location: 53

(D) Other information: / Note = "At position 53 Xaa is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or M ..."

(ix) Features:

(A) Name / Key:

(B) Location: 54

(D) Other information: / Note = "at position 54 Xaa is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 55

(D) Other information: / Note = "at position 55 Xaa is Arg, Thr, Val, Ser, Leu or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 56

Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys at position 56;

(ix) Features:

(A) Name / Key:

(B) Location: 57

(D) Other information: / Note = "At position 57 Xaa is Asn or Gly;"

(ix) Features:

(A) Name / Key:

(B) Location: 58

(D) Other information: / Note = "At position 58 Xaa is Leu, Ser, Asp, Arg, Gln, Val or Cys;

(ix) Features:

(A) Name / Key:

(B) Location: 59

(D) Other information: / Note = "At position 59 Xaa is Glu, Tyr, His, Leu, Pro or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 60

(D) Other information: / Note = "At position 60 Xaa is Ala, Ser, Pro, Tyr, Asn or Thr;

(ix) Features:

(A) Name / Key:

(B) Location: 61

(D) Other information: / Note = "Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 62

(D) Other information: / Note = "At position 62 Xaa is Asn, His, Val, Arg, Pro, Thr, Asp or Ile;

(ix) Features:

(A) Name / Key:

(B) Location: 63

(D) Other information: / Note = "Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val;

(ix) Features:

(A) Name / Key:

(B) Location: 64

(D) Other information: / Note = "At position 64 Xaa is Ala, Asn, Pro, Ser or Lys;

(ix) Features:

(A) Name / Key:

(B) Location: 65

(D) Other information: / Note = "At position 65 Xaa is Val, Thr, Pro, His, Leu, Phe or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 66

(D) Other information: / Note = "Xaa at position 66 is Lys, Ile, Arg, Val, Asn, Glu or Ser;

(ix) Features:

(A) Name / Key:

(B) Location: 67

(D) Other information: / Note = "Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, Ile, Pro or His;

(ix) Features:

(A) Name / Key:

(B) Location: 68

(D) Other information: / Note = "Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His;

(ix) Features:

(A) Name / Key:

(B) Location: 69

(D) Other information: / Note = "Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or L ..."

(ix) Features:

(A) Name / Key:

(B) Location: 70

(D) Other information: / Note = "At position 70 Xaa is Asn, Leu, Val, Trp, Pro or Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 71

(D) Other information: / Note = "Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn;

(ix) Features:

(A) Name / Key:

(B) Location: 72

(D) Other information: / Note = "Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp;

(ix) Features:

(A) Name / Key:

(B) Location: 73

(D) Other information: / Note = "Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 74

(D) Other information: / Note = "Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala;

(ix) Features:

(A) Name / Key:

(B) Location: 75

(D) Other information: / Note = "Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 76

(D) Other information: / Note = "Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or A ..."

(ix) Features:

(A) Name / Key:

(B) Location: 77

(D) Other information: / Note = "At position 77 Xaa is Ile, Ser, Arg, Thr or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 78

(D) Other information: / Note = "At position 78 Xaa is Leu, Ala, Ser, Glu, Phe, GLy or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 79

(D) Other information: / Note = "At position 79 Xaa is Lys, Thr, Asn, Met, Arg, Ile, Gly or Asp;

(ix) Features:

(A) Name / Key:

(B) Location: 80

Trp, Val, Gly, Thr, Leu, Glu or Arg at position 80; (D) Other information:

(ix) Features:

(A) Name / Key:

(B) Location: 81

(D) Other information: / Note = "Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys;

(ix) Features:

(A) Name / Key:

(B) Location: 82

(D) Other information: / Note = "At position 82 Xaa is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; "

(ix) Features:

(A) Name / Key:

(B) Location: 83

(D) Other information: / Note = "At position 83 Xaa is Pro, Ala, Thr, Trp, Arg or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 84

(D) Other information: / Note = "at position 84 Xaa is Cys, Glu, Gly, Arg, Met or Val;

(ix) Features:

(A) Name / Key:

(B) Location: 85

(D) Other information: / Note = "At position 85 Xaa is Leu, Asn, Val or Gln;"

(ix) Features:

(A) Name / Key:

(B) Location: 86

(D) Other information: / Note = "At position 86, Xaa is Pro, Cys, Arg, Ala or Lys;

(ix) Features:

(A) Name / Key:

(B) Location: 87

(D) Other information: / Note = "At position 87 Xaa is Leu, Ser, Trp or Gly;"

(ix) Features:

(A) Name / Key:

(B) Location: 88

(D) Other information: / Note = "At position 88 Xaa is Ala, Lys, Arg, Val or Trp;

(ix) Features:

(A) Name / Key:

(B) Location: 89

(D) Other information: / Note = "At position 89 Xaa is Thr, Asp, Cys, Leu, Val, Glu, His, Asn or S ..."

(ix) Features:

(A) Name / Key:

(B) Location: 90

(D) Other information: / Note = "At position 90 Xaa is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 91

(D) Other information: / Note = "Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His;

(ix) Features:

(A) Name / Key:

(B) Location: 92

(D) Other information: / Note = "Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 93

(D) Other information: / Note = "Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 94

(D) Other information: / Note = "Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 95

(D) Other information: / Note = "at position 95 Xaa is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr;

(ix) Features:

(A) Name / Key:

(B) Location: 96

(D) Other information: / Note = "At position 96 Xaa is Pro, Lys, Tyr, Gly, Ile or Thr;

(ix) Features:

(A) Name / Key:

(B) Location: 97

(D) Other information: / Note = "At position 97 Xaa is Ile, Val, Lys, Ala or Asn;

(ix) Features:

(A) Name / Key:

(B) Location: 98

(D) Other information: / Note = "At position 98 Xaa is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; "

(ix) Features:

(A) Name / Key:

(B) Location: 99

(D) Other information: / Note = "Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His;

(ix) Features:

(A) Name / Key:

(B) Location: 100

(D) Other information: / Note = "At position 100 Xaa is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or ..."

(ix) Features:

(A) Name / Key:

(B) Location: 101

(D) Other information: / Note = "Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln;

(ix) Features:

(A) Name / Key:

(B) Location: 102

(D) Other information: / Note = "At position 102 Xaa is Gly, Leu, Glu, Lys, Ser, Tyr or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 103

(D) Other information: / Note = "At position 103 Xaa is Asp, or Ser;"

(ix) Features:

(A) Name / Key:

(B) Location: 104

Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or GIy at position 104; (D)

(ix) Features:

(A) Name / Key:

(B) Location: 105

(D) Other information: / Note = "Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His;

(ix) Features:

(A) Name / Key:

(B) Location: 106

(D) Other information: / Note = "Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 108

(D) Other information: / Note = "Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 109

(D) Other information: / Note = "At position 109 Xaa is Arg, Thr, Pro, Glu, Tyr, Leu, Ser or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 110

(D) Other information: / Note = "Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp;

(ix) Features:

(A) Name / Key:

(B) Location: 111

(D) Other information: / Note = "At position 111 Xaa is Leu, Ile, Arg, Asp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 112

(D) Other information: / Note = "Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe;

(ix) Features:

(A) Name / Key:

(B) Location: 113

Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, Ile, Val or Asn at position 113;

(ix) Features:

(A) Name / Key:

(B) Location: 114

(D) Other information: / Note = "At position 114 Xaa is Tyr, Cys, His, Ser, Trp, Arg or Leu;

(ix) Features:

(A) Name / Key:

(B) Location: 115

(D) Other information: / Note = "Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 116

(D) Other information: / Note = "Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile to be;"

(ix) Features:

(A) Name / Key:

(B) Location: 117

(D) Other information: / Note = "Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro;

(ix) Features:

(A) Name / Key:

(B) Location: 118

(D) Other information: / Note = "At position 118 Xaa is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr;

(ix) Features:

(A) Name / Key:

(B) Location: 119

(D) Other information: / Note = "Xaa at position 119 is Glu, Ser, Lys, Pro, leu, Thr, Tyr or Arg;

(ix) Features:

(A) Name / Key:

(B) Location: 120

(D) Other information: / Note = "At position 120 Xaa is Asn, Ala, Pro, Leu, His, Val or Gln;

(ix) Features:

(A) Name / Key:

(B) Location: 121

(D) Other information: / Note = "At position 121 Xaa is Ala, Ser, Ile, Asn, Pro, Lys, Asp or Gly;

(ix) Features:

(A) Name / Key:

(B) Location: 122

Arg, Phe, Pro, His, Ile, Tyr or Cys at position 122; (D)

(ix) Features:

(A) Name / Key:

(B) Location: 123

(D) Other information: / Note = "At position 123 Xaa is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu;

(xi) Sequence description: Sequence 2

(2) Information on SEQ ID NO: 3

(i) Sequence characteristics:

(A) Length: 332 Amino acids

(B) Type: Amino acid

(C) Strand Form: unknown

(D) Form: unknown

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key:

(B) Location: 112

(D) Other information: / State = "Location 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or M ..."

(ix) Features:

(A) Name / Key:

(B) Location: 113

(D) Other information: / Note = "Location 113 is deleted or Pro, Phe, Ala, Leu, Ile, Trp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 114

(D) Other information: / Note = "position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 115

(D) Other information: / Note = "Position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn;

(xi) Sequence description: Sequence 3

(2) Information on SEQ ID NO: 4

(i) Sequence characteristics:

(A) Length: 1 amino acid

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key: Protein

(B) Location: 1

(D) Other information: / Note = "where x = (glyglyglyser) n where n is an integer.

(xi) Sequence description: Sequence 4

(2) Information on SEQ ID NO: 5

(i) Sequence characteristics:

(A) Length: 1 amino acid

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key: Protein

(B) Location: 1

(D) Other information: / Note = "where x = (glyglyglyglyser) n where n is an integer.

(xi) Sequence description: SEQ ID NO: 5

(2) Information on SEQ ID NO: 6

(i) Sequence characteristics:

(A) Length: 1 amino acid

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key: Protein

(B) Location: 1

(D) Other information: / Note = "where x = (glyglyglyglyglyser) n, where n is an integer.

(xi) Sequence description: SEQ ID NO: 6

(2) Information on SEQ ID NO: 7

(i) Sequence characteristics:

(A) Length: 1 amino acid

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key: Protein

(B) Location: 1

(D) Other information: / Note = "where x = (gly n ser) n where n is an integer.

(xi) SEQ ID NO: SEQ ID NO: 7

(2) Information about SEQ ID NO: 8

(i) Sequence characteristics:

(A) Length: 1 amino acid

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key: Protein

(B) Location: 1

(D) Other information: / Note = "where x = (alaglyser) n, where n is an integer.

(xi) SEQ ID NO: SEQ ID NO: 8

(2) Information on SEQ ID NO: 9

(i) Sequence characteristics:

(A) Length: 35 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 9

(2) Information on SEQ ID NO: 10

(i) Sequence characteristics:

(A) Length: 24 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 10

(2) Information on SEQ ID NO: 11

(i) Sequence characteristics:

(A) Length: 28 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 11

(2) Information on SEQ ID NO: 12

(i) Sequence characteristics:

(A) Length: 4 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 12

(2) Information on SEQ ID NO: 13

(i) Sequence characteristics:

(A) Length: 45 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 13

(2) Information on SEQ ID NO: 14

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 14

(2) Information on Sequence 15

(i) Sequence characteristics:

(A) Length: 33 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 15

(2) Information on SEQ ID NO: 16

(i) Sequence characteristics:

(A) Length: 10 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 16

(2) Information on SEQ ID NO: 17

(i) Sequence characteristics:

(A) Length: 10 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 17

(2) Information on SEQ ID NO: 18

(i) Sequence characteristics:

(A) Length: 13 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 18

(2) Information on SEQ ID NO: 19

(i) Sequence characteristics:

(A) Length: 13 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 19

(2) Information on sequence 20

(i) Sequence characteristics:

(A) Length: 22 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 20

(2) Information on sequence 21

(i) Sequence characteristics:

(A) Length: 22 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 21

(2) Information on SEQ ID NO: 22

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 22

(2) Information on SEQ ID NO: 23

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 23

(2) Information on SEQ ID NO: 24

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 24

(2) Information on SEQ ID NO: 25

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 25

(2) Information on sequence 26

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 26

(2) Information on SEQ ID NO: 27

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 27

(2) Information on sequence 28

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 28

(2) Information on sequence 29

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 29

(2) Information on sequence 30

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 30

(2) Information on sequence 31

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 31

(2) Information on sequence 32

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 32

(2) Information on SEQ ID NO: 33

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 33

(2) Information on sequence 34

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 34

(2) Information on sequence 35

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 35

(2) Information on sequence 36

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 36

(2) Information on sequence 37

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 37

(2) Information about SEQ ID NO: 38

(i) Sequence characteristics:

(A) Length: 27 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 38

(2) Information on SEQ ID 39

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 39

(2) Information on sequence 40

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 40

(2) Information about SEQ ID NO: 41

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 41

(2) Information on sequence 42

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 42

(2) Information on SEQ ID NO: 43

(i) Sequence characteristics:

(A) Length: 29 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 43

(2) Information on SEQ ID NO: 44

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 44

(2) Information on sequence 45

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 45

(2) Information on sequence 46

(i) Sequence characteristics:

(A) Length: 83 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 46

(2) Information on sequence 47

(i) Sequence characteristics:

(A) Length: 83 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 47

(2) Information on SEQ ID NO: 48

(i) Sequence characteristics:

(A) Length: 59 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 48

(2) Information on sequence 49

(i) Sequence characteristics:

(A) Length: 56 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 49

(2) Information on sequence 50

(i) Sequence characteristics:

(A) Length: 80 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 50

(2) Information on SEQ ID NO: 51

(i) Sequence characteristics:

(A) Length: 80 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 51

(2) Information on sequence 52

(i) Sequence characteristics:

(A) Length: 30 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 52

(2) Information on SEQ ID NO: 53

(i) Sequence characteristics:

(A) Length: 28 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 53

(2) Information on SEQ ID NO: 54

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 54

(2) Information on sequence 55

(i) Sequence characteristics:

(A) Length: 28 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 55

(2) Information about sequence 56

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 56

(2) Information on sequence 57

(i) Sequence characteristics:

(A) Length: 28 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 57

(2) Information about SEQ ID NO: 58

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 58

(2) Information on sequence 59

(i) Sequence characteristics:

(A) Length: 28 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 59

(2) Information on sequence 60

(i) Sequence characteristics:

(A) Length: 54 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 60

(2) Information on SEQ ID NO: 61

(i) Sequence characteristics:

(A) Length: 54 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 61

(2) Information on sequence 62

(i) Sequence characteristics:

(A) Length: 18 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 62

(2) Information on SEQ ID NO: 63

(i) Sequence characteristics:

(A) Length: 21 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 63

(2) Information on SEQ ID 64

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 64

(2) Information on sequence 65

(i) Sequence characteristics:

(A) Length: 36 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 65

(2) Information on sequence 66

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 66

(2) Information on sequence 67

(i) Sequence characteristics:

(A) Length: 36 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 67

(2) Information on sequence 68

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 68

(2) Information on sequence 69

(i) Sequence characteristics:

(A) Length: 36 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 69

(2) Information on sequence 70

(i) Sequence characteristics:

(A) Length: 32 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 70

(2) Information on sequence 71

(i) Sequence characteristics:

(A) Length: 36 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 71

(2) Information on sequence 72

(i) Sequence characteristics:

(A) Length: 36 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 72

(2) Information on SEQ ID NO: 73

(i) Sequence characteristics:

(A) Length: 36 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 73

(2) Information on sequence 74

(i) Sequence characteristics:

(A) Length: 21 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 74

(2) Information on sequence 75

(i) Sequence characteristics:

(A) Length: 25 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 75

(2) Information on SEQ ID NO: 76

(i) Sequence characteristics:

(A) Length: 53 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 76

(2) Information on sequence 77

(i) Sequence characteristics:

(A) Length: 53 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 77

(2) Information on sequence 78

(i) Sequence characteristics:

(A) Length: 439 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 78

(2) Information on sequence 79

(i) Sequence characteristics:

(A) Length: 465 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 79

(2) Information on sequence 80

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 80

(2) Information about sequence 81

(i) Sequence characteristics:

(A) Length: 936 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 81

(2) Information on sequence 82

(i) Sequence characteristics:

(A) Length: 939 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 82

(2) Information on SEQ ID NO: 83

(i) Sequence characteristics:

(A) Length: 948 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 83

(2) Information about SEQ ID NO: 84

(i) Sequence characteristics:

(A) Length: 688 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 84

(2) Information on sequence 85

(i) Sequence characteristics:

(A) Length: 712 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 85

(2) Information on sequence 86

(i) Sequence characteristics:

(A) Length: 975 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 86

(2) Information on sequence 87

(i) Sequence characteristics:

(A) Length: 975 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 87

(2) Information about SEQ ID NO: 88

(i) Sequence characteristics:

(A) Length: 975 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 88

(2) Information on sequence 89

(i) Sequence characteristics:

(A) Length: 975 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 89

(2) Information about sequence 90

(i) Sequence characteristics:

(A) Length: 999 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 90

(2) Information about SEQ ID NO: 91

(i) Sequence characteristics:

(A) Length: 999 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 91

(2) Information about SEQ ID NO: 92

(i) Sequence characteristics:

(A) Length: 999 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 92

(2) Information about SEQ ID NO: 93

(i) Sequence characteristics:

(A) Length: 999 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 93

(2) Information about SEQ ID NO: 94

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 94

(2) Information on sequence 95

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 95

(2) Information about SEQ ID NO: 96

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 96

(2) Information on sequence 97

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 97

(2) Information on SEQ ID 98

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 98

(2) Information on sequence 99

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 99

(2) Information about sequence number 100

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 100

(2) Information on SEQ ID 101

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 101

(2) Information about SEQ ID NO: 102

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 102

(2) Information on SEQ ID NO: 103

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 103

(2) Information about SEQ ID NO: 104

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 104

(2) Information about SEQ ID NO: 105

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 105

(2) Information about SEQ ID NO: 106

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 106

(2) Information about SEQ ID NO: 107

(i) Sequence characteristics:

(A) Length: 972 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 107

(2) Information about SEQ ID NO: 108

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 108

(2) Information about SEQ ID NO: 109

(i) Sequence characteristics:

(A) Length: 972 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 109

(2) Information about SEQ ID NO: 110

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 110

(2) Information about SEQ ID NO: 111

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 111

(2) Information about SEQ ID 112

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 112

(2) Information about SEQ ID NO: 113

(i) Sequence characteristics:

(A) Length: 972 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 113

(2) Information about SEQ ID NO: 114

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 114

(2) Information about SEQ ID NO: 115

(i) Sequence characteristics:

(A) Length: 972 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 115

(2) Information about SEQ ID NO: 116

(i) Sequence characteristics:

(A) Length: 963 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 116

(2) Information about SEQ ID NO: 117

(i) Sequence characteristics:

(A) Length: 972 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 117

(2) Information about SEQ ID NO: 118

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 118

(2) Information about SEQ ID NO: 119

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 119

(2) Information about sequence 120

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 120

(2) Information about SEQ ID NO: 121

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 121

(2) Information on SEQ ID 122

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 122

(2) Information about SEQ ID NO: 123

(i) Sequence characteristics:

(A) Length: 907 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 123

(2) Information on SEQ ID NO: 124

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 124

(2) Information on sequence 125

(i) Sequence characteristics:

(A) Length: 848 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 125

(2) Information about SEQ ID NO: 126

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 126

(2) Information about sequence 127

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 127

(2) Information about SEQ ID 128

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 128

(2) Information on SEQ ID 129

(i) Sequence characteristics:

(A) Length: 918 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 129

(2) Information about sequence 130

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 130

(2) Information about SEQ ID NO: 131

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 131

(2) Information about SEQ ID NO: 132

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 132

(2) Information about SEQ ID NO: 133

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 133

(2) Information about SEQ ID NO: 134

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 134

(2) Information about SEQ ID NO: 135

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO:

(2) Information about SEQ ID NO: 136

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 136

(2) Information about sequence 137

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 137

(2) Information about SEQ ID NO: 138

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 138

(2) Information about SEQ ID NO: 139

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 139

(2) Information on sequence 140

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 140

(2) Information about SEQ ID NO: 141

(i) Sequence characteristics:

(A) Length: 915 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 141

(2) Information about SEQ ID NO: 142

(i) Sequence characteristics:

(A) Length: 921 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 142

(2) Information on SEQ ID NO: 143

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 143

(2) Information on SEQ ID 144

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 144

(2) Information about SEQ ID NO: 145

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 145

(2) Information about sequence 146

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 146

(2) Information about SEQ ID NO: 147

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 147

(2) Information about SEQ ID NO: 148

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 148

(2) Information about SEQ ID NO: 149

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 149

(2) Information about sequence 150

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 150

(2) Information on SEQ ID 151

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 151

(2) Information about SEQ ID NO: 152

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 152

(2) Information about SEQ ID NO: 153

(i) Sequence characteristics:

(A) Length: 927 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 153

(2) Information about SEQ ID NO: 154

(i) Sequence characteristics:

(A) Length: 906 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO:

(2) Information about SEQ ID NO: 155

(i) Sequence characteristics:

(A) Length: 993 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 155

(2) Information about sequence 156

(i) Sequence characteristics:

(A) Length: 993 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 156

(2) Information about SEQ ID NO: 157

(i) Sequence characteristics:

(A) Length: 993 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 157

(2) Information about SEQ ID NO: 158

(i) Sequence characteristics:

(A) Length: 993 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 158

(2) Information about SEQ ID NO: 159

(i) Sequence characteristics:

(A) Length: 993 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 159

(2) Information about SEQ ID NO: 160

(i) Sequence characteristics:

(A) Length: 1027 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 160

(2) Information about SEQ ID NO: 161

(i) Sequence characteristics:

(A) Length: 155 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 161

(2) Information about SEQ ID NO: 162

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 162

(2) Information on SEQ.

(i) Sequence characteristics:

(A) Length: 312 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 163

(2) Information about SEQ ID NO: 164

(i) Sequence characteristics:

(A) Length: 313 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 164

(2) Information about sequence 165

(i) Sequence characteristics:

(A) Length: 316 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 165

(2) Information on SEQ.

(i) Sequence characteristics:

(A) Length: 302 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 166

(2) Information on SEQ.

(i) Sequence characteristics:

(A) Length: 317 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 167

(2) Information about SEQ ID NO: 168

(i) Sequence characteristics:

(A) Length: 302 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 168

(2) Information on SEQ.

(i) Sequence characteristics:

(A) Length: 317 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 169

(2) Information about SEQ ID NO: 170

(i) Sequence characteristics:

(A) Length: 302 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 170

(2) Information about SEQ ID NO: 171

(i) Sequence characteristics:

(A) Length: 317 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 171

(2) Information about SEQ ID NO: 172

(i) Sequence characteristics:

(A) Length: 302 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 172

(2) Information about SEQ ID NO: 173

(i) Sequence characteristics:

(A) Length: 317 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 173

(2) Information about SEQ ID NO: 174

(i) Sequence characteristics:

(A) Length: 302 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 174

(2) Information on sequence 175

(i) Sequence characteristics:

(A) Length: 317 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 175

(2) Information about SEQ ID NO: 176

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 176

(2) Information on SEQ ID NO: 177

(i) Sequence characteristics:

(A) Length: 320 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 177

(2) Information on SEQ ID NO: 178

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 178

(2) Information about SEQ ID NO: 179

(i) Sequence characteristics:

(A) Length: 320 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 179

(2) Information about sequence 180

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 180

(2) Information about SEQ ID NO: 181

(i) Sequence characteristics:

(A) Length: 320 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 181

(2) Information about SEQ ID NO: 182

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 182

(2) Information on SEQ ID NO: 183

(i) Sequence characteristics:

(A) Length: 320 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 183

(2) Information on SEQ ID NO: 184

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 184

(2) Information about SEQ ID NO: 185

(i) Sequence characteristics:

(A) Length: 320 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 185

(2) Information about SEQ ID NO: 186

(i) Sequence characteristics:

(A) Length: 321 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 186

(2) Information about SEQ ID NO: 187

(i) Sequence characteristics:

(A) Length: 321 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 187

(2) Information on SEQ ID NO: 188

(i) Sequence characteristics:

(A) Length: 321 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 188

(2) Information about SEQ ID NO: 189

(i) Sequence characteristics:

(A) Length: 321 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 189

(2) Information on sequence 190

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 190

(2) Information on sequence 191

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 191

(2) Information about SEQ ID NO: 192

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 192

(2) Information on sequence 193

(i) Sequence characteristics:

(A) Length: 299 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 193

(2) Information on sequence 194

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 194

(2) Information about sequence 195

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 195

(2) Information on sequence 196

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 196

(2) Information about sequence 197

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 197

(2) Information about sequence 198

(i) Sequence characteristics:

(A) Length: 329 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 198

(2) Information about sequence 199

(i) Sequence characteristics:

(A) Length: 319 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 199

(2) Information about sequence 200

(i) Sequence characteristics:

(A) Length: 322 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 200

(2) Information on sequence 201

(i) Sequence characteristics:

(A) Length: 319 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 201

(2) Information about SEQ ID NO: 202

(i) Sequence characteristics:

(A) Length: 322 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 202

(2) Information on SEQ ID NO: 203

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 203

(2) Information about SEQ ID NO: 204

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 204

(2) Information about sequence 205

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: SEQ ID NO: 205

(2) Information about sequence 206

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 206

(2) Information about SEQ ID NO: 207

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 207

(2) Information about SEQ ID NO: 208

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 208

(2) Information on sequence 209

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 209

(2) Information about sequence 210

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 210

(2) Information about SEQ ID NO: 211

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 211

(2) Information about SEQ ID NO: 212

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 212

(2) Information about SEQ ID NO: 213

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 213

(2) Information about SEQ ID NO: 214

(i) Sequence characteristics:

(A) Length: 306 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 214

(2) Information about SEQ ID NO: 215

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 215

(2) Information about sequence 216

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 216

(2) Information on sequence 217

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 217

(2) Information on sequence 218

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 218

(2) Information on sequence 219

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 219

(2) Information about sequence 220

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: Sequence 220

(2) Information about SEQ ID NO: 221

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 221

(2) Information about SEQ ID NO: 222

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: SEQ ID NO: 222

(2) Information about SEQ ID NO: 223

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 223

(2) Information about SEQ ID NO: 224

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 224

(2) Information about sequence 225

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: SEQ ID NO: 225

(2) Information on sequence 226

(i) Sequence characteristics:

(A) Length: 305 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 226

(2) Information about SEQ ID NO: 227

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 227

(2) Information about SEQ ID NO: 228

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 228

(2) Information about SEQ ID NO: 229

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 229

(2) Information on sequence 230

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 230

(2) Information about SEQ ID NO: 231

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 231

(2) Information about SEQ ID NO: 232

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 232

(2) Information about SEQ ID NO: 233

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 233

(2) Information on SEQ ID NO: 234

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 234

(2) Information about SEQ ID NO: 235

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 233

(2) Information about SEQ ID NO: 236

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 236

(2) Information about SEQ ID NO: 237

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 237

(2) Information about SEQ ID NO: 238

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 238

(2) Information about SEQ ID NO: 239

(i) Sequence characteristics:

(A) Length: 302 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 239

(2) Information about SEQ ID NO: 240

(i) Sequence characteristics:

(A) Length: 83 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 240

(2) Information about SEQ ID NO: 241

(i) Sequence characteristics:

(A) Length: 82 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 241

(2) Information about SEQ ID NO: 242

(i) Sequence characteristics:

(A) Length: 8 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 242

(2) Information about SEQ ID NO: 243

(i) Sequence characteristics:

(A) Length: 12 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 243

(2) Information about SEQ ID NO: 244

(i) Sequence characteristics:

(A) Length: 7 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 244

(2) Information on sequence 245

(i) Sequence characteristics:

(A) Length: 6 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 245

(2) Information about sequence 246

(i) Sequence characteristics:

(A) Length: 7 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 244

(2) Information on sequence 247

(i) Sequence characteristics:

(A) Length: 10 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 247

(2) Information about SEQ ID NO: 248

(i) Sequence characteristics:

(A) Length: 309 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 248

(2) Information on sequence 249

(i) Sequence characteristics:

(A) Length: 459 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Description / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 249

(2) Information on sequence 250

(i) Sequence characteristics:

(A) Length: 447 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: Sequence 250

(2) Information on sequence 251

(i) Sequence characteristics:

(A) Length: 459 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: 251

(2) Information on sequence 252

(i) Sequence characteristics:

(A) Length: 153 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 252

(2) Information on sequence 253

(i) Sequence characteristics:

(A) Length: 149 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) Sequence description: SEQ ID NO: 253

(2) Information about SEQ ID NO: 254

(i) Sequence characteristics:

(A) Length: 153 amino acids

(B) Type: Amino acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: protein

(xi) SEQ ID NO: 254

(2) Information about SEQ ID NO: 255

(i) Sequence characteristics:

(A) Length: 64 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) SEQ ID NO: SEQ ID NO: 255

(2) Information about sequence 256

(i) Sequence characteristics:

(A) Length: 153 amino acids

(B) Type: Amino acid

(C) Strand Form: unknown

(D) Form: unknown

(ii) Molecular type: protein

(ix) Features:

(A) Name / Key:

(B) Location: 112

(D) Other information: / Note = "Position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 113

(D) Other information: / Note = "Position 113 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 114

(D) Other information: / Note = "position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met;

(ix) Features:

(A) Name / Key:

(B) Location: 115

(D) Other information: / Note = "Position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn;

(xi) SEQ ID NO: 256

(2) Information on sequence 257

(i) Sequence characteristics:

(A) Length: 464 base pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 257

(2) Information on sequence 258

(i) Sequence characteristics:

(A) Length: 419 pairs

(B) Type: Nucleic acid

(C) Strand Form: Single

(D) Shape: Linear

(ii) Molecular type: other nucleic acid

(A) Explanation: / Description = "DNA (synthetic)"

(xi) Sequence description: SEQ ID NO: 258

Claims (41)

A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R ₁ and R ₂ are independently selected from the group consisting of (I), (II), (III), (IV) or (V) Wherein L ₁ is a linker that can be connected to R ₁ to R _2; With the proviso that at least R ₁ or R ₂ is selected from the polypeptides of formula (I), (II), or (III); And The hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). (I) a polypeptide comprising a modified human G-CSF amino acid sequence of the formula: (SEQ ID NO: 1) In the above sequence Xaa in position 1 is Thr, Ser, Arg, Tyr or Gly; Xaa of position 2 is Pro or Leu; Xaa at position 3 is Leu, Arg, Tyr or Ser; Xaa at position 13 is Phe, Ser, His, Thr or Pro; Xaa at position 16 is Lys, Pro, Ser, Thr or His; Xaa at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr or Arg; Xaa at position 18 is Leu, Thr, Pro, His, He or Cys; Xaa at position 22 is Arg, Tyr, Ser, Thr or Ala; Xaa at position 24 is Ile, Pro, Tyr or Leu; Xaa at position 27 is Asp or Gly; Xaa at position 30 is Ala, Ile, Leu or Gly; Xaa at position 34 is Lys or Ser; Xaa at position 36 is Cys or Ser; Xaa at position 42 is Cys or Ser; Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu; Xaa at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr; Xaa at position 46 is Glu, Arg, Phe, Arg, Ile or Ala; Xaa of position 47 is Leu or Thr; Xaa at position 49 is Leu, Phe, Arg or Ser; Xaa at position 50 is Leu, Ile, His, Pro or Tyr; Xaa at position 54 is Leu or His; Xaa at position 64 is Cys or Ser; Xaa at position 67 is Gln, Lys, Leu or Cys; Xaa at position 70 is Gln, Pro, Leu, Arg or Ser; Xaa at position 74 is Cys or Ser; Xaa at position 104 is Asp, Gly or Val; Xaa at position 108 is Leu, Ala, Val, Arg, Trp, Gln or Gly; Xaa at position 115 is Thr, His, Leu or Ala; Xaa at position 120 is Gln, Gly, Arg, Lys or His; Xaa at position 123 is Glu, Arg, Phe or Thr; Xaa at position 144 is Phe, His, Arg, Pro, Leu, Gln or GIu; Xaa at position 146 is Arg or Gln; Xaa at position 147 is Arg or Gln; Xaa at position 156 is His, GIy or Ser; Xaa at position 159 is Ser, Arg, Thr, Tyr, Val or Gly; Xaa at position 162 is Glu, Leu, Gly or Trp; Xaa at position 163 is Val, Gly, Arg or Ala; Xaa at position 169 is Arg, Ser, Leu, Arg or Cys; Xaa at position 170 is His, Arg or Ser; Wherein optionally 1-11 amino acids from the N-terminus and 1-5 amino acids from the C-terminus may optionally be deleted from the modified human G-CSF amino acid sequence as described above; Wherein the N-terminus can be linked directly to the C-terminus, or via the linker which is capable of linking the N-terminus to the C-terminus and having the new C- and N-terminus at the following amino acids; (II) a polypeptide comprising a modified human IL-3 amino acid sequence as set forth below; (SEQ ID NO: 2a) (SEQ ID NO: 2b) Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asp; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus of said modified human IL-3 amino acid sequence may be optionally deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 0 to 44 of the amino acid represented by Xaa is different from the corresponding amino acid of the original (1- 133) human interleukin-3; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have a new C-terminus and an N-terminus at the following amino acids; A polypeptide comprising a modified human c-mpl ligand amino acid sequence of (III) below; (SEQ ID NO: 256) In the above sequence Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met; Xaa at position 113 is deleted or Pho, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have new C- and N-terminus at the following amino acids; A polypeptide comprising a modified human IL-3 amino acid sequence of (IV) (SEQ ID NO: 2a) (SEQ ID NO: 2b) Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lsy, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, GLy, Ser or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Set, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Por, Glu, Tyr, Leu, Ser or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asn; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus of said modified human IL-3 amino acid sequence may be optionally deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 1 to 44 of the amino acids represented by Xaa are different from the corresponding amino acids of the native (1 - 133) human interleukin - 3; (V) Colony-forming stimulating factor. A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R ₁ and R ₂ are independently selected from the group consisting of (I), (II), (III), (IV) or (V) Wherein L ₁ is a linker that can be connected to R ₁ to R _2; With the proviso that at least R ₁ or R ₂ is selected from the polypeptides of formula (I), (II), or (III); And The hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). (I) a polypeptide comprising a modified human G-CSF amino acid sequence of the formula: (SEQ ID NO: 1) In the above sequence Xaa in position 1 is Thr, Ser, Arg, Tyr or Gly; Xaa of position 2 is Pro or Leu; Xaa at position 3 is Leu, Arg, Tyr or Ser; Xaa at position 13 is Phe, Ser, His, Thr or Pro; Xaa at position 16 is Lys, Pro, Ser, Thr or His; Xaa at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr or Arg; Xaa at position 18 is Leu, Thr, Pro, His, He or Cys; Xaa at position 22 is Arg, Tyr, Ser, Thr or Ala; Xaa at position 24 is Ile, Pro, Tyr or Leu; Xaa at position 27 is Asp or Gly; Xaa at position 30 is Ala, Ile, Leu or Gly; Xaa at position 34 is Lys or Ser; Xaa at position 36 is Cys or Ser; Xaa at position 42 is Cys or Ser; Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu; Xaa at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr; Xaa at position 46 is Glu, Arg, Phe, Arg, Ile or Ala; Xaa of position 47 is Leu or Thr; Xaa at position 49 is Leu, Phe, Arg or Ser; Xaa at position 50 is Leu, Ile, His, Pro or Tyr; Xaa at position 54 is Leu or His; Xaa at position 64 is Cys or Ser; Xaa at position 67 is Gln, Lys, Leu or Cys; Xaa at position 70 is Gln, Pro, Leu, Arg or Ser; Xaa at position 74 is Cys or Ser; Xaa at position 104 is Asp, Gly or Val; Xaa at position 108 is Leu, Ala, Val, Arg, Trp, Gln or Gly; Xaa at position 115 is Thr, His, Leu or Ala; Xaa at position 120 is Gln, Gly, Arg, Lys or His; Xaa at position 123 is Glu, Arg, Phe or Thr; Xaa at position 144 is Phe, His, Arg, Pro, Leu, Gln or GIu; Xaa at position 146 is Arg or Gln; Xaa at position 147 is Arg or Gln; Xaa at position 156 is His, GIy or Ser; Xaa at position 159 is Ser, Arg, Thr, Tyr, Val or Gly; Xaa at position 162 is Glu, Leu, Gly or Trp; Xaa at position 163 is Val, Gly, Arg or Ala; Xaa at position 169 is Arg, Ser, Leu, Arg or Cys; Xaa at position 170 is His, Arg or Ser; Wherein optionally 1-11 amino acids from the N-terminus and 1-5 amino acids from the C-terminus may be deleted from the modified human G-CSF amino acid sequence as described above; Wherein the N-terminus can be linked directly to the C-terminus, or via the linker which is capable of linking the N-terminus to the C-terminus and having the new C- and N-terminus at the following amino acids; (II) a polypeptide comprising a modified human IL-3 amino acid sequence as set forth below; Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asp; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus of said modified human IL-3 amino acid sequence may be optionally deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 0 to 44 of the amino acid represented by Xaa is different from the corresponding amino acid of the original (1- 133) human interleukin-3; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have a new C-terminus and an N-terminus at the following amino acids; A polypeptide comprising a modified human c-mpl ligand amino acid sequence of (III) below; (SEQ ID NO: 256) In the above sequence Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met; Xaa at position 113 is deleted or Pho, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have new C- and N-terminus at the following amino acids; A polypeptide comprising a modified human IL-3 amino acid sequence of (IV) Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lsy, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, GLy, Ser or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Set, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Por, Glu, Tyr, Leu, Ser or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asn; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus of said modified human IL-3 amino acid sequence may be optionally deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 1 to 44 of the amino acids represented by Xaa are different from the corresponding amino acids of the native (1 - 133) human interleukin - 3; (V) Colony-forming stimulating factor. The hematopoietic protein of claim 1, wherein the polypeptide of (IV) is selected from the group consisting of: (SEQ ID NO: 225) (SEQ ID NO: 226) (SEQ ID NO: 227) And (SEQ ID NO: 228) The hematopoietic protein according to claim 2, wherein the polypeptide of (IV) is selected from the group consisting of (SEQ ID NO: 225) (SEQ ID NO: 226) (SEQ ID NO: 227) And (SEQ ID NO: 228) A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R ₁ is a polypeptide comprising a modified human G-CSF amino acid sequence of the formula: (SEQ ID NO: 1) In the above sequence Xaa in position 1 is Thr, Ser, Arg, Tyr or Gly; Xaa of position 2 is Pro or Leu; Xaa at position 3 is Leu, Arg, Tyr or Ser; Xaa at position 13 is Phe, Ser, His, Thr or Pro; Xaa at position 16 is Lys, Pro, Ser, Thr or His; Xaa at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr or Arg; Xaa at position 18 is Leu, Thr, Pro, His, He or Cys; Xaa at position 22 is Arg, Tyr, Ser, Thr or Ala; Xaa at position 24 is Ile, Pro, Tyr or Leu; Xaa at position 27 is Asp or Gly; Xaa at position 30 is Ala, Ile, Leu or Gly; Xaa at position 34 is Lys or Ser; Xaa at position 36 is Cys or Ser; Xaa at position 42 is Cys or Ser; Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu; Xaa at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr; Xaa at position 46 is Glu, Arg, Phe, Arg, Ile or Ala; Xaa of position 47 is Leu or Thr; Xaa at position 49 is Leu, Phe, Arg or Ser; Xaa at position 50 is Leu, Ile, His, Pro or Tyr; Xaa at position 54 is Leu or His; Xaa at position 64 is Cys or Ser; Xaa at position 67 is Gln, Lys, Leu or Cys; Xaa at position 70 is Gln, Pro, Leu, Arg or Ser; Xaa at position 74 is Cys or Ser; Xaa at position 104 is Asp, Gly or Val; Xaa at position 108 is Leu, Ala, Val, Arg, Trp, Gln or Gly; Xaa at position 115 is Thr, His, Leu or Ala; Xaa at position 120 is Gln, Gly, Arg, Lys or His; Xaa at position 123 is Glu, Arg, Phe or Thr; Xaa at position 144 is Phe, His, Arg, Pro, Leu, Gln or GIu; Xaa at position 146 is Arg or Gln; Xaa at position 147 is Arg or Gln; Xaa at position 156 is His, GIy or Ser; Xaa at position 159 is Ser, Arg, Thr, Tyr, Val or Gly; Xaa at position 162 is Glu, Leu, Gly or Trp; Xaa at position 163 is Val, Gly, Arg or Ala; Xaa at position 169 is Arg, Ser, Leu, Arg or Cys; Xaa at position 170 is His, Arg or Ser; Wherein optionally 1-11 amino acids from the N-terminus and 1-5 amino acids from the C-terminus may be deleted from the modified human G-CSF amino acid sequence as described above; Wherein the N-terminus can be linked directly to the C-terminus, or via the linker which is capable of linking the N-terminus to the C-terminus and having the new C- and N-terminus at the following amino acids; Wherein R ₂ is a polypeptide comprising a modified human IL-3 amino acid sequence of the formula: (SEQ ID NO: 2a) (SEQ ID NO: 2b) Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asp; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus of said modified human interleukin-3 amino acid sequence may optionally be deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 0 to 44 of the amino acid represented by Xaa is different from the corresponding amino acid of the original (1- 133) human interleukin-3; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have a new C-terminus and an N-terminus at the following amino acids; Wherein L ₁ is a linker that can be connected to R ₁ to R _2; And The hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R ₁ is a polypeptide comprising a modified human G-CSF amino acid sequence of the formula: (SEQ ID NO: 1) In the above sequence Xaa in position 1 is Thr, Ser, Arg, Tyr or Gly; Xaa of position 2 is Pro or Leu; Xaa at position 3 is Leu, Arg, Tyr or Ser; Xaa at position 13 is Phe, Ser, His, Thr or Pro; Xaa at position 16 is Lys, Pro, Ser, Thr or His; Xaa at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr or Arg; Xaa at position 18 is Leu, Thr, Pro, His, He or Cys; Xaa at position 22 is Arg, Tyr, Ser, Thr or Ala; Xaa at position 24 is Ile, Pro, Tyr or Leu; Xaa at position 27 is Asp or Gly; Xaa at position 30 is Ala, Ile, Leu or Gly; Xaa at position 34 is Lys or Ser; Xaa at position 36 is Cys or Ser; Xaa at position 42 is Cys or Ser; Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu; Xaa at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr; Xaa at position 46 is Glu, Arg, Phe, Arg, Ile or Ala; Xaa of position 47 is Leu or Thr; Xaa at position 49 is Leu, Phe, Arg or Ser; Xaa at position 50 is Leu, Ile, His, Pro or Tyr; Xaa at position 54 is Leu or His; Xaa at position 64 is Cys or Ser; Xaa at position 67 is Gln, Lys, Leu or Cys; Xaa at position 70 is Gln, Pro, Leu, Arg or Ser; Xaa at position 74 is Cys or Ser; Xaa at position 104 is Asp, Gly or Val; Xaa at position 108 is Leu, Ala, Val, Arg, Trp, Gln or Gly; Xaa at position 115 is Thr, His, Leu or Ala; Xaa at position 120 is Gln, Gly, Arg, Lys or His; Xaa at position 123 is Glu, Arg, Phe or Thr; Xaa at position 144 is Phe, His, Arg, Pro, Leu, Gln or GIu; Xaa at position 146 is Arg or Gln; Xaa at position 147 is Arg or Gln; Xaa at position 156 is His, GIy or Ser; Xaa at position 159 is Ser, Arg, Thr, Tyr, Val or Gly; Xaa at position 162 is Glu, Leu, Gly or Trp; Xaa at position 163 is Val, Gly, Arg or Ala; Xaa at position 169 is Arg, Ser, Leu, Arg or Cys; Xaa at position 170 is His, Arg or Ser; Wherein optionally 1-11 amino acids from the N-terminus and 1-5 amino acids from the C-terminus may be deleted from the modified human G-CSF amino acid sequence as described above; Wherein the N-terminus can be linked directly to the C-terminus, or via the linker which is capable of linking the N-terminus to the C-terminus and having the new C- and N-terminus at the following amino acids; R ₂ is a polypeptide comprising a modified human IL-3 amino acid sequence of the following formula: Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asp; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus may be optionally deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 1 to 44 of the amino acids represented by Xaa are different from the corresponding amino acids of the original (l-133) human interleukin-3; Wherein L ₁ is a linker that can be connected to R ₁ to R _2; And In addition, the hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R ₁ is a polypeptide comprising a modified human G-CSF amino acid sequence of the formula: (SEQ ID NO: 1) In the above sequence Xaa in position 1 is Thr, Ser, Arg, Tyr or Gly; Xaa of position 2 is Pro or Leu; Xaa at position 3 is Leu, Arg, Tyr or Ser; Xaa at position 13 is Phe, Ser, His, Thr or Pro; Xaa at position 16 is Lys, Pro, Ser, Thr or His; Xaa at position 17 is Cys, Ser, Gly, Ala, Ile, Tyr or Arg; Xaa at position 18 is Leu, Thr, Pro, His, He or Cys; Xaa at position 22 is Arg, Tyr, Ser, Thr or Ala; Xaa at position 24 is Ile, Pro, Tyr or Leu; Xaa at position 27 is Asp or Gly; Xaa at position 30 is Ala, Ile, Leu or Gly; Xaa at position 34 is Lys or Ser; Xaa at position 36 is Cys or Ser; Xaa at position 42 is Cys or Ser; Xaa at position 43 is His, Thr, Gly, Val, Lys, Trp, Ala, Arg, Cys or Leu; Xaa at position 44 is Pro, Gly, Arg, Asp, Val, Ala, His, Trp, Gln or Thr; Xaa at position 46 is Glu, Arg, Phe, Arg, Ile or Ala; Xaa of position 47 is Leu or Thr; Xaa at position 49 is Leu, Phe, Arg or Ser; Xaa at position 50 is Leu, Ile, His, Pro or Tyr; Xaa at position 54 is Leu or His; Xaa at position 64 is Cys or Ser; Xaa at position 67 is Gln, Lys, Leu or Cys; Xaa at position 70 is Gln, Pro, Leu, Arg or Ser; Xaa at position 74 is Cys or Ser; Xaa at position 104 is Asp, Gly or Val; Xaa at position 108 is Leu, Ala, Val, Arg, Trp, Gln or Gly; Xaa at position 115 is Thr, His, Leu or Ala; Xaa at position 120 is Gln, Gly, Arg, Lys or His; Xaa at position 123 is Glu, Arg, Phe or Thr; Xaa at position 144 is Phe, His, Arg, Pro, Leu, Gln or GIu; Xaa at position 146 is Arg or Gln; Xaa at position 147 is Arg or Gln; Xaa at position 156 is His, GIy or Ser; Xaa at position 159 is Ser, Arg, Thr, Tyr, Val or Gly; Xaa at position 162 is Glu, Leu, Gly or Trp; Xaa at position 163 is Val, Gly, Arg or Ala; Xaa at position 169 is Arg, Ser, Leu, Arg or Cys; Xaa at position 170 is His, Arg or Ser; Wherein optionally 1-11 amino acids from the N-terminus and 1-5 amino acids from the C-terminus may be deleted from the modified human G-CSF amino acid sequence as described above; Wherein the N-terminus can be linked directly to the C-terminus, or via the linker which is capable of linking the N-terminus to the C-terminus and having the new C- and N-terminus at the following amino acids; R ₂ is a polypeptide comprising a modified human c-mpl ligand amino acid sequence of the following formula: (SEQ ID NO: 256) In the above sequence Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met; Xaa at position 113 is deleted or Pho, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have new C- and N-terminus at the following amino acids; Wherein L ₁ is a linker that can be connected to R ₁ to R _2; And In addition, the hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R < ₁ > is a polypeptide comprising a modified human c-mpl ligand amino acid sequence of the formula: (SEQ ID NO: 256) In the above sequence Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met; Xaa at position 113 is deleted or Pho, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have new C- and N-terminus at the following amino acids; R ₂ is a polypeptide comprising a modified human IL-3 amino acid sequence of the following formula: Xaa at position 17 in the sequence is Ser, Lys, Gly, Asp, Met, Gln or Arg; Xaa at position 18 is Asn, His, Leu, Ile, Phe, Arg or Gln; Xaa at position 19 is Met, Phe, Ile, Arg, Gly, Ala or Cys; Xaa at position 20 is Ile, Cys, Gln, Glu, Arg, Pro or Ala; Xaa at position 21 is Asp, Phe, Lys, Arg, Ala, Gly, Glu, Gln, Asn, Thr, Ser or Val; Xaa at position 22 is Glu, Trp, Pro, Ser, Ala, His, Asp, Asn, Gln, Leu, Val or Gly; Xaa at position 23 is Ile, Val, Ala, Gly, Trp, Lys, Phe, Leu, Ser or Arg; Xaa at position 24 is Ile, GIy, Val, Arg, Ser, Phe or Leu; Xaa at position 25 is Thr, His, Gly, Gln, Arg, Pro or Ala; Xaa at position 26 is His, Thr, Phe, Gly, Arg, Ala or Trp; Xaa at position 27 is Leu, Gly, Arg, Thr, Ser or Ala; Xaa at position 28 is Lys, Arg, Leu, Gln, Gly, Pro, Val or Trp; Xaa at position 29 is Gln, Asn, Leu, Pro, Arg or Val; Xaa at position 30 is Pro, His, Thr, Gly, Asp, Gln, Ser, Leu or Lys; Xaa at position 31 is Pro, Asp, Gly, Ala, Arg, Leu or Gln; Xaa at position 32 is Leu, VaI, Arg, Gln, Asn, GIy, Ala or GIu; Xaa at position 33 is Pro, Leu, Gln, Ala, Thr or GIu; Xaa at position 34 is Leu, Val, Gly, Ser, Lys, Glu, Gln, Thr, Arg, Ala, Phe, Ile or Met; Xaa at position 35 is Leu, Ala, Gly, Asn, Pro, Gln or Val; Xaa at position 36 is Asp, Leu or Val; Xaa at position 37 is Phe, Ser, Pro, Trp or Ile; Xaa of position 38 is Asn or Ala; Xaa at position 40 is Leu, Trp or Arg; Xaa at position 41 is Asn, Cys, Arg, Leu, His, Met or Pro; Xaa at position 42 is Gly, Asp, Ser, Cys, Asn, Lys, Thr, Leu, Val, Glu, Phe, Tyr, Ile, Met or Ala; Xaa at position 43 is Glu, Asn, Tyr, Leu, Phe, Asp, Ala, Cys, Gln, Arg, Thr, Gly or Ser; Xaa at position 44 is Asp, Ser, Leu, Arg, Lys, Thr, Met, Trp, Glu, Asn, Gln, Ala or Pro; Xaa at position 45 is Gln, Pro, Phe, Val, Met, Leu, Thr, Lys, Trp, Asp, Asn, Arg, Ser, Ala, Ile, Glu or His; Xaa at position 46 is Asp, Phe, Ser, Thr, Cys, Glu, Asn, Gln, Lys, His, Ala, Tyr, Ile, Val or Gly; Xaa at position 47 is Ile, GIy, Val, Ser, Arg, Pro or His; Xaa at position 48 is Leu, Ser, Cys, Arg, Ile, His, Phe, Glu, Lys, Thr, Ala, Met, Val or Asn; Xaa at position 49 is Met, Arg, Ala, Gly, Pro, Asn, His or Asp; Xaa at position 50 is Glu, Leu, Thr, Asp, Tyr, Lys, Asn, Ser, Ala, Ile, Val, His, Phe, Met or Gln; Xaa at position 51 is Asn, Arg, Met, Pro, Ser, Thr or His; Xaa at position 52 is Asn, His, Arg, Leu, Gly, Ser, or Thr; Xaa at position 53 is Leu, Thr, Ala, Gly, Glu, Pro, Lys, Ser or Met; Xaa at position 54 is Arg, Asp, Ile, Ser, Val, Thr, Gln, Asn, Lys, His, Ala or Leu; Xaa at position 55 is Arg, Thr, Val, Ser, Leu or Gly; Xaa at position 56 is Pro, Gly, Cys, Ser, Gln, Glu, Arg, His, Thr, Ala, Tyr, Phe, Leu, Val or Lys; Xaa at position 57 is Asn or Gly; Xaa at position 58 is Leu, Ser, Asp, Arg, Gln, Val or Cys; Xaa at position 59 is Glu, Tyr, His, Leu, Pro or Arg; Xaa at position 60 is Ala, Ser, Pro, Tyr, Asn or Thr; Xaa at position 61 is Phe, Asn, Glu, Pro, Lys, Arg or Ser; Xaa at position 62 is Asn, His, Val, Arg, Pro, Thr, Asp or Ile; Xaa at position 63 is Arg, Tyr, Trp, Lys, Ser, His, Pro or Val; Xaa at position 64 is Ala, Asn, Pro, Ser or Lys; Xaa at position 65 is Val, Thr, Pro, His, Leu, Phe or Ser; Xaa at position 66 is Lys, Ile, Arg, Val, Asn, GIu or Ser; Xaa at position 67 is Ser, Ala, Phe, Val, Gly, Asn, He, Pro or His; Xaa at position 68 is Leu, Val, Trp, Ser, Ile, Phe, Thr or His; Xaa at position 69 is Gln, Ala, Pro, Thr, Glu, Arg, Trp, Gly or Leu; Xaa at position 70 is Asn, Leu, Val, Trp, Pro or Ala; Xaa at position 71 is Ala, Met, Leu, Pro, Arg, Glu, Thr, Gln, Trp or Asn; Xaa at position 72 is Ser, Glu, Met, Ala, His, Asn, Arg or Asp; Xaa at position 73 is Ala, Glu, Asp, Leu, Ser, Gly, Thr or Arg; Xaa at position 74 is Ile, Met, Thr, Pro, Arg, Gly, Ala; Xaa at position 75 is Glu, Lys, Gly, Asp, Pro, Trp, Arg, Ser, Gln or Leu; Xaa at position 76 is Ser, Val, Ala, Asn, Trp, Glu, Pro, Gly or Asp; Xaa at position 77 is Ile, Ser, Arg, Thr or Leu; Xaa at position 78 is Leu, Ala, Ser, Glu, Phe, Gly or Arg; Xaa at position 79 is Lys, Thr, Asn, Met, Arg, Ile, GIy or Asp; Xaa at position 80 is Asn, Trp, Val, Gly, Thr, Leu, Glu or Arg; Xaa at position 81 is Leu, Gln, Gly, Ala, Trp, Arg, Val or Lys; Xaa at position 82 is Leu, Gln, Lys, Trp, Arg, Asp, Glu, Asn, His, Thr, Ser, Ala, Tyr, Phe, Ile, Met or Val; Xaa at position 83 is Pro, Ala, Thr, Trp, Arg or Met; Xaa at position 84 is Cys, Glu, Gly, Arg, Met or Val; Xaa at position 85 is Leu, Asn, Val or Gln; Xaa at position 86 is Pro, Cys, Arg, Ala or Lys; Xaa at position 87 is Leu, Ser, Trp or Gly; Xaa at position 88 is Ala, Lys, Arg, Val or Trp; Xaa at position 89 is Thr, Asp, Cys, Leu, VaI, Glu, His, Asn or Ser; Xaa at position 90 is Ala, Pro, Ser, Thr, Gly, Asp, Ile or Met; Xaa at position 91 is Ala, Pro, Ser, Thr, Phe, Leu, Asp or His; Xaa at position 92 is Pro, Phe, Arg, Ser, Lys, His, Ala, Gly, Ile or Leu; Xaa at position 93 is Thr, Asp, Ser, Asn, Pro, Ala, Leu or Arg; Xaa at position 94 is Arg, Ile, Ser, Glu, Leu, Val, Gln, Lys, His, Ala or Pro; Xaa at position 95 is His, Gln, Pro, Arg, Val, Leu, Gly, Thr, Asn, Lys, Ser, Ala, Trp, Phe, Ile or Tyr; Xaa at position 96 is Pro, Lys, Tyr, Gly, Ile or Thr; Xaa at position 97 is Ile, Val, Lys, Ala or Asn; Xaa at position 98 is His, Ile, Asn, Leu, Asp, Ala, Thr, Glu, Gln, Ser, Phe, Met, Val, Lys, Arg, Tyr or Pro; Xaa at position 99 is Ile, Leu, Arg, Asp, Val, Pro, Gln, Gly, Ser, Phe or His; Xaa at position 100 is Lys, Tyr, Leu, His, Arg, Ile, Ser, Gln or Pro; Xaa at position 101 is Asp, Pro, Met, Lys, His, Thr, Val, Tyr, Glu, Asn, Ser, Ala, Gly, Ile, Leu or Gln; Xaa at position 102 is Gly, Leu, Glu, Lys, Ser, Tyr or Pro; Xaa at position 103 is Asp or Ser; Xaa at position 104 is Trp, Val, Cys, Tyr, Thr, Met, Pro, Leu, Gln, Lys, Ala, Phe or Gly; Xaa at position 105 is Asn, Pro, Ala, Phe, Ser, Trp, Gln, Tyr, Leu, Lys, Ile, Asp or His; Xaa at position 106 is Glu, Ser, Ala, Lys, Thr, Ile, Gly or Pro; Xaa at position 108 is Arg, Lys, Asp, Leu, Thr, Ile, Gln, His, Ser, Ala or Pro; Xaa at position 109 is Arg, Thr, Pro, Glu, Tyr, Leu, Ser, or Gly; Xaa at position 110 is Lys, Ala, Asn, Thr, Leu, Arg, Gln, His, Glu, Ser or Trp; Xaa at position 111 is Leu, Ile, Arg, Asp or Met; Xaa at position 112 is Thr, Val, Gln, Tyr, Glu, His, Ser or Phe; Xaa at position 113 is Phe, Ser, Cys, His, Gly, Trp, Tyr, Asp, Lys, Leu, He, Val or Asp; Xaa at position 114 is Tyr, Cys, His, Ser, Trp, Arg or Leu; Xaa at position 115 is Leu, Asn, Val, Pro, Arg, Ala, His, Thr, Trp or Met; Xaa at position 116 is Lys, Leu, Pro, Thr, Met, Asp, Val, Glu, Arg, Trp, Ser, Asn, His, Ala, Tyr, Phe, Gln or Ile; Xaa at position 117 is Thr, Ser, Asn, Ile, Trp, Lys or Pro; Xaa at position 118 is Leu, Ser, Pro, Ala, Glu, Cys, Asp or Tyr; Xaa at position 119 is Glu, Ser, Lys, Pro, Leu, Thr, Tyr or Arg; Xaa at position 120 is Asn, Ala, Pro, Leu, His, Val or Gln; Xaa at position 121 is Ala, Ser, Ile, Asn, Pro, Lys, Asp, or Gly; Xaa at position 122 is Gln, Ser, Met, Trp, Arg, Phe, Pro, His, Ile, Tyr or Cys; Xaa at position 123 is Ala, Met, Glu, His, Ser, Pro, Tyr or Leu; Wherein from 1 to 14 amino acids from the N-terminus may be optionally deleted and / or from 1 to 15 amino acids from the C-terminus may be optionally deleted; 1 to 44 of the amino acids represented by Xaa are different from the corresponding amino acids of the original (l-133) human interleukin-3; Wherein L ₁ is a linker that can be connected to R ₁ to R _2; And In addition, the hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). 9. A hematopoietic protein according to claim 6 or 8, wherein R < _{2 >} is selected from the group consisting of (SEQ ID NO: 225) (SEQ ID NO: 226) (SEQ ID NO: 227) And (SEQ ID NO: 228) A hematopoietic protein characterized by comprising an amino acid sequence of the following formula. R ₁ -L ₁ -R ₂ , R ₂ -L ₁ -R ₁ , R ₁ -R ₂ , or R ₂ -R ₁ Wherein R < ₁ > is a polypeptide comprising a modified human c-mpl ligand amino acid sequence of the formula: (SEQ ID NO: 256) In the above sequence Xaa at position 112 is deleted or Leu, Ala, Val, Ile, Pro, Phe, Trp or Met; Xaa at position 113 is deleted or Pho, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 114 is deleted or Pro, Phe, Ala, Val, Leu, Ile, Trp or Met; Xaa at position 115 is deleted or Gln, Gly, Ser, Thr, Tyr or Asn; Wherein the N-terminus is linked directly to the C-terminus, or via a linker (L ₂ ) which can link the N-terminus to the C-terminus and which may have new C- and N-terminus at the following amino acids; R ₂ is G-CSF or G-CSF Ser ¹⁷ ; Wherein L ₁ is a linker that can be connected to R ₁ to R _2; And The hematopoietic protein may optionally be preceded by (methionine- ¹ ), (alanine- ¹ ) or (methionine- ² , alanine- ¹ ). The linker (L ₂ ) according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, ≪ / RTI > or a pharmaceutically acceptable salt thereof. (SEQ ID NO: 12) GlyGlyGlySer; (SEQ ID NO: 242) GlyGlyGlySerGlyGlyGlySer; (SEQ ID NO: 243) GlyGlyGlySerGlyGlyGlySerGlyGlyGlySer; (SEQ ID NO: 244) SerGlyGlySerGlyGlySer; (SEQ ID NO: 245) GluPheGlyAsnMetAla; (SEQ ID NO: 246) GluPheGlyGlyAsnMetAla; (SEQ ID NO: 247) GluPheGlyGlyAsnGlyGlyAsnMetAla; And (SEQ ID NO: 248) GlyGlySerAspMetAlaGly. The hematopoietic protein according to claim 9, wherein the linker (L ₂ ) is selected from the group consisting of (SEQ ID NO: 12) GlyGlyGlySer; (SEQ ID NO: 242) GlyGlyGlySerGlyGlyGlySer; (SEQ ID NO: 243) GlyGlyGlySerGlyGlyGlySerGlyGlyGlySer; (SEQ ID NO: 244) SerGlyGlySerGlyGlySer; (SEQ ID NO: 245) GluPheGlyAsnMetAla; (SEQ ID NO: 246) GluPheGlyGlyAsnMetAla; (SEQ ID NO: 247) GluPheGlyGlyAsnGlyGlyAsnMetAla; And (SEQ ID NO: 248) GlyGlySerAspMetAlaGly. The hematopoietic protein according to claim 1, wherein the protein is selected from the group consisting of: (SEQ ID NO: 166) (SEQ ID NO: 167) (SEQ ID NO: 168) (SEQ ID NO: 169) (SEQ ID NO: 170) (SEQ ID NO: 171) (SEQ ID NO: 172) (SEQ ID NO: 173) (SEQ ID NO: 177) (SEQ ID NO: 175) (SEQ ID NO: 176) (SEQ ID NO: 177) (SEQ ID NO: 179) (SEQ ID NO: 181) (SEQ ID NO: 182) (SEQ ID NO: 183) (SEQ ID NO: 184) (SEQ ID NO: 194) (SEQ ID NO: 195) (SEQ ID NO: 196) (SEQ ID NO: 197) (SEQ ID NO: 198) (SEQ ID NO: 209) (SEQ ID NO: 210) (SEQ ID NO: 211) (SEQ ID NO: 212) (SEQ ID NO: 186) (SEQ ID NO: 187) (SEQ ID NO: 189) (SEQ ID NO: 190) (SEQ ID NO: 191) (SEQ ID NO: 199) (SEQ ID NO: 200) (SEQ ID NO: 201) (SEQ ID NO: 202) (SEQ ID NO: 221) (SEQ ID NO: 222) (SEQ ID NO: 223) (SEQ ID NO: 234) (SEQ ID NO: 235) (SEQ ID NO: 236) (SEQ ID NO: 237) (SEQ ID NO: 238) And (SEQ ID NO: 239) The method according to any one of claims 1, 2, 3, 4, 5, 6, 7, 8, 10 and 20, wherein the colony forming stimulus Factors such as GM-CSF, G-CSF, G-CSF Ser ¹⁷ , c-mpl ligand (TPO), M-CSF, erythropoietin (EPO), IL-1, IL-4, IL- IL-15, LIF, flt3 / flk2 ligand, human growth hormone, IL-6, IL-6, IL-7, IL-8, IL-9, IL-10, IL- B-cell growth factor, B-cell differentiation factor, eosinophil factor and hepatocyte factor (SCF). ^{15. The} hematopoietic protein of claim 14, wherein the colony-forming stimulating factor is selected from the group consisting of G-CSF, G-CSF Ser17 and c-mpl ligand (TPO). A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 1. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 2. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 3. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 4. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 5. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 6. A nucleic acid molecule which encodes the hematopoietic protein of claim 7. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 8. 10. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 9. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 10. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 11. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 12. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 13. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 14. A nucleic acid molecule characterized by encoding said hematopoietic protein of claim 15. 28. The nucleic acid molecule according to claim 27, which is selected from the group consisting of: (SEQ ID NO: 94) (SEQ ID NO: 95) (SEQ ID NO: 96) (SEQ ID NO: 97) (SEQ ID NO: 98) (SEQ ID NO: 99) (SEQ ID NO: 100) (SEQ ID NO: 101) (SEQ ID NO: 102) pMON25191 (SEQ ID NO: 107) (SEQ ID NO: 103) (SEQ ID NO: 104) (SEQ ID NO: 105) (SEQ ID NO: 109) (SEQ ID NO: 110) (SEQ ID NO: 111) (SEQ ID NO: 112) (SEQ ID NO: 155) (SEQ ID NO: 156) (SEQ ID NO: 157) (SEQ ID NO: 158) (SEQ ID NO: 159) (SEQ ID NO: 124) (SEQ ID NO: 125) (SEQ ID NO: 126) (SEQ ID NO: 127) (SEQ ID NO: 128) (SEQ ID NO: 114) (SEQ ID NO: 115) (SEQ ID NO: 116) (SEQ ID NO: 117) (SEQ ID NO: 86) (SEQ ID NO: 87) (SEQ ID NO: 88) (SEQ ID NO: 90) (SEQ ID NO: 91) (SEQ ID NO: 136) (SEQ ID NO: 137) (SEQ ID NO: 148) (SEQ ID NO: 149) (SEQ ID NO: 150) (SEQ ID NO: 151) (SEQ ID NO: 152) (SEQ ID NO: 153) And (SEQ ID NO: 154) The method according to any one of claims 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, A host cell transformed or transfected with a replicable vector comprising the nucleic acid molecule of any one of claims 26, 27, 28, 29, 30, 31, A method for producing a hematopoietic protein, which comprises recovering a hematopoietic protein. The method of claim 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13 or 14 ≪ / RTI > and a pharmaceutically acceptable carrier. The method of claim 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13 or 14 Comprising administering to said patient an effective amount of a hematopoietic protein as set forth in claim < RTI ID = 0.0 > 11. < / RTI > A method for stimulating hematopoietic cell generation in a patient, which comprises administering to the patient an effective amount of a hematopoietic protein as defined in claim 9. (a) separating hepatocytes from other cells; (b) The method of claim 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13 Culturing the separated hepatocytes with a selected medium containing the hematopoietic protein of claim 14; And (c) harvesting the cultured cells / RTI > The method of claim 1, (a) separating hepatocytes from other cells; (b) culturing the separated hepatocytes in a selected medium containing the hemaglobin protein of claim 9; And (c) harvesting the cultured cells / RTI > The method of claim 1, (a) transferring hepatocytes; (b) separating hepatocytes from other cells; (c) The method of claim 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13 Culturing the separated hepatocytes with a selected medium containing the hematopoietic protein of claim 14; (d) harvesting the cultured cells; And (e) transplanting the cultured cells into the patient ≪ / RTI > a method of treating a patient with a hematopoietic disorder. (a) transferring hepatocytes; (b) separating hepatocytes from other cells; (c) culturing the separated hepatocytes in a selected medium containing the hematopoietic protein of claim 9; (d) harvesting the cultured cells; And (e) transplanting the cultured cells into the patient ≪ / RTI > a method of treating a patient with a hematopoietic disorder. (a) transferring hepatocytes from a patient; (b) separating the hepatocytes from other cells; (c) The method of claim 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13 Culturing the separated hepatocytes with a selected medium containing the hematopoietic protein of claim 14; (d) introducing the DNA into the cultured cells; (e) harvesting the transduced cells; And (f) transplanting said transduced cells into said patient / RTI > of claim 1, wherein the human gene therapy method comprises the steps of: (a) transferring hepatocytes from a patient; (b) separating the hepatocytes from other cells; (c) The method of claim 1, 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13 Culturing the separated hepatocytes with a selected medium containing the hematopoietic protein of claim 14; (d) introducing the DNA into the cultured cells; (e) harvesting the transduced cells; And (f) transplanting said transduced cells into said patient / RTI > of claim 1, wherein the human gene therapy method comprises the steps of: