KR102681662B1 - Composition for preventing, improving, or treating hair loss, or for promoting hair growth, containing a fusion peptide in which a pentapeptide and biotin are combined - Google Patents

Abstract

The present invention relates to a composition for preventing, improving or treating hair loss, or for promoting hair growth or hair growth, comprising a fusion peptide combining pentapeptide and biotin.
The fusion peptide combining pentapeptide and biotin according to the present invention has the effect of preventing or improving hair loss, or promoting hair growth or hair growth by increasing melanin biosynthesis and hair growth promoting factors, and is used as a material for cosmetics and pharmaceuticals. possible.

Description

{Composition for preventing, improving, or treating hair loss, or for promoting hair growth, containing a fusion peptide in which a pentapeptide and biotin are combined}

The present invention relates to a composition for preventing, improving or treating hair loss, or for promoting hair growth or hair growth, comprising a fusion peptide combining pentapeptide and biotin.

Hair is very important not only because it primarily protects the skin and scalp, but also because it plays a unique role in social and sexual communication. In the human body, hair grows from hair follicles in the skin, and the hair follicles from which hair grows are complex organs composed of the inner root epithelial sheath, outer root epithelial sheath, hair stem, and hair matrix, and go through cycles such as growth, catagen, and telogen throughout life. has the characteristic of being continuously repeated. In particular, among the cells that form hair follicles, dermal papilla cells play an important role in hair growth, and during the growth period of hair follicles, proliferation of hair follicle constituent cells, including keratinocytes of the stroma surrounding the dermal papilla, occurs. In the catagen phase, hair follicle growth stops and apoptosis, condensation of the dermal papilla, and reorganization of the extracellular matrix occur. In the telogen phase, which is the stage in which the hair follicle prepares to enter the growth phase again, only the permanently lasting parts, including the ridges, remain. This remains.

On the human scalp, 85-90% of the hair is in the anagen phase, which lasts for an average of 3 years. Hair bulbs exist in mature hair follicles in the growth stage, and the hair bulbs are the place where hair follicle proliferation occurs and contain melanin-forming cells. It is known that melanocytes play a very important role in the growth cycle and development of hair.

In particular, the differentiation and development of melanocytes are very active during the period of hair follicle formation. At this time, melanosomes produced from melanin-forming cells stabilize the hair growth cycle and complete the generation of hair bulbs. For hair to grow, the production of hair bulbs is essential.

Additionally, melanin is a major factor that determines hair color. Melanin synthesis uses tyrosine, an amino acid, as a substrate through tyrosinase, tyrosinase-related protein-1 (TRP-1), and tyrosinase-related protein-2 (TRP-2). It is converted to DOPA quinone through 4-dihydroxyphenylalanine (DOPA), and through autoxidation and enzyme reactions to DOPA chrome to produce melanin, a dark brown complex. In addition, microphthalmia-associated transcription factor (MITF), a well-known regulator of melanin formation, binds to the M-box sequence of tyrosinase and TRPs to regulate the expression of enzymes involved in melanin formation. It is well known that Therefore, melanin formation in hair is important for hair blackening.

Meanwhile, hair loss refers to the absence of hair in areas where hair should normally exist, and generally refers to the loss of hair (thick, black hair) on the scalp. The causes of this hair loss have been discussed, including poor blood circulation, excessive male hormone action, excessive sebum secretion, decreased scalp function due to peroxides and bacteria, genetic factors, aging, and stress, but there is still no clear explanation for hair loss. The cause is unknown. In general, the most typical form of hair loss is male-pattern alopecia, which is caused by excessive action of male hormones. It occurs dependent on androgens, male hormones. Representative androgens include testosterone and dihydrotestosterone, and hair loss patients are more likely to have DHT. It is known. Testosterone is converted to DHT by 5-reductase, and this conversion occurs by Type 2 5-alpha-reductase among the two types of 5-alpha-reductase, Type 1 and Type 2. It has been reported that converted DHT causes gradual shrinkage of dermal papillae and hair follicles.

Currently, the most widely used treatment and prevention of alopecia is Upjohn's minoxidil-containing preparation approved by the U.S. FDA, and recently, Merck & Co. has introduced finasteride, the main ingredient of which has a Type 2 5-alpha-reductase inhibitory effect. Propecia has been released and is being used. However, the reality is that minoxidil or finasteride are difficult to use for a long period of time because the effects are minimal or vary greatly from person to person and have side effects. Therefore, there is an urgent need for the development of anti-hair loss agents, hair growth agents, hair growth agents, and hair growth agents that have no side effects and are highly stable.

Republic of Korea Patent Publication No. 10-2022-0118611

The present invention aims to solve the above-described problems and other problems associated therewith.

The object of the present invention is the pentapeptide of SEQ ID NO: 1; And to provide a cosmetic composition for preventing or improving hair loss, or promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide.

Another object of the present invention is the pentapeptide of SEQ ID NO: 1; And to provide a pharmaceutical composition for preventing or treating hair loss comprising a fusion peptide containing biotin bound to the pentapeptide.

Another object of the present invention is the pentapeptide of SEQ ID NO: 1; And to provide a quasi-drug composition for preventing or improving hair loss, including a fusion peptide containing biotin bound to the pentapeptide.

Another object of the present invention is the pentapeptide of SEQ ID NO: 1; and a food composition for preventing or improving hair loss, or promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide.

Another object of the present invention is the pentapeptide of SEQ ID NO: 1; and a fusion peptide containing biotin bound to the pentapeptide, to provide a feed composition for preventing or improving hair loss, or for promoting hair growth or hair growth.

The technical problem to be achieved according to the technical idea of the invention disclosed in this specification is not limited to the problem to solve the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below. There will be.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Additionally, the scope of the present application cannot be considered limited by the specific description described below.

In one aspect for achieving the above object, the present invention provides a pentapeptide of SEQ ID NO: 1; It provides a composition for preventing, improving or treating hair loss, or for promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide. Specifically, the present invention develops a new peptide derivative to prevent the side effects of existing hair loss treatments and provide an effect in preventing hair loss or improving hair growth, and to prevent and improve hair loss including a fusion peptide combining biotin and pentapeptide and the same. Alternatively, a composition for treatment or for promoting hair growth or hair growth is provided.

In another aspect for achieving the above object, the present invention provides a pentapeptide of SEQ ID NO: 1; and a fusion peptide containing biotin bound to the pentapeptide. It provides a cosmetic composition for preventing or improving hair loss, or for promoting hair growth or hair growth.

In the present invention, the 'peptide' is a substance in which two or more amino acids are linked in the form of a chemical bond called a peptide bond, and the 'pentapeptide' may be composed of the amino acid sequence of SEQ ID NO: 1.

SEQ ID NO: 1: RKDVY

In the present invention, the 'biotin' is a water-soluble vitamin called vitamin B7 and vitamin H. If there is a lack of biotin in the body, hair thinning and damage, hair loss, nail damage, skin disease, and blood sugar control problems occur. Various problems can appear in the human body.

In the present invention, the biotin may be bound to the N-terminus of the pentapeptide, and the binding may be accomplished by a conventional liquid phase synthesis method, a solid phase peptide synthesis method, or a peptide synthesis method using an automatic peptide synthesizer, but preferably. may be achieved by solid phase peptide synthesis. Specifically, the pentapeptide of SEQ ID NO: 1; And the fusion peptide containing biotin bound to the pentapeptide may be represented by Formula 1 below.

[Formula 1]

In the present invention, 'hair loss' refers to a phenomenon in which hair completely falls out of the scalp, 'hair growth' refers to hair growing from the scalp, and 'hair growth' refers to hair growing longer and thicker. It means 'wool' and is used in the same sense as 'wool', another term used in the industry.

In the present invention, the 'prevention' refers to any act of suppressing or delaying hair loss by administering or applying a composition containing the fusion peptide of the present invention to an individual.

In the present invention, the 'improvement' refers to any action that improves or improves hair loss or hair condition by using a composition containing the fusion peptide of the present invention.

The cosmetic composition of the present invention may contain the fusion peptide in various amounts as long as it has the effect of preventing or improving hair loss or promoting hair growth or hair growth.

The composition of the present invention may increase melanin biosynthesis, and the present invention may stabilize the production of hair bulbs by promoting the proliferation of melanocytes and promotion of melanin biosynthesis. Specifically, the present invention relates to tyrosinase, tyrosinase related protein-1, dopachrome tautomerase, or microphthalmia, which are enzymes involved in melanin formation. It may increase the expression of transcription factors (microphthalmia-associated transcription factors).

Additionally, the composition of the present invention may increase the expression of wnt3a or noggin, and may increase the activity of tyrosinase. The 'Noggin' exists as a dimer in the human body, and the main role of Noggin is to inhibit BMP. Noggin binds to the site where BMP binds to the BMP receptor, preventing BMP from attaching to the receptor.

In addition to the fusion peptide, the cosmetic composition according to the present invention contains various ingredients commonly used in cosmetic compositions, such as water-soluble ingredients, powder ingredients, oils, surfactants, and moisturizers, as necessary, within the range that does not reduce the effect of the present invention. , viscosity modifiers, preservatives, antioxidants, fragrances, pigments, etc. may be combined.

Non-limiting examples of the surfactants that can be used include anionic surfactants, cationic surfactants, nonionic surfactants, and amphoteric surfactants. More specifically, the anionic surfactant includes alkylbenzene sulfonate, polyoxyalkylene alkyl sulfuric acid ester salt, alkyl sulfuric acid ester salt, olefin sulfonate, alkyl phosphate, polyoxyalkylene alkyl ether phosphate, and dialkyl sulfosuccine. Salts, fatty acid salts, etc. may be mentioned, and nonionic surfactants include polyoxyethylene alkyl ether, polyoxyethylene fatty acid ester, polyhydric alcohol fatty acid partial ester, polyoxyethylene polyhydric alcohol fatty acid partial ester, polyglycerol fatty acid ester, and polyoxyethylene fatty acid ester. Examples include ethylene hydrogenated castor oil derivatives and fatty acid diethanolamide. In addition, cationic surfactants include tertiary aliphatic amine salts, alkyltrimethylammonium halides, dialkyldimethylammonium halides, etc., and examples of amphoteric surfactants include amide betaine type, imidazolinium betaine type, and sulfobetaine type. etc. can be mentioned.

Examples of the moisturizing agent include glycerin, propylene glycol, 1,3-butylene glycol, dipropylene glycol, and sorbitol. Examples of the preservative include benzoic acid, dehydroacetic acid, paraoxybenzoic acid ester (methyl paraoxybenzoate, butyl paraoxybenzoate, etc.), phenoxyethanol, etc. In addition, the antioxidants include ascorbic acid, BHA, etc., and in addition, ultraviolet absorbers, anti-inflammatory agents, fresheners, etc. can be added.

The cosmetic composition of the present invention is selected from the group consisting of solution, emulsion, suspension, shampoo, tonic, lotion, oil, rinse, conditioner, treatment, cream, pack, spray, essence, mousse, paste, soap, powder or gel. It can be manufactured in a dosage form, but is not limited thereto.

The cosmetic composition of the present invention may further include one or more cosmetically acceptable carriers that are blended with general skin cosmetics, and common ingredients include, for example, oil, water, surfactant, moisturizer, lower alcohol, thickener, Chelating agents, pigments, preservatives, fragrances, etc. may be appropriately mixed, but are not limited thereto.

Cosmetically acceptable carriers included in the cosmetic composition of the present invention vary depending on the formulation of the cosmetic composition.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. are used as carrier ingredients. It may be, but is not limited to this. These may be used alone or in combination of two or more types.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, etc. may be used as carrier ingredients, and especially in the case of a spray, chlorofluorohydride may be additionally used. It may include propellants such as locarbon, propane/butane, or dimethyl ether, but is not limited thereto, and these may be used alone or in a mixture of two or more types.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent, or emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Propylene glycol, 1,3-butyl glycol oil, etc. can be used, especially cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan. may be used, but is not limited thereto, and may be used alone or in a mixture of two or more types.

When the formulation of the present invention is a suspension, the carrier components include water, liquid diluents such as ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, and miso. Crystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used, but are not limited thereto, and they may be used alone or in a mixture of two or more types.

When the formulation of the present invention is soap, alkali metal salts of fatty acids, hemiester salts of fatty acids, fatty acid protein hydrolyzates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. are used as carrier components. It may be, but is not limited to, these may be used alone or in combination of two or more types.

As another aspect for achieving the above object, the present invention provides a pentapeptide of SEQ ID NO: 1; and a fusion peptide containing biotin bound to the pentapeptide. It provides a pharmaceutical composition for preventing or treating hair loss.

The ‘biotin’, ‘pentapeptide’, ‘hair loss’, ‘prevention’ and ‘composition’ are as described above.

In the present invention, the 'treatment' refers to any action that improves, alleviates, or benefits hair loss by administering or applying a composition containing the fusion peptide of the present invention to an individual.

In the present invention, 'hair loss' refers to hair growth defects and partial or complete loss of hair, including alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis ( hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis It may include, but is not limited to, alopecia totalis, alopecia universalis, or telogen effluvium.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc.

Carriers for parenteral administration may also include water, suitable oils, saline solutions, aqueous glucose and glycols, and the like. Additionally, stabilizers and preservatives may be additionally included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally, and parenteral administration methods are not limited to, but are intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, and intraperitoneal. , may be administered intranasally, enterally, topically, sublingually, or rectally.

The pharmaceutical composition of the present invention can be formulated into a preparation for oral administration or parenteral administration according to the administration route described above. When formulated, one or more buffers (e.g. saline or phosphate buffered saline (PBS)), antioxidants, bacteriostatic agents, chelating agents (e.g. EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g. For example, aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrants or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, solutions, gels, syrups, slurries, suspensions or capsules, etc. These solid preparations include the pharmaceutical composition of the present invention and at least one excipient, e.g. For example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol and maltitol. It can be prepared by mixing cellulose, methyl cellulose, sodium carboxymethyl cellulose, hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or dragees can be obtained by combining the active ingredient with solid excipients, grinding them, adding suitable auxiliaries, and processing them into a granule mixture.

In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, or syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, or preservatives may be included. there is. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included. .

When administered parenterally, the pharmaceutical composition of the present invention can be formulated with a suitable parenteral carrier in the form of injections, transdermal administration, and nasal inhalation according to methods known in the art. The above injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. For injections, examples of suitable carriers include, but are not limited to, solvents or dispersion media including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), mixtures thereof, and/or vegetable oils. You can. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or sterile water for injection, and isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. . In order to protect the injection from microbial contamination, it may additionally contain various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. Additionally, in most cases, the injection may additionally contain an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administration, forms such as ointments, creams, lotions, gels, external solutions, paste preparations, linear preparations, and aerol preparations are included. Here, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

For inhalation administration, the compositions used according to the invention may be packaged in pressurized packs or using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. For pressurized aerosols, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a text generally known in all pharmaceutical chemistry.

The pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, or methods using biological response modifiers.

As another aspect for achieving the above object, the present invention provides a pentapeptide of SEQ ID NO: 1; and a fusion peptide containing biotin bound to the pentapeptide. It provides a quasi-drug composition for preventing or improving hair loss.

The ‘biotin’, ‘pentapeptide’, ‘hair loss’, ‘prevention’, ‘improvement’ and ‘composition’ are the same as described above.

In the present invention, the 'quasi-drug' refers to articles that are not instruments, machines, or devices among articles used for the purpose of diagnosing, treating, alleviating, treating, or preventing diseases in humans or animals, and that have pharmacological effects on the structure and function of humans or animals. Among the products used for the purpose of influencing, it refers to products excluding those that are not instruments, machines, or devices. One specific example may include preparations for internal use, but is not limited thereto, and the formulation method, dosage, and use method of quasi-drugs , components, etc. can be appropriately selected from conventional techniques known in the technical field.

In addition to the above ingredients, the quasi-drug composition of the present invention may further include pharmaceutically acceptable carriers, excipients, or diluents as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included.

As another aspect for achieving the above object, the present invention provides a pentapeptide of SEQ ID NO: 1; It provides a food composition for preventing or improving hair loss, or for promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide.

The terms 'biotin', 'pentapeptide', 'hair loss', 'prevention', 'improvement', 'hair growth', 'hair growth', and 'composition' are as described above.

The food composition of the present invention includes all forms of functional food, nutritional supplements, health food, food additives, and feed, and includes animals including humans and livestock. Targeted for consumption. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruit and its processed foods (canned fruit, bottled food, jam, marmalade, etc.), fish, meat, and their processed foods (ham, sausage, corned beef, etc.) , bread and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable protein, retort food, frozen food. , can be manufactured by adding the above active ingredients to various seasonings (soybean paste, soy sauce, sauce, etc.).

Additionally, nutritional supplements can be manufactured by adding the above-mentioned active ingredients to capsules, tablets, pills, etc. In addition, health functional foods are not limited to this, but for example, they can be manufactured in the form of tea, juice, and drinks and consumed by liquefying, granulating, encapsulating, and powdering so that they can be consumed as health drinks. Additionally, in order to use the fusion peptide in the form of a food additive, it can be prepared and used in powder or concentrate form. Additionally, it can be prepared in the form of a composition by mixing it with known active ingredients known to be effective in preventing or improving hair loss, or promoting hair growth or hair growth.

In addition to the above, the health food of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, It may contain glycerin, alcohol, or carbonating agent.

As another aspect for achieving the above object, the present invention provides a pentapeptide of SEQ ID NO: 1; and a fusion peptide containing biotin bound to the pentapeptide. It provides a feed composition for preventing or improving hair loss, or for promoting hair growth or hair growth.

The terms 'biotin', 'pentapeptide', 'hair loss', 'prevention', 'improvement', 'hair growth', 'hair growth', and 'composition' are as described above.

In the present invention, the 'feed' is any natural or artificial diet, meal, etc., or a component of the meal, for animals to eat, ingest, and digest, and is manufactured from various types of feed known in the art. Possible, and specifically, it may include, but is not limited to, concentrated feed, roughage, feed additives, feed supplements, pet nutrients, or special feed.

The feed additive of the present invention corresponds to supplementary feed under the Feed Management Act, and includes mineral preparations such as sodium bicarbonate (sodium bicarbonate), bentonite, magnesium oxide, and complex minerals, and trace minerals such as zinc, copper, cobalt, and selenium. Preparations, vitamin preparations such as kerotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex, protective amino acid preparations such as methionine and lysic acid, protective fatty acid preparations such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture Water, live bacteria such as mold fermentation products, yeast, etc. may be additionally included.

Concentrated feed includes seeds and fruits including grains such as wheat, oats, and corn, bran including rice bran, wheat bran, and barley bran as by-products obtained from refining grains, soybeans, soybeans, sesame seeds, linseed, coco palm, etc. It is a concentrate of residues such as residual starch, which is the main component of the starch residue remaining after removing starch from seed cakes, sweet potatoes, and potatoes, which are by-products obtained from oil extraction, fishmeal, fish residue, and fresh liquid obtained from fish. Animal feed such as fish soluble, meat meal, blood meal, feather meal, skim milk powder, dried whey, which is the remaining whey when producing cheese from milk, and casein from skim milk, yeast, etc. , chlorella, and seaweed, but are not limited to these. Forage includes raw grass feed such as wild grass, grass, and green cuttings, turnips for feed, beets for feed, root vegetables such as rutterbearger, a type of turnip, raw grass, green cuttings, and grains, etc., in silos. These include, but are not limited to, silage, which is stored feed that has been filled and fermented with lactic acid, field grass, hay made by cutting and drying grass, straw from breeding crops, and leaves from legumes. Special feeds include mineral feeds such as oyster shells and rock salt, urea feeds such as urea and its derivative diureide isobutane, and mixed feeds to supplement ingredients that are likely to be lacking when mixing only natural feed ingredients, or to increase the storability of the feed. Substances added in trace amounts include feed additives and dietary supplements, but are not limited to these.

The feed composition of the present invention may further include ingredients added to conventional feed. Examples of ingredients added to such feed may include grain powder, meat powder, and beans. In the above, the grain powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour. In the above, the meat powder may be a meat powder obtained by pulverizing any one or more selected from chicken, beef, pork, and ostrich meat. In the above, the pulses may be one or more types selected from soybeans, kidney beans, peas, and black beans.

In addition to grain powder, meat powder, and pulses, which are the ingredients added to the conventional feed mentioned above, the feed composition of the present invention can add one or more selected from nutrients and minerals to increase the nutritional value of the feed, and feed quality. In order to prevent deterioration, it may contain one or more selected from anti-fungal agents, antioxidants, anti-coagulants, emulsifiers, and binders.

The feed or feed additive of the present invention can be applied to a number of animal diets, including mammals, poultry, and fish.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention should not be construed as limited by these examples.

The composition containing a fusion peptide combining pentapeptide and biotin according to the present invention has effects such as preventing, improving or treating hair loss, or promoting hair growth or hair growth by increasing melanin biosynthesis and hair growth promoting factors, and is used in cosmetics, It can be used as a material for medicines, etc.

Figure 1 shows the structural formula, chemical formula, and molecular weight of biotinoyl pentapeptide, a new material fusion peptide of the present invention.
Figure 2 shows the results of measuring the purity of the fusion peptide of the present invention after purification.
Figure 3 shows the results of confirming cytotoxicity by treating human keratinocytes with the fusion peptide of the present invention.
Figure 4 shows the results of confirming cytotoxicity by treating human fibroblasts with the fusion peptide of the present invention.
Figure 5 shows the results of confirming cytotoxicity by treating human dermal papilla cells with the fusion peptide of the present invention.
Figures 6 and 7 show the results of confirming the melanin biosynthetic ability of the fusion peptide of the present invention.
Figures 8 to 10 show the results of confirming the effect of the fusion peptide of the present invention on gene expression of hair growth promoting factors (Wnt3a, Noggin) in dermal papilla cells.
Figures 11 to 14 show the results of confirming the effect of the fusion peptide of the present invention on gene expression of melanin biosynthesis promoters (DCT, TRP-1, tyrosinase, MITF).
Figure 15 shows the results of confirming the effect of increasing tyrosinase activity by measuring the change in L-DOPA oxidation activity of the fusion peptide of the present invention.
Figure 16 shows the results of measuring changes in tyrosinase activity of the fusion peptide of the present invention.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. Synthesis of new material fusion peptide of the present invention

The sequence of a peptide derivative that is effective in preventing hair loss and improving hair growth is a pentapeptide consisting of arginine-lysine-aspartic acid-valine-tyrosine, and a new material fusion peptide (hereinafter referred to as 'biotinyl pentapeptide') was developed by linking with biotin. (Figure 1).

For the highly efficient production of biotinyl pentapeptide (hereinafter referred to as 'ScalpON'), a synthesis method based on a solid phase synthesis platform was used. In a specific method, pentapeptide, which is the peptide part, was first synthesized by successively adding amino acids with protecting groups to insoluble polystyrene resin, and then the final sequence, biotin, was combined without separating it from the synthetic support. Afterwards, unbound biotin was removed from the reactant to synthesize highly pure ScalpON. The sequence of the pentapeptide is as shown in SEQ ID NO: 1 in Table 1 below, and the sequence of the synthesized ScalpON is as shown in Chemical Formula 1 below.

sequence number designation order One pentapeptide RKDVY

[Formula 1]

The synthesized ScalpON was purified by RP-HPLC (Reverse Phase-High Performance Liquid Chromatography). The column used at this time was a C18 column, and the purification solvent was solvent A (0.1% trifluoroacetic acid (TFA)). water containing this) and solvent B (acetonitrile containing 0.1% TFA) were used, and purification was performed using solvent gradient conditions. At this time, the purity was over 95% (Figure 2).

Example 2. Confirmation of safety of ScalpON on human keratinocytes

2.1. Human keratinocyte culture

The HaCaT cell line, a human keratinocyte, was cultured in an incubator at 37°C and 5% CO ₂ . When a degree of culture equivalent to 85 to 90% of the area of the culture vessel was shown, the cells were detached by trypsin treatment, counted, and subcultured at 5 × 10 ³ cells/cm ² . Cell culture included 10% fetal bovine serum (FBS), GIBCO, Cat. No., 26140-079, USA, 100 U/ml penicillin, and 100 ug/ml streptomycin. Added Dulbecco's Modified Eagle Medium (DMEM, GIBCO, Cat. No. 11995-065, USA) was used. A 75 T-flask (NUNC, Cat. No. 156499, Danmark) was used for subculture, and a 24 well plate (NUNC, Cat. No., 142475, Danmark) was used for cytotoxicity testing.

2.2. Toxicity test on human keratinocytes

In order to confirm whether ScalpON, the fusion peptide of the present invention, can show improvement effects without skin irritation even when used for a long period of time, the presence or absence of cytotoxicity on human keratinocytes was tested. Human keratinocytes cultured in the manner described in Example 2.1 were counted and dispensed into 24-well plates at 1×10 ⁴ cells/well using a heamacytometer. When cultured in DMEM containing 10% FBS for 24 hours and reached 60 to 70% of the surface area of the culture vessel, it was replaced with FBS-free DMEM containing ScalpON and cultured for another 24 hours. After incubation, 50 ul of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg/ml) was added and cultured for an additional 3 hours. Afterwards, all cell culture was discarded, and 500 ul of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was added to each well and stirred. Then, 100 ul was taken into 96 wells and 540 μl was used in Enzyme-Linked Immunosorbent Assay (ELISA). Absorbance was measured in nm. The degree of cytotoxicity was expressed as a percentage based on the absorption intensity of the control group treated with pure water instead of the sample.

Cell proliferation rate (%) = (absorbance of test group/absorbance of control group) × 100

2.3. Toxicity test results for human keratinocytes

^Initial culture per well: 5 As a result of treating ScalpON up to 1000 ppm, all showed a growth rate of over 95%, and at concentrations of 200, 400, and 600 ppm, the growth rate was over 100%.

This result confirmed that skin irritation due to cytotoxicity was not caused even when the fusion peptide ScalpON of the present invention was used for a long period of time.

Example 3. Confirmation of safety of ScalpON on fibroblasts

3.1. Fibroblast culture

Fibroblasts are cells that produce skin collagen such as hyaluronic acid, collagen, and elastin. For wrinkle improvement and elasticity, fibroblast proliferation and differentiation must occur.

The fibroblast CCD986-SK cell line was cultured in an incubator at 37°C and 5% CO ₂ . When a degree of culture equivalent to 85 to 90% of the area of the culture vessel was shown, the cells were detached by trypsin treatment, counted, and subcultured at 5 × 10 ³ cells/cm ² . Cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS), GIBCO, Cat. No., 26140-079, USA, 100 U/ml penicillin, and 100 ug/ml streptomycin. (DMEM, GIBCO, Cat. No. 11995-065, USA) was used. For subculture, 75 T-flasks (NUNC, Cat. No. 156499, Danmark) were used.

3.2. Toxicity test on fibroblasts

In order to confirm whether the fusion peptide ScalpON of the present invention can show improvement effects without skin irritation even when used for a long period of time, the cell proliferation rate of fibroblasts was tested. CCD986-SK cells were counted in a 24-well plate at 1 × 10 ⁴ cells/well using a heamacytometer and then dispensed. When cultured in DMEM containing 10% FBS for 24 hours and reached 60 to 70% of the surface area of the culture vessel, it was replaced with ScalpON of the present invention and cultured for another 24 hours. After incubation, 50 ul of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg/ml) was added and cultured for an additional 3 hours. Afterwards, all cell culture was discarded, and 500 ul of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was added to each well and stirred. Then, 100 ul each was taken into 96 wells and the absorbance was measured at 540 nm using Enzyme-Linked Immunosorbent Assay (ELISA). Measured. The degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using pure water instead of the sample.

Cell proliferation rate (%) = (absorbance of test group/absorbance of control group) × 100

3.3. Toxicity test results for fibroblasts

As a result of confirming the toxicity of ScalpON, the fusion peptide of the present invention, to human fibroblasts, the degree of proliferation was approximately 85% or more when ScalpON was treated up to 1000 ppm, and the proliferation was more than 90% at concentrations up to 200, 400, 800, and 1000 ppm. It was confirmed that a degree of proliferation was observed (Figure 4).

From these results, it was confirmed that skin irritation due to cytotoxicity was not caused even when the fusion peptide ScalpON of the present invention was used for a long period of time.

Example 4. Confirmation of safety of ScalpON on human dermal papilla cells

4.1. Human dermal papilla cell culture

Human dermal papilla cells were cultured in an incubator at 37°C and 5% CO ₂ . When a culture degree of 85 to 90% of the area of the culture vessel was shown, the cells were detached by treatment with trypsin, counted, and then subcultured at 5 × 10 ³ cells/cm ² . Cells were cultured in Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum (FBS), GIBCO, Cat. No., 26140-079, USA, 100 U/ml penicillin, and 100 ug/ml streptomycin. (DMEM, GIBCO, Cat. No. 11995-065, USA) was used. A 75 T-flask (NUNC, Cat. No. 156499, Danmark) was used for subculture, and a 24-well plate (NUNC, Cat. No., 142475, Danmark) was used for cytotoxicity testing. Due to the characteristics of the cells, all experiments used cells between passages 5 and 7.

4.2. Toxicity test on human dermal papilla cells

In order to confirm whether the fusion peptide ScalpON according to the present invention shows an improvement effect on the scalp, the presence or absence of cytotoxicity on human dermal papilla cells was observed.

The human dermal papilla cells cultured in Example 4-1 were equally counted at 1 × 10 ⁴ cells/well in a 24-well plate using a hemacytometer and then dispensed. Human dermal papilla cells were cultured in DMEM containing 10% FBS for 24 hours to reach 60 to 70% of the surface area of the culture vessel, then replaced with FBS-free DMEM containing the fusion peptide ScalpON according to the present invention and cultured for 24 hours. . Then, 50 ul of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg/ml) was added and incubated for an additional 3 hours. . Afterwards, all cell culture was discarded, and 500 ul of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was added to each well and stirred. 100 ul was taken from each well, and the absorbance was measured by performing an enzyme-linked immunosorbent assay (ELISA) at 540 nm. The cell proliferation rate was calculated using the following formula, and the degree of cytotoxicity was expressed as a percentage based on the absorption intensity of the control group using pure water.

Cell viability (%) = (absorbance of test group/absorbance of control group) × 100

4.3. Confirmation results of toxicity to human dermal papilla cells

Initial culture 1×10 ⁴ cells/well per well When cells were cultured to 60 to 70% of the surface area of the culture vessel, the cytotoxicity compared to the control group by adding ScalpON of the present invention at various concentrations is shown in Figure 5. As a result of treating ScalpON at 0, 200, 400, 600, 800, and 1000 ppm, a proliferation rate of more than 80% was observed, and 200 ppm showed the highest proliferation rate of more than 95%. In the ScalpON-treated group, cell activity was slightly decreased compared to the control group, but no toxicity was shown (Figure 5).

From these results, it was confirmed that scalp irritation due to cytotoxicity was not induced even when the fusion peptide ScalpON of the present invention was used for a long period of time.

Example 5. Confirmation of induction of melanin biosynthesis by the fusion peptide ScalpON according to the present invention using B16F10 melanocytes

In order to confirm that the peptide derivative according to the present invention induces melanin biosynthesis in hair melanocytes, an experiment on melanin synthesis was conducted.

5.1. B16F10 melanocyte culture

In order to confirm that the peptide derivative according to the present invention induces melanocyte biosynthesis, the B16F10 cell line, which is a hair cell that forms melanin, was cultured in an incubator at 37°C and 5% CO ₂ . When a culture degree corresponding to 85 to 90% of the area of the culture vessel was shown, the cells were detached by trypsin treatment, counted, and subcultured at 5 × 10 ³ cells/cm ² . Cell culture was performed using Dulbecco's Modified Eagle Medium (DMEM, GIBCO, Cat. No.11995-065, USA) was used. A 75 T-flask (NUNC, Cat. No.156499, Danmark) was used for subculture, and a 6-well plate (NUNC, Cat. No., 142475, Danmark) was used for experiments related to melanin biosynthesis induction.

5.2. Induction of melanin biosynthesis using B16F10 melanocytes

The fusion peptide ScalpON according to the present invention was treated with the B16F10 cell line, and the amount of melanin biosynthesis produced during cell culture was measured.

The B16F10 cell line was distributed in a 6-well plate at 1 × 10 ⁵ cells/well, and the culture medium was treated with ScalpON, the fusion peptide according to the present invention, at 400, 600, 800, and 1000 ppm. Then, to induce melanin biosynthesis, the cells were treated with 10 uM α-MSH (α-melanocyte-stimulating hormone) and cultured for an additional 72 hours. After further incubation, the medium in each well was removed, washed with PBS, and the cells were detached by trypsin treatment and transferred to an e-tube. The cells were centrifuged at 4°C and 12000 rpm for 10 minutes to precipitate them. Afterwards, all cell culture was discarded, and 500ul of 1N NaOH containing 10% DMSO was added. After completely dissolving the melanoma cells formed within the cells at 50°C for 30 minutes, 150 ul each was dispensed into a 96 well plate and the absorbance was measured at 490 nm using an enzyme-linked immunosorbent assay (ELISA). Melanin bioactivity was evaluated by expressing the melanin synthesis rate as a percentage using the formula below.

Melanin synthesis rate (%) = (absorbance of test group/absorbance of control group) × 100

5.3. Confirmation results of melanin biosynthesis in B16F10 melanocytes

It was confirmed with the naked eye that the fusion peptide ScalpON according to the present invention increased melanin biosynthesis (FIG. 6). In addition, when the α-MSH-treated control group was considered to have 100% melanin biosynthesis, it was confirmed that the biosynthetic performance increased by more than 20% by the fusion peptide ScalpON of the present invention (FIG. 7). In other words, it was confirmed that the fusion peptide ScalpON of the present invention significantly increases intracellular melanin biosynthesis by α-MSH.

Example 6. Confirmation of expression of hair growth promoting factors in human dermal papilla cells by the fusion peptide ScalpON according to the present invention

6.1. RNA extraction and cDNA synthesis from human dermal papilla cells

The cultured cells were equally counted at 1×10 ⁵ cells/well in a 6-well plate using a hemacytometer and then dispensed. When the cells are cultured in DMEM containing 10% FBS for 24 hours to cover 60 to 70% of the surface area of the culture vessel, FBS-free cells containing the fusion peptide ScalpON (200, 400, 600, 800, 1000 ppm) according to the present invention are grown. It was replaced with DMEM and cultured for 24 hours.

Cells after cell culture were lysed using QIAzol Lysis Reagent (QIAGEN, 79306, USA), then 0.2 mL chloroform (Duksan, 67-66-3, Korea) was added and left at room temperature. Centrifugation was carried out at 12,000 rpm and 4°C for 20 minutes to separate the supernatant containing protein from the supernatant containing mRNA. 0.5 mL isopropanol (Merck, 109634, Germany) was added to the supernatant and left at room temperature for 10 minutes. Then, the RNA was precipitated by centrifugation at 12,000 rpm and 4°C. After washing with 75% ethanol, the ethanol was removed and dried at room temperature. The dried mRNA was dissolved in diethylpyrocarbonate (DEPC, Biopure) water and used in the experiment. The extracted RNA was tested using Nanodrop (Nanodrop, USA), and only RNA with a purity of 1.8 or higher at 260 nm/280 nm was tested. It was used in . cDNA synthesis using Takara PrimeScript?? RT Master Mix (RR036A) was used. cDNA was synthesized by preparing a total of 10 μl of 1 μg RNA, 2 μl of 5ХPrimeScript RT Master Mix, and RNase Free dH ₂ O in a PCR tube and reacting at 37°C for 10 min and 85°C for 5 seconds.

6.2. RT-PCR

Expression of hair growth-related genes in the fraction was confirmed through RT-PCR using the cDNA synthesized in Example 6.1.

RT-PCR conditions are as follows.

After reaction at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at an appropriate temperature (55 to 65°C) for 30 seconds, and then extension at 72°C for 1 minute, the cycle was repeated for 30 cycles. After repeating several times, the final extension was performed in a PCR machine (BIO-GENER) at 72°C for 10 minutes. Each PCR product was loaded onto a 1.5% agarose gel and analyzed by electrophoresis at 100 V for 30 minutes.

Hair-related genes Wnt3a, Noggin and housekeeping GAPDH were used as primers, and the base sequences are shown in Table 2 below.

gene Length (bp) Forward Sequences (5’→3’) Reverse Sequences (5’→3’) Wnt3a 541 TCA GCT GCC AGG AGT GCA CG
(SEQ ID NO: 2) CGC CCT CAG GGA GCA GCC TAC
(SEQ ID NO: 3) Noggin 343 AGC ACC CAG CGA CAA CCT
(SEQ ID NO: 4) CAG CCA CAT CTG TAA CTT CCT C
(SEQ ID NO: 5) GAPDH 226 GAAGGTGAAGGTCGGAGT
(SEQ ID NO: 6) GAAGATGGTGATGGGATTTC
(SEQ ID NO: 7)

6.3. Results of confirming the expression of hair growth promoting factors of the fusion peptide ScalpON according to the present invention in human dermal papilla cells

Noggin is an antagonist of 'BMP', one of the Negative Cytokines, and is known to promote differentiation of stem cells and prevent destruction of hair follicle cells through BMP regulation. It is also known to promote hair growth by activating the Wnt/β-catenin signal, which is an essential signal for proliferation and differentiation of stem cells and hair follicle cells.

In human dermal papilla cells, the peptide derivative ScalpON according to the present invention significantly increased the concentration of Wnt3a and Noggin, factors involved in hair growth promotion (FIG. 8). Specifically, when ScalpON was treated at 200 to 1000 ppm, the expression level of Noggin increased up to about 7 times or more compared to the untreated group (FIG. 9). In addition, it was confirmed that the expression level of Wnt3a increased by up to approximately 3 times compared to the untreated group (FIG. 10). It can be judged that BMP activity is suppressed due to the increase in Noggin, which results in increased Wnt3a expression. Therefore, it was confirmed that the peptide derivative ScalpON according to the present invention has excellent hair growth promoting efficacy.

Example 7. Confirmation of expression of melanin biosynthesis promoting factors in B16F10 melanocytes by fusion peptide ScalpON according to the present invention

7.1. RNA extraction and cDNA synthesis from B16F10 melanocytes

The cultured cells were distributed in a 6-well plate using a hemacytometer at 1×10 ⁵ cells/well of the B16F10 cell line, and the fusion peptide ScalpON according to the present invention in the culture medium was treated in each well at different concentrations.

Afterwards, to induce melanin biosynthesis, the cells were treated with 10 uM α-MSH (α-melanocyte-stimulating hormone) and cultured for an additional 72 hours.

Cells after cell culture were lysed using QIAzol Lysis Reagent (QIAGEN, 79306, USA), then 0.2 mL chloroform (Duksan, 67-66-3, Korea) was added and left at room temperature. Centrifugation was carried out at 12,000 rpm and 4°C for 20 minutes to separate the subnatant containing protein and the supernatant containing mRNA. 0.5 mL isopropanol (Merck, 109634, Germany) was added to the supernatant, left at room temperature for 10 minutes, and then incubated at 12,000 rpm. RNA was precipitated by centrifugation at rpm and 4°C, washed with 75% ethanol, then ethanol was removed and dried at room temperature. The dried mRNA was dissolved in diethylpyrocarbonate (DEPC, Biopure) water and used in the experiment. The extracted RNA was used in the experiment using Nanodrop (Nanodrop, USA), and only RNA with a purity of 260 nm/280 nm ratio of 1.8 or higher was used in the experiment. cDNA synthesis using Takara PrimeScript?? RT Master Mix (RR036A) was used. cDNA was synthesized by preparing a total of 10 μl of 1 μg RNA, 2 μl of 5ХPrimeScript RT Master Mix, and RNase Free dH ₂ O in a PCR tube and reacting at 37°C for 10 minutes and 85°C for 5 seconds.

7.2. RT-PCR

Expression of hair growth-related genes in the fraction was confirmed through RT-PCR using the cDNA synthesized in Example 7.1.

RT-PCR conditions are as follows.

After reaction at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at an appropriate temperature (55 to 65°C) for 30 seconds, and then extension at 72°C for 1 minute, the cycle was repeated for 30 cycles. After repeating several times, the final extension was performed in a PCR machine (BIO-GENER) at 72°C for 10 minutes. Each PCR product was loaded onto a 1.5% agarose gel and analyzed by electrophoresis at 100 V for 30 minutes.

Primers used were melanin biosynthesis-related factors MITF, tyrosinase, TRP-1, DCT (TRP-2), and housekeeping GAPDH, and the nucleotide sequences are shown in Table 3 below.

gene Length (bp) Forward Sequences (5’→3’) Reverse Sequences (5’→3’) Tyrosinase 477 GGC CAG CTT TCA GGC AGA GGT
(SEQ ID NO: 8) TGG TGC TTC ATG GGC AAA ATC
(SEQ ID NO: 9) MITF 239 AGC GTG TAT TTT CCC CAC AG (SEQ ID NO: 10) CCT TAG CTC GTT GCT GTT CC
(SEQ ID NO: 11) TRP-1 285 GTC ATT GCC ACA AGG AGG TT (SEQ ID NO: 12) CCC AGT TGC AAA ATT CCA GT
(SEQ ID NO: 13) DCT(TRP-2) 378 TGT GCA AGA TTG CCT GTC TC (SEQ ID NO: 14) GTT GCT CTG CGG TTA GGA AG
(SEQ ID NO: 15)

7.3. Confirmation results of melanin biosynthesis promoting factor expression of the fusion peptide ScalpON according to the present invention in B16F10 melanocytes

Melanin synthesis uses tyrosine, one of the amino acids, as a substrate and involves tyrosinase, tyrosinase related protein-1 (TRP-1), and tyrosinase-related protein-2 (tyrosine- 3,4-dihydroxyphenylalanine (DOPA) is converted to DOPA quinone by related protein-2 (Dopachrome tautomerase), TRP-2 (DCT), and autoxidation reaction and enzymes As a reaction, melanin, a dark brown complex, is produced through DOPA chrome. In addition, microphthalmia-associated transcription factor (MITF), a well-known regulator of melanin formation, binds to the M-box sequence of tyrosinase and TRPs to regulate the expression of enzymes involved in melanin formation. It is well known for controlling Therefore, the expression of tyrosinase, TRP-1, DCT (TRP-2), and MITF according to ScalpON treatment was confirmed.

In the case of DCT expression level, when ScalpON was treated at 50, 100, and 200 ppm, it was confirmed that it increased by about 20 to 34% compared to the untreated group (FIG. 11). It was confirmed that the expression level of TRP-1 was significantly increased compared to the untreated group. At a concentration of ScalpON of 800 ppm, the expression level was 198.89%, showing a higher expression level than the positive control group (FIG. 12). In addition, as a result of checking the mRNA expression level of tyrosinase, which is considered an important melanin synthesis factor, it was confirmed that it increased significantly compared to the untreated group by 285.63 and 316.49% at test concentrations of 400 and 800 ppm, respectively (FIG. 13). Lastly, the mRNA expression level of MITF also increased as the ScalpON concentration increased. Specifically, expression levels of 249.36, 351.94, and 385.18% were confirmed at ScalpON treatment concentrations of 200, 400, and 800 ppm, respectively, and untreated. Compared with the group and the positive control group, the expression level significantly increased after ScalpON treatment (Figure 14).

As a result, it was confirmed that the fusion peptide ScalpON according to the present invention promotes melanin synthesis, which determines hair color.

Example 8. Confirmation of melanin biosynthesis induction by the fusion peptide ScalpON according to the present invention using tyrosinase

Melanin is the main factor that determines the color of skin and hair. Therefore, melanin formation is important for hair blackening. In order to determine whether the peptide derivative according to the present invention induces melanin biosynthesis, a test was performed to measure the amount of melanin biosynthesis using Tyrosinase enzyme. Tyrosinase converts tyrosine into L-DOPA during melanin synthesis and oxidizes L-DOPA to form dopaquinone. It was confirmed at what stage of the melanin synthesis process the peptide derivative according to the present invention is involved in melanin biosynthesis.

8.1. Tyrosinase activity measurement test using L-DOPA

In order to confirm the melanin biosynthesis of the fusion peptide according to the present invention, an experiment was conducted to confirm the activity of the tyrosinase DOPA oxidation reaction, which catalyzes the rate-determining step of the melanin synthesis process.

First, 50ul of 2000 unit/ml tyrosinase (Tyrosinase from mushroom, sigma T3824, USA) solution, 800ul of sodium phosphate buffer (pH 6.8), and fusion peptide ScalpON according to the present invention were added to the e-tube at different concentrations (0, 50). , 100, 200, 400, 600, 800, 1000 ppm) and then reacted at 37°C for 6 minutes. Afterwards, 50 ul of 6mM L-DOPA (substrate) solution was added to each solution and reacted at 37°C for 1 minute. After completion of the reaction, absorbance was measured at 475 nm, and arbutin was used at the same concentration as a positive control. As a negative control, 0.1M phosphate buffer solution (pH7.0) was added instead of the sample. L-DOPA activity was expressed as a percentage based on the absorption intensity of the control group using the formula below.

L-DOPA activity (%) = (absorbance of sample/absorbance of control) × 100

8.2. Tyrosinase activity measurement test using L-tyrosine

In order to confirm the melanin biosynthesis of the fusion peptide ScalpON according to the present invention, an experiment was conducted to confirm the activity of tyrosinase, which catalyzes the rate-determining step of the melanin synthesis process.

14ul of 2000 unit/ml tyrosinase solution, 140ul of sodium phosphate buffer (pH 7.0), and 20% of the fusion peptide ScalpON according to the present invention at different concentrations (0, 50, 100, 200, 400, 600, 800, 1000 ppm). ul and 26ul of 1.5 mM L-tyrosine (substrate) were added and reacted at 37°C for 15 minutes. After completion of the reaction, absorbance was measured at 490 nm. As a negative control, 0.1M phosphate buffer solution (pH7.0) was added instead of the sample. Tyrosinase activity was expressed as a percentage based on the absorption intensity of the control group using the formula below.

Tyrosinase activity (%) = (absorbance of sample/absorbance of control) × 100

8.3. Confirmation results of melanin biosynthesis induction by the fusion peptide ScalpON according to the present invention using tyrosinase

8.3.1. Tyrosinase activity test using L-DOPA

The effect of the fusion peptide ScalpON on the DOPA oxidation activity of tyrosinase, which catalyzes the rate-determining step of the melanin synthesis process, was confirmed. Tyrosinase activity was compared after treating the fusion peptide ScalpON according to the present invention at concentrations of 0, 50, 100, 200, 400, 600, 800, and 1000 ppm, respectively. The fusion peptide ScalpON was 104.06 ± 4.70%, 108.96 ± 3.21%, 108.96 ± 1.64%, 113.98 ± 0.62%, 121.38 ± 0.55%, 119.24 ± 4.60%, 120.55 ± 1.15%, 123.18% at the above concentrations. Concentration of ± 0.55% It was confirmed that the higher the concentration, the higher the activity of tyrosinase (L-DOPA oxidation activity). It was confirmed that the fusion peptide ScalpON according to the present invention promotes melanin synthesis, which determines hair color, by increasing the activity of tyrosinase using L-DOPA as a substrate (FIG. 15).

8.3.2. Tyrosinase activity test using L-Tyrosine

The fusion peptide ScalpON of the present invention was evaluated to determine whether it has a melanin activation effect by affecting the activity of tyrosinase, which catalyzes the rate-determining step of the melanin synthesis process. The fusion peptide ScalpON according to the present invention was treated at concentrations of 0, 50, 100, 200, 400, 600, 800, and 1000 ppm, and then the tyrosinase activity was compared. Considering the untreated group as 100%, the fusion peptide ScalpON was 130.67 ± 1.24% at 50 ppm, 140.98 ± 6.47% at 100 ppm, 165.59 ± 2.90% at 200 ppm, 189.05 ± 0.39% at 400 ppm, and 187.5% at 600 ppm. It was confirmed that the activity of tyrosinase increased as the concentration increased: ± 1.39%, 189.18 ± 0.22% at 800 ppm, and 188.79 ± 0.59% at 1000 ppm. That is, it was confirmed that the fusion peptide ScalpON according to the present invention promotes melanin synthesis, which determines hair color, by increasing the activity of tyrosinase (FIG. 16).

As above, specific parts of the content of the present invention have been described in detail, and those skilled in the art will understand that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. It will be obvious. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Sequence list electronic file attached

Claims (16)

Pentapeptide of SEQ ID NO: 1; A cosmetic composition for preventing or improving hair loss, or promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide,
The fusion peptide is represented by the following formula (1):
[Formula 1]
,
The composition is a cosmetic composition that increases melanin biosynthesis.
According to paragraph 1,
A cosmetic composition wherein the biotin is bound to the N-terminus of the pentapeptide.
delete According to paragraph 1,
The composition increases the expression of tyrosinase, tyrosinase related protein-1, Dopachrome tautomerase, or microphthalmia-associated transcription factor. A cosmetic composition that is intended to be used.
According to paragraph 1,
The composition is a cosmetic composition that increases the expression of wnt3a or noggin.
According to paragraph 1,
The composition is a cosmetic composition that increases the activity of tyrosinase.
Pentapeptide of SEQ ID NO: 1; A pharmaceutical composition for preventing or treating hair loss comprising a fusion peptide containing biotin bound to the pentapeptide,
The fusion peptide is represented by the following formula (1):
[Formula 1]
,
The composition is a pharmaceutical composition that increases melanin biosynthesis.
In clause 7,
A pharmaceutical composition wherein the biotin is bound to the N-terminus of the pentapeptide.
In clause 7,
The composition may be used to treat alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, and congenital alopecia. From the group consisting of alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, and telogen effluvium. A pharmaceutical composition for preventing or treating one or more selected alopecia conditions.
Pentapeptide of SEQ ID NO: 1; A quasi-drug composition for preventing or improving hair loss comprising a fusion peptide containing biotin bound to the pentapeptide,
The fusion peptide is represented by the following formula (1):
[Formula 1]
,
The composition is a quasi-drug composition that increases melanin biosynthesis.
According to clause 10,
A quasi-drug composition in which the biotin is bound to the N-terminus of the pentapeptide.
According to clause 10,
The composition may be used to treat alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, and congenital alopecia. From the group consisting of alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, and telogen effluvium. A quasi-drug composition that prevents or improves one or more selected alopecia.
Pentapeptide of SEQ ID NO: 1; A food composition for preventing or improving hair loss, or promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide,
The fusion peptide is represented by the following formula (1):
[Formula 1]
,
A food composition that increases melanin biosynthesis.
According to clause 13,
A food composition wherein the biotin is bound to the N-terminus of the pentapeptide.
Pentapeptide of SEQ ID NO: 1; A feed composition for preventing or improving hair loss, or promoting hair growth or hair growth, comprising a fusion peptide containing biotin bound to the pentapeptide,
The fusion peptide is represented by the following formula (1):
[Formula 1]
,
The composition is a feed composition that increases melanin biosynthesis.
According to clause 15,
The biotin is a feed composition bound to the N-terminus of the pentapeptide.