KR102657828B1 - Composition containing a fusion peptide of tripeptide and biotin as an active ingredient with skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects - Google Patents

Abstract

The present invention relates to a composition containing a fusion peptide of tripeptide and biotin as an active ingredient that has skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects.
The fusion peptide combining tripeptide and biotin according to the present invention inhibits melanin biosynthesis or promotes cell proliferation, enhances antioxidant activity, and has effects such as skin whitening, skin regeneration, wound improvement, hair loss inhibition, and hair growth promotion. It can be used as a material for cosmetics, medicine, food, etc.

Description

A composition containing a fusion peptide of tripeptide and biotin as an active ingredient with skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects {Composition containing a fusion peptide of tripeptide and biotin as an active ingredient with skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects}

The present invention relates to a composition containing biotinyltripeptide, a fusion peptide of tripeptide and biotin, as an active ingredient with skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects.

The skin is made up of the epidermis, dermis, and subcutaneous fat, and not only acts as an outer wall that protects the body, but also plays an important role in aesthetic functions and social meaning that expresses emotions.

The skin is essential for maintaining homeostasis and is an important organ that performs a variety of functions, including regulating body temperature, suppressing moisture loss, containing sensory receptors, synthesizing various biochemical substances, and excreting small amounts of waste in addition to protective functions.

However, compared to other organs, the skin has many opportunities to come into direct contact with external stimulation or various pathogens, and in particular, when ultraviolet rays are absorbed into the skin, a photochemical reaction occurs, causing skin lesions. In addition, the number of patients with skin diseases caused by factors commonly occurring in modern society, such as mental stress, obesity, alcohol, and smoking, is rapidly increasing.

Accordingly, the development of various skin protectants to suppress skin damage and protect skin cells is actively being developed. However, the developed skin protectors mainly contain synthetic compounds as active ingredients, which can cause damage to the skin or cause itchiness and spots. It has the disadvantage of causing side effects. Therefore, there is a need to develop new natural materials that have excellent skin damage inhibition and skin strengthening functions without side effects on the skin.

In addition, the improvement in living standards and the development of biotechnology and medicine have brought about changes in customers' cosmetics consumption patterns, leading to an explosive increase in the demand for cosmetics that enhance functional aspects such as skin whitening, antioxidant, and skin regeneration. In response to consumer demands, the cosmetics industry is also focusing on developing new functional materials.

Meanwhile, in modern society, the hair loss market is growing rapidly due to the increase in the hair loss population, and interest in and importance of scalp and hair health along with skin health is increasing. In this regard, anti-hair loss shampoos, scalp and hair care products, hair loss treatments, etc. are continuously being developed, but the development of materials with clear effects is still insufficient. As the side effects of finasteride and minoxidil, products that have been certified until recently, have been revealed when treated at high concentrations, the development of new products to replace them is urgently needed.

Skin Appendage Disord 2017;3:166-169

The purpose of the present invention is to provide a cosmetic composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising the fusion peptide represented by Formula 1 as an active ingredient.

Another object of the present invention is to provide a quasi-drug composition for preventing or improving skin disease or hair loss, comprising the fusion peptide represented by Formula 1 as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating skin disease or hair loss, comprising the fusion peptide represented by Formula 1 as an active ingredient.

Another object of the present invention is to provide a food composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, containing the fusion peptide represented by Formula 1 as an active ingredient.

Another object of the present invention is to provide a feed composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising the fusion peptide represented by Formula 1 as an active ingredient.

This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Additionally, the scope of the present application cannot be considered limited by the specific description described below.

In one aspect for achieving the above object, the present invention provides a composition for improving skin condition, preventing hair loss, or promoting hair growth, which contains biotinyl tripeptide, a fusion peptide combining tripeptide and biotin, as an active ingredient.

The inventors of the present invention made diligent efforts to develop peptides that exhibit various skin condition improvement effects, and as a result, a composition containing a fusion peptide linking biotin and a tripeptide composed of three amino acids, glutamic acid, cysteine, and glycine, was developed to prevent skin aging and skin whitening. The present invention was completed by confirming that it has excellent effects such as antioxidant, hair loss inhibition, or hair growth promotion.

In another aspect for achieving the above object, the present invention provides a cosmetic composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising the fusion peptide represented by Formula 1 as an active ingredient.

[Formula 1]

In the present invention, the 'fusion peptide' is a fusion peptide that links a tripeptide consisting of three amino acids, glutamic acid, cysteine, and glycine, and biotin, It may be represented by Formula 1, and the biotin may be connected to the N-terminus of the tripeptide.

The fusion peptide may be synthesized by solid-phase peptide synthesis (SPSS). In one example of the present invention, a tripeptide was synthesized by successively adding amino acids with a protecting group to an insoluble polystyrene resin, and then a fusion peptide was synthesized by binding biotin, the final sequence, without separating the tripeptide from the synthetic support.

In the present invention, 'active ingredient' refers to an ingredient that exhibits the desired activity alone or can exhibit activity in combination with a carrier that is not active on its own.

In the present invention, the meaning of 'including as an active ingredient' refers to including an effective amount capable of producing effects such as improving skin condition, preventing or improving hair loss, and promoting hair growth.

In the present invention, 'improvement of skin condition' refers to all actions that improve or benefit the skin condition by including the fusion peptide represented by Formula 1 as an active ingredient. The term 'skin condition improvement' may mean skin regeneration, skin soothing, skin whitening, wound improvement, or prevention of skin aging, but is not limited thereto.

In the present invention, 'skin regeneration' refers to the recovery process of skin tissue against damage caused by external and internal causes. Damage due to external causes may include ultraviolet rays, external contaminants, wounds, trauma, etc., and damage due to internal causes may include stress, etc., but are not limited thereto.

In the present invention, 'skin soothing' refers to the process of soothing the heat or pain of irritated skin and returning it to its original state.

In the present invention, 'skin whitening' not only brightens skin tone by inhibiting the synthesis of melanin pigment, but also improves hyperpigmentation of the skin caused by ultraviolet rays, hormones, or genetics. Here, hyperpigmentation of the skin may include, but is not limited to, freckles, freckles, senile lentigo, brown spots, or age spots.

In the present invention, 'wound' means a disruption of the normal continuity of the skin structure due to physical damage to the skin, specifically contusion or bruise, laceration, avulsion, Penetrating wounds, non-healing traumatic wounds, destruction of tissue by irradiation, abrasion, bone gangrene, gun-shot wounds, cuts, burns, frostbite, skin ulcers, dry skin, keratosis skin. , cracks, tears, dermatitis, pain due to dermatophytosis, surgical wounds, vascular disease wounds, corneal wounds, bedsores, flat sores, conditions related to diabetes and poor circulation, chronic ulcers, suture sites after plastic surgery, spinal injuries. It refers comprehensively to damage to parts of an organism, such as wounds, gynecological wounds, chemical wounds, and acne.

In the present invention, 'prevention of skin aging' means preventing or delaying both natural (endogenous) aging that occurs due to physiological changes in the body over time and photoaging that occurs in areas exposed to sunlight.

The skin aging of the present invention may be photoaging caused by UV-B ultraviolet rays, but is not limited thereto. Specifically, photoaging of skin cells may occur due to light with a wavelength of 280 nm to 40 nm included in sunlight. In particular, irradiation of ultraviolet rays such as UV-B, which has a wavelength in the range of 280 nm to 320 nm, may cause damage to the skin or fibers and cause a blackening of the skin. When UV-B is irradiated, the accumulation of active oxygen (e.g. H ₂ O ₂ ) and free radicals within skin cells is promoted, and the radicals stimulate the intracellular signaling system to oxidize biomolecules such as DNA, proteins, and lipids. It can cause stress, which can cause damage to skin tissue. When oxidative stress in skin cells increases, stimulation occurs in keratinocytes in the epidermis or fibroblasts in the dermis, and through a series of intracellular signaling processes, the expression of genes such as MMP (matrix metalloproteinase), a collagen-degrading enzyme, increases. This can cause a decrease in collagen, which is a major component of the skin and accounts for 90% of the dermis and protects the skin from external stimulation or force by providing strength and tension to the skin, resulting in skin aging. Wrinkles may form.

The improvement of the skin condition of the present invention may be due to cell proliferation promoting activity, and specifically may be due to the proliferation promoting activity of human keratinocytes or fibroblasts, but is not limited thereto.

In the present invention, 'hair loss' refers to the phenomenon of hair falling off from the scalp or the phenomenon of hair becoming sparse or thin. Hair loss in the present invention may include androgenetic alopecia, telogen effluvium, anagen alopecia, alopecia areata, drug-induced telogen effluvium, postpartum telogen effluvium, etc. In addition, it can include all types of hair loss that form abnormal hair loss patterns such as vellus hair of terminal hair, short hair of group hair, and hair follicle atrophy due to a series of factors.

In the present invention, 'prevention' refers to all actions that suppress or delay hair loss through the composition of the present invention, and 'improvement' refers to all actions that improve or benefit hair loss or the condition of hair with the composition. .

In the present invention, 'hair growth promotion' refers not only to the hair growth function of generating new hair or the function of improving hair growth, but also to the function of promoting the delay from the growth phase to the catagen phase and allowing existing hair to grow healthily.

In the present invention, the composition may enhance antioxidant activity, and specifically may have DPPH radical scavenging activity. The term 'antioxidant' refers to the action of suppressing oxidation. The human body maintains a balance between prooxidants and antioxidants, but due to various factors, this balance becomes unbalanced and oxidation occurs. If it leans toward promotion, oxidative stress is induced, causing potential cell damage and pathological diseases. Reactive oxygen species (ROS), which are the direct cause of this oxidative stress, are unstable and highly reactive, so they easily react with various biological substances and attack macromolecules in the body, causing irreversible damage to cells and tissues, mutations, and mutations. It causes cytotoxicity and carcinogenesis. Reactive nitrogen species (RNS), such as NO, HNO2, and ONOO-, are produced in large quantities due to the immune response of macrophages, neutrophils, and other immune cells during inflammatory reactions, and ROS is also produced at this time. The above-described free radicals oxidize and destroy cells in the body, thereby exposing them to various diseases. In addition, the antioxidant refers to the function of suppressing oxidation of cells by highly reactive free radicals or reactive oxygen species (ROS) due to oxidative stress caused by intracellular metabolism or the influence of ultraviolet rays. This includes removing free radicals or reactive oxygen species, thereby reducing damage to cells.

In the present invention, the composition may inhibit the oxidation activity of L-tyrosine or L-dopa, and may inhibit the activity of tyrosinase against the L-tyrosine substrate. there is.

In the present invention, the composition includes tyrosinase, tyrosinase related protein-1 (TRP1), Dopachrome tautomerase (DCT), and small phthalmia-related transcription factors. (Microphthalmia-associated transcription factor, MITF), Dickkopf-related protein 1 (DKK-1), or Steroid 5 Alpha-Reductase 1 (SRD5A1). It may be, and specifically, it may be reducing the gene expression of the above factors.

In the present invention, the composition may increase the expression level of Noggin, and specifically may increase the expression level of the Noggin gene.

The composition of the present invention may contain the fusion peptide in various amounts as long as it has the effects of skin regeneration, skin whitening, wound improvement, skin aging prevention, or hair loss prevention or improvement. Specifically, the fusion peptide may be used in the composition. It may contain 0.1 to 10% by weight based on the total weight. This ratio is only an exemplary range, and it is obvious to those skilled in the art that even if it is 20% or 30% or more, it has the effect of skin regeneration, skin whitening, wound improvement, skin aging prevention, or hair loss prevention or improvement.

In addition to the fusion peptide, the cosmetic composition according to the present invention contains various ingredients commonly used in cosmetic compositions, such as water-soluble ingredients, powder ingredients, oils, surfactants, and moisturizers, as necessary, within the range that does not reduce the effect of the present invention. , it can be composed by combining viscosity modifiers, preservatives, antioxidants, fragrances, pigments, etc.

Non-limiting examples of the surfactants that can be used include anionic surfactants, cationic surfactants, nonionic surfactants, and amphoteric surfactants. More specifically, the anionic surfactant includes alkylbenzene sulfonate, polyoxyalkylene alkyl sulfuric acid ester salt, alkyl sulfuric acid ester salt, olefin sulfonate, alkyl phosphate, polyoxyalkylene alkyl ether phosphate, and dialkyl sulfosuccine. Salts, fatty acid salts, etc. can be mentioned, and nonionic surfactants include polyoxyethylene alkyl ether, polyoxyethylene fatty acid ester, polyhydric alcohol fatty acid partial ester, polyoxyethylene polyhydric alcohol fatty acid partial ester, polyglycerol fatty acid ester, and polyoxyethylene fatty acid ester. Examples include ethylene hydrogenated castor oil derivatives and fatty acid diethanolamide. In addition, cationic surfactants include tertiary aliphatic amine salts, alkyltrimethylammonium halides, dialkyldimethylammonium halides, etc., and examples of amphoteric surfactants include amide betaine type, imidazolinium betaine type, and sulfobetaine type. etc. can be mentioned.

Examples of the moisturizing agent include glycerin, propylene glycol, 1,3-butylene glycol, dipropylene glycol, and sorbitol. Examples of the preservative include benzoic acid, dehydroacetic acid, paraoxybenzoic acid ester (methyl paraoxybenzoate, butyl paraoxybenzoate, etc.), phenoxyethanol, etc. In addition, the antioxidants include ascorbic acid, BHA, etc., and in addition, ultraviolet absorbers, anti-inflammatory agents, fresheners, etc. can be added.

The cosmetic composition of the present invention includes solution, external ointment, cream, foam, nutritional lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath agent, sunscreen cream, sun oil, suspension, and emulsion. It can be prepared in a formulation selected from the group consisting of liquid, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch and spray. no.

The cosmetic composition of the present invention may further include one or more carriers acceptable in cosmetic formulations, and common ingredients include, for example, oil, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, pigments, Preservatives, fragrances, etc. may be appropriately mixed, but are not limited thereto. Here, 'acceptable carrier in cosmetic preparations' means a compound or composition that is already known and used or a compound or composition that will be developed in the future that can be included in cosmetic preparations and has no toxicity, instability or irritation beyond what the human body can adapt to when contacted with the skin. say something that doesn't exist The carrier may be included in the composition of the present invention in an amount of about 1% to about 99.99% by weight based on the total weight of the composition, preferably about 90% by weight to about 99.99% by weight of the composition. However, since the ratio varies depending on the formulation in which the composition of the present invention is manufactured, its specific application area (face, neck, etc.), and its preferred application amount, the ratio does not limit the scope of the present invention in any respect. It should not be understood as

In the cosmetic formulation included in the cosmetic composition of the present invention, acceptable carriers vary depending on the formulation of the cosmetic composition.

When the formulation of the present invention is an ointment, paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. are used as carrier ingredients. may be used, but is not limited thereto. These may be used alone or in combination of two or more types.

When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, etc. can be used as carrier ingredients, and especially in the case of a spray, chlorofluorohydride may be additionally used. It may include propellants such as locarbon, propane/butane, or dimethyl ether, but is not limited thereto, and these may be used alone or in a mixture of two or more types.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent, or emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, Propylene glycol, 1,3-butyl glycol oil, etc. can be used, especially cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan. may be used, but is not limited thereto, and may be used alone or in a mixture of two or more types.

When the formulation of the present invention is a suspension, the carrier components include water, liquid diluents such as ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, and miso. Crystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used, but are not limited thereto, and they may be used alone or in a mixture of two or more types.

When the formulation of the present invention is soap, alkali metal salts of fatty acids, hemiester salts of fatty acids, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. are used as carrier components. It may be, but is not limited to, these may be used alone or in combination of two or more types.

The cosmetic composition of the present invention can be prepared by including the fusion peptide as an active ingredient, and the manufacturing method can be selected by a person skilled in the art according to common sense in the relevant technical field, and is not particularly limited thereto.

In another aspect for achieving the above object, the present invention provides a quasi-drug composition for preventing or improving skin disease or hair loss, comprising the fusion peptide represented by Formula 1 as an active ingredient.

The terms ‘fusion peptide’, ‘active ingredient’, ‘included as an active ingredient’ and ‘hair loss’ are as described above.

In the present invention, 'skin disease' refers to a disease that occurs on the skin, and the skin disease may mean skin pigmentation, skin wounds, and skin scars, but is not limited thereto.

In the present invention, non-limiting examples of 'skin wound' and 'skin scar' include abrasions, scars caused by abrasions, etc.

In the present invention, 'skin pigmentation' refers to all diseases caused by skin pigmentation due to increased production of melanin. Non-limiting examples of the skin pigmentation disease include blemishes, freckles, spots, solar pigmentation, pigmentation after drug use, pigmentation after inflammation, and pregnancy-related pigmentation.

In the present invention, 'hair loss' refers to alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, localized alopecia ( circumscribed alopecia, alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, telogen efffluvium), etc. may be included, but are not limited thereto.

In the present invention, 'prevention' refers to any act of suppressing or delaying skin diseases such as skin wounds, skin scars, and skin pigmentation by administering or applying the fusion peptide of the present invention to an individual, and suppressing hair loss or It means any act of delay.

In the present invention, 'improvement' refers to any action that improves or benefits skin diseases such as skin wounds, skin scars, and skin pigmentation by using the fusion peptide of the present invention, and improves hair loss or hair condition. It means any action that makes it possible or beneficial.

In the present invention, 'quasi-drugs' are articles used for the purpose of diagnosing, treating, mitigating, treating, or preventing diseases in humans or animals, but are not instruments, machines, or devices, and have pharmacological effects on the structure and function of humans or animals. Among the products used for the purpose of giving, it refers to products excluding those that are not instruments, machines, or devices. One specific example may include preparations for internal use, but is not limited thereto, and includes methods of formulation, dosage, and use of quasi-drugs; Components, etc. may be appropriately selected from conventional techniques known in the technical field.

In the present invention, the quasi-drug may further include a pharmaceutically acceptable carrier, excipient, or diluent as needed in addition to the fusion peptide. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included. Representative examples of pharmaceutically acceptable carriers, excipients or diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, gum acacia, alginate, calcium phosphate, calcium carbonate, calcium. Silicates, Cellulose, Methyl Cellulose, Microcrystalline Cellulose, Polyvinyl Pyrrolidone, Water, Methylhydroxybenzoate, Propylhydroxybenzoate, Talc, Magnesium Stearate, Mineral Oil, Propylene Glycol, Polyethylene Glycol, Vegetable Oil, Injectable Examples include ester, Witepsol, Macrogol, Twin 61, Kakao Oji, and Lauridge.

In addition, the quasi-drug composition of the present invention may contain one or more active ingredients that exhibit the same or similar functions in addition to the fusion peptide, such as known effects on skin regeneration, skin soothing, antioxidant, skin whitening, and hair growth promotion. It may include components representing . The quasi-drug composition of the present invention may include, but is not limited to, disinfectant cleaner, shower foam, ointment, wet tissue, coating agent, etc., and the formulation method, dosage, usage method, and components of the quasi-drug are commonly known in the technical field. It can be appropriately selected from the techniques.

In another aspect for achieving the above object, the present invention provides a pharmaceutical composition for preventing or treating skin disease or hair loss, comprising the fusion peptide represented by Formula 1 as an active ingredient.

The terms ‘fusion peptide’, ‘active ingredient’, ‘included as an active ingredient’, ‘skin disease’, ‘hair loss’ and ‘prevention’ are as described above.

In the present invention, 'treatment' refers to any action that improves, alleviates, or benefits the degree of skin disease or hair loss symptoms such as skin wounds, skin scars, and skin pigmentation by administering the composition of the present invention to an individual.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc.

Carriers for parenteral administration may also include water, suitable oils, saline solutions, aqueous glucose and glycols, and the like. Additionally, stabilizers and preservatives may be additionally included. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally, and parenteral administration methods include intravenous, intramuscular, intraarterial, intracentral, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, and intranasal. , may be administered enterally, topically, sublingually or intrarectally, and preferably centrally administered, but is not limited thereto.

The pharmaceutical composition of the present invention can be formulated into a preparation for oral administration or parenteral administration according to the administration route described above. When formulated, one or more buffers (e.g. saline or phosphate buffered saline (PBS)), antioxidants, bacteriostatic agents, chelating agents (e.g. EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g. For example, aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, surfactants, diluents or excipients may be used.

Solid preparations for oral administration include tablets, pills, powders, granules, solutions, gels, syrups, slurries, suspensions or capsules, etc. These solid preparations include the pharmaceutical composition of the present invention and at least one excipient, e.g. For example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol. It can be prepared by mixing cellulose, methyl cellulose, sodium carboxymethyl cellulose, hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or dragees can be obtained by combining the active ingredient with solid excipients, grinding them, adding suitable auxiliaries, and processing them into a granule mixture.

In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, or syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, or preservatives may be included. there is. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as a disintegrant, and anti-coagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included. .

When administered parenterally, the pharmaceutical composition of the present invention can be formulated with a suitable parenteral carrier in the form of injections, transdermal administration, and nasal inhalation according to methods known in the art. The above injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. For injections, examples of suitable carriers may be, but are limited to, solvents or dispersions including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), mixtures thereof, and/or vegetable oils. That is not the case. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or sterile water for injection, and isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. . In order to protect the injection from microbial contamination, it may additionally contain various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In addition, in most cases, the injection may additionally contain an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administration, forms such as ointments, creams, lotions, gels, external solutions, paste preparations, linear preparations, and aerol preparations are included. Here, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

For inhalation administration, the compositions used according to the invention may be packaged in pressurized packs or using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. For pressurized aerosols, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators can be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a text generally known in all pharmaceutical chemistry.

In the pharmaceutical composition of the present invention, the amount of the active compound in the unit dose formulation may vary, and specifically, it may be adjusted to about 0.01 mg to about 1 g per time based on an average human weighing 70 kg. However, the administered dose may vary depending on the requirements of humans and mammals, the severity of the disease being treated, and the final composition of the compound used. It falls to those skilled in the art to determine the appropriate dosage for a particular situation.

The pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, or methods using biological response modifiers.

In another aspect for achieving the above object, the present invention provides a food composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising the fusion peptide represented by Formula 1 as an active ingredient.

The terms 'fusion peptide', 'active ingredient', 'included as an active ingredient', 'improvement of skin condition', 'hair loss', 'prevention', 'improvement' and 'promotion of hair growth' are the same as described above.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives, and feed, and includes all forms of food such as functional food, nutritional supplement, health food, food additives, and feed, and is used for use in humans or animals including livestock. It is intended for consumption. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruit and its processed foods (canned fruit, bottled food, jam, marmalade, etc.), fish, meat, and their processed foods (ham, sausage, corned beef, etc.) , bread and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable protein, retort food, frozen food. , can be manufactured by adding the above active ingredients to various seasonings (soybean paste, soy sauce, sauce, etc.).

Additionally, nutritional supplements can be manufactured by adding the above-mentioned active ingredients to capsules, tablets, pills, etc. In addition, health functional foods are not limited to this, but for example, they can be manufactured in the form of tea, juice, and drinks and consumed by liquefying, granulating, encapsulating, and powdering so that they can be consumed as health drinks. Additionally, in order to use the fusion peptide in the form of a food additive, it can be prepared and used in powder or concentrate form. Additionally, it can be prepared in the form of a composition by mixing it with known active ingredients that are known to be effective in improving muscle disease, bone disease, muscle loss, bone loss, etc.

In addition to the above, the health food of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, It may contain glycerin, alcohol, or carbonating agent.

In another aspect for achieving the above object, a feed composition for improving skin condition, preventing or improving hair loss, or promoting hair growth comprising the fusion peptide represented by Formula 1 as an active ingredient is provided.

The terms 'fusion peptide', 'active ingredient', 'included as an active ingredient', 'improvement of skin condition', 'hair loss', 'prevention', 'improvement' and 'promotion of hair growth' are the same as described above.

The term 'feed' in the present invention refers to any natural or artificial diet, meal, etc., or a component of the meal, for animals to eat, ingest, and digest, and can be manufactured with various types of feed known in the art. , specifically, may include, but is not limited to, concentrated feed, roughage, feed additives, feed supplements, companion animal nutrients, or special feed.

The feed additive of the present invention corresponds to supplementary feed under the Feed Management Act, and includes mineral preparations such as sodium bicarbonate (sodium bicarbonate), bentonite, magnesium oxide, and complex minerals, and trace minerals such as zinc, copper, cobalt, and selenium. Preparations, vitamin preparations such as kerotene, vitamin E, vitamins A, D, E, nicotinic acid, and vitamin B complex, protective amino acid preparations such as methionine and lysic acid, protective fatty acid preparations such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture Water, live bacteria such as mold fermentation products, yeast, etc. may be additionally included.

Concentrated feed includes seeds and fruits including grains such as wheat, oats, and corn, bran including rice bran, wheat bran, and barley bran as by-products obtained from refining grains, soybeans, soybeans, sesame seeds, linseed, and coco palm. It is a concentrate of residues such as residual starch, which is the main component of the starch residue that is left after removing starch from seed cakes, sweet potatoes, and potatoes, which are by-products of oil extraction, fishmeal, fish residue, and fresh liquid obtained from fish. Animal feed such as fish soluble, meat meal, blood meal, feather meal, skim milk powder, dried whey, which is the remaining whey when producing cheese from milk, and casein from skim milk, yeast, etc. , chlorella, and seaweed, but are not limited to these. Forage includes raw grass feed such as wild grass, grass, and green cuttings, turnips for feed, beets for feed, root vegetables such as rutterbearger, a type of turnip, raw grass, green cuttings, and grains, etc., in silos. These include, but are not limited to, silage, which is stored feed that has been filled and fermented with lactic acid, field grass, hay made by cutting and drying grass, straw from crops for breeding livestock, and leaves from legumes. Special feeds include mineral feeds such as oyster shells and rock salt, urea feeds such as urea and its derivative diureide isobutane, and mixed feeds to supplement ingredients that are likely to be lacking when mixing only natural feed ingredients, or to increase the storability of the feed. Substances added in trace amounts include feed additives and dietary supplements, but are not limited to these.

The feed composition of the present invention may further include ingredients added to conventional feed. Examples of ingredients added to such feed may include grain powder, meat powder, and beans. In the above, the grain powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour. In the above, the meat powder may be a meat powder obtained by pulverizing any one or more selected from chicken, beef, pork, and ostrich meat. In the above, the pulses may be one or more types selected from soybeans, kidney beans, peas, and black beans.

In addition to grain powder, meat powder, and pulses, which are the ingredients added to the conventional feed mentioned above, the feed composition of the present invention can add one or more selected from nutrients and minerals to increase the nutritional value of the feed, and feed quality. In order to prevent deterioration, it may contain one or more selected from anti-fungal agents, antioxidants, anti-coagulants, emulsifiers, and binders.

The feed or feed additive of the present invention can be applied to a number of animal diets, including mammals, poultry, and fish.

The fusion peptide combining tripeptide and biotin according to the present invention inhibits melanin biosynthesis or promotes cell proliferation, and has effects such as skin whitening, skin regeneration, wound improvement, hair loss inhibition, and hair growth promotion, and is used in cosmetics and pharmaceuticals. It can be used as a material such as

Figure 1 shows the structural formula of biotinyl tripeptide (hereinafter referred to as 'fusion peptide') synthesized in the present invention.
Figure 2 shows the results of HPLC analysis of the fusion peptide synthesized and purified in the present invention.
Figure 3 shows the results of measuring the cell survival rate of human keratinocytes following treatment with the fusion peptide and tripeptide of the present invention.
Figure 4 shows the results of measuring the cell survival rate of human fibroblasts according to treatment with the fusion peptide of the present invention.
Figure 5 shows the results of measuring the survival rate of human dermal papilla cells according to treatment with the fusion peptide of the present invention and biotin + tripeptide (hereinafter, 'simple mixture').
Figure 6 shows the results of comparing the micrograph (A) of the wound area and the area of the wound area (B) in the group treated with the fusion peptide of the present invention and the untreated group.
Figure 7 shows the results of comparing the antioxidant effect through DPPH radical scavenging activity of the fusion peptide, tripeptide, and simple mixture of the present invention.
Figure 8 shows the results of comparing the inhibitory effects of the fusion peptide, tripeptide, and simple mixture of the present invention on tyrosinase activity against the L-DOPA substrate.
Figure 9 shows the results of comparing the inhibitory effects on tyrosinase activity of the fusion peptide, tripeptide, and simple mixture of the present invention on L-tyrosine substrate.
Figure 10 shows the results of electrophoresis confirming changes in mRNA expression levels for whitening factors (Tyrosinase, TRP1, DCT, and MITF) according to treatment with the fusion peptide of the present invention.
Figure 11 is a graphical representation of changes in mRNA expression levels for whitening factors (Tyrosinase, TRP1, DCT, and MITF) according to treatment with the fusion peptide of the present invention.
Figure 12 shows the results of electrophoresis confirming changes in mRNA expression levels for hair growth and hair loss-related factors (DKK-1, SRD5A1, and Noggin) according to treatment with the fusion peptide of the present invention.
Figure 13 is a graphical representation of the change in Noggin mRNA expression level according to treatment with the fusion peptide of the present invention.
Figure 14 is a graphical representation of the change in the mRNA expression level of DKK-1 according to treatment with the fusion peptide of the present invention.
Figure 15 is a graphical representation of the change in the mRNA expression level of SRD5A1 according to treatment with the fusion peptide of the present invention.

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. Synthesis and purification of the fusion peptide of the present invention

1-1. Fusion peptide synthesis

The biotinoyl tripeptide (hereinafter referred to as 'fusion peptide') of the present invention is a new material fusion that connects a tripeptide consisting of three amino acids, glutamic acid, cysteine, and glycine, and biotin. As a peptide, biotinoyl tripeptide was synthesized using solid-phase peptide synthesis (SPSS).

Specifically, a tripeptide was synthesized by successively adding amino acids with a protecting group to an insoluble polystyrene resin, and then the final sequence, biotin, was conjugated to the tripeptide without separating it from the synthetic support. Afterwards, unbound biotin was removed from the reactant and a highly pure fusion peptide was synthesized.

The structural formula of the fusion peptide synthesized in the present invention is as shown in Figure 1.

1-2. Fusion peptide purification

The fusion peptide synthesized in Example 1-1 was purified by Reverse Phase-High Performance Liquid Chromatography (RP-HPLC), using a C18 column as a column, and solvent A (water containing 0.1% TFA) as a purification solvent. ) and solvent B (acetonitrile containing 0.1% TFA) were used and purified using solvent gradient conditions. As a result, purity was confirmed to be over 95% (Figure 2).

Experimental Example 1. Confirmation of cellular stability of fusion peptide on human keratinocytes

1-1. Human keratinocyte culture

In order to confirm whether the fusion peptide synthesized in Example 1 could show an improvement effect without skin irritation even when used for a long period of time, the presence or absence of cytotoxicity on human keratinocytes was tested.

The keratinocyte cell line HaCaT, a human skin cell, was cultured in an incubator at 37°C and 5% CO ₂ . When the degree of culture was 85 to 90% of the area of the culture vessel, the cells were detached by trypsin treatment, counted, and then subcultured at 5Х10 ³ cells/cm ² . For cell culture, DMEM (Delbecco's Modified Eagle Medium, GIBCO) medium supplemented with 100 U/ml of 10% FBS (GIBCO) and 100 μg/ml of penicillin and streptomycin was used.

1-2. Safety confirmation for human keratinocytes

Safety tests on human keratinocytes were performed for each of the fusion peptide and tripeptide synthesized in Example 1 and then compared.

First, human keratinocytes were counted and dispensed into a 24-well plate at 5Х10 ³ cells/well using a hemacytometer. When cultured in DMEM medium containing 10% fetal bovine serum (FBS) for 48 hours to ~ 70% of the surface area of the culture vessel, the fusion peptide or tripeptide of the present invention is diluted by concentration and added to the FBS-containing peptide. It was replaced with free DMEM and cultured for an additional 24 hours. After incubation, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655) solution (2.5 mg/ml) was added and cultured for an additional 3 hours. Afterwards, all cell culture was discarded, 300 ㎕ of DMSO (dimethyl sulfoxide, Sigma D2650) was added to each well, and after stirring, 100 ㎕ was taken into 96 wells, and the absorbance was measured at 570 nm using ELISA (Enzyme-Linked Immunosorbent Assay). . The degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using pure water.

As a result of a cytotoxicity test on human keratinocytes of the fusion peptide, no significant toxicity was observed even at 2mM, the highest treatment concentration tested (Figure 3). In addition, when treated with the fusion peptide of the present invention in the range of 0.05 to 1 mM, cell proliferation of human keratinocytes was confirmed compared to the untreated group. In particular, it was confirmed that the cell survival rate increased by 127.67% in the group treated with 0.05mM of the fusion peptide of the present invention and by 131.38% in the group treated with 0.1mM compared to the untreated group.

On the other hand, the cell viability of the tripeptide was confirmed to be reduced to about 80% in the 0.5mM treatment group, and the cell viability was confirmed to be reduced to below 20% at a test concentration of 1mM or more (FIG. 3).

From the above results, it was confirmed that the fusion peptide of the present invention has much better cell safety against human keratinocytes than the tripeptide.

Experimental Example 2. Confirmation of cellular stability of fusion peptide on human fibroblasts

2-1. Human fibroblast culture

In order to confirm whether the fusion peptide synthesized in Example 1 could show improvement effects without skin irritation even when used for a long period of time, the presence or absence of cytotoxicity on human fibroblasts was tested.

Human fibroblasts, CCD-986sk, were cultured in an incubator at 37°C and 5% CO ₂ . When the degree of culture was 85 to 90% of the area of the culture vessel, the cells were detached by trypsin treatment, counted, and subcultured at 5Х10 ³ cells/cm ² . DMEM (Delbecco's Modified Eagle Medium, GIBCO) medium supplemented with 10% FBS (GIBCO), 100 U/ml penicillin, and 100 μg/ml streptomycin was used to culture the cells.

2-2. Confirmation of stability on human fibroblasts

Fibroblasts, CCD-986sk, were counted in a 24-well plate at 5Х10 ³ cells/well using a hemacytometer, and then distributed and cultured. After culturing in DMEM containing 10% FBS for 48 hours and reaching ~70% of the surface area of the culture vessel, it was replaced with FBS-free DMEM containing the diluted fusion peptide of the present invention and cultured for another 24 hours.

After additional incubation, 50 ㎕ of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg/ml) was added and incubated for an additional 3 hours. . Afterwards, all cell culture was discarded, and 300 ㎕ of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was added to each well and stirred. Then, 100 ㎕ was taken into 96 wells and analyzed by Enzyme-Linked Immunosorbent Assay (ELISA) at 570 nm. Absorbance was measured. To make a relative evaluation, the degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using FBS-free DMEM without the sample.

As a result, it was confirmed that the fusion peptide of the present invention was not cytotoxic to human fibroblasts (Figure 4).

Experimental Example 3. Confirmation of cellular stability of fusion peptide on human dermal papilla cells

3-1. Human hair papilla cell culture

In order to confirm whether the fusion peptide synthesized in Example 1 could show an improvement effect without skin irritation even when used for a long period of time, the presence or absence of cytotoxicity on human dermal papilla cells was tested. At this time, 'biotin + tripeptide' (hereinafter referred to as 'simple mixture'), which is simply a mixture of biotin and tripeptide, was also tested and compared.

Human follicle dermal papilla cells (HFDPC), which are human dermal papilla cells, were cultured in an incubator at 37°C and 5% CO ₂ . When the degree of culture was 85 to 90% of the area of the culture vessel, the cells were detached by trypsin treatment, counted, and subcultured at 5Х10 ³ cells/cm ² . DMEM (Delbecco's Modified Eagle Medium, GIBCO) medium supplemented with 10% FBS (GIBCO), 100 U/ml penicillin, and 100 μg/ml streptomycin was used to culture the cells.

3-2. Safety confirmation for human dermal papilla cells

Human dermal papilla cells, HFDPC, were counted in a 24-well plate at 5Х10 ³ cells/well using a hemacytometer, and then aliquoted and cultured. After culturing in DMEM containing 10% FBS for 48 hours to reach ~70% of the surface area of the culture vessel, it was replaced with FBS-free DMEM containing the diluted fusion peptide or simple mixture of the present invention and cultured for an additional 24 hours.

After additional incubation, 50 ㎕ of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg/ml) was added and incubated for an additional 3 hours. . Afterwards, all cell culture was discarded, and 300 ㎕ of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was added to each well and stirred. Then, 100 ㎕ was taken into 96 wells and analyzed by Enzyme-Linked Immunosorbent Assay (ELISA) at 570 nm. Absorbance was measured. To make a relative evaluation, the degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using FBS-free DMEM without the sample.

As a result, it was confirmed that the fusion peptide of the present invention had no cytotoxicity against human dermal papilla cells even at 100 ppm, but that the simple mixture showed a survival rate of less than 40% compared to the untreated group (FIG. 5).

Experimental Example 4. Confirmation of skin regeneration effect of fusion peptide

The degree of wound regeneration was confirmed as one of the main physiological activity mechanisms of the composition having skin regeneration and skin soothing effects. The keratinocyte cell line HaCaT was dispensed into a 6-well plate at a rate of 2Х10 ⁵ cells/well and cultured in 10% FBS/DMEM medium for 48 hours to form a keratinocyte monolayer, then the culture medium was removed and a wound maker was used. A cell-free zone (scratch wound) was formed in each well. Afterwards, each well was washed three times with 1 ml of phosphate buffer (pH 7.4), and 3 ml of the fusion peptide, stepwise diluted with FBS-free DMEM culture medium, was added to each well and incubated in a CO ₂ incubator for 24 hours. The regenerative ability (healing ability) of the fusion peptide was measured by setting the control group treated with only FBS-free DMEM medium without peptide sample as 100 (%). Regenerative capacity was measured by comparing the wound area with the untreated group through cell staining and microscopy. Figure 6 shows a comparison of the micrograph of the wound site (Figure 6A) and the area of the wound site (Figure 6B).

As a result, the fusion peptide of the present invention showed excellent skin regeneration effect compared to the untreated group. When comparing the untreated group (control) to the fusion peptide-treated group with 100 (%), the wound healing was about 116.27% in the group treated with the fusion peptide at a concentration of 0.25 mM and about 163.27% in the group treated with the 0.5 mM concentration. It showed effect. From the above results, it was confirmed that the fusion peptide of the present invention has excellent skin regenerative efficacy .

Experimental Example 5. Confirmation of antioxidant effect of fusion peptide

The antioxidant effect of the fusion peptide synthesized in Example 1 was tested by measuring the free radical scavenging effect of the sample using DPPH (2,2-diphenyl-1-picrylhydrazyl). The freeze-dried fusion peptide was prepared by diluting it with each phosphate buffer (pH 7.4), and then 100 μL of 0.2 mM DPPH methanol solution was added to 100 μL of each sample solution and reacted at room temperature for 30 minutes. Afterwards, 100 μL of methanol was added to 100 μL of each sample solution as a blank, and the DPPH methanol solution was used as a negative control. The absorbance was measured at 520 nm, and the DPPH scavenging activity (antioxidation rate) was calculated. At this time, for comparative testing, the free radical scavenging effects of the tripeptide and the simple mixture were also measured and the results were compared.

As a result of the experiment, it was confirmed that the fusion peptide of the present invention had DPPH radical scavenging activity by showing an antioxidant rate of 40.33% to 72.23% (Table 1).

division Fusion peptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 Antioxidant rate (%) 0 40.33 48.52 60.16 72.23

On the other hand, the tripeptide had a similar or lower antioxidant rate than the fusion peptide of the present invention when treated at the same molar concentration (Table 2). Specifically, as the treatment concentration of the fusion peptide increased, the antioxidant activity increased, and at the highest concentration tested, 2 mM, it was confirmed that the antioxidant activity was approximately 20% higher than that of the tripeptide. Meanwhile, it was confirmed that the simple mixture of biotin and tripeptide had a lower antioxidant rate than when tripeptide was treated alone (Table 3).

division Tripeptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 Antioxidant rate (%) 0 45.56 48.16 49.16 52.25

division Simple mixture treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 Antioxidant rate (%) 0 15.16 27.51 34.30 38.87

That is, it was confirmed that the fusion peptide of the present invention had an excellent antioxidant rate compared to the tripeptide alone and the simple mixture (FIG. 7).

Experimental Example 6. Confirmation of L-DOPA inhibitory effect of fusion peptide

The effect of the whitening ingredient was evaluated by measuring the activity inhibition of the DOPA oxidation reaction of tyrosinase, which catalyzes the rate-determining step of the melanin synthesis process, using the L-DOPA inhibition test method. For comparative tests with the freeze-dried fusion peptide of the present invention, biotin, tripeptide, and a simple mixture of biotin and tripeptide were prepared by diluting them with sodium phosphate buffer (0.1 M, pH 6.8). In a test tube, 850 ul of sodium phosphate buffer (0.1 M, pH 7.0), 50 ul of sample diluted to the appropriate concentration, and 50 ul of mushroom tyrosinase solution were sequentially added and reacted at 37°C for 6 minutes. Add 50 ul of 0.06mM L-DOPA (L-3,4-dihydroxyphenylalanine, Sigma D9628-25G) solution to this solution and react at 37°C for 1 minute. After the reaction was completed, absorbance was measured at 475 nm using an ELISA reader.

As a result, very strong inhibitory activity against the L-DOPA substrate was observed in the group treated with the fusion peptide compared to the untreated control group, showing an inhibitory activity of 85.92% at the highest test concentration of 2 mM (Table 4).

division Fusion peptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 L-DOPA inhibition ability (%) 0 68.04 82.32 86.33 85.92

On the other hand, in the case of tripeptide, the inhibitory activity was 64.23% in the 2 mM concentration treatment group, which was a difference of about 21% compared to the inhibitory activity of the fusion peptide (Table 5). In the case of biotin, there was little effect with an inhibitory activity of about 2.5% in the 2mM concentration treatment group. Meanwhile, even in the case of simple mixture samples, the inhibitory activity of the fusion peptide of the present invention was 21.35% lower in the 2 mM concentration treatment group (Table 6 and Figure 8).

division Tripeptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 L-DOPA inhibition ability (%) 0 58.79 63.60 64.02 64.23

division Simple mixture treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 L-DOPA inhibition ability (%) 0 54.32 62.7 64.1 64.57

Experimental Example 7. Confirmation of L-tyrosine inhibitory effect of fusion peptide

The fusion peptide synthesized in Example 1 and the tripeptide as a comparison group were diluted with sodium phosphate buffer (0.1 M, pH 6.8) to prepare the final concentration of the entire reaction solution from 0.25 mM to 2.0 mM. 290 μL of sodium phosphate buffer, 100 μL of prepared sample, 10 mM, and 100 μL of substrate were added to a 2 mL tube and pre-incubated at 37°C for 5 minutes. Afterwards, 10 μL of 2,500 unit/mL tyrosinase solution was added to each solution and reacted at 37°C for 10 minutes. After completion of the reaction, the absorbance was measured at 475 nm, and 0.1 M phosphate buffer solution (pH 7.0) was used as a blank sample solution instead of the sample solution.

As a result, a strong inhibitory activity against tyrosine substrates was observed in the group treated with the fusion peptide compared to the untreated control group, and it was confirmed that the inhibitory activity was 63.53% to a maximum of 79.11% (Table 7, Figure 9).

division Fusion peptide treatment concentration (mM) Untreated group 0.25 0.5 0.75 1.0 2.0 L-tyrosine inhibition ability (%) 0 63.53 78.23 78.23 79.11 78.93

On the other hand, in the case of tripeptide, it showed an inhibitory activity of 79.01% of the maximum activity in the 2mM concentration treatment group (Table 8), but in the cell safety test on human keratinocytes conducted previously, the tripeptide showed cytotoxicity at 2mM concentration. Considering this, it was expected that the fusion peptide of the present invention could be used as a tyrosinase activity inhibitor without skin irritation.

In addition, when the simple mixture was treated at all tested concentrations, it was confirmed that the inhibitory activity was lower than that of the fusion peptide of the present invention (Table 9).

division Tripeptide treatment concentration (mM) Untreated group 0.25 0.5 0.75 1.0 2.0 L-tyrosine inhibition ability (%) 0 53.03 70.16 74.76 77.34 79.01

division Simple mixture treatment concentration (mM) Untreated group 0.25 0.5 0.75 1.0 2.0 L-tyrosine inhibition ability (%) 0 62.05 74.11 74.55 73.17 73.44

Experimental Example 8. Confirmation of the effect of fusion peptide on whitening factor mRNA expression

8-1. Melanocyte culture

B16F10 cells were distributed in 6-well plates at 1Х10 ⁴ cells/well, cultured in 10% FBS/DMEM medium for 24 hours, and then fusion peptides serially diluted in FBS-free DMEM medium were treated in each well. The negative control group was treated with FBS-free DMEM medium alone without any sample treatment.

8-2. Confirmation of change in whitening factor mRNA expression level according to fusion peptide treatment

After 24 hours of sample treatment, the sample was washed with phosphate buffer solution (PBS) and RNA was extracted by adding 1 ml of Trizol reagent. 5 Х prime script RT master mix (Takara, Japan) was added to the extracted RNA, reacted at 37°C for 15 minutes to synthesize cDNA, and then RT-PCR was performed. For RT-PCR, 2 μl of each primer was added to 1 μl of synthesized cDNA, 25 μl of EmeraldAmp GT PCR Master Mix (Takara, Japan) and 20 μl of tertiary sterilized water were added and mixed well. Denaturation was performed at 95°C for 30 seconds, extension at 72°C for 1 minute, a total of 30 cycles, and annealing was performed at the optimal temperature for each primer. Primer types for evaluating mRNA expression levels include Tyrosinase, Tyrosinase related protein-1 (TRP1), Dopachrome tautomerase (DCT), and microphthalmia-related transcripts. Primers for the factor (Microphthalmia-associated transcriptian factor, MITF) were used, and the primer sequences are shown in Table 10 below.

type Forward sequence
(5’→ 3’) Reverse sequence
(5’→ 3’) Tyrosinase GGCCAGCTTTCAGGCAGAGGT
(SEQ ID NO: 1) TGGTGCTTCATGGGCAAAATC
(SEQ ID NO: 2) TRP1 GTCATTGCCACAAGGAGGTT
(SEQ ID NO: 3) CCCAGTTGCAAAATTCCAGT
(SEQ ID NO: 4) DCT TGTGCAAGATTGCCTGTCTC
(SEQ ID NO: 5) GTTGCTCTGCGGTTAGGAAG
(SEQ ID NO: 6) MITF AGCGTGTATTTTCCCCACAG
(SEQ ID NO: 7) CCTTAGCTCGTTGCTGTTCC
(SEQ ID NO: 8)

The higher the ability to suppress the expression of melanin synthesis factors, the more suppressed melanin synthesis is, and the better the whitening effect. After treating B16F10 cells with the fusion peptide of the present invention, it was confirmed that the mRNA expression levels of tyrosinase, TRP1, DCT, and MITF, which are factors that promote melanin synthesis, were all decreased (FIG. 10). Specifically, the fusion peptide of the present invention has a tyrosinase mRNA expression level of 50.62%, TRP1 mRNA expression level of 56.95%, DCT mRNA expression level of 70.08%, and MITF mRNA expression level of 39.66% compared to the untreated group (Control). This was confirmed through electrophoresis band quantification (FIG. 11).

Experimental Example 9. Confirmation of the effect of fusion peptide on hair growth promoting factor mRNA expression

9-1. Human hair papilla cell culture

Human hair papilla cells were distributed in 6-well plates at 1Х10 ⁴ cells/well, cultured in 10% FBS/DMEM medium for 24 hours, and then fusion peptides diluted stepwise with FBS-free DMEM medium were treated in each well. In the negative control group, only FBS-free DMEM medium was treated without sample treatment.

9-2. Confirmation of change in hair growth promoting factor mRNA expression level according to fusion peptide treatment

After 24 hours of sample treatment, the sample was washed with phosphate buffer solution (PBS) and RNA was extracted by adding 1 ml of Trizol reagent. 5 Х prime script RT master mix (Takara, Japan) was added to the extracted RNA, reacted at 37°C for 15 minutes to synthesize cDNA, and then RT-PCR was performed. For RT-PCR, 2 μl of each primer was added to 1 μl of synthesized cDNA, 25 μl of EmeraldAmp GT PCR Master Mix (Takara, Japan) and 20 μl of tertiary sterilized water were added and mixed well. Denaturation was performed at 95°C for 30 seconds, extension was performed at 72°C for 1 minute, a total of 30 cycles, and annealing temperature was performed at the optimal temperature for each primer. The types of primers used to evaluate mRNA expression levels were DKK-1 (Dickkopf-related protein 1), SRD5A1 (Steroid 5 Alpha-Reductase 1), and Noggin, and the sequences are shown in Table 11 below.

type Forward sequence
(5’→ 3’) Reverse sequence
(5’→ 3’) DKK-1 TGATGAGTACTGCGCTAGTC
(SEQ ID NO: 9) CTCCTATGCTTGGTACACAC
(SEQ ID NO: 10) SRD5A1 ACTGCATCCTCTCTGGCCATGTTC
(SEQ ID NO: 11) GGCATAGCCACACCACTCCATGA
(SEQ ID NO: 12) Noggin GGCACCCAGCGACAACCT
(SEQ ID NO: 13) CAGCCACATCTGTAACTTCCTC
(SEQ ID NO: 14)

As a result of the experiment, it was confirmed that the fusion peptide according to the present invention in human dermal papilla cells increased the expression level of Noggin, a factor involved in hair growth promotion, and decreased the expression level of DKK-1 and SRD5A1, a factor involved in hair loss promotion ( Figure 12). Specifically, when the fusion peptide was treated at 10 and 100 ppm, the expression level of Noggin was up to 123% compared to the untreated group (Figure 13), and in the case of DKK-1, mRNA expression was up to about 74.11% compared to the untreated group. The amount decreased (Figure 14), and in the case of SRD5A1, it was confirmed that the mRNA expression level decreased by 54.64% compared to the untreated group (Figure 15).

From the above results, it was confirmed that the fusion peptide of the present invention is effective in skin whitening, antioxidant, skin condition improvement, and hair loss inhibition.

As above, specific parts of the content of the present invention have been described in detail, and those skilled in the art will understand that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. It will be obvious. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (14)

A cosmetic composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising a fusion peptide represented by the following formula (1) as an active ingredient.
[Formula 1]
According to paragraph 1,
A cosmetic composition wherein the skin condition improvement is at least one selected from the group consisting of skin regeneration, skin soothing, skin whitening, and wound improvement. According to paragraph 1,
The composition is a cosmetic composition that promotes antioxidant activity. According to paragraph 1,
The composition is a cosmetic composition that inhibits the oxidation activity of L-tyrosine (L-tyrosine) or L-dopa (L-dopa). According to paragraph 1,
The composition is a cosmetic composition that reduces the expression of one or more selected from the group consisting of tyrosinase, TRP1, DCT, MITF, DKK-1, and SRD5A1. According to paragraph 1,
The composition is a cosmetic composition that increases the expression of Noggin. A quasi-drug composition for preventing or improving skin disease or hair loss comprising a fusion peptide represented by the following formula (1) as an active ingredient,
A quasi-drug composition, wherein the skin disease is at least one selected from the group consisting of skin pigmentation, skin wounds, and skin scars.
[Formula 1]
delete In clause 7,
The composition may be used to treat alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, and congenital alopecia. From the group consisting of alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, and telogen effluvium. A quasi-drug composition that prevents or improves one or more selected alopecia. A pharmaceutical composition for preventing or treating skin disease or hair loss comprising a fusion peptide represented by the following formula (1) as an active ingredient,
A pharmaceutical composition, wherein the skin disease is at least one selected from the group consisting of skin pigmentation, skin wounds, and skin scars.
[Formula 1]
delete According to clause 10,
The composition may be used to treat alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, and congenital alopecia. From the group consisting of alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, and telogen effluvium. A pharmaceutical composition for preventing or treating one or more selected alopecia conditions. A food composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising a fusion peptide represented by the following formula (1) as an active ingredient.
[Formula 1]
A feed composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising the fusion peptide represented by the following formula (1) as an active ingredient.
[Formula 1]