KR102666212B1 - Pharmaceutical Composition for preventing and treating of obesity or metabolic disease comprising cholecystokinin and nonanoic acid - Google Patents

Abstract

The present invention relates to pharmaceutical compositions for preventing or treating obesity or metabolic diseases, food compositions for preventing or improving them, and health functional foods containing cholecystokinin and nonanoic acid as active ingredients. The colacystokinin octapeptide and nonanoic acid of the present invention are excellent in promoting the formation of beige adipocytes in mouse mesenchymal stem cells and can effectively increase the density and activity of mitochondria, which can be used as active ingredients. The composition of the present invention containing the composition can be usefully used in the pharmaceutical and food fields as a material that can prevent, improve, and treat obesity and metabolic diseases caused by obesity.

Description

Pharmaceutical composition for preventing or treating obesity or metabolic disease comprising cholecystokinin and nonanoic acid as active ingredients {Pharmaceutical Composition for preventing and treating of obesity or metabolic disease comprising cholecystokinin and nonanoic acid}

The present invention relates to pharmaceutical compositions for preventing or treating obesity or metabolic diseases, food compositions for preventing or improving them, and health functional foods containing cholecystokinin and nonanoic acid as active ingredients.

Obesity and obesity-related metabolic health complications are now becoming an important public health issue. Obesity is associated with an increased risk of death because it clearly increases the risk of many serious and life-threatening conditions (or diseases), including diabetes, atherosclerosis, hypertension, coronary artery disease, and cancer. Worldwide, approximately 700 million adults are currently obese, and the prevalence of obesity is expected to rapidly increase by 2030. The cause of this rapid increase in the prevalence of obesity appears to be the result of a shift over the past century toward a lifestyle in which exercise is recreational, consumption of high-calorie foods, and physical inactivity. These changes in lifestyle prevent excess energy from being released, store it in the body as fat for a long period of time, and cause obesity.

Mammals have two specific types of fat tissue that play contrasting roles. These two types of adipose tissue are white adipose tissues and brown adipose tissues. White adipose tissue, characterized by having large unilocular lipid droplets and peripheral nuclei containing white adipocytes, is an active endocrine organ that secretes various adipokines and regulates metabolic responses. Brown adipose tissue and white adipose tissue are morphologically and functionally different from each other. Although each can differentiate into individual adipocytes, the origins of differentiation are distinctly different. The presence of UCP1 in white adipose tissue with multivesicular lipid droplets containing cells with the ability to generate heat is called Beige Adipose Tissue. Beige adipocytes not only have the same characteristics as brown adipocytes, such as expressing UCP-1, producing heat, and having a higher number of mitochondria, but also have fibroblast growth factor 21 (FGF21), CD137, and T-box transcription factor (TBX1). ), transmembrane protein 26 (TMEM26), and cytochrome c oxidase subunit II (Cox2). Brown and beige fat may contribute to regulating energy expenditure throughout the body. It is believed that promoting the differentiation of white adipocytes into brown and beige adipocytes may help alleviate the side effects of white adipocytes and improve metabolic disorders.

Meanwhile, cholecystokinin is a peptide hormone secreted from small intestine epithelial cells that promotes the secretion of enzymes that digest food. Additionally, it is known to suppress appetite by acting on the central nervous system. Intestinal hormones such as cholecystokinin play an important role in various metabolic functions such as appetite, calorie consumption, glucose homeostasis, and lipid metabolism that occur after food intake.

Nonanoic acid, one of the medium chain fatty acids, is also called pelargonic acid because it is contained in large quantities in the oil of the flower called palargonium. Nonanoic acid binds to isophoric receptors in mouse intestinal cells and promotes the secretion of a hormone called GLP-1, which has the effect of reducing blood sugar. It also prevents enteritis and protects the intestinal barrier by preventing bacterial infection and is involved in the intestinal function. It is known to do so. However, there has been no research on the beige fat-forming action of medium-chain fatty acids, including nonanoic acid.

Against this background, the present inventors confirmed that cholecystokinin and nonanoic acid can be usefully used to improve obesity and related metabolic diseases by promoting the differentiation of mouse mesodermal stem cells into beige adipocytes and increasing mitochondrial density and activity, thereby providing the basis for the present invention. was completed.

Korean Patent Publication No. 10-2010-0088887 Korean Patent Publication No. 10-2005-0071355 Korean Patent Publication No. 10-2020-0109475

Therefore, the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, which can promote beige fat formation and effectively increase mitochondrial density and activity.

Another object of the present invention is to provide a food composition for preventing or improving obesity or metabolic diseases caused by obesity, which can promote beige fat formation and effectively increase mitochondrial density and activity.

Another object of the present invention is to provide a health functional food for preventing or improving obesity or metabolic diseases caused by obesity, which can promote beige fat formation and effectively increase mitochondrial density and activity.

In order to achieve the above object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating obesity containing nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the composition may further include colacystokinin octapeptide as an active ingredient.

In one embodiment of the present invention, the colacystokinin octapeptide may be a compound represented by Formula 1 below.

[Formula 1]

In one embodiment of the present invention, the nonanoic acid or a pharmaceutically acceptable salt thereof may be included at a concentration of 0.1 to 1000 μM.

Additionally, the present invention provides a food composition for preventing or improving obesity comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the composition may further include colacystokinin octapeptide as an active ingredient.

In one embodiment of the present invention, the colacystokinin octapeptide may be a compound represented by Formula 1 above.

In addition, the present invention provides a health functional food for preventing or improving obesity containing nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the composition may further include colacystokinin octapeptide as an active ingredient.

In one embodiment of the present invention, the colacystokinin octapeptide may be a compound represented by Formula 1 above.

In one embodiment of the present invention, the food is selected from the group consisting of beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements. It can be.

Additionally, the present invention provides a composition for preventing, improving, or treating metabolic diseases caused by obesity, comprising nonanoic acid and colacystokinin octapeptide as active ingredients.

In one embodiment of the present invention, the colacystokinin octapeptide may be a compound represented by Formula 1 above.

In one embodiment of the present invention, the metabolic disease caused by obesity may be selected from the group consisting of diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease, or metabolic syndrome in which the above diseases occur simultaneously. .

In one embodiment of the present invention, the composition may be a pharmaceutical composition or a food composition.

The colacystokinin octapeptide and nonanoic acid of the present invention are excellent in promoting the formation of beige adipocytes in mouse mesenchymal stem cells and can effectively increase the density and activity of mitochondria, which can be used as active ingredients. The composition of the present invention containing the composition can be usefully used in the pharmaceutical and food fields as a material that can prevent, improve, and treat obesity and metabolic diseases caused by obesity.

Figure 1 shows the results of measuring the expression of the CCK B receptor gene after differentiation of mouse mesenchymal stem cells into beige adipocytes through RT-PCR and qPCR. Figure 1A shows RT-PCR results, and Figure 1B shows q-PCR results (*p <0.05).
Figure 2 shows the results of immunocytochemical staining of Cy5-CCK B receptor in mouse mesenchymal stem cells. Figure 2A shows the results of Cy5-CCK B receptor aptamer (red), Na+/K+ pump antibody (green), DAPI nuclear staining (blue), and merged. Figure 2B shows the results of Cy5-CCK B receptor aptamer (red) and DAPI nuclear staining (blue), merged, in live cells.
Figure 3 shows the results of measuring the change in beige fat marker gene expression by q-PCR according to treatment with colacystokinin octapeptide and nonanoic acid during differentiation of mouse mesenchymal stem cells into beige adipocytes (*p <0.05, ** p <0.01, NS: not significant)
Figure 4 shows the results of confirming changes in intracellular fat accumulation according to treatment with colacystokinin octapeptide and nonanoic acid during differentiation of mouse mesenchymal stem cells into beige adipocytes through Oil-Red-O staining. Figure 4 is a micrograph obtained after staining, and Figure 4B is the absorbance measurement result (p <0.05, **p <0.01, ***p <0.001, NS: not significant).
Figure 5 shows the results of measuring changes in mitochondrial density according to treatment with colacystokinin octapeptide and nonanoic acid during differentiation of mouse mesenchymal stem cells into beige adipocytes (** p <0.01, NS: not significant).

Hereinafter, the terms used in the present invention will be explained.

In the present invention, “pharmaceutically acceptable” means that it does not significantly stimulate the organism and does not inhibit the biological activity and properties of the administered active substance.

The term “prevention” used in the present invention refers to any action that suppresses the symptoms or delays the progression of a specific disease (eg, obesity or metabolic disease caused by obesity) by administering the composition of the present invention.

The term “treatment” used in the present invention refers to any action that improves or beneficially changes the symptoms of a specific disease (eg, obesity or metabolic disease caused by obesity) by administering the composition of the present invention.

As used herein, the term “improvement” means any action that reduces at least the severity of parameters related to the condition being treated, such as symptoms of a particular disease (e.g., obesity or metabolic diseases caused by obesity).

As used herein, the term “administration” means providing a given composition of the invention to a subject by any suitable method. At this time, the subject is any human, monkey, dog, goat, pig, or rat, etc., who has a disease in which the symptoms of a specific disease (e.g., obesity or metabolic disease caused by obesity) can be improved by administering the composition of the present invention. means animal.

In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit or risk ratio applicable to medical treatment, which refers to the type, severity, activity of the drug, and It can be determined based on factors including sensitivity, time of administration, route of administration and excretion rate, duration of treatment, drugs used simultaneously, and other factors well known in the medical field.

Hereinafter, the present invention will be described in detail.

The present invention is characterized by providing a composition for preventing or treating obesity or metabolic diseases caused by obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

“Nonanoic acid” referred to in this specification is also called pelargonic acid because it is contained in large quantities in the oil of the flower called Pallargonium, and is an organic compound consisting of 9 carbons with a carboxylic acid at the terminal. The chemical formula is CH ₃ (CH ₂ ) ₇ COOH. Nonanoic acid is a clear, oily liquid with an unpleasant rancid odor. It is virtually insoluble in water, but soluble in chloroform, ether, and hexane. It is commonly used in combination with glyphosate, a non-selective herbicide, to quickly control weeds in lawns.

The nonanoic acid according to the present invention can be used in the form of a salt, preferably a pharmaceutically acceptable salt.

A useful pharmaceutically acceptable salt is an acid addition salt formed by a pharmaceutically acceptable free acid. Acid addition salts are prepared by conventional methods, for example, by dissolving the compound in an excess of aqueous acid and precipitating the salt using a water-miscible organic solvent, such as methanol, ethanol, acetone or acetonitrile. Equimolar amounts of the compound and an acid or alcohol (e.g., glycol monomethyl ether) in water can be heated and the mixture can then be evaporated to dryness, or the precipitated salt can be filtered off with suction.

At this time, organic acids and inorganic acids can be used as free acids. Hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. can be used as inorganic acids, and methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, etc. can be used as organic acids. Citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid ( gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid, etc. can be used.

Additionally, a pharmaceutically acceptable metal salt can be prepared using a base. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. At this time, it is particularly pharmaceutically suitable to produce sodium, potassium or calcium salts as metal salts, and the corresponding silver salts are obtained by reacting an alkali metal or alkaline earth metal salt with an appropriate silver salt (eg, silver nitrate).

In the following examples of the present invention, it was confirmed for the first time that nonanoic acid promotes the differentiation of mouse mesodermal stem cells into beige adipocytes and increases the density and activity of mitochondria.

Therefore, the present invention provides a pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In the present invention, the term “obesity” includes simple obesity, symptomatic obesity, childhood obesity, adult obesity, cytoproliferative obesity, hypertrophic obesity, upper body obesity, lower body obesity, visceral fat type obesity, and subcutaneous fat type obesity, but does not necessarily include It is not limited.

In the present invention, the “metabolic disease” may be a metabolic disease caused by obesity or a metabolic disease caused by other causes. Examples of metabolic diseases include diabetes, hyperlipidemia, fatty liver, arteriosclerosis, high blood pressure, cardiovascular disease, or the above. Diseases may be selected from the group consisting of metabolic syndromes that occur simultaneously, but are not limited thereto.

The pharmaceutical composition of the present invention can be prepared using pharmaceutically suitable and physiologically acceptable auxiliaries in addition to the above active ingredients, and the auxiliaries include excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants, Lubricants or flavoring agents can be used.

For administration, the pharmaceutical composition may preferably be formulated as a pharmaceutical composition containing one or more pharmaceutically acceptable carriers in addition to the active ingredients described above.

The pharmaceutical composition may be in the form of granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, or injectable solutions. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacance or sodium oleate, sodium stearate, magnesium stearate, sodium Includes benzoate, sodium acetate, sodium chloride, etc. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, etc. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. Additionally, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or ingredient using a method disclosed by Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA, as an appropriate method in the field.

In one embodiment of the present invention, nonanoic acid or a pharmaceutically acceptable salt thereof may be included in an amount of 0.1 to 99% by weight based on the total weight of the composition, and the nonanoic acid or its pharmaceutically acceptable salt may be included in an amount of 0.1 to 99% by weight based on the total weight of the composition. Acceptable salts may be included in concentrations from 0.1 to 1000 μM.

The composition of the present invention, in addition to the above-mentioned nonanoic acid or a pharmaceutically acceptable salt thereof, is a mixture of anti-obesity agents that have been used conventionally as long as they do not cause side effects by reacting with nonanoic acid (or a salt thereof). You can also use it.

In one embodiment of the present invention, the composition may further include Cholecystokinin octapeptide as an active ingredient in addition to Nonanoic acid.

The cholecystokinin octapeptide may be a compound represented by the following formula (1).

[Formula 1]

Additionally, the present invention provides a food composition for preventing or improving obesity or metabolic diseases caused by obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, nonanoic acid or a pharmaceutically acceptable salt thereof may be included in an amount of 0.1 to 99% by weight based on the total weight of the food composition, and nonanoic acid or a pharmaceutically acceptable salt thereof may be included in an amount of 0.1 to 99% by weight based on the total weight of the food composition. Acceptable salts may be included in the food composition at a concentration of 0.1 to 1000 μM.

The food composition of the present invention, in addition to containing the active ingredient nonanoic acid or a pharmaceutically acceptable salt thereof, may contain various flavoring agents or natural carbohydrates as additional ingredients like a typical food composition. .

Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The above-described flavoring agents include natural flavoring agents (thaumatin), stevia extracts (e.g. rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).

In addition, the food composition of the present invention can be preferably formulated as a food composition by including one or more foodologically acceptable or pharmaceutically acceptable carriers in addition to the active ingredients described above.

The formulation form of the food composition may be tablets, capsules, powders, granules, liquids, pills, liquids, syrups, juices, suspensions, emulsions, or drops. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacance or sodium oleate, sodium stearate, magnesium stearate, sodium Includes benzoate, sodium acetate, sodium chloride, etc. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, etc. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. Additionally, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

The food composition of the present invention formulated in the manner described above can be used as a functional food or added to various foods.

Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, health supplements, etc. There is.

In addition, the food composition contains various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants, and thickening agents in addition to the active ingredient nonanoic acid or a pharmaceutically acceptable salt thereof. (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated drinks, etc. . In addition, the food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages.

Nonanoic acid or its pharmaceutically acceptable salt, which is the active ingredient of the present invention, is a type of organic acid and has almost no side effects like chemicals, so it can be used for a long period of time for the purpose of providing functionality such as anti-obesity or improving metabolic syndrome. You can use it with confidence.

In one embodiment of the present invention, the composition may further include Cholecystokinin octapeptide as an active ingredient in addition to Nonanoic acid.

The cholecystokinin octapeptide may be a compound represented by Formula 1.

In addition, the present invention provides a health functional food for preventing or improving obesity or metabolic diseases caused by obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The health functional food of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing or improving obesity or metabolic diseases caused by obesity.

In the present invention, “health functional food” refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with the Health Functional Food Act, and refers to food that adjusts nutrients or regulates nutrients for the structure and function of the human body. It means ingestion for the purpose of obtaining useful health effects such as physiological effects.

The health functional food of the present invention may contain common food additives, and its suitability as a food additive is determined in accordance with the general provisions and general test methods of the food additive code approved by the Food and Drug Administration, unless otherwise specified. Judgment is made according to specifications and standards.

Items listed in the “Food Additive Code” include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as dark pigment, licorice extract, crystalline cellulose, high-quality pigment, and guar gum; Mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations are included.

For example, health functional foods in the form of tablets are prepared by mixing nonanoic acid, the active ingredient of the present invention, or a pharmaceutically acceptable salt thereof with excipients, binders, disintegrants, and other additives in a conventional manner. After granulation, a lubricant, etc. can be added and compression molded, or the mixture can be directly compression molded. Additionally, the health functional food in the form of tablets may contain flavoring agents, etc., if necessary.

Among capsule-type health functional foods, hard capsules can be manufactured by filling a regular hard capsule with nonanoic acid, the active ingredient of the present invention, or a pharmaceutically acceptable salt thereof, and soft capsules contain the nonanoic acid ( Nonanoic acid) can be manufactured by filling a mixture of additives such as excipients into a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.

The health functional food in the form of a ring can be prepared by molding a mixture of nonanoic acid, the active ingredient of the present invention, or a pharmaceutically acceptable salt thereof, and excipients, binders, disintegrants, etc., using a known method. If necessary, the surface can be coated with white sugar or other peeling agents, or the surface can be coated with substances such as starch or talc.

The health functional food in the form of granules is manufactured by mixing nonanoic acid, the active ingredient of the present invention, or a pharmaceutically acceptable salt thereof, with excipients, binders, disintegrants, etc., into granules using a known method. It may contain flavoring agents, flavoring agents, etc., if necessary.

In one embodiment of the present invention, the health functional food may further include Cholecystokinin octapeptide as an active ingredient in addition to Nonanoic acid.

The cholecystokinin octapeptide may be a compound represented by Formula 1.

The health functional foods may include beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrating the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example 1>

Gene expression analysis of cholecystokinin B receptor, the molecular target of cholecystokinin octapeptide

In this experiment, an experiment was performed to measure the expression of the cholecystokinin B receptor (hereinafter simply abbreviated as 'CCK B Receptor') gene, the molecular target of cholecystokinin octapeptide, in C3H/10T1/2 cells. did. Receptor expression was confirmed by RT-PCR and q-PCR in C3H/10T1/2 cells. C3H/10T1/2 cells used in the experiment were purchased from Korea Cell Line Bank (KCLB).

<1-1> Cell culture

The cell culture medium was DMEM (Dulbecco’s Modified Eagle’s Medium) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (PEST) and cultured at 37°C and 5% CO₂ conditions. 10 ml of medium was added to a 75 cm2 culture flask and cultured, and the medium was replaced every 2-3 days. During subculture, after washing with PBS, 1ml of 0.01% trypsin was added, incubated for 5 minutes, and 4ml of DMEM/FBS/PEST medium was added to stop the reaction.

<1-2> Beige adipocyte differentiation

To induce differentiation of C3H/10T1/2 cells into beige fat, 125μM indomethacin, 0.5μM rosiglitazone, 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 5μg/ml Culture medium containing insulin, 1nM 3,3',5-Triiodo-L-thyronine (T3), and 2μg/ml dexamethaxone was incubated at 37°C and 5% CO. Cultured for two days under CO₂ conditions. Then, to maintain differentiation, the culture medium containing 1nM 3,3',5-triiodo-L-tyrosine (T3), 5μg/ml insulin, and 1μM rosiglitazone was replaced for two days, and cultured at 37°C for 6 days until complete differentiation. Cultured under 5% CO₂ conditions. In the control group, the differentiation medium was replaced with new culture medium containing the same amount of DMSO for both groups, and the cells were cultured at 37°C and 5% CO₂ for two days.

<1-3> Cholecystokinin B receptor gene expression

RT-PCR and qPCR were performed to confirm RNA expression of the cholecystokinin B receptor gene in C3H/10T1/2 cells.

[cDNA synthesis]

RNA was extracted from cultured C3H/10T1/2 cells, and cDNA synthesis was performed using the ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). More specifically, to increase the efficiency of the RT-PCR reaction, the extracted RNA was treated at 65°C for 5 minutes and then immediately stored on ice. Afterwards, a total of 8 μl of reaction product was prepared with 2 μl of 4×DNA Master Mix containing gDNA remover, 0.5 μg of RNA, and distilled (nuclease-free water) and reacted at 37°C for 5 minutes. Next, 5×RT Master mix was added to the reaction product and reacted for 37°C for 5 minutes, 50°C for 5 minutes, and 98°C for 5 minutes to synthesize cDNA.

[PCR]

The cDNA synthesized by the above method was subjected to PCR using the primers listed in Table 1 below. Next, the obtained PCR product was loaded onto an agarose gel by electrophoresis to confirm RNA expression of the cholecystokinin B receptor gene. At this time, L32, a house keeping gene, was used as a control.

As a result, as shown in Figure 1A, it was confirmed that the expression of cholecystokinin B receptor (CCK B Receptor) increased after differentiation into beige fat compared to before differentiation.

Gene amplification primer sequences used for PCR and qPCR gene Primer sequence (5'->3') CCK B Receptor forward CGCTGCTGTCCTCAACAATA Reverse AGGCCAACTTCATCACATCC L32 forward AGAAGTTCATCCGGCACCAG Reverse CACTTCCAGCTCCTTGACGT

[qPCR(quantitative real-time PCR)]

qPCR using the cDNA synthesized by the above method was performed using the primers disclosed in Table 1 above using a method known to those skilled in the art, using the THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) and the iQ5 iCycler system (Bio-rad, California, USA) ), and more specifically, after denaturation at 95°C for 4 minutes and 30 seconds, an additional denaturation process was performed over 40 cycles for 10 seconds at the same temperature, followed by heating and cooling at 55°C to 60°C for 30 seconds. The process was performed and stretched at 68°C for 20 seconds. The expression level of each gene was normalized using L32 expression. Primers were designed using the nucleotide blast software of the National Center for Biotechnology Information (NCBI) and purchased from Bionics (Seoul, Korea).

As a result, it was confirmed that the gene expression of CCK B Receptor was significant in C3H/10T1/2 cells before differentiation and cells differentiated into beige fat. Figure 1A shows an RT-PCR experiment, and Figure 1B shows a qPCR experiment. In both experiments, the expression of CCK B Receptor was found to be higher after differentiation than before differentiation.

<Example 2>

Gene expression analysis of cholecystokinin B receptor, the molecular target of cholecystokinin octapeptide, using immunocytochemistry

In this experiment, immunocytochemistry was performed using antibodies and aptamers to confirm the expression of CCK B Receptor in C3H/10T1/2 cells.

<2-1> Immunocytochemical staining using aptamers and antibodies

To confirm the location of a specific protein within the cell, immunocytochemical staining was performed using a sodium/potassium pump antibody (Santa Cruz, Cat. sc-48345), one of the cell membrane potential proteins, and an aptamer (Genotech, AP1153). It was analyzed through immunofluorescence microscopy. Cells were cultured in a 35mm glass bottom 6-well plate, and 500㎕ medium was added and cultured at 37°C and 5% CO₂ conditions. Binding buffer prepared to increase the binding force between cells and aptamers (2mM MgCl2, 100mM NaCl, 5mM KCl, 1Mm CaCl2, 20mM Tris-HCl, Tween 20 (0.02%) and pH 7.6, hereinafter briefly referred to as ' The cells were washed with (abbreviated as BB'). Without a fixation step, 200 ㎕ of aptamer working solution prepared to have a concentration of 250 nM in BB with Cy5-labeled CCK B receptor aptamer was added to each well and incubated at room temperature for 30 minutes. After washing once with BB, 200 μl of 4% paraformaldehyde was added to each well and incubated at room temperature for 10 minutes to fix the cells. After the fixation step, the cells were washed again with BB and then diluted with 1% fish gelatin and 10% goat serum in PBS-T to avoid non-specific antigen-antibody binding and incubated at 37°C for 1 hour. , cultured under 5% CO₂ conditions. Primary antibody, 5% BSA (bovine serum albumin), and 0.1% TBS Tween diluted 1:100 were added to the blocked cells in BB and incubated at room temperature for 2 hours. Next, DAPI dye was added and incubated for 5 minutes at room temperature. After washing with BB as before, it was observed under a confocal microscope using a 40X objective lens. The software used was Leica application suite software.

As a result, as shown in Figure 2A, it was confirmed that the antibody and aptamer were located in the cell membrane. These results show that CCK B Receptor is expressed in C3H/10T1/2 cells.

<2-2> Immunocytochemical staining using aptamer

To confirm the location of specific proteins within cells, immunocytochemical staining was performed and analyzed through immunofluorescence microscopy. Cells were cultured in a 35mm glass bottom 6-well plate, and 500㎕ medium was added and cultured at 37°C and 5% CO₂ conditions. Cells were washed with binding buffer (BB) prepared to increase the binding force between cells and aptamers. Without a fixation step, 200 ㎕ of aptamer working solution prepared to have a concentration of 250 nM in BB with Cy5-labeled CCK B receptor aptamer was added to each well and incubated at room temperature for 30 minutes. After washing once with BB, 200 μl of 4% paraformaldehyde was added to each well and incubated at room temperature for 10 minutes to fix the cells. After the fixation step, the cells were washed again with BB, then DAPI dye was added and incubated at room temperature for 5 minutes. After washing with BB as before, it was observed under a confocal microscope using a 40X objective lens. The software used was Leica application suite software.

As a result, as shown in Figure 2B, it was confirmed that the aptamer bound to the cell membrane location and displayed fluorescence. These results show that CCK B Receptor is expressed in C3H/10T1/2 cells.

<Example 3>

Verification of the efficacy of promoting beige fat differentiation by treatment with cholecystokinin octapeptide and nonanoic acid in C3H/10T1/2 cells

In this experiment, C3H/10T1/2 cells were treated with Cholecystokinin octapeptide (hereinafter simply abbreviated as 'CCK-8') and Nonanoic acid (hereinafter simply abbreviated as 'NA') during differentiation. An experiment was conducted to confirm the effect of promoting beige fat differentiation. For this purpose, changes in the expression of beige fat marker genes ( Ucp1, Dio2, Chrna2, Pgc1a, Cidea, CytC ) were confirmed using q-PCR when the material was treated during differentiation. Additionally, to confirm the degree of differentiation, Oil-Red-O staining was performed to measure the degree of intracellular lipid accumulation.

<3-1> Cell culture

The cell culture medium was DMEM (Dulbecco’s Modified Eagle’s Medium) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (PEST) and cultured at 37°C and 5% CO₂ conditions. 10 ml of medium was added to a 75 cm2 culture flask and cultured, and the medium was replaced every 2-3 days. During subculture, after washing with PBS, 1ml of 0.01% trypsin was added, incubated for 5 minutes, and 4ml of DMEM/FBS/PEST medium was added to stop the reaction.

<3-2> Beige adipocyte differentiation

To induce differentiation of C3H/10T1/2 cells into beige fat, 125μM indomethacin, 0.5μM rosiglitazone, 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 5μg/ml Culture medium containing insulin, 1nM 3,3',5-Triiodo-L-thyronine (T3), and 2μg/ml dexamethaxone was incubated at 37°C and 5% CO. Cultured for two days under CO₂ conditions. Then, to maintain differentiation, the culture medium containing 1nM 3,3',5-triiodo-L-tyrosine (T3), 5μg/ml insulin, and 1μM rosiglitazone was replaced for two days, and cultured at 37°C for 6 days until complete differentiation. Cultured under 5% CO₂ conditions. 10 μM of cholecystokinin octapeptide (Cayman chemical, CAS. 25126-32-3) and 2 μM of nonanoic acid (Sigma-Aldrich, CAS. 112-05-0) were treated with the medium containing the differentiation inducing reagent during the differentiation process into beige fat. . To confirm the effect of the substance, the experiment was divided into a negative control group, an experimental group treated with each reagent separately, and an experimental group treated with the two reagents together.

<3-3> Beige fat-related gene expression

qPCR was performed to confirm the RNA expression of beige fat-related genes ( Ucp1, Dio2, Chrna2, Pgc1a, Cidea, CytC ) in C3H/10T1/2 cells.

[cDNA synthesis]

RNA was extracted from differentiated beige adipocytes and cDNA was synthesized using the ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). More specifically, to increase the efficiency of the RT-PCR reaction, the extracted RNA was treated at 65°C for 5 minutes and then immediately stored on ice. Afterwards, a total of 8 μl of reaction product was prepared with 2 μl of 4×DNA Master Mix containing gDNA remover, 0.5 μg of RNA, and distilled (nuclease-free water) and reacted at 37°C for 5 minutes. Next, 5×RT Master mix was added to the reaction product and reacted for 37°C for 5 minutes, 50°C for 5 minutes, and 98°C for 5 minutes to synthesize cDNA.

[qPCR (quantitative real-time PCR)]

Using the cDNA synthesized by the above method, qPCR was performed using the primers listed in Table 2 below using a method known to those skilled in the art, using THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) and iQ5 iCycler system (Bio-rad, California, USA). This was performed using , and more specifically, after denaturation at 95℃ for 4 minutes and 30 seconds, an additional denaturation process was performed over 40 cycles for 10 seconds at the same temperature, followed by heating and cooling at 55℃~60℃ for 30 seconds. was performed and stretched at 68°C for 20 seconds. The expression level of each gene was normalized using L32 expression. Primers were designed using the nucleotide blast software of the National Center for Biotechnology Information (NCBI) and purchased from Bionics (Seoul, Korea).

As a result, as shown in Figure 3, it was confirmed that the expression of beige fat-related genes ( Ucp1, Dio2, Chrna2, Pgc1a, Cidea, CytC ) was increased in the group treated with CCK-8 and NA compared to the control group. In addition, the expression of the above genes was found to be further increased when the two substances were treated together compared to the group treated alone.

Gene amplification primer sequences used in qPCR gene Primer sequence (5'->3') Ucp1 forward GGG CCC TTG TAA ACA ACA AA Reverse GTC GGT CCT TCC TTG GTG TA Dio2 forward CAT CTT CCT CCT AGA TGC CCA Reverse CTG ATT CAG GAT TGG AGA CGT G Crna2 forward GCC ACC GGA ACC TAT AAC AGC Reverse CCG GCG GAT AAC GAA GTA GTA Pgc1a forward GCT GCA TGG TTC TGA GTG CTA AG Reverse AGC CGT GAC CAC TGA CAA CGA G Cidea forward ATC ACA ACT GGC CTG GTT ACG Reverse TAC TAC CCG GTG TCC ATT TCT CytC forward ACA AGA AGA CTC AAA TGT GTT TCA GT Reverse TGC ACT GTC AAG AAT AGA CAG TTG L32 forward AGAAGTTCATCCGGCACCAG Reverse CACTTCCAGCTCCTTGACGT

<3-4> Confirmation of beige fat differentiation rate

Oil-Red-O staining was performed to determine the rate of beige fat differentiation when C3H/10T1/2 cells were treated with the substance. Oil-Red-O staining stains intracellular lipids red, so the differentiation rate from stem cells to adipocytes can be compared when measuring their absorbance. As a control group, an undifferentiated cell group and a differentiated cell group that was not treated with a substance were used.

In detail, the wells of cells that had completed differentiation into beige fat were carefully washed twice with ice-cold PBS 1X and fixed with 4% paraformaldehyde for 10 minutes at room temperature. After fixation, it was washed three times with distilled water, fixed in 60% isopropanol at room temperature for 10 minutes, and the filtered Oil-Red-O working solution was left at room temperature for 20 minutes. Washed five times with distilled water, and at the end, 100ul of distilled water was added to each well, and observations and images were obtained under a microscope. To measure absorbance, distilled water was removed and completely dried at room temperature, and then 200 ul of 100% isopropanol was added to each well and pipetted to dissolve all the dye. 100 ul of the solution was transferred to a 96-well transparent plate, and the absorbance was measured at 510 nm using a spectrophotometer (Smart spec Plus, Bio-rad, CA, USA). Blank is made using isophanol.

As a result, as shown in Figure 4, the group treated with CCK-8 or NA showed higher absorbance during differentiation. In addition, the group treated with the two substances together showed the highest absorbance compared to the group treated with the two substances alone.

<Example 4>

Measurement of mitochondrial activity following treatment with cholecystokinin octapeptide and nonanoic acid in C3H/10T1/2 cells.

Beige fat, unlike white fat, has the characteristic of high mitochondrial density and activity. Therefore, in this experiment, mitochondrial density according to treatment with cholecystokinin octapeptide and nonanoic acid during C3H/10T1/2 cell differentiation was measured using Mitotracker.

<4-1> Cell culture

The cell culture medium was DMEM (Dulbecco’s Modified Eagle’s Medium) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (PEST) and cultured at 37°C and 5% CO₂ conditions. 10 ml of medium was added to a 75 cm2 culture flask and cultured, and the medium was replaced every 2-3 days. During subculture, after washing with PBS, 1ml of 0.01% trypsin was added, incubated for 5 minutes, and 4ml of DMEM/FBS/PEST medium was added to stop the reaction.

<4-2> Beige adipocyte differentiation

To induce differentiation of C3H/10T1/2 cells into beige fat, 125μM indomethacin, 0.5μM rosiglitazone, 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 5μg/ml Culture medium containing insulin, 1nM 3,3',5-Triiodo-L-thyronine (T3), and 2μg/ml dexamethaxone was incubated at 37°C and 5% CO. Cultured for two days under CO₂ conditions. Then, to maintain differentiation, the culture medium containing 1nM 3,3',5-triiodo-L-tyrosine (T3), 5μg/ml insulin, and 1μM rosiglitazone was replaced for two days, and cultured at 37°C for 6 days until complete differentiation. Cultured under 5% CO₂ conditions. 10 μM of cholecystokinin octapeptide (Cayman chemical, CAS. 25126-32-3) and 2 μM of nonanoic acid (Sigma-Aldrich, CAS. 112-05-0) were added to the medium containing the differentiation inducing reagent during the differentiation process into beige fat, respectively. Or processed together. To confirm the effect of the substance, the experiment was divided into a negative control group, an experimental group treated with each reagent separately, and an experimental group treated with the two reagents together.

<4-3> Mitotracker measurement

Working reagent was prepared by adding DMSO to Mitotracker green FM (Invitrogen, Cat. M7514) at a concentration of 1 mM. The staining reagent was prepared by diluting the working reagent to 200 nM in DMEM-/- medium. The plate on which differentiation was completed was washed with PBS 1X, then a previously prepared staining reagent was added and incubated at room temperature for 30 minutes. The absorbance of Ex/Em=490 nm/516 nm was measured using SpectraMax.

As a result, as shown in Figure 5, it was confirmed that the mitochondrial density tended to be higher in the group treated with CCK-8 or NA during differentiation compared to the control group. Additionally, when the two substances (CCK-8, NA) were treated together, a statistically significant increase was shown. These results indicate that treatment with CCK-8 or NA promotes differentiation into beige adipocytes.

So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

Claims (15)

A pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, comprising:
The pharmaceutical composition contains nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient,
The metabolic disease caused by obesity is characterized in that it is selected from the group consisting of diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease, or metabolic syndrome in which the above diseases occur simultaneously. Pharmaceutical composition for preventing or treating metabolic diseases. According to paragraph 1,
A pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, characterized in that the composition further comprises colacystokinin octapeptide as an active ingredient. According to paragraph 2,
A pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, wherein the colacystokinin octapeptide is a compound represented by the following formula (1).
[Formula 1]
According to paragraph 1,
A pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, wherein the nonanoic acid or a pharmaceutically acceptable salt thereof is contained at a concentration of 0.1 to 1000 μM. A food composition for preventing or improving obesity or metabolic diseases caused by obesity, comprising:
The food composition contains nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient,
The metabolic disease caused by obesity is characterized in that it is selected from the group consisting of diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease, or metabolic syndrome in which the above diseases occur simultaneously. Food composition for preventing or improving metabolic diseases. According to clause 5,
A food composition for preventing or improving obesity or metabolic diseases caused by obesity, characterized in that the composition further contains colacystokinin octapeptide as an active ingredient. According to clause 6,
A food composition for preventing or improving obesity or metabolic diseases caused by obesity, wherein the colacystokinin octapeptide is a compound represented by the following formula (1).
[Formula 1]
It is a health functional food for preventing or improving obesity or metabolic diseases caused by obesity.
The health functional food contains nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient,
The metabolic disease caused by obesity is characterized in that it is selected from the group consisting of diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease, or metabolic syndrome in which the above diseases occur simultaneously. Health functional food for preventing or improving metabolic diseases. According to clause 8,
The composition is a health functional food for preventing or improving obesity or metabolic diseases caused by obesity, characterized in that it further contains colacystokinin octapeptide as an active ingredient. According to clause 9,
The colacystokinin octapeptide is a health functional food for preventing or improving obesity or metabolic diseases caused by obesity, characterized in that it is a compound represented by the following formula (1).
[Formula 1]
According to any one of claims 8 to 10,
The health functional food is characterized in that it is selected from the group consisting of beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements. Or health functional food for preventing or improving metabolic diseases caused by obesity. delete delete delete delete