KR102588274B1 - Pharmaceutical composition for preventing or treating epilepsy or seizure-related diseases comprising D-limonene as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of epilepsy or seizure-related diseases, and more specifically, to a pharmaceutical composition for the prevention, improvement or treatment of epilepsy or seizure-related diseases containing D-limonene as an active ingredient; It relates to food compositions and health functional foods. D-limonene of the present invention can effectively relieve convulsions when administered to animal models of episodic convulsions or chronic convulsions caused by PTZ (pentylenetetrazole), and the composition of the present invention containing it as an active ingredient is effective in treating epilepsy or seizures. It can be useful in preventing or treating related diseases. In particular, D-limonene is a natural material derived from the peel of citrus fruit ( Citrus unshiu Marcov) and has the advantage of being safe for the human body.

Description

Pharmaceutical composition for preventing or treating epilepsy or seizure-related diseases comprising D-limonene as an active ingredient}

The present invention relates to a pharmaceutical composition for the prevention or treatment of epilepsy or seizure-related diseases, and more specifically, to a pharmaceutical composition for the prevention, improvement or treatment of epilepsy or seizure-related diseases containing D-limonene as an active ingredient; It relates to food compositions and health functional foods.

Epilepsy is a chronic brain dysfunction characterized by unpredictable and recurrent seizures. Seizures that occur in epilepsy patients are temporary changes in behavior, sensation, or consciousness caused by abnormal and synchronous electrical discharges in the brain. In severe cases, epilepsy is the result of brain trauma, stroke, or brain damage. In other cases, developmental abnormalities such as brain tumors and malformations of the cerebral cortex or blood vessels may cause epilepsy. Hereditary epilepsy, which may have genetic factors as its underlying cause, is often called idiopathic, and in most cases, inheritance is complex. Rarely, genes encoding voltage-gated ion channels and synaptic receptors such as GABA receptors, factors involved in neurotransmitter release, including syntaxin binding proteins, and nerve adhesion molecules such as PCDH19. Proteins involved in ganglion development, such as LGI1 (Leucine-rich glioma inactivated-1), may affect hereditary epilepsy.

Epileptic seizures are mainly classified into two types: focal-onset seizures, which begin in a local cortical area, and generalized-onset seizures, which initially start in both cerebral hemispheres. Focal seizures may progress to bilateral tonic-clonic seizures. In focal arousal seizures, consciousness is maintained; In focal dysstatic seizures, tonic-clonic convulsions, which most people would consider typical seizures, are accompanied by loss of consciousness, collapse, stiffening (tonic convulsions), and violent tremors (clonic convulsions). . Tonic-clonic convulsions usually last less than 3 minutes, but the period followed by confusion and fatigue varies from patient to patient. Generalized tonic-clonic seizures occur in both cerebral hemispheres from onset. Generalized petit seizures involve a brief loss of consciousness without any aura, followed by an immediate return to consciousness. Generalized petit seizures occur most commonly in children with childhood petit seizures. Childhood petit seizures are idiopathic seizures that begin between the ages of 4 and 10 and usually disappear by age 12. Other important epileptic syndromes include infantile spasms, Lennox-Gastout syndrome, juvenile myoclonic epilepsy, and Dravet syndrome. The most common seizure type of infantile spasms is epileptic spasms, which mainly manifest as sudden flexion, extension, or mixed flexion-extension of the proximal and trunk muscles. It can also appear in localized forms such as frowning, head nodding, and subtle eye movements. Myoclonic seizures are sudden, brief, involuntary single or multiple contractions of muscles or muscle groups in various anatomical regions. Myoclonic contractions are less regularly repetitive and persistent than myoclonus.

Treatments for epilepsy include levetiracetam, carbamazepine, ethosuximide, cabapentin, and oxcarbazepine, but they can cause rashes, blood disorders, osteoporosis, Side effects such as hyponatremia, headache, behavioral changes, and immune response are known. Since most of these drugs play a role in controlling symptoms rather than treating the cause, continuous drug use is required, and long-term use of these drugs can result in a huge financial burden and serious side effects such as suicidal impulses, drowsiness, and fatigue. can cause

Against this background, the present inventor sought to develop a drug that can safely and effectively treat convulsive symptoms, and as a result, limonene derived from the peel of citrus fruit ( Citrus unshiu Marcov), a natural product with proven safety, treats convulsions caused by PTZ (pentylenetetrazole). The present invention was completed by confirming that it can be effectively suppressed.

Korean Patent Publication No. 10-2017-0034662 Korean Patent Publication No. 10-2018-0040374 Korean Patent No. 10-2138348

Therefore, the purpose of the present invention is to provide a pharmaceutical composition that is safe for the human body and can effectively treat epilepsy or seizure-related diseases.

Another object of the present invention is to provide a food composition containing the composition that is safe for the human body and can effectively improve epilepsy or seizure-related diseases.

Another object of the present invention is to provide a health functional food that is safe for the human body and can effectively improve epilepsy or seizure-related diseases.

In order to achieve the purpose of the present invention as described above,

The present invention provides a pharmaceutical composition for preventing or treating epilepsy or seizure-related diseases containing D-limonene as an active ingredient.

In one embodiment of the present invention, the D-limonene may have an anticonvulsant effect through adenosine A2A receptor activation and GABAergic neurotransmitter regulation.

In one embodiment of the present invention, the seizure-related diseases include stroke, hippocampal sclerosis, corpus callosum paralysis, congenital malformation, central nervous system infection, hypoxia, brain tumor, traumatic brain injury, neurodegenerative disease, metabolic disease, autoimmune disease, and unknown cause. It may be selected from the group consisting of seizures caused by.

Additionally, the present invention provides a food composition for preventing or improving epilepsy or seizure-related diseases containing D-limonene as an active ingredient.

In addition, a health functional food for preventing or improving epilepsy or seizure-related diseases containing D-limonene as an active ingredient is provided.

In one embodiment of the present invention, the health functional food may be selected from the group consisting of beverages, meat, confectionery, noodles, rice cakes, bread, gum, candy, ice cream, and alcoholic beverages.

D-limonene of the present invention can effectively relieve convulsions when administered to animal models of episodic convulsions or chronic convulsions caused by PTZ (pentylenetetrazole), and the composition of the present invention containing it as an active ingredient is effective in treating epilepsy or seizures. It can be useful in preventing or treating related diseases. In particular, D-limonene is a natural material derived from the peel of citrus fruit (Citrus unshiu Marcov) and has the advantage of being safe for the human body.

Figure 1 shows the results of evaluating the degree of seizure inhibition according to D-limonene pretreatment in a PTZ-induced single seizure mouse model. Data are expressed as mean ± standard deviation (n = 6-7 for each group). **p<0.01 vs. Vehicle (0.25% tween80 in saline)+Saline, # p<0.05 and ## p<0.01 vs. Vehicle (0.25% tween80 in saline)+PTZ 60mg/kg (Kruskal-Wallis one-way ANOVA on ranks with Dunn's post hoc analysis).
Figure 2 shows the results of evaluating the degree of seizure inhibition according to D-limonene pretreatment in a PTZ-induced kindling mouse model. Data are expressed as mean ± standard deviation (n = 6-8 for each group). **p<0.01 vs. Vehicle (0.25% tween80 in saline)+Saline, # p<0.05 and ## p<0.01 vs. Vehicle (0.25% tween80 in saline)+PTZ, $$ p<0.01, &&p<0.01 (Two-way RM ANOVA followed by Holm-Sidak test).
Figure 3 shows the results of confirming the degree of inhibition of mossy fiber sprouting in the hippocampus according to D-limonene pretreatment in a PTZ-induced kindling mouse model through immunohistochemical staining. A representative section is shown with triple immunofluorescence staining with synaptoporin (red), NeuN (green), and DAPI (blue) (A: vehicle (0.25% tween80 in saline) + saline treatment group; B: vehicle (0.25% tween80 in saline) +PTZ treated group; C is D-limonene+saline treated group; D is D-limonene+PTZ treated group). Wide scale bars represent 100 μm, small scale bars represent 10 μm.
Figure 4 shows the expression level of GABA synthase (GAD-67) measured in the hippocampus according to D-limonene pretreatment in a PTZ-induced kindling mouse model by Western blot. The relative protein expression levels of GAD-67/GAPDH were shown graphically. Data are expressed as mean ± standard deviation (n = 4 for each group).
Figures 5A and 5B show the results of measuring the Npas4 mRNA expression level in the hippocampus according to D-limonene pretreatment in a PTZ-induced single seizure mouse model and a PTZ-induced kindling mouse model, respectively, using RT-PCR. Data are expressed as mean ± standard deviation (n = 4-6 for each group).
Figure 6A shows the results of HPLC measurement of GABA levels in the hippocampus following D-limonene pretreatment in a PTZ-induced kindling mouse model. Data are expressed as mean ± standard deviation (n = 7 for each group). *p<0.05 vs. Vehicle (0.25% tween80 in saline) (Student's t-test). Figure 6B measures the level of GABA release according to D-limonene treatment in PC12 cell culture. Data are expressed as mean ± standard deviation (n = 4-8 for each group). ## p<0.01 vs. Vehicle (0.25% tween80 in saline)+Vehicle (DMSO:tween80:saline = 1:1:18), $$ p<0.01 vs. D-Limonene+vehicle (DMSO:tween80:saline = 1:1:18) (Two-way ANOVA followed by Holm-Sidak test).
Figure 7 shows the results of a convulsive behavior test after administering SCH58261 (1 mg/kg) or ZM241385 (15 mg/kg), an antagonist for adenosine receptor A2A, along with D-limonene in a PTZ-induced convulsion mouse model. Data are expressed as mean ± standard deviation (n = 6-8 for each group). **p<0.01 vs. Vehicle (0.25% tween80 in saline)+Vehicle (DMSO:tween80:saline = 1:1:18), ## p<0.01 vs. D-Limonene+vehicle (DMSO:tween80:saline = 1:1:18) (Two-way ANOVA followed by Holm-Sidak test).
Figure 8 shows the results of measuring the level of phosphorylated CREB (p-CREB) in hippocampal tissue following administration of D-limonene (10 mg/kg) to mice. The relative protein expression levels of p-CREB/CREB were shown graphically. Data are expressed as mean ± standard deviation (n = 4 for each group). *p<0.05 vs. Vehicle (0.25% tween80 in saline)+Vehicle (DMSO:tween80:saline = 1:1:18), ## p<0.01 vs. D-Limonene+vehicle (DMSO:tween80:saline = 1:1:18) (Two-way ANOVA followed by Holm-Sidak test).

The present invention provides a pharmaceutical composition for the prevention and treatment of epilepsy or seizure-related diseases, comprising a D-limonene compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient. There is a characteristic.

<Formula 1>

The 'D-limonene' of the present invention is a substance belonging to the C10 terpenoid extracted from the peel _of Citrus plants such as oranges. The molecular formula is _C10H16 , and the molecular weight is 136.23 g/ It is a mol compound and is also called (R)-(+)-Limonene or (+)-(4R)-Limonene. Research related to limonene is known for its antibacterial, antiviral, antioxidant, and anti-inflammatory effects.

However, there has been no report yet on the fact that the compound effectively suppresses epileptic seizures (convulsions).

Accordingly, in order to investigate the potential of D-limonene as a treatment for epilepsy or seizure-related diseases, the present inventor tested the spasm-relieving effect upon administration to animal models of episodic convulsions or chronic convulsions induced by PTZ (pentylenetetrazole). As a result, D -It was first discovered that limonene has an anti-convulsant effect through activating adenosine A2A receptors and regulating GABAergic neurotransmission.

As used herein, the term 'epilepsy' refers to a chronic disease in which epileptic seizures occur repeatedly. The causes of epilepsy are very diverse, and the exact cause is not known. However, with the recent development of neuroimaging technology, it has become possible to observe subtle pathological changes in the brain that could not be observed in the past, and the identification of the causes of epilepsy is gradually expanding. In some epidemiological studies, it has been reported that more than one-third of patients have a past history of pathological changes or brain damage in the brain, and the main causes are stroke, congenital anomaly, head trauma, encephalitis, brain tumor, degenerative encephalopathy, It is known to be caused by genetics, prematurity, and damage before and after delivery.

As used herein, the term 'seizure-related disease' includes brain-related diseases accompanied by seizures, causing seizures, such as stroke; encephalitis; Hippocampal sclerosis; cerebral palsy and congenital malformations; Seizures related to CNS infection; hypoxia; brain tumor; traumatic brain injury; vascular malformations; Neurodegenerative diseases; Metabolic diseases such as hypoglycemia, glycogen storage disease, and pyruvate dehydrogenase deficiency; multiple sclerosis; Examples include autoimmune diseases such as systemic lupus erythematosus, and include diseases in which seizures occur without known cause.

First, in order to evaluate the anti-convulsant activity of D-limonene in the following examples, the present inventor confirmed the degree of inhibition of convulsions through a single-episode convulsion test induced by PTZ (pentylenetetrazole). In detail, mice were treated with D-limonene (5 or 10 mg/kg) and then PTZ (60 mg/kg) was administered to induce episodic convulsions. As a result, it was confirmed that PTZ-induced convulsions were alleviated depending on the D-limonene administration dose (see Figure 1).

In addition, in the following examples, the present inventors administered 30 mg/kg of PTZ once every 2 days for a total of 27 days to determine whether D-limonene had an anti-convulsant effect in a chronic convulsive animal model, creating a kindling model. It was created and the degree of seizure inhibition of D-limonene was confirmed. As a result, it was confirmed that when mice were pretreated with the drug D-limonene (10 mg/kg), the seizure score caused by PTZ was significantly reduced. These results showed that D-limonene prevents kindling caused by PTZ. It was shown (see Figure 2).

In addition, the present inventors investigated changes in axonal sprouting induced by PTZ in the mouse hippocampus due to D-limonene treatment in the following examples. As a result, the increase in axonal sprouting induced by PTZ was found to be due to D-limonene. It was confirmed that it was reduced (see Figure 3). For reference, axon sprouting refers to the process in which normal axon projections abnormally branch out (axonal sprouting), and in severe cases, extend to their own cell bodies, creating abnormally excessive circuits and easily transmitting excited states to the surroundings. plays a role. This axon sprouting is closely related to the mechanism of epilepsy.

In addition, in the following examples, the present inventor investigated the expression level of GABA synthase (GAD-67) through Western blotting analysis to reveal the mechanism of D-limonene's effect on seizures. In addition, D -We further investigated whether limonene regulates transcription factors such as Npas4 induced by neuronal activity. As a result, it was confirmed that treatment with D-limonene increased the expression of GAD-67 protein (see Figure 4). In addition, it was confirmed that D-limonene effectively inhibits the increase in Npas4 expression in the hippocampus following acute and chronic administration of PTZ (see Figure 5).

In addition, the present inventors investigated the effect of D-limonene treatment on the GABA level of the hippocampus in the following examples, and found that the GABA level in the hippocampus was decreased in the mouse group treated with D-limonene compared to the negative control group (Figure 6A), and further investigation of the effect of D-limonene on GABAergic neurotransmission and the underlying mechanisms of PC12 cells showed that GABA levels in the culture medium of PC12 cells were enhanced by D-limonene pretreatment. and was confirmed to be reduced by SCH58261 (see Figure 6B).

In addition, in the following examples, the present inventors treated SCH58261 or ZM241385 before D-limonene injection and performed a convulsive behavior test to determine whether D-limonene reduced the seizure score induced by PTZ through adenosine A2A receptor. . For reference, SCH58261 and ZM241385 are antagonists for adenosine receptor A2A. As a result, it was confirmed that the seizure score suppressed by D-limonene was recovered through pretreatment with SCH58261 or ZM241385 (see Figure 7). These results show that D-limonene suppresses PTZ-induced convulsions through regulation of adenosine A2A receptor activation.

Additionally, in the following examples, the present inventors investigated whether D-limonene affects the level of phosphorylated CREB (p-CREB) in the adenosine A2A receptor downstream signaling pathway. As a result, it was confirmed that acute injection of D-limonene (10 mg/kg) increased the level of phosphorylated CREB (p-CREB) in the hippocampus (see Figure 8).

Therefore, in the present invention, it has been objectively proven through experiments that D-limonene can suppress convulsions (seizures) in a concentration-dependent manner, and the composition of the present invention containing limonene as an active ingredient having this effect can prevent epilepsy or seizures. It can be useful in the prevention and treatment of related diseases.

The D-limonene compound according to the present invention can be used in the form of a salt, preferably a pharmaceutically acceptable salt. The salt is preferably an acid addition salt formed from a pharmaceutically acceptable free acid, and the free acid can be an organic acid or an inorganic acid. The organic acids are not limited thereto, but include citric acid, acetic acid, lactic acid, tartaric acid, maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, metasulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, Includes glutamic acid and aspartic acid. Additionally, the inorganic acids include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid.

D-limonene according to the present invention can be used commercially, or can be isolated from nature or manufactured by chemical synthesis methods known in the art.

The composition of the present invention is a pharmaceutical composition containing the D-limonene as an active ingredient and can be prepared using pharmaceutically suitable and physiologically acceptable auxiliaries in addition to the active ingredient, and the auxiliaries include excipients and disintegrants. , sweeteners, binders, coating agents, swelling agents, lubricants, lubricants, or flavoring agents can be used.

For administration, the pharmaceutical composition may be preferably formulated as a pharmaceutical composition containing one or more pharmaceutically acceptable carriers in addition to the active ingredients described above.

The pharmaceutical composition may be in the form of granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, or injectable solutions. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacance or sodium oleate, sodium stearate, magnesium stearate, sodium Includes benzoate, sodium acetate, sodium chloride, etc. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, etc. Acceptable pharmaceutical carriers for compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or ingredient using a method disclosed by Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA, as an appropriate method in the field.

In one embodiment of the present invention, the D-limonene of the present invention may be included in the composition at a concentration of 0.1 to 10000 mg/ml, and the limonene compound of the present invention may be included in the composition at a concentration of 0.1 to 95% by weight based on the total weight of the composition. there is.

Additionally, the present invention provides the use of a composition containing D-limonene as an active ingredient for the production of a medicine for the prevention and treatment of epilepsy or seizure-related diseases. The composition of the present invention containing the above-mentioned D-limonene as an active ingredient can be used for the production of medicine for the prevention and treatment of epilepsy or seizure-related diseases.

Additionally, the present invention provides a method for preventing and treating epilepsy or seizure-related diseases comprising administering D-limonene to a mammal.

As used herein, the term 'mammal' refers to a mammal that is the subject of treatment, observation, or experiment, and preferably refers to a human.

As used herein, the term 'therapeutically effective amount' refers to the amount of an active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal, or human as considered by a researcher, veterinarian, doctor, or other clinician, which means treatment. Includes an amount that induces relief of symptoms of the disease or disorder. It is obvious to those skilled in the art that the therapeutically effective dosage and frequency of administration of the active ingredient of the present invention will vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by a person skilled in the art, and can be determined based on the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of dosage form, and the patient's age, weight, and general health condition. , gender and diet, administration time, administration route and secretion rate of the composition, treatment period, and concurrently used drugs can be adjusted according to various factors. In the treatment method of the present invention, for adults, it is preferable to administer the limonene of the present invention at a dose of 0.01 mg/kg to 250 mg/kg once or several times a day.

In the treatment method of the present invention, the pharmaceutical composition of the present invention can be administered in a conventional manner via oral, rectal, intravenous, intraarterial, intraperitoneal, intramuscular, intrasternal, transdermal, topical, intraocular or intradermal routes. there is.

In the present invention, the pharmaceutical composition can be used by co-formulating or using D-limonene and a conventionally known treatment for epilepsy.

Additionally, the present invention provides a food composition for preventing or improving epilepsy or seizure-related diseases containing D-limonene as an active ingredient.

In addition to containing the active ingredient D-limonene, the food composition may contain various flavoring agents or natural carbohydrates as additional ingredients like a typical food composition.

Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The above-described flavoring agents include natural flavoring agents (thaumatin), stevia extracts (e.g. rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).

The food composition of the present invention can be formulated in the same way as the pharmaceutical composition above and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, health supplements, etc. There is.

In addition, the food composition contains, in addition to the active ingredient (D-limonene), various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and thickening agents (cheese, chocolate, etc.), pectic acid, and It may contain salts thereof, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages.

The active ingredient (D-limonene) of the present invention is a material extracted from edible plants and has almost no side effects like chemicals, so it can be safely used even when taken for a long period of time for the purpose of providing functionality to improve epilepsy or seizure-related diseases. You can.

That is, the food composition of the present invention can be usefully used as a functional food composition for preventing or improving epilepsy or seizure-related diseases.

In addition, the present invention provides a health functional food for preventing or improving epilepsy or seizure-related diseases containing D-limonene as an active ingredient.

The health functional food of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing or improving epilepsy or seizure-related diseases.

In the present invention, “health functional food” refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with Act No. 6727 on Health Functional Food, and nutrients for the structure and function of the human body. It means ingestion for the purpose of controlling health or obtaining useful health effects such as physiological effects.

The health functional food of the present invention may contain common food additives, and its suitability as a food additive is determined in accordance with the general provisions and general test methods of the food additive code approved by the Food and Drug Administration, unless otherwise specified. Judgment is made according to specifications and standards.

Items listed in the “Food Additive Code” include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as dark pigment, licorice extract, crystalline cellulose, high-quality pigment, and guar gum; Mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations are included.

For example, the health functional food in the form of tablets is made by granulating a mixture of the active ingredient (D-limonene) of the present invention with excipients, binders, disintegrants and other additives in a conventional manner, and then adding a lubricant, etc. Compression molding may be performed, or the mixture may be directly compression molded. In addition, the health functional food in the form of tablets may contain flavoring agents, etc., if necessary.

Among capsule-type health functional foods, hard capsules can be manufactured by filling a regular hard capsule with a mixture of the active ingredient (D-limonene) of the present invention mixed with additives such as excipients, and soft capsules contain the active ingredient of the present invention. It can be manufactured by filling a mixture of (D-limonene) with additives such as excipients into a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.

The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient (D-limonene) of the present invention and excipients, binders, disintegrants, etc., using a known method. If necessary, it can be mixed with white sugar or other toppings. It can be peeled off, or the surface can be coated with substances such as starch or talc.

Health functional food in the form of granules can be manufactured into granules using a mixture of the active ingredient (D-limonene) of the present invention and excipients, binders, disintegrants, etc., using a known method, and if necessary, flavoring agents and mixing agents. It may contain the like.

The health functional food containing D-limonene as an active ingredient of the present invention has a convulsive (seizure) suppressing effect as confirmed in the examples below, and in addition to epilepsy, various seizure-related diseases (stroke, hippocampal sclerosis, corpus callosum paralysis, It is effective in preventing or improving congenital malformations, central nervous system infections, hypoxia, brain tumors, traumatic brain injury, neurodegenerative diseases, metabolic diseases, autoimmune diseases, and seizures of unknown cause).

The health functional foods may include beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

<Example>

1. Materials and Methods

drug

R-(+)-limonene (C10H16) with 97% purity was purchased from Sigma-Aldrich (St. Louis, MO, USA) and prepared as a fresh solution by dissolving it in 0.25% Tween-80 in saline every day. SCH58261 was purchased from Tocris (Bristol, UK). PTZ, ZM241385, and other reagents were purchased from Sigma-Aldrich unless otherwise specified.

animal

C57BL/6J mice were purchased from Daehan Biolink (Chungbuk, Korea). Animals aged 7-11 weeks were maintained at 4-5 per cage under standard conditions (23 ± 2°C, 50 ± 5% humidity) with a controlled 12-hour light/dark cycle. Drinking water and feed were provided ad libitum. At the start of the experiment, all mice weighed 20 to 25 g. All experiments were performed in accordance with the Animal Care and Use Guide (Chungbuk National University).

cell culture

PC12 cells, a cell line derived from pheochromocytoma of the rat adrenal medulla, were provided by the Korean Collection for Type Cultures. Cells were grown in RPMI cell culture medium supplemented with fetal bovine serum (FBS, 5%), horse serum (10%, Gibco, Grand Island, USA) and antibiotics (1%, Gibco) under standard conditions and 37°C high atmospheric humidity. was cultured. For the experiment, cells subcultured 4-6 times were used in a 35mm plate coated with Poly-L-Lysine, and the cells were distributed at a density of 1×10 ⁶ cells/plate.

Pentylenetetrazole (PTZ)-induced convulsions and neuronal firing model (kindling model)

PTZ was injected intraperitoneally (i.p.) into mice at a dose of 30 or 60 mg/kg, and the intensity of PTZ-induced convulsions was scored according to previous studies. Convulsive behavior was observed for 30 minutes. Seizure states were classified as follows. 0: Normal behavior or no abnormalities; 1: immobilization or lying on belly; 2: Head nodding and facial, forelimb, or hindlimb myoclonus; 3: Continuous whole-body myoclonus, myoclonic jerks or tail held up stiffly; 4: rearing, tonic seizure or falling down on its side; 5: Tonic-clonic seizure, falling down on its back, wild rushing or jumping; 6: death.

To establish a PTZ-induced neurofiring mouse model, 30 mg/kg PTZ was administered intraperitoneally once every 48 hours (total of 14 times). Mice with three or more consecutive stage 4 seizure levels were defined as neurogenic mice. Brain samples for immunoblotting, IHC, HPLC, and RT-PCR were obtained immediately after the final behavioral test.

Effect of D-limonene on PTZ-induced convulsions and neuronal kindling

To study the effect of D-limonene on PTZ-induced convulsions, D-limonene (5 or 10 mg/kg, i.p.) was administered intraperitoneally 40 min before PTZ injection (60 mg/kg). Seizure scores were measured over a 30-minute period. To evaluate the effect of D-limonene on PTZ-induced neuronal kindling, D-limonene (10 mg/kg) was administered intraperitoneally to mice 40 minutes before injection of PTZ (30 mg/kg). Convulsive behavior was observed for 30 minutes. To investigate the role of adenosine A2A receptors in the anticonvulsant activity induced by D-limonene, mice were treated with SCH58261 (1 mg/kg, i.p.) or ZM241385 (15 mg/kg, i.p.) 10 min before D-limonene injection. . PTZ-induced convulsive behavior tests were performed 40 min after D-limonene injection.

Immunoblotting

Hippocampal homogenates were determined using the Bio-Rad DC protein assay kit (BIO-RAD, Hercules, USA) according to the manufacturer's protocol. For immunoblotting analysis, 30 μg of hippocampal proteins were separated on a 12% Tris-glycine polyacrylamide gel and then transferred to polyvinylidene fluoride membranes (Merck Millipore, Burlington, USA). Blots were blocked using 5% nonfat dry milk, and these immunoblots were incubated with primary antibodies Tyrosine hydroxylase (EMD Millipore, Darmstadt, Germany), GAD-67 (Abcam, Cambridge, UK), and CREB (Cell signaling, Danvers, USA). ), phospho-CREB (EMD Millipore), and GAPDH (Cell signaling) were incubated overnight, followed by incubation with horseradish peroxidase-conjugated secondary antibody (Amersham Life Science Inc., IL, USA). Proteins were detected by chemiluminescence using the ECL kit (Amersham Life Science). The relative density of protein bands was scanned and quantified by ImageJ (Wayne Rasband, National Institutes of Health, Bethesda, MD).

RAN extraction and real-time RT-PCR

RNA was extracted from the frozen hippocampus using the QIAGEN RNA kit (QIAGEN, Hilden, Germany), and cDNA was synthesized from 1 μg total RNA using the high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster city, USA). Amplification reactions were performed using the StepOne Plus real-time RCR system (Applied Biosystems) with 12.5 μL 2×SYBR Green PCR master mix (Applied Biosystems), 1 μg cDNA, and forward and reverse primers (100 μM each). PCR reaction conditions were as follows: 50°C for 2 min and 95°C for 10 min; 1 cycle at 95°C for 15 seconds and 40 cycles at 60°C for 2 minutes; Then the first step at 95℃ for 30 seconds and the last step at 55℃ for 30 seconds. Primer sequences are shown in detail in Table 1 below.

Primer sequences for RT-PCR amplification gene Primer sequence (5'->3') Npas4 forward AGCATTCCAGGCTCATCTGAA reverse GGCGAAGTAAGTCTTGGTAGGATT GAPDH forward TGTCAAGCTCATTTCCTGGTATGA reverse TCTTACTCCTTGGAGGCCATGTAG

Immunohistochemistry

Mice were anesthetized and perfused transcardially with cold phosphate-buffered saline (PBS, containing 0.1% heparin). The brain was perfusion-fixed with PBS containing 4% paraformaldehyde (PFA). The perfusion-fixed brains were post-fixed overnight at 4°C in PBS containing 4% PFA and then coronally sectioned with a Leica CM1850 microtome (10 μm thick sections). Sections were then permeabilized in PBS using 0.3% Triton The sections were then reacted overnight with primary antibodies diluted in 5% BSA at 4°C using rabbit Synaptoporin (SynapticSystems, 1/300) and mouse-NeuN (EMD Millipore, 1/500). The sections were washed three times with PBS, reacted with Alexa Fluor-conjugated secondary antibodies diluted in 5% BSA for 1 hour at room temperature, and finally incubated with DAPI (300 nM in 5% BSA, Sigma-Aldrich) for 20 hours. Stained for minutes. The sections were then mounted on glass slides (Matsunami, Osaka, Japan) with mounting medium (Vector Laboratories, Inc., California, USA). For each section, images were taken using a 2.5X or 40X objective using confocal microscope (LSM-880, ZEISS, Oberkochen, Germany) settings.

High performance liquid chromatography (HPLC) analysis

Mice were sacrificed immediately after final behavioral analysis. The brain was then removed and the hippocampus was isolated on an ice-chilled glass plate. These tissues were quickly frozen on dry ice and stored at -80°C until analysis. Frozen tissues were weighed, placed in 1.5 mL Eppendorf tubes, and homogenized in 1 mL ice-cold PBS. For PC12 cells, the control group was cultured with complete medium, the limonene group was treated with limonene (30 μM) for 1 hour, the SCH58261 group was treated with SCH58261 (1 μM) for 30 minutes, and the SCH58261 + limonene group was treated with SCH58261 (1 μM) for 30 minutes and then limonene (30 μM). was treated for 1 hour, and the supernatant was obtained. After centrifugation at 20,000 G for 15 min at 4°C, the clear supernatant was filtered through a 0.22 μm CHROMDISC syringe filter. For GABA detection, 180 μL of sample was added to 10 μL of reactive solution prepared with o-phthaldialdehyde (37 mM) in 0.1 μM borate buffer (pH 10.4) containing 250 μL ethanol and 50 mM sodium sulfite. A UK-C18 column (50 × 2 mm, 3 μm; Imtakt) was coupled to an electrochemical detector (Eicom) with a glassy carbon electrode set at 0.85 V. The mobile phase consisted of 50mM phosphoric acid, 50mM citric acid, 0.1mM EDTA (pH 3.5), and 5% acetonitrile and was filtered through a 0.45μm filter (EMD Millipore) at a flow rate of 0.3mL/min. Samples (20 μL) were injected into an HPLC system (Waters Corporation, Milford, USA).

data analysis

Data are expressed as mean ± standard deviation. Data were analyzed using Student's t-test, one-way, two-way, or two-way repeated measures analysis of variance (ANOVA), followed by Holm-Sidak post-hoc tests using SigmaPlot 13 software (SigmaPlot, Chicago, IL, USA). proceeded. Non-parametric data were analyzed using Kruskal Wallis ANOVA on ranks, followed by Dunn’s post hoc analysis using SigmaPlot 13 software.

2. Results

D-Limonene reduces PTZ-induced spasticity in a dose-dependent manner.

To evaluate the anticonvulsant activity of D-limonene, the degree of inhibition of convulsions was confirmed through a convulsion test induced by D-limonene in PTZ. Mice were injected with vehicle (0.25% tween-80 in saline, 10 mL/kg) or D-limonene (5 or 10 mg/kg) 40 minutes before administration of PTZ (60 mg/kg).

As a result, as shown in Figure 1, when PTZ (60 mg/kg) was injected into mice, significant seizures were induced compared to the control group. On the other hand, it was confirmed that PTZ-induced seizures were suppressed in a dose-dependent manner in the experimental group pretreated with D-limonene. In detail, in the PTZ-only treatment group (60 mg/kg, n = 7), 2 mice showed 5 points and 5 mice showed 4 points. On the other hand, in the group treated with D-limonene along with PTZ (10 mg/kg of D-limonene, 60 mg/kg of PTZ, n = 7), only 1 mouse showed a seizure score of 4, whereas 4 mice showed a seizure score of 4. and two other mice had seizure scores of 2 and 3, respectively. These results show that treatment with D-limonene reduces PTZ-induced convulsions.

D-Limonene inhibits the occurrence of PTZ-induced nerve firing (kindling)

To confirm whether limonene has an anti-convulsant effect in a chronic convulsive model, 30 mg/kg of PTZ was administered once every two days for a total of 27 days to create a kindling model and the degree of inhibition of convulsions was confirmed. A kindling model was developed in which a single dose of PTZ resulted in an average seizure score of 1.2 (30 mg/kg), which was administered repeatedly once every two days to cause limbic seizures whenever there was subsequent stimulation.

As a result, as shown in Figure 2, it was confirmed that when mice were pretreated with D-limonene (10 mg/kg), the seizure score due to PTZ was significantly reduced. These results show that D-limonene prevents neuronal kindling caused by PTZ.

For reference, the neural kindling model was developed by repeatedly applying weak electrical stimulation to the amygdala and hippocampus according to a set schedule to rodents or repeatedly administering the same dose, so that limbic seizures appear permanently whenever stimulation occurs. It's a model. Neuronal firing models are used to evaluate whether chemicals have activity that may protect against focal seizures.

D-Limonene Inhibits Axonal Sprouting in the Hippocampus

We investigated changes in PTZ-induced axonal sprouting in the hippocampus due to D-limonene treatment. For this purpose, mice were immediately sacrificed after scoring seizures on the last day of kindling, and immunohistochemical staining was performed thereafter.

As a result, as shown in Figure 3, it was confirmed that the increase in axon sprouting induced by PTZ was reduced by D-limonene (see B and D). These results show that D-limonene can prevent PTZ-induced axon sprouting.

For reference, axon sprouting refers to the process in which a normal axon's projections abnormally branch out (axonal sprouting), and in severe cases, extend to its own cell body, creating an abnormally excessive circuit and easily transmitting excitement to the surroundings. plays a role. This axon sprouting is closely related to the mechanism of epilepsy.

D-Limonene regulates GAD-67 and Npas4 expression levels

To elucidate the mechanism of D-limonene's effect on seizures, the expression level of GABA synthase (GAD-67) was examined through Western blotting analysis. In addition, D-limonene was induced by neuronal activity. We further investigated whether it regulates transcription factors such as Npas4.

As a result, as shown in Figure 4, it was shown that treatment with D-limonene increased the expression of GAD-67 protein, a GABA synthase enzyme. Additionally, as shown in Figure 5, both acute and chronic administration of PTZ increased Npas4 expression in the hippocampus, while this increased Npas4 expression was confirmed to be effectively suppressed by D-limonene.

D-Limonene Regulates GABA Levels

GABA, an inhibitory neurotransmitter, may play a role in the anticonvulsant effect of D-limonene. In this experiment, we investigated how D-limonene treatment affects GABA levels in the hippocampus. As a result, the mouse group treated with acute D-limonene showed decreased GABA levels in the hippocampus compared to the group treated with vehicle (0.25% tween-80 in saline, 10 mL/kg) (see Figure 6A). In addition, the effects of D-limonene on GABAergic neurotransmission and the basic mechanisms of PC12 cells were further investigated. As a result, GABA levels in the culture medium of PC12 cells were shown to be enhanced by D-limonene pretreatment and decreased by SCH58261 (see Figure 6B).

These results suggest that D-limonene regulates GABAergic neurotransmission.

D-Limonene Inhibits PTZ-Induced Seizure Scores Through Adenosine A2A Receptors

To determine whether D-limonene reduced seizure scores induced by PTZ through adenosine A2A receptors, we treated patients with SCH58261 or ZM241385 before D-limonene injection and performed a convulsive behavior test. For reference, SCH58261 and ZM241385 are antagonists for adenosine receptor A2A.

As a result, as shown in Figure 7, it was confirmed that the seizure score suppressed by D-limonene was recovered through pretreatment with SCH58261 or ZM241385. However, treatment of SCH58261 or ZM241385 with vehicle (0.25% tween 80 in saline) or D-limonene did not induce convulsions (data not shown). These results show that D-limonene suppresses PTZ-induced convulsions through regulation of adenosine A2A receptor activation.

D-Limonene enhances phosphorylated CREB in the hippocampus.

Since D-limonene is an adenosine A2A receptor agonist, this experiment investigated whether D-limonene affects the level of phosphorylated CREB (p-CREB) in the adenosine A2A receptor downstream signaling pathway.

As a result, as shown in Figure 8, it was confirmed that acute injection of D-limonene (10 mg/kg) increased the level of phosphorylated CREB (p-CREB) in the hippocampus. However, the overall CREB expression level did not appear to change. Moreover, pretreatment with the adenosine A2A receptor antagonist SCH58261 appeared to reduce D-limonene-induced phosphorylated CREB (p-CREB) upregulation.

Considering the above results, it is believed that D-limonene exerts anti-convulsant effects through adenosine A2A receptor activation and regulation of GABAergic neurotransmitters.

So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

CREB: cAMP response element-binding protein
GABA: Gamma-aminobutyric acid
GAD-67: Glutamate decarboxylase-67
HPLC: High-performance liquid chromatography
Npas4: Neuronal PAS Domain Protein 4
PC12 cell: Pheochromocytoma cells derived from the adrenal gland of Rattus norvegicus
PTZ: Pentylenetetrazole

Claims (6)

A pharmaceutical composition for preventing or treating epilepsy or seizure-related diseases,
The composition contains D-limonene as an active ingredient,
The D-limonene exhibits anticonvulsant effects through adenosine A2A receptor activation and GABAergic neurotransmitter regulation.
A pharmaceutical composition for the prevention or treatment of epilepsy or seizure-related diseases, wherein the seizure-related disease is selected from the group consisting of stroke, hippocampal sclerosis, cerebral glandular paralysis, hypoxia, traumatic brain injury, and seizures due to unknown causes. delete delete A food composition for preventing or improving epilepsy or seizure-related diseases,
The composition contains D-limonene as an active ingredient,
The D-limonene exhibits anticonvulsant effects through adenosine A2A receptor activation and GABAergic neurotransmitter regulation.
A food composition for preventing or improving epilepsy or seizure-related diseases, wherein the seizure-related disease is selected from the group consisting of stroke, hippocampal sclerosis, corpus callosum paralysis, hypoxia, traumatic brain injury, and seizures due to unknown causes. As a health functional food for preventing or improving epilepsy or seizure-related diseases,
The composition contains D-limonene as an active ingredient,
The D-limonene exhibits anticonvulsant effects through adenosine A2A receptor activation and GABAergic neurotransmitter regulation.
The seizure-related disease is a health functional food for preventing or improving epilepsy or seizure-related diseases, characterized in that it is selected from the group consisting of stroke, hippocampal sclerosis, cerebral glandular paralysis, hypoxia, traumatic brain injury, and seizures due to unknown causes. According to clause 5,
The health functional food is a health functional food selected from the group consisting of beverages, meat, confectionery, noodles, rice cakes, bread, gum, candy, ice cream, and alcoholic beverages.