KR20230007682A - Pharmaceutical Composition for preventing and treating of obesity or metabolic disease comprising cholecystokinin and nonanoic acid - Google Patents

Abstract

The present invention relates to a pharmaceutical composition comprising cholecystokinin and nonanoic acid as active ingredients for preventing or treating obesity or a metabolic disease and a food composition and functional health food for prevention and treatment. The cholecystokinin and nonanoic acid according to the present invention have excellent effects of promoting the formation of beige adipocytes in a mesenchymal stem cell in a mouse and effectively increase the density and activity of mitochondria, so that the composition of the present invention, which comprises the same as active ingredients can be advantageously used in the fields of medicine and food as a material for preventing, alleviating, and treating obesity and a metabolic disease caused by obesity.

Description

Pharmaceutical composition for preventing or treating obesity or metabolic disease comprising cholecystokinin and nonanoic acid as active ingredients

The present invention relates to a pharmaceutical composition for prevention or treatment of obesity or metabolic disease, a food composition for prevention or improvement, and a health functional food containing cholecystokinin and nonanoic acid as active ingredients.

Obesity and obesity-related metabolic health complications are now becoming significant issues in the public health sector. Obesity is associated with an increased risk of death because it obviously increases the risk of many serious and fatal conditions (or diseases), including diabetes, atherosclerosis, high blood pressure, coronary artery disease and cancer. About 700 million adults worldwide are currently obese, and obesity prevalence is expected to soar by 2030. This rapid increase in the prevalence of obesity appears to be a result of a change in the past century towards a lifestyle in which exercise becomes recreational, high-calorie foods are consumed, and physical activity is inactive. These changes in lifestyle prevent excessive energy from being released, stored in the body as fat for a long time, and cause obesity.

Mammals have two specific types of adipose tissue that serve contrasting roles. These two adipose tissues are white adipose tissues and brown adipose tissues. White adipose tissue, characterized by having peripheral nuclei containing large unilocular lipid droplets and white adipocytes, is an active endocrine organ secreting various adipokines and regulating metabolic responses. Brown adipose tissue and white adipose tissue are morphologically and functionally different from each other. Although they can differentiate into individual adipocytes from each other, the origins of differentiation are distinctly different. The presence of UCP1 in white adipose tissue with multivesicular lipid droplets containing cells with the ability to generate heat is called Beige Adipose Tissue. Beige adipocytes not only have characteristics like those of brown adipocytes, such as UCP-1 expression, thermogenesis and having a higher number of mitochondria, but also fibroblast growth factor 21 (FGF21), CD137, T-box transcription factor (TBX1) ), transmembrane protein 26 (TMEM26) and cytochrome c oxidase subunit II (Cox2). Brown and beige fats can contribute to the regulation of energy expenditure throughout the body. It is thought that promoting the differentiation of white adipocytes into brown and beige adipocytes can help alleviate the side effects of white adipocytes and improve metabolic disorders.

On the other hand, cholecystokinin is a peptide hormone that is secreted from the epithelial cells of the small intestine and promotes the secretion of enzymes for digesting food. It is also known to suppress appetite by acting on the central nervous system. Intestinal hormones such as cholecystokinin play an important role in various metabolic functions such as appetite, calorie consumption, glucose homeostasis, and lipid metabolism that occur after food intake.

Nonanoic acid, one of the medium-chain fatty acids, is also called Pelargonic acid because it is contained in a large amount in the oil of a flower called pallagonium. Nonanoic acid combines with isoolfactory receptors in mouse intestinal cells to promote secretion of a hormone called GLP-1, has blood sugar lowering effects, and protects the intestinal barrier by preventing bacterial infection, thereby preventing enteritis and being involved in intestinal disease. It is known to do However, there has been no study on the beige adipogenic action of medium chain fatty acids including nonanoic acid.

Under this background, the inventors of the present invention confirmed that cholecystokinin and nonanoic acid can be usefully used to improve obesity and related metabolic diseases by promoting differentiation of mouse mesenchymal stem cells into beige adipocytes and increasing mitochondrial density and activity. has been completed.

Korean Patent Publication No. 10-2010-0088887 Korean Patent Publication No. 10-2005-0071355 Korean Patent Publication No. 10-2020-0109475

Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, which can promote formation of beige fat and effectively increase mitochondrial density and activity.

Another object of the present invention is to provide a food composition for preventing or improving obesity or metabolic diseases caused by obesity, which can promote formation of beige fat and effectively increase mitochondrial density and activity.

Another object of the present invention is to provide a health functional food for preventing or improving obesity or metabolic diseases caused by obesity, which can promote formation of beige fat and effectively increase mitochondrial density and activity.

In order to achieve the object of the present invention as described above, the present invention provides a pharmaceutical composition for preventing or treating obesity comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the composition may further include cola cystokinin octapeptide as an active ingredient.

In one embodiment of the present invention, the cola cystokinin octapeptide may be a compound represented by Formula 1 below.

[Formula 1]

In one embodiment of the present invention, the nonanoic acid or a pharmaceutically acceptable salt thereof may be included at a concentration of 0.1 to 1000 μM.

In addition, the present invention provides a food composition for preventing or improving obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the composition may further include cola cystokinin octapeptide as an active ingredient.

In one embodiment of the present invention, the cola cystokinin octapeptide may be a compound represented by Formula 1 above.

In addition, the present invention provides a health functional food for preventing or improving obesity containing nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the composition may further include cola cystokinin octapeptide as an active ingredient.

In one embodiment of the present invention, the cola cystokinin octapeptide may be a compound represented by Formula 1 above.

In one embodiment of the present invention, the food is selected from the group consisting of beverages, meat, chocolate, food, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements It can be.

In addition, the present invention provides a composition for preventing, improving or treating metabolic diseases caused by obesity, comprising nonanoic acid and cholacystokinin octapeptide as active ingredients.

In one embodiment of the present invention, the cola cystokinin octapeptide may be a compound represented by Formula 1 above.

In one embodiment of the present invention, the metabolic disease caused by obesity may be selected from the group consisting of diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease, or metabolic syndrome in which the above diseases occur simultaneously. .

In one embodiment of the present invention, the composition may be a pharmaceutical composition or a food composition.

Collacystokinin octapeptide and nonanoic acid of the present invention are excellent in accelerating the formation of beige adipocytes in mouse mesenchymal stem cells, and can effectively increase the density and activity of mitochondria. The composition of the present invention comprising the composition can be usefully used in the pharmaceutical and food fields as a material capable of preventing, improving, and treating obesity and metabolic diseases caused by obesity.

1 is a result of measuring the expression of the CCK B receptor gene through RT-PCR and qPCR after differentiation from mouse mesenchymal stem cells into beige adipocytes. 1A shows RT-PCR, 1B shows q-PCR results (* p <0.05).
2 is a result of immunocytochemical staining of the Cy5-CCK B receptor in mouse mesenchymal stem cells. Figure 2A shows the results of Cy5-CCK B receptor aptamer (red), Na + / K + pump antibody (green), DAPI nuclear staining (blue), and overlap (Merged). Fig. 2B shows the result of Cy5-CCK B receptor aptamer (red) and DAPI nuclear staining (blue), and merged in living cells.
Figure 3 is the result of measuring the change in beige fat marker gene expression according to the treatment of cholacystokinin octapeptide and nonanoic acid during the differentiation of mouse mesenchymal stem cells into beige adipocytes by q-PCR (* p <0.05, **p <0.01, NS: not significant)
Figure 4 shows the result of confirming changes in intracellular fat accumulation according to treatment with cholecystokinin octapeptide and nonanoic acid through Oil-Red-O staining during the differentiation of mouse mesenchymal stem cells into beige adipocytes. 4 is a photomicrograph obtained after staining, and FIG. 4B is an absorbance measurement result (p <0.05, ** p <0.01, *** p <0.001, NS: not significant).
Figure 5 shows the results of measuring mitochondrial density changes according to treatment with cholacystokinin octapeptide and nonanoic acid during differentiation from mouse mesenchymal stem cells to beige adipocytes (** p <0.01, NS: not significant).

Hereinafter, terms used in the present invention will be described.

In the present invention, "pharmaceutically acceptable" means that it does not significantly stimulate living organisms and does not inhibit the biological activity and properties of the active substance administered.

As used herein, the term "prevention" refers to any activity that suppresses symptoms or delays the progression of a specific disease (eg, obesity or metabolic disease caused by obesity) by administration of the composition of the present invention.

As used herein, the term "treatment" refers to any activity that improves or beneficially changes symptoms of a specific disease (eg, obesity or metabolic disease caused by obesity) by administration of the composition of the present invention.

As used herein, the term "improvement" refers to any activity that reduces at least the degree of a parameter related to the condition being treated, such as a symptom of a specific disease (eg, obesity or a metabolic disease caused by obesity).

As used herein, the term "administering" means providing a given composition of the present invention to a subject by any suitable method. At this time, the subject is all humans, monkeys, dogs, goats, pigs or rats with a disease that can improve the symptoms of a specific disease (eg, obesity or a metabolic disease caused by obesity) by administering the composition of the present invention. means animals.

In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit or risk ratio applicable to medical treatment, which is a subject's disease type, severity, drug activity, drug It may be determined according to factors including sensitivity, time of administration, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.

Hereinafter, the present invention will be described in detail.

The present invention is characterized by providing a composition for preventing or treating obesity or metabolic diseases caused by obesity, comprising Nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

"Nonanoic acid" referred to in this specification is also called pelargonic acid because it is contained in a large amount in the oil of a flower called pallagonium, and is an organic compound composed of 9 carbons having a carboxylic acid at the terminal. The chemical formula is CH ₃ (CH ₂ ) ₇ COOH. Nonanoic acid is a clear, greasy liquid with an unpleasant rancid odor. It is practically insoluble in water, but soluble in chloroform, ether and hexane. It is commonly used in conjunction with glyphosate, a non-selective herbicide, for rapid weed control in lawns.

The nonanoic acid according to the present invention may be used in the form of a salt, preferably a pharmaceutically acceptable salt.

As the pharmaceutically acceptable salt, an acid addition salt formed with a pharmaceutically acceptable free acid is useful. Acid addition salts are prepared by conventional methods, for example, by dissolving the compound in an excess of an aqueous acid solution and precipitating the salt using a water-miscible organic solvent, such as methanol, ethanol, acetone or acetonitrile. Equimolar amounts of the compound and an acid or alcohol (eg, glycol monomethyl ether) in water can be heated and then the mixture evaporated to dryness, or the precipitated salt can be suction filtered.

At this time, organic acids and inorganic acids can be used as the free acid, and hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. can be used as the inorganic acid, and methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, Citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid ( gluconic acid), galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carbonic acid, vanillic acid, hydroiodic acid, and the like can be used.

In addition, a pharmaceutically acceptable metal salt may be prepared using a base. An alkali metal or alkaline earth metal salt is obtained, for example, by dissolving a compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. At this time, as the metal salt, it is particularly suitable for pharmaceutical purposes to prepare a sodium, potassium or calcium salt, and the corresponding silver salt is obtained by reacting an alkali metal or alkaline earth metal salt with an appropriate silver salt (eg, silver nitrate).

In the following examples of the present invention, it was confirmed for the first time that Nonanoic acid promotes differentiation of mouse mesenchymal stem cells into beige adipocytes and increases mitochondrial density and activity.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating obesity or metabolic diseases caused by obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In the present invention, the "obesity" includes simple obesity, symptomatic obesity, childhood obesity, adult obesity, cell proliferation type obesity, cell hypertrophy obesity, upper body obesity, lower body obesity, visceral fat type obesity and subcutaneous fat type obesity, but must be It is not limited.

In the present invention, the "metabolic disease" may be a metabolic disease caused by obesity or a metabolic disease caused by other causes, examples of metabolic diseases include diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease or the above The diseases may be selected from the group consisting of concurrently occurring metabolic syndrome, but are not limited thereto.

The pharmaceutical composition of the present invention can be prepared using pharmaceutically suitable and physiologically acceptable adjuvants in addition to the above active ingredients, and the adjuvants include excipients, disintegrants, sweeteners, binders, coating agents, expanding agents, lubricants, A lubricant or flavoring agent may be used.

The pharmaceutical composition may be preferably formulated as a pharmaceutical composition by including one or more pharmaceutically acceptable carriers in addition to the above-described active ingredients for administration.

Formulations of the pharmaceutical composition may be granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, or injectable solutions. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. In addition, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacanth or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like. In compositions formulated as liquid solutions, acceptable pharmaceutical carriers are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added if necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets. Furthermore, using a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field, it can be preferably formulated according to each disease or component.

In one embodiment of the present invention, nonanoic acid or a pharmaceutically acceptable salt thereof of the present invention may be included in an amount of 0.1 to 99% by weight based on the total weight of the composition, and the nonanoic acid or a pharmaceutically acceptable salt thereof may be included. Acceptable salts may be included at concentrations of 0.1 to 1000 μM.

The composition of the present invention, in addition to the above-mentioned nonanoic acid or a pharmaceutically acceptable salt thereof, is mixed with an anti-obesity agent that has been used conventionally to the extent that it does not react with nonanoic acid (or its salt) to cause side effects. can also be used

In one embodiment of the present invention, the composition may further contain Cholecystokinin octapeptide in addition to Nonanoic acid as an active ingredient.

The Cholecystokinin octapeptide may be a compound represented by Formula 1 below.

[Formula 1]

In addition, the present invention provides a food composition for preventing or improving obesity or metabolic diseases caused by obesity, comprising Nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, nonanoic acid or a pharmaceutically acceptable salt thereof of the present invention may be included in an amount of 0.1 to 99% by weight based on the total weight of the food composition, and nonanoic acid or a pharmaceutically acceptable salt thereof Acceptable salts can be included in the food composition at a concentration of 0.1 to 1000 μM.

In addition to containing nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient, the food composition of the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional food compositions. .

Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides such as conventional sugars such as dextrins, cyclodextrins, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agents described above, natural flavoring agents (thaumatin), stevia extracts (eg rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can advantageously be used.

In addition, the food composition of the present invention may be preferably formulated as a food composition by including at least one food-acceptable or pharmaceutically-acceptable carrier in addition to the above-described active ingredients.

The formulation form of the food composition may be tablets, capsules, powders, granules, liquids, pills, solutions, syrups, juices, suspensions, emulsions, or drops. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. In addition, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacanth or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, and the like. In compositions formulated as liquid solutions, acceptable pharmaceutical carriers are sterile and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added if necessary. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets.

The food composition of the present invention formulated in the above manner can be used as a functional food or added to various foods.

Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. there is

In addition, the food composition includes various nutrients, vitamins, minerals (electrolytes), flavors, colorants, and enhancers such as synthetic flavors and natural flavors in addition to active ingredient Nonanoic acid or a pharmaceutically acceptable salt thereof. (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. . In addition, the food composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages.

Nonanoic acid or its pharmaceutically acceptable salt, which is an active ingredient of the present invention, is a kind of organic acid and has almost no side effects such as chemicals, so it can be used even when taken for a long time for the purpose of providing functionality such as anti-obesity or improvement of metabolic syndrome. You can use it with confidence.

In one embodiment of the present invention, the composition may further contain Cholecystokinin octapeptide in addition to Nonanoic acid as an active ingredient.

The Cholecystokinin octapeptide may be a compound represented by Formula 1 above.

In addition, the present invention provides a health functional food for preventing or improving obesity or metabolic diseases caused by obesity, comprising Nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The health functional food of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. for the purpose of preventing or improving obesity or metabolic diseases caused by obesity.

In the present invention, "functional health food" refers to food manufactured and processed using raw materials or ingredients having useful functionality for the human body in accordance with the Act on Health Functional Food, which regulates nutrients for the structure and function of the human body, or It refers to intake for the purpose of obtaining useful effects for health purposes such as physiological actions.

The health functional food of the present invention may contain ordinary food additives, and the suitability as a food additive is determined according to the general rules of the Food Additive Code and General Test Methods approved by the Food and Drug Administration, unless otherwise specified. It is judged according to standards and standards.

Examples of the items listed in the “food additives code” include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; natural additives such as persimmon pigment, licorice extract, crystalline cellulose, kaoliang pigment, and guar gum; and mixed preparations such as sodium L-glutamate preparations, noodle-added alkali preparations, preservative preparations, and tar color preparations.

For example, a health functional food in the form of a tablet is a mixture obtained by mixing Nonanoic acid or a pharmaceutically acceptable salt thereof, an active ingredient of the present invention, with excipients, binders, disintegrants, and other additives in a conventional manner. After granulation, a lubricant or the like may be added thereto for compression molding, or the mixture may be directly compression molded. In addition, the health functional food in the form of a tablet may contain a flavoring agent and the like as needed.

Among health functional foods in the form of capsules, hard capsules can be prepared by filling nonanoic acid or a pharmaceutically acceptable salt thereof, which is the active ingredient of the present invention, in conventional hard capsules, and soft capsules contain the nonanoic acid ( Nonanoic acid) and additives such as excipients can be prepared by filling a capsule base such as gelatin. The soft capsule may contain a plasticizer such as glycerin or sorbitol, a colorant, a preservative, and the like, if necessary.

The health functional food in the form of a pill can be prepared by molding a mixture obtained by mixing Nonanoic acid or a pharmaceutically acceptable salt thereof, which is the active ingredient of the present invention, with excipients, binders, disintegrants, etc., by a conventionally known method. If necessary, it can be coated with sucrose or other coating agent, or the surface can be coated with a material such as starch or talc.

Health functional food in the form of granules can be prepared in granular form by a conventionally known method of mixing a mixture of nonanoic acid or a pharmaceutically acceptable salt thereof, which is an active ingredient of the present invention, with excipients, binders, disintegrants, etc. It may contain a flavoring agent, a flavoring agent, etc., if necessary.

In one embodiment of the present invention, the health functional food may further include Cholecystokinin octapeptide in addition to Nonanoic acid as an active ingredient.

The Cholecystokinin octapeptide may be a compound represented by Formula 1 above.

The health functional food may be beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

Hereinafter, the present invention will be described in more detail through examples. These examples are intended to explain the present invention in more detail, and the scope of the present invention is not limited to these examples.

<Example 1>

Analysis of cholecystokinin B receptor gene expression, a molecular target of cholecystokinin octapeptide

In this experiment, an experiment was performed to measure the expression of the cholecystokinin B receptor (hereinafter simply abbreviated as 'CCK B Receptor') gene, which is a molecular target of cholecystokinin octapeptide, in C3H/10T1/2 cells. did Receptor expression was confirmed by RT-PCR and q-PCR in C3H/10T1/2 cells. C3H/10T1/2 cells used in the experiment were purchased from Korea Cell Line Bank (KCLB).

<1-1> Cell culture

The cell culture medium was cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (PEST) at 37°C and 5% CO₂ conditions. Culture was performed by adding 10 ml of medium to a 75 cm 2 culture flask, and the medium was replaced every 2-3 days. At the time of subculture, after washing with PBS, 1 ml of 0.01% trypsin was added and incubated for 5 minutes, and the reaction was stopped by adding 4 ml of DMEM/FBS/PEST medium.

<1-2> Beige adipocyte differentiation

125μM indomethacin, 0.5μM rosiglitazone, 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 5μg/ml to induce differentiation of C3H/10T1/2 cells into beige fat Insulin, 1nM 3,3',5-triiodo-L-tyrosine (3,3',5-Triiodo-L-thyronine, T3), culture medium containing 2μg / ml dexametaxone at 37 ℃, 5% It was cultured for two days under CO2 conditions. Next, the culture medium containing 1 nM 3,3',5-triiodo-L-tyrosine (T3), 5 μg/ml insulin, and 1 μM rosiglitazone was changed for two days to maintain differentiation, and the culture medium was maintained at 37°C for 6 days until complete differentiation. It was cultured under 5% CO2 condition. The control group was cultured at 37°C and 5% CO2 conditions by replacing the differentiation medium with a new culture medium for two days so that both groups contained the same amount of DMSO.

<1-3> Cholecystokinin B Receptor Gene Expression

RT-PCR and qPCR were performed to confirm the RNA expression of the cholecystokinin B receptor gene in C3H/10T1/2 cells.

[cDNA synthesis]

RNA was extracted from cultured C3H/10T1/2 cells and cDNA synthesis was performed using ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). More specifically, in order to increase the efficiency of the RT-PCR reaction, the extracted RNA was treated at 65° C. for 5 minutes and immediately stored on ice. Then, a total of 8 μl of reaction was prepared with 2 μl of 4×DNA Master Mix containing gDNA remover, 0.5 μg of RNA, and nuclease-free water, and reacted at 37° C. for 5 minutes. Then, 5×RT Master mix was added to the reaction product and reacted at 37°C-5 minutes, 50°C-5 minutes, and 98°C-5 minutes to synthesize cDNA.

[PCR]

The cDNA synthesized by the above method was subjected to PCR using the primers shown in Table 1 below. Then, the obtained PCR product was loaded on an agarose gel by electrophoresis to confirm RNA expression of the cholecystokinin B receptor gene. At this time, L32, a house keeping gene, was used as a control group.

As a result, as shown in FIG. 1A, it was confirmed that the expression of the cholecystokinin B receptor (CCK B Receptor) was further increased after differentiation into beige fat compared to before differentiation.

Gene amplification primer sequences used for PCR and qPCR gene Primer sequence (5'->3') CCK-B Receptor forward CGCTGCTGTCCTCAACAATA Reverse AGGCCAACTTCATCACATCC L32 forward AGAAGTTCATCCGGCACCAG Reverse CACTTCCAGCTCCTTGACGT

[Quantitative real-time PCR (qPCR)]

qPCR using the cDNA synthesized by the above method is a method known to those skilled in the art, using the primers shown in Table 1 above, THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) and iQ5 iCycler system (Bio-rad, California, USA) ), and more specifically, after denaturation at 95 ° C for 4 minutes and 30 seconds, an additional denaturation process was performed over 40 cycles at the same temperature for 10 seconds, followed by heating and cooling at 55 ° C to 60 ° C for 30 seconds. The process was carried out and elongation was performed at 68° C. for 20 seconds. The level of expression of each gene was normalized using L32 expression. Primers were designed using NCBI (National Center for Biotechnology Information) nucleotide blast software and purchased from Bionics (Seoul, Korea).

As a result, it was confirmed that CCK B Receptor gene expression was significantly expressed in C3H/10T1/2 cells before differentiation and cells differentiated into beige fat. Fig. 1A shows RT-PCR experiments and Fig. 1B shows qPCR experiments. In both experiments, CCK B receptor expression was higher after differentiation than before differentiation.

<Example 2>

Analysis of cholecystokinin B receptor gene expression, a molecular target of cholecystokinin octapeptide, using immunocytochemistry

In this experiment, immunocytochemistry was performed using antibodies and aptamers to confirm CCK B Receptor expression in C3H/10T1/2 cells.

<2-1> Immunocytochemical staining using aptamers and antibodies

In order to confirm the location of a specific protein in the cell, immunocytochemical staining was performed using a sodium/potassium pump antibody (Santa Cruz, Cat. sc-48345) and an aptamer (Genotech, AP1153), which are one of the cell membrane potential proteins. It was analyzed by immunofluorescence microscopy. The cells were cultured in a 35mm glass bottom 6-well plate, and cultured at 37° C. and 5% CO₂ conditions by adding 500 μl of medium. Binding buffer (2 mM MgCl2, 100 mM NaCl, 5 mM KCl, 1 Mm CaCl2, 20 mM Tris-HCl, Tween 20 (0.02%) and pH 7.6, prepared to increase the binding force between cells and aptamers, and pH 7.6; Abbreviated as BB'), the cells were washed. Without a fixation step, 200 μl of an aptamer working solution prepared to have a concentration of 250 nM in BB of the Cy5-labeled CCK B receptor aptamer was added to each well and incubated at room temperature for 30 minutes. Then, after washing once with BB, 200 μl of 4% paraformaldehyde was added to each well and incubated at room temperature for 10 minutes to fix the cells. After the fixation step, the cells were washed again with BB and then diluted with 1% fish gelatin and 10% goat serum in PBS-T to avoid non-specific antigen-antibody binding and incubated at 37°C for 1 hour. , and cultured under 5% CO2 conditions. Primary antibody diluted 1:100, 5% bovine serum albumin (BSA), and 0.1% TBS Tween were added to the cells after blocking was added to the BB and incubated for 2 hours at room temperature. Next, DAPI dye was added and incubated for 5 minutes at room temperature. After washing with BB as before, it was observed under a confocal microscope using a 40X objective lens. As software, Leica application suite software was used.

As a result, as shown in Figure 2A, it was confirmed that the antibody and the aptamer are located in the cell membrane. These results show that CCK B Receptor is expressed in C3H/10T1/2 cells.

<2-2> Immunocytochemical staining using an aptamer

Immunocytochemical staining was performed to confirm the location of specific proteins in cells and analyzed through immunofluorescence microscopy. The cells were cultured in a 35mm glass bottom 6-well plate, and cultured at 37° C. and 5% CO₂ conditions by adding 500 μl of medium. The cells were washed with a binding buffer (BB) prepared to increase the binding force between the cells and the aptamer. Without a fixation step, 200 μl of an aptamer working solution prepared to have a concentration of 250 nM in BB of the Cy5-labeled CCK B receptor aptamer was added to each well and incubated at room temperature for 30 minutes. Then, after washing once with BB, 200 μl of 4% paraformaldehyde was added to each well and incubated at room temperature for 10 minutes to fix the cells. After the fixation step, the cells were washed again with BB and then incubated for 5 minutes at room temperature with the addition of DAPI dye. After washing with BB as before, it was observed under a confocal microscope using a 40X objective lens. As software, Leica application suite software was used.

As a result, as shown in FIG. 2B, it was confirmed that the aptamer binds to the cell membrane and emits fluorescence. These results show that CCK B Receptor is expressed in C3H/10T1/2 cells.

<Example 3>

Verification of beige fat differentiation promotion effect according to cholecystokinin octapeptide and nonanoic acid treatment in C3H/10T1/2 cells

In this experiment, C3H/10T1/2 cells were treated with cholecystokinin octapeptide (abbreviated as 'CCK-8' hereinafter) and nonanoic acid (abbreviated as 'NA' hereinafter) during differentiation. An experiment was performed to confirm the effect of promoting differentiation of beige fat when To this end, changes in the expression of beige fat marker genes ( Ucp1, Dio2, Chrna2, Pgc1a, Cidea, CytC ) when the material was treated during differentiation were confirmed using q-PCR. In addition, Oil-Red-O staining was performed to determine the degree of lipid accumulation in cells to confirm the degree of differentiation.

<3-1> Cell culture

The cell culture medium was cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (PEST) at 37°C and 5% CO₂ conditions. Culture was performed by adding 10 ml of medium to a 75 cm 2 culture flask, and the medium was replaced every 2-3 days. At the time of subculture, after washing with PBS, 1 ml of 0.01% trypsin was added and incubated for 5 minutes, and the reaction was stopped by adding 4 ml of DMEM/FBS/PEST medium.

<3-2> Beige adipocyte differentiation

125μM indomethacin, 0.5μM rosiglitazone, 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 5μg/ml to induce differentiation of C3H/10T1/2 cells into beige fat Insulin, 1nM 3,3',5-triiodo-L-tyrosine (3,3',5-Triiodo-L-thyronine, T3), culture medium containing 2μg / ml dexametaxone at 37 ℃, 5% It was cultured for two days under CO2 conditions. Next, the culture medium containing 1 nM 3,3',5-triiodo-L-tyrosine (T3), 5 μg/ml insulin, and 1 μM rosiglitazone was changed for two days to maintain differentiation, and the culture medium was maintained at 37°C for 6 days until complete differentiation. It was cultured under 5% CO2 condition. 10 μM of cholecystokinin octapeptide (Cayman chemical, CAS. 25126-32-3) and 2 μM of nonanoic acid (Sigma-Aldrich, CAS. 112-05-0) were treated in a medium containing the differentiation induction reagent during the differentiation process into beige fat. . In order to confirm the effect of the substance, the experiment was conducted by dividing into a negative control group, an experimental group treated with each reagent separately, and an experimental group treated with both reagents together.

<3-3> Expression of genes related to beige fat

qPCR was performed to confirm RNA expression of beige fat-related genes ( Ucp1, Dio2, Chrna2, Pgc1a, Cidea, CytC ) in C3H/10T1/2 cells.

[cDNA synthesis]

RNA was extracted from differentiated beige adipocytes and cDNA synthesis was performed using the ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan). More specifically, in order to increase the efficiency of the RT-PCR reaction, the extracted RNA was treated at 65° C. for 5 minutes and immediately stored on ice. Thereafter, a total of 8 μl of reaction was prepared with 2 μl of 4×DNA Master Mix containing gDNA remover, 0.5 μg of RNA, and nuclease-free water, and reacted at 37° C. for 5 minutes. Then, 5×RT Master mix was added to the reaction product and reacted at 37°C-5 minutes, 50°C-5 minutes, and 98°C-5 minutes to synthesize cDNA.

[Quantitative real-time PCR (qPCR)]

qPCR using the cDNA synthesized by the above method is a method known to those skilled in the art, using the primers shown in Table 2 below, THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) and iQ5 iCycler system (Bio-rad, California, USA) It was performed using, and more specifically, after denaturation at 95 ° C for 4 minutes and 30 seconds, further denaturation at the same temperature for 40 cycles for 10 seconds, followed by heating and cooling at 55 ° C to 60 ° C for 30 seconds was performed and elongated at 68° C. for 20 seconds. The level of expression of each gene was normalized using L32 expression. Primers were designed using NCBI (National Center for Biotechnology Information) nucleotide blast software and purchased from Bionics (Seoul, Korea).

As a result, as shown in FIG. 3, it was confirmed that the expression of beige fat-related genes ( Ucp1, Dio2, Chrna2, Pgc1a, Cidea, CytC ) increased in the group treated with CCK-8 and NA compared to the control group. In addition, it was found that the expression of the above genes was further increased when the two materials were treated together compared to the single treatment group.

Gene amplification primer sequences used for qPCR gene Primer sequence (5'->3') Ucp1 forward GGG CCC TTG TAA ACA ACA AA Reverse GTC GGT CCT TCC TTG GTG TA Dio2 forward CAT CTT CCT CCT AGA TGC CCA Reverse CTG ATT CAG GAT TGG AGA CGT G Chrna2 forward GCC ACC GGA ACC TAT AAC AGC Reverse CCG GCG GAT AAC GAA GTA GTA Pgc1a forward GCT GCA TGG TTC TGA GTG CTA AG Reverse AGC CGT GAC CAC TGA CAA CGA G Cidea forward ATC ACA ACT GGC CTG GTT ACG Reverse TAC TAC CCG GTG TCC ATT TCT CytC forward ACA AGA AGA CTC AAA TGT GTT TCA GT Reverse TGC ACT GTC AAG AAT AGA CAG TTG L32 forward AGAAGTTCATCCGGCACCAG Reverse CACTTCCAGCTCCTTGACGT

<3-4> Confirmation of beige fat differentiation rate

Oil-Red-O staining was performed to examine the rate of beige fat differentiation when C3H/10T1/2 cells were treated with the material. Since the Oil-Red-O staining method stains intracellular lipids in red, the differentiation rate from stem cells to adipocytes can be compared when its absorbance is measured. As a control group, a non-differentiated cell group and a differentiated cell group not treated with a substance were used.

Specifically, wells of cells that had differentiated into beige fat were carefully washed twice with ice-cold PBS 1X, and then fixed with 4% paraformaldehyde for 10 minutes at room temperature. After fixation, the sample was washed with distilled water three times, fixed in 60% isopropanol at room temperature for 10 minutes, and filtered, and the Oil-Red-O working solution was left at room temperature for 20 minutes. After washing with distilled water 5 times, 100 ul of distilled water was added to each well at the end, and observation and images were obtained under a microscope. For absorbance measurement, after removing distilled water and drying completely at room temperature, 200 ul of 100% isopropanol was added to each well and pipetted to dissolve all dyes. 100 ul of the solution was transferred to a 96-well transparent plate, and absorbance was measured at 510 nm using a spectrophotometer (Smart spec Plus, Bio-rad, CA, USA). Blanks are those using isophanol.

As a result, as shown in Figure 4, higher absorbance was shown in the group treated with CCK-8 or NA during differentiation. In addition, the highest absorbance was shown in the group treated with the two materials compared to the single treatment group.

<Example 4>

Measurement of mitochondrial activity following treatment with cholecystokinin octapeptide and nonanoic acid in C3H/10T1/2 cells

Unlike white fat, beige fat has the characteristics of high mitochondrial density and activity. Therefore, in this experiment, mitochondrial density according to treatment with cholecystokinin octapeptide and nonanoic acid during C3H/10T1/2 cell differentiation was measured by performing Mitotracker.

<4-1> Cell culture

The cell culture medium was cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with 10% fetal bovine serum (FBS, Hyclone) and 1% penicillin/streptomycin (PEST) at 37°C and 5% CO₂ conditions. Culture was performed by adding 10 ml of medium to a 75 cm 2 culture flask, and the medium was replaced every 2-3 days. At the time of subculture, after washing with PBS, 1 ml of 0.01% trypsin was added and incubated for 5 minutes, and the reaction was stopped by adding 4 ml of DMEM/FBS/PEST medium.

<4-2> Beige adipocyte differentiation

125μM indomethacin, 0.5μM rosiglitazone, 0.5mM 3-Isobutyl-1-methylxanthine (IBMX), 5μg/ml to induce differentiation of C3H/10T1/2 cells into beige fat Insulin, 1nM 3,3',5-triiodo-L-tyrosine (3,3',5-Triiodo-L-thyronine, T3), culture medium containing 2μg / ml dexametaxone at 37 ℃, 5% It was cultured for two days under CO2 conditions. Next, the culture medium containing 1 nM 3,3',5-triiodo-L-tyrosine (T3), 5 μg/ml insulin, and 1 μM rosiglitazone was changed for two days to maintain differentiation, and the culture medium was maintained at 37°C for 6 days until complete differentiation. It was cultured under 5% CO2 conditions. 10 μM of cholecystokinin octapeptide (Cayman chemical, CAS. 25126-32-3) and 2 μM of nonanoic acid (Sigma-Aldrich, CAS. 112-05-0) were added to the medium containing the differentiation inducing reagent in the process of differentiation into beige fat, respectively, or treated together. In order to confirm the effect of the substance, the experiment was conducted by dividing into a negative control group, an experimental group treated with each reagent separately, and an experimental group treated with both reagents together.

<4-3> Mitotracker measurement

Working reagent was prepared by adding DMSO to Mitotracker green FM (Invitrogen, Cat. M7514) at a concentration of 1 mM. The staining reagent was prepared by diluting the Working reagent at 200 nM in DMEM-/- medium. The differentiated plate was washed with PBS 1X, and then a pre-prepared staining reagent was added and incubated at room temperature for 30 minutes. Absorbance at Ex/Em = 490 nm/516 nm was measured using SpectraMax.

As a result, as shown in Figure 5, it was confirmed that the mitochondrial density tended to be higher in the group treated with CCK-8 or NA during differentiation compared to the control group. In addition, a statistically significant increase was shown when the two substances (CCK-8, NA) were treated together. These results indicate that treatment with CCK-8 or NA promotes differentiation into beige adipocytes.

So far, the present invention has been looked at with respect to its preferred embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent scope will be construed as being included in the present invention.

Claims (15)

A pharmaceutical composition for preventing or treating obesity comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient. According to claim 1,
The composition is a pharmaceutical composition for the prevention or treatment of obesity, characterized in that it further comprises a cola cystokinin octapeptide as an active ingredient. According to claim 2,
The collagen cystokinin octapeptide is a pharmaceutical composition for the prevention or treatment of obesity, characterized in that the compound represented by the following formula (1).
[Formula 1]

According to claim 1,
The nonanoic acid or a pharmaceutically acceptable salt thereof is characterized in that contained in a concentration of 0.1 to 1000μM, a pharmaceutical composition for preventing or treating obesity. A food composition for preventing or improving obesity, comprising nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient. According to claim 5,
The composition is a food composition for preventing or improving obesity, characterized in that it further comprises a cola cystokinin octapeptide as an active ingredient. According to claim 6,
The cholecystokinin octapeptide is a food composition for preventing or improving obesity, characterized in that the compound represented by the following formula (1).
[Formula 1]

Health functional food for preventing or improving obesity, containing nonanoic acid or a pharmaceutically acceptable salt thereof as an active ingredient. According to claim 8,
The composition is a health functional food for preventing or improving obesity, characterized in that it further comprises a cola cystokinin octapeptide as an active ingredient. According to claim 9,
The collagen cystokinin octapeptide is a health functional food for preventing or improving obesity, characterized in that it is a compound represented by the following formula (1).
[Formula 1]

According to any one of claims 8 to 10,
The food is characterized in that it is selected from the group consisting of beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, chewing gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, prevention of obesity Or health functional food for improvement. A composition for preventing, improving or treating metabolic diseases caused by obesity, comprising nonanoic acid and cholacystokinin octapeptide as active ingredients. According to claim 12,
The collagen cystokinin octapeptide is a composition for preventing, improving or treating metabolic diseases caused by obesity, characterized in that the compound represented by the following formula (1).
[Formula 1]

According to claim 12,
The metabolic disease caused by obesity is characterized in that it is selected from the group consisting of diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease or metabolic syndrome in which the above diseases occur simultaneously. Metabolic disease caused by obesity A composition for the prevention, improvement or treatment of According to claim 12,
The composition is a composition for preventing, improving or treating metabolic diseases caused by obesity, characterized in that a pharmaceutical composition or a food composition.

Images