KR102637204B1 - Salvianolic acid B enhanced Salvia miltiorrhiza extract and cosmetic composition containing the same for improving acne - Google Patents

Abstract

The present invention relates to Salvia miltiorrhiza extract enhanced with salvianolic acid B and a cosmetic composition containing the same for improving acne.
The extract exhibits an antibacterial effect against the causative agent of acne ( Propionibacterium acnes ) and increases AR (Androgen Receptor) and SREBP-1c (Sterol regulatory element-binding transcription factor 1) due to DHT (Dihydrotestosterone) in human sebocytes. ), it shows that it has superior acne improvement efficacy compared to panthenol and salicylic acid, which are conventional acne symptom improvement agents.

Description

Salvia miltiorrhiza extract and cosmetic composition containing the same for improving acne}

The present invention relates to Salvianolic acid B-enhanced Salvian ginseng extract and a cosmetic composition for improving acne containing the same.

In Southeast Asia, including Korea, the number of people suffering from skin problems is increasing significantly due to the westernization of eating habits, severe daily temperature fluctuations, and environmental pollution. Among them, the acne improvement cosmetics market is expanding significantly, especially in Southeast Asia. In addition, the cosmetics market is also rapidly growing due to preference for cosmetics with functional efficacy.

Cosmetics have long been of great interest to women, mainly as a way to pursue beauty. However, recently, there has been a lot of interest as a product not only for skin care but also for functional purposes such as anti-aging, UV protection, and whitening. Despite the advancement of science, skin diseases such as acne caused by microbial infection of the face frequently occur due to decreased immunity due to environmental pollution and stress. In particular, due to COVID-19, high humidity and temperature in the O zone around the mouth covered by the mask can cause edema in the epidermal keratinocytes, make the skin sensitive, and worsen the skin barrier, which can be the main cause of skin diseases.

In skin care, inflammation control is of great interest to people, and demand for products to control inflammation is rapidly increasing.

Acne is an inflammatory disease of the sebaceous glands and is characterized by the formation of comedones, erythematous papules, and pustules, and may also leave lacuna or hypertrophic scars. The exact cause of acne is not known, so various factors are involved.

Research into the causes and treatments of acne has been conducted around the world, and known treatments for acne include surgical treatment, hormone treatment, use of antibiotics, and diet and stress control.

Drugs used to treat acne have problems such as discoloration and skin irritation when exposed to sunlight, and antibiotics cause problems such as increased resistance to bacteria. In addition, studies have shown that salicylic acid (BHA) and triclosan, which are used as drug treatments in acne products, dry the skin, and that triclosan is converted into harmful substances when exposed to sunlight. Accordingly, the use of salicylic acid in cosmetics is limited to 0.5% and triclosan to 0.3%, making it difficult to expect a therapeutic effect.

Hormone treatment can bring rapid improvement in acne symptoms, but the side effects of steroid use can be greater, so it is a treatment that consumers avoid. In addition, improving or treating acne through diet and stress relief is very difficult to maintain and is an unproven method in terms of efficacy.

In addition, compounds such as glycolic acid (AHA), which is an exfoliating ingredient, vitamin A with a soothing effect, and anhydrous ethanol, as well as grapefruit seed extract, cucumber grass extract, cinnamon extract, ginger extract, and cypress extract, are used, but their efficacy is minimal. As such, there is an urgent need to develop natural extract materials that can properly prove this.

Meanwhile, Salvia miltiorrhiza Bunge is a perennial herb belonging to the Lamiaceae family. Its roots are similar in appearance to ginseng and are red in color, giving it the name Salvia miltiorrhiza. Salvia Salvia is known as an herb that strengthens blood vessels since ancient times. The tanshinone component contained in Salvia Salvia helps rejuvenate blood vessels by suppressing the oxidation of waste products in the blood vessels and dilates blood vessels to improve blood circulation and prevent high blood pressure or myocardial infarction. It is known to prevent vascular diseases such as. In Oriental medicine, Salvia Salvia is recorded as an herb that promotes blood flow, removes stagnant blood, and helps create new blood. In addition, Salvia miltiorrhiza has been reported to have effects such as ischemic damage repair, coronary artery relaxation, inhibition of atherosclerosis, antihypertension, antihyperlipidemia, antidiabetic, antibacterial, antioxidant, anticancer, antimutagenic, and antithrombotic. Research is in progress on the various uses of Salvian ginseng extract and its active ingredient, salvianolic acid B, using these functional properties, but research on acne improvement is still insufficient.

Therefore, while researching the various physiological activities of Salvia Miltiorrhiza extract and its active ingredients, the present inventors discovered that the Salvia Salvia extract and its active ingredients were effective in controlling acne bacteria and sebum production, and thus developed pharmaceutical compositions, cosmetic compositions or compositions for improving acne. The present invention was completed by confirming that it can be used as a health functional food.

Republic of Korea Patent No. 10-2326886 (Title of invention: Anti-acne and anti-inflammatory composition containing Houttuynia cordata complex extract as an active ingredient, Applicant: PF Nature Co., Ltd. and one other person, Registration date: 2021.11.10) Republic of Korea Patent No. 10-0371028 (Title of Invention: Cosmetic composition containing salvia ginseng extract and polyethoxylated retinamide that is effective in preventing and treating acne with excellent skin safety, Applicant: LG Life & Health Co., Ltd., Registration date: January 2003. 22) Republic of Korea Patent No. 10-0371028 (Title of Invention: Cosmetic composition containing salvia ginseng extract and polyethoxylated retinamide that is effective in preventing and treating acne with excellent skin safety, Applicant: LG Life & Health Co., Ltd., Registration date: January 2003. 22)

The purpose of the present invention is to provide a salvianolic acid B-enhanced Salvia ginseng extract and a cosmetic composition containing the same for improving acne.

The present invention relates to a cosmetic composition for improving acne containing Salvian ginseng extract enhanced with Salvianolic acid B.

The content of salvianolic acid B in the extract is characterized in that it is 0.7 to 1.5% by weight.

The extraction solvent of the Salvia Salvia Militiorrhiza extract contains propanediol, glycerin, 1,2-hexanediol, and purified water. Preferably, it may contain 7 to 15% by weight of propanediol, 3 to 14% by weight of glycerin, 0.5 to 2% by weight of 1,2-hexanediol, and 70 to 85% by weight of purified water.

The extract is characterized by suppressing gene expression of AR (Androgen Receptor) or SREBP-1c (Sterol regulatory element-binding transcription factor 1).

The extract may have antibacterial effect against Cutibacterium acnes 3314.

Additionally, the present invention may relate to a pharmaceutical composition for preventing or treating acne containing salvianolic acid B-enhanced Salvia miltiorrhiza extract.

The pharmaceutical composition is characterized as a composition for external application to the skin.

Hereinafter, the present invention will be described in detail.

The solvent used in preparing the Salvia Miltiorrhiza extract can be used in an amount of 1 to 40 times the weight based on the weight of Salvia Salvia Miltiorrhiza, preferably 5 to 40 times the weight. Extraction conditions for the Salvia Miltiorrhiza extract may be 1 minute to 48 hours at 20 to 70°C. The above process can be repeated 1 to 4 times.

The extraction time is not particularly limited, but is preferably extracted within 10 minutes to 2 days, and the extraction device may be a conventional extraction device, an ultrasonic grinding extractor, or a fractionator.

The extract prepared in this way can be used directly as a cosmetic composition without separately removing the solvent, thereby reducing the time and cost required for additional solvent removal, fractionation, purification, etc., and has excellent formulation stability even when used as a cosmetic composition.

When the extract is separately concentrated, dried, etc., the extract is extracted according to conventional methods, such as extraction with an organic solvent (alcohol, ether, acetone, etc.), distribution of hexane and water, column chromatography, etc., of plant components. It can be used by fractionation or purification using known methods used for separation and extraction alone or in an appropriate combination.

The chromatography includes silica gel column chromatography, LH-20 column chromatography, ion exchange resin chromatography, and medium pressure liquid chromatography. chromatography), thin layer chromatography (TLC), silica gel vacuum liquid chromatography, and high performance liquid chromatography.

Additionally, the present invention provides a pharmaceutical composition for preventing or treating acne containing Salvia Militiorrhiza extract. The pharmaceutical composition is preferably a composition for external application to the skin, but the formulation is not particularly limited. The Salvia Miltiorrhiza extract may be added to the pharmaceutical composition of the present invention in an amount of 0.001 to 100% by weight.

Carriers, excipients, and diluents that may be included in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, and cellulose. , methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include the extract of the present invention with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, It is prepared by mixing gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use include suspensions, oral solutions, emulsions, syrups, etc. In addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. . Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.

The dosage of the pharmaceutical composition of the present invention will vary depending on the age, gender, and weight of the subject to be treated, the specific disease or pathological state to be treated, the severity of the disease or pathological state, the route of administration, and the judgment of the prescriber. Dosage determinations based on these factors are within the level of one skilled in the art, and dosages generally range from 0.01 mg/kg/day to approximately 2000 mg/kg/day. A more preferred dosage is 1 mg/kg/day to 500 mg/kg/day. Administration may be administered once a day, or may be administered several times. The above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention can be administered to mammals such as rats, livestock, and humans through various routes.

The formulation of the cosmetic composition provided by the present invention can be manufactured in any formulation commonly manufactured in the art, and includes essence, lotion, emulsion, pack, hand cream, foot cream, lip balm, lipstick, eye shadow, and eye liner. , eyebrow pencil, blusher, highlighter, general lotion, skin, cream, serum, beauty soap, softening lotion, medicated lotion, body cleanser, cleansing foam, cleansing lotion, gel, cleansing oil, cleansing cream, shampoo, conditioner, hair We can provide a selection of treatments, hair lotions, cleansing tissues and cleansing water.

More specifically, when the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, and silica are used as carrier ingredients. , talc or zinc oxide can be used. When the formulation of the cosmetic composition of the present invention is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder can be used as the carrier ingredient. In particular, when the cosmetic composition is a spray, chlorofluorohydride may be used as a carrier ingredient. It may contain propellants such as carbon, propane-butane or dimethyl ether. When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene. These include fatty acid esters of glycol, 1,3-butylglycol oil, glycerol aliphatic esters, polyethylene glycol or sorbitan. When the formulation of the cosmetic composition of the present invention is a suspension, the carrier component includes water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used. When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing agent, the carrier ingredients include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, acethionate, imidazolinium derivative, methyl taurate, and sarcosinate. , fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linoline derivative, or ethoxylated glycerol fatty acid ester can be used. The cosmetic composition of the present invention may further contain excipients including fluorescent substances, fungicides, hydrotropes-inducing substances, moisturizers, fragrances, fragrance carriers, proteins, solubilizers, sugar derivatives, sunscreens, vitamins, plant extracts, etc. . The amount of the above ingredients can be selected depending on the formulation or purpose of use within a range that does not impair the inherent effect of the cosmetic composition. The amount of the ingredients added may be, for example, 0.1 to 10% by weight, preferably 0.1 to 6% by weight, based on the total weight of the composition, but is not limited thereto.

The present invention relates to Salvia miltiorrhiza extract enhanced with salvianolic acid B and a cosmetic composition containing the same for improving acne.

The extract exhibits an antibacterial effect against the causative agent of acne ( Propionibacterium acnes ) and increases AR (Androgen Receptor) and SREBP-1c (Sterol regulatory element-binding transcription factor 1) due to DHT (Dihydrotestosterone) in human sebocytes. ), it shows that it has superior acne improvement efficacy compared to panthenol and salicylic acid, which are conventional acne symptom improvement agents.

Figure 1 shows the results of confirming the cell viability of human primary sebocytes using samples prepared in the present invention.
Figure 2 shows the results of confirming the effect of suppressing the expression of hormone imbalance genes increased due to DHT (Dihydrotestosterone) using samples prepared in the present invention.
Figure 3 shows the results of confirming the effect of suppressing the expression of sebum regulatory genes increased due to DHT using samples prepared in the present invention.
Figure 4 shows the results of confirming the effect of inhibiting the growth of acne bacteria using samples prepared in the present invention.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to ensure that the content introduced here is thorough and complete, and to sufficiently convey the spirit of the present invention to those skilled in the art.

Example 1. Propanediol extract

Add 1000 g (Propanediol 10%, Glycerin 7%, 1,2 Hexanediol 1%, purified water 82% w/w) to 100 g of chopped dried Salvia Militias, perform reflux extraction at 60°C for 3 hours, and filter to obtain Salvia Miltiorrhiza polyol blended extract. 895 g was obtained.

Comparative Example 1: Purified water extract

1000 g of purified water was added to 100 g of dried Salvia Miltia ginseng, extracted under reflux at 90°C for 3 hours, and filtered to obtain 902 g of purified Salvia Salvia extract.

Comparative Example 2: 70% ethanol aqueous solution extract

1000 g of 70% (w/w) ethanol aqueous solution was added to 100 g of dried Salvia Salvia Salvia, extracted under reflux at 60°C for 3 hours, and then filtered to obtain 890 g of 70% ethanol aqueous solution extract of Salvia Salvia Salvia.

Comparative Example 3: Dipropylene glycol aqueous solution extract

Add 1000 g of dipropylene glycol aqueous solution (Dipropylene glycol 10%, Glycerin 7%, 1,2 Hexanediol 1%, purified water 82% w/w) to 100 g of shredded dried Salvia ginseng, extract under reflux at 60°C for 3 hours, and then filter. Thus, 895 g of Salvia Salvia dipropylene glycol aqueous solution extract was obtained.

Comparative Example 4: 1,3-butylene glycol aqueous solution extract

Add 1,000 g of 1,3-butylene glycol aqueous solution (10% of 1,3-Butylene Glycol, 7% of Glycerin, 1% of 1,2 Hexanediol, 82% of purified water) to 100 g of dried Salvia ginseng and heat at 60℃ 3. After time-heated reflux extraction, 895 g of Salvia Miltiorrhiza 1,3-butylene glycol aqueous solution extract was obtained by filtration.

Comparative Example 5: Pentanediol aqueous solution extract

Add 1000 g (10% of dried Salvia ginseng, 10% of 1,2-pentanediol, 7% of Glycerin, 1% of 1,2 Hexanediol, 82% of purified water) to 100 g of dried Salvia ginseng, extract under reflux at 60°C for 3 hours, and then filter. 895 g of Salvia Salvia pentanediol aqueous solution extract was obtained.

<Experimental Example 1. Comparison of Salvianolic acid B content of Salvian ginseng extract (1) >

To confirm the content of salvianolic acid B in each Salvia ginseng extract, HPLC analysis was performed using a Nexera This was performed under conditions in which a gradient of 90% acetonitrile from the initial 10% of the eluent water was flowed at a flow rate of 0.7 mL/min for 29 minutes. HPLC was performed under the conditions in Table 1.

column Capcell pak C18 UG 4.6 x 250 mm, 5 μm) Column temperature 40℃ flow rate 0.7mL Measuring instrument UV 270nm injection volume 10 μL mobile phase 10% Acetonitrile Gradient

Content of salvianolic acid B (% by weight) Example 1 1.4 Comparative Example 1 0.01 Comparative Example 2 0.2 Comparative Example 3 0.31 Comparative Example 4 0.36 Comparative Example 5 0.48

As shown in the results in Table 2 above, it was confirmed that the extract of Example 1 had the highest salvianolic acid B content.

<Experimental Example 2. Cell culture and confirmation of cytotoxicity of Salvia Salvia ginseng extract>

Human primary sebocytes were used in the experiment of the present invention to confirm cytotoxicity and expression of various acne-related factors. Cells were cultured in DMEM/F-12 (Dulbecco's) containing 10% Fetal Bovine Serum (FBS), 1% antibiotics, and 10 ng/mL human epidermal growth factor (hEGF). Modified Eagle Medium/Nutrient Mixture F-12) was used and cultured at 37°C and 5% CO ₂ conditions.

Next, in order to observe the cytotoxicity of each Salvia ginseng extract of Example 1 and Comparative Examples 1 to 5 on the human sebaceous gland cells, an MTT assay (3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide assay) was performed. For this purpose, DMEM/F-12 medium containing fetal bovine serum and human primary sebocytes were distributed at 5x10 ⁵ cells/well each in a 24-well plate, and after 24 hours of culture, each well was replaced with serum free medium. Each extract was treated at different concentrations and cultured for 24 hours. After incubation, the culture medium was removed, the MTT solution was diluted to 0.1 mg/mL in serum free medium, and 500 μL of this was dispensed into each well where the cells were cultured, followed by dark reaction for 4 hours. After the reaction was completed, the reaction solution was removed and 500 μL of DMSO was added to dissolve the resulting Fomazan, and the absorbance was measured at 570 nm.

As a result, it was confirmed that there was almost no cytotoxicity up to 4 (w/w)% of each extract. Additionally, subsequent experiments were conducted by setting the concentration to 3(w/w)%. The results are shown in Figure 1.

<Experimental Example 3. RNA extraction, cDNA synthesis, real-time PCR performance, AR and SREBP-1c gene expression confirmation (1) >

One of the causes of acne is hormonal imbalance, which is caused by androgen hormones, which are byproducts of DHT. Therefore, to evaluate hormonal imbalance, we processed DHT (Dihydrotestosterone) and conducted an experiment on the expression of the AR (Androgen Receptor) gene, which is a receptor that accepts DHT and is involved in the occurrence of acne due to hormonal imbalance, using human sebaceous gland cells (Human primary sebocyte, Celprogen). did. In addition, to evaluate sebum control due to hormonal imbalance, the expression of SREBP-1c (Sterol regulatory element-binding transcription factor 1) gene, which is involved in fatty acid biosynthesis and plays a major role in sebum production, was also checked.

For the experiment, DMEM/F-12 medium containing fetal bovine serum and human primary sebocyte (Celprogen) were distributed at 5x10 ⁵ cells/well in a 6-well plate and cultured for 24 hours in each well. was replaced with serum free medium and cultured for an additional 4 hours to prepare cells for experiment. In order to induce an environment that produces acne due to hormonal imbalance, human sebaceous gland cells were treated with 5α-Dihydrotestosterone (DHT) and each extract prepared in the present invention was added and cultured for 24 hours. Panthenol, known as a regenerative and moisturizing agent for sebaceous gland cells and a treatment for acne, was used as a positive control for the extract of the present invention. After the treatment time, the cells treated with each sample, positive control material, and acne-causing material were washed using PBS (Phosphate buffered saline), and the cultured cells were treated with QIAzol ^® (QIAGENL ®, USA) to proceed with cell lysis. RNA was isolated using the protocol provided by the manufacturer (QIAGENL ^® ). The isolated RNA was quantified using the Qubit® fluorometer with RNA BR Assay kit, then cDNA was synthesized and real-time PCR was performed. For cDNA synthesis, a cDNA synthesis kit (qPCRBIO cDNA Synthesis Kit, PCRBIOSYSTEMS, London, UK) was used, and the experiment was performed according to the kit's method. Real-time PCR amplified the gene using a Real-time PCR Kit (2x qPCRBIO SyGreen Blue mix Lo-ROX, PCRBIOSYSTEMS, London, UK) and then quantitatively analyzed the amplification product. Real-time PCR conditions were all 95°C for 5 seconds, 60°C for 30 seconds, and 40 cycles. Primers used in the experiment are shown in Table 3 below.

primer Sequence AR Forward ATGGTGAGCAGAGTGCCCTATC AR Reverse ATGGTCCCTGGCAGTTTCCAAAA SREBP-1c Forward ACTTCTGGAGGCATCGCAAGCA SREBP-1c Reverse AGGTTCCAGAGGAGGCTACAAG β-actin Forward CACCATTGGCAATGAGCGGTTC β-actin Reverse AGGTCTTTGCGGATGTCCACGT

The mRNA expression level of the AR gene is shown in Table 4 and Figure 2.

sample AR gene expression amount (%) error No treatment (Control) 55.15 4.20 DHT 350 μM 100.0 6.35 DHT 350 μM+ Comparative Example 1 3(w/w)% 105.24 4.70 DHT 350 μM+ Comparative Example 2 3(w/w)% 95.15 3.71 DHT 350 μM+ Comparative Example 3 3(w/w)% 95.23 2.34 DHT 350 μM+ Comparative Example 4 3(w/w)% 94.23 2.13 DHT 350 μM+ Comparative Example 5 3(w/w)% 91.23 1.52 DHT 350 μM+ Example 1 3(w/w)% 78.26 5.06 DHT 350 μM+ Salvianolic Acid B 400 μg/mL 67.35 7.52 DHT 350 μM + Panthenol 50 μM 74.99 3.14

Looking at the results in Table 4 and Figure 2, when human sebaceous gland cells were treated with DHT, the expression of AR, a gene related to hormonal imbalance, increased by 44.85%. As a result of treating the extracts of Comparative Examples 1 and 2, AR gene expression decreased. is not observed.

On the other hand, when treated with the extract of Example 1, it was confirmed that hormonal imbalance was alleviated by reducing AR gene expression by up to 21.74% compared to the DHT treatment group alone. Salvianolic acid B, used as an indicator, was also observed to have similar efficacy to the extract of Example 1, and through the present invention, the salvianolic acid B content was increased without purifying salvianolic acid B. It can be confirmed that the effect of alleviating hormonal imbalance can be easily induced.

Next, the level of SREBP-1c (Sterol regulatory element-binding transcription factor 1) gene expression is shown in Table 5 and Figure 3.

sample SREBP-1c gene expression level (%) error No treatment (Control) 79.24 1.71 DHT 350 μM 100.0 3.38 DHT 350 μM+ Comparative Example 1 3(w/w)% 97.52 7.78 DHT 350 μM+ Comparative Example 2 3(w/w)% 95.02 6.09 DHT 350 μM+ Comparative Example 3 3(w/w)% 88.54 2.45 DHT 350 μM+ Comparative Example 4 3(w/w)% 86.53 1.52 DHT 350 μM+ Comparative Example 5 3(w/w)% 81.03 3.32 DHT 350 μM+ Example 1 3(w/w)% 43.36 2.16 DHT 350 μM + Salvianolic Acid B 400 μg/mL 34.85 1.61 DHT 350 μM + Panthenol 50 μM 44.16 2.88

Through these results, the same trend as confirmed for AR expression was confirmed. By treating human sebaceous gland cells with DHT, the expression of the sebum production gene SREBP-1c was increased by 20.76%, but the extracts of Comparative Examples 1 and 2 were SREBP -Failed to induce a decrease in gene expression. Likewise, the extracts of Comparative Examples 3 to 5 only showed a weak decrease in SREBP-1c gene expression.

On the other hand, as a result of treatment with the extract of Example 1, SREBP-1c gene expression was reduced by 56.64% compared to the DHT treatment group alone, confirming the effect of alleviating sebum production. The salvianolic acid B treatment group also had a similar effect on SREBP-1c gene expression. Through this, it can be further confirmed that the extract of Example 1 has an overall effect of alleviating sebum production.

<Experimental Example 4. Cutibacterium acnes ( Cutibacterium acnes 3314) Growth inhibition test>

The antibacterial activity of the extract of the present invention against acne bacteria was confirmed.

The strain used to measure antibacterial activity was Cutibacterium acnes (3314) distributed from the Korea Microorganism Conservation Center. RCA (Reinforced clostridial agar) was used as the culture medium for C. acnes . After inoculating the bacteria into the medium, it was placed in an anaerobic jar and cultured anaerobically at 35°C for 48 hours. Specifically, the pure isolated strain on the plate medium was taken as a loop, suspended in 5ml of RCB liquid medium, and activated under certain conditions in a shaking incubator. Afterwards, it was manufactured to have an absorbance in the range of 0.08-0.10 at 600 nm using a spectrophotometer. The number of bacteria in the culture medium was adjusted to 1x10 ⁵ cfu/ml, and the mixture was dispensed into a Petri dish, placed on a paper disk, and the sample was dissolved at 500 mg/ml and then loaded at 50 ㎕ each. Afterwards, the plate was placed in an anaerobic jar that blocks oxygen and cultured under anaerobic conditions. As a negative control, 70% EtOH was prepared and used, and as a positive control, salicylic acid was diluted in sterilized purified water. As a result, the size (in mm) of the circular growth-restricting ring formed around the paper disk was measured. All tests were independently repeated three times and the average value was obtained. The results are shown in Table 6 and Figure 4.

Sample Diameter of clear zone(mm) Control 1 (untreated) N.D. Control 2 (Salycilic acid 300 ㎍/㎖) 1.78 ± 0.21 Comparative Example 1 N.D. Comparative example 2 N.D. Example 1 3.60 ± 0.14 Salvianolic acid B 3.62 ± 0.45

As can be seen from the results in Table 6 and Figure 3, the extracts of Comparative Examples 1 and 2 did not show antibacterial activity, but Example 1 showed high antibacterial activity. This demonstrates that the extraction solvent of Example 1 has a high extraction efficiency of various active ingredients such as Salvianolic Acid B in Salvia Miltiorrhiza ginseng, and it can be confirmed that these substances function to increase antibacterial activity against C. acnes .

<Examples 2 to 6, Comparative Examples 6 to 12. Establishment of solvent raw material mixing conditions>

Next, Salvia Miltiorrhiza extract was prepared by subdividing the content of each component of the solvent as follows.

menstruum Content ((w/w)%) propanediol glycerin 1,2 hexanediol Purified water total Example 2 7 13.5 0.5 82 100 Example 3 11 5 2 82 100 Example 4 14 3 One 82 100 Example 5 15 4 One 80 100 Example 6 8 10 2 80 100

menstruum Content ((w/w)%) propanediol glycerin 1,2 hexanediol Purified water total Comparative Example 6 20 16 One 63 100 Comparative Example 7 5 20 2 73 100 Comparative Example 8 10 0 One 89 100 Comparative Example 9 0 10 One 89 100 Comparative Example 10 5 2 5 88 100 Comparative Example 11 20 10 0 70 100 Comparative Example 12 100 0 0 0 100

<Experimental Example 5. Comparison of salvianolic acid B content of Salvia ginseng extract (2)>

Under the conditions of Experimental Example 1, the content of salvianolic acid B was compared for each new Salvian ginseng extract prepared in Table 8 and shown in Table 9 below.

extract Content of salvianolic acid B (% by weight) Example 2 0.8 Example 3 1.0 Example 4 1.2 Example 5 0.7 Example 6 0.9 Comparative Example 6 0.5 Comparative Example 7 0.3 Comparative Example 8 0.4 Comparative Example 9 0.4 Comparative Example 10 0.5 Comparative Example 11 0.4

<Experimental Example 6. Confirmation of AR and SREBP-1c gene expression (2)>

Under the conditions of Experimental Example 3, the expression levels of AR and SREBP-1c genes were confirmed for each new Salvia Militiorrhiza extract prepared in Table 8 and are shown in Table 10.

Gene expression level (%) extract AR SREBP-1c No treatment (Control) 56.35 77.32 DHT 350 μM 100.0 100.0 DHT 350 μM + Example 2 3(w/w)% 79.35 35.23 DHT 350 μM + Example 3 3(w/w)% 81.64 40.25 DHT 350 μM + Example 4 3(w/w)% 80.03 42.03 DHT 350 μM + Example 5 3(w/w)% 82.43 43.80 DHT 350 μM + Example 6 3(w/w)% 81.50 45.23 DHT 350 μM + Comparative Example 6 3(w/w)% 91.63 76.14 DHT 350 μM + Comparative Example 7 3(w/w)% 89.34 85.23 DHT 350 μM + Comparative Example 8 3(w/w)% 90.60 74.56 DHT 350 μM + Comparative Example 9 3(w/w)% 89.04 93.02 DHT 350 μM + Comparative Example 10 3(w/w)% 92.23 79.33 DHT 350 μM + Comparative Example 11 3(w/w)% 93.15 92.40

As a result, the extracts of Examples 2 to 6 of the present invention, like the extract of Example 1, reduce the expression of the AR gene by 15 to 25% at a concentration of 3 (w/w)%, and reduce the expression of SREBP-1c by 50 to 65%. % decreased. Accordingly, it can be seen that the extract of the present invention is also an effective extract for improving acne.

<Cosmetic composition formulation example 1. Preparation of skin>

1% by weight of extract of Example 1 of the present invention, 5.2% by weight of propylene glycol, 1.5% by weight of oleyl alcohol, 3.2% by weight of ethanol, 3.2% by weight of polysorbate 20, 2.0% by weight of benzophenone-9, carboxyl vinyl polymer The skin was prepared using a conventional method with the content of 1.0% by weight, 3.5% by weight of glycerin, a trace amount of fragrance, a trace amount of preservative, and the remaining amount of purified water.

<Cosmetic composition formulation example 2. Preparation of lotion>

0.01% by weight of extract of Example 1 of the present invention, 1.0% by weight of cetostearyl alcohol, 0.8% by weight of glyceryl monostearate, 0.3% by weight of sorbitan monostearate, 1.0% by weight of polysorbate 60, 5.0% by weight of mineral oil. %, cyclomethicone 3.0% by weight, dimethicone 0.5% by weight, allantoin 0.1% by weight, glycerin 5.0% by weight, alcohol 2% by weight, propylene glycol 3.0% by weight, a trace amount of flavor, a trace amount of preservative, and the remaining amount of purified water. A lotion was prepared using.

<Cosmetic composition formulation example 3. Preparation of essence>

1% by weight of extract of Example 1 of the present invention, 4.0% by weight of propylene glycol, 3.0% by weight of glycerin, 0.5% by weight of allantoin, 0.01% by weight of EDTA-2Na, 5.0% by weight of ethanol, 1.5% by weight of triethanolamine, 2.0% by weight of squalane Essence is prepared using a conventional method with the following contents: 2.5% by weight of beeswax, 60% by weight of polysorbate, 1.0% by weight of carboxylic vinyl polymer, 2.5% by weight of sorbitan sesquioleate, a trace amount of fragrance, a trace amount of preservative, and the remaining amount of purified water. did.

<Cosmetic composition formulation example 4. Preparation of cream>

1% by weight of extract of Example 1 of the present invention, 0.7% by weight of polyoxyethylene sorbitan monostearate, 0.5% by weight of sorbitan sesquioleate, 0.6% by weight of cetyl alcohol, 0.75% by weight of stearic acid, 0.6% by weight of glyceryl monostearate A cream was prepared using a conventional method with the following contents by weight: 15.0% by weight of liquid paraffin, 10.0% by weight of carboxyvinyl polymer, 0.2% by weight of triethanolamine, a trace amount of flavor, a trace amount of preservative, and the remaining amount of purified water.

Claims (10)

A cosmetic composition for improving acne containing Salvia miltiorrhiza extract enhanced with Salvianolic acid B,
The above Salvia Miltiorrhiza extract is obtained by extracting Salvia Miltiorrhiza ginseng in an extraction solvent 5 to 40 times the weight at 20 to 70°C for 10 minutes to 48 hours and filtering,
The extraction solvent of the Salvia Salvia Salvia extract includes 7 to 15% by weight of propanediol, 3 to 14% by weight of glycerin, 0.5 to 2% by weight of 1,2-hexanediol, and 70 to 85% by weight of purified water,
The content of salvianolic acid B in the extract is 0.7 to 1.5% by weight,
A cosmetic composition for improving acne, characterized in that gene expression of SREBP-1c (Sterol regulatory element-binding transcription factor 1) is reduced to 50-65% due to 3(w/w)% treatment of the extract. delete According to paragraph 1,
The extract is a cosmetic composition for improving acne, characterized in that it inhibits gene expression of AR (Androgen Receptor). delete According to paragraph 1,
The extract is a cosmetic composition for improving acne, characterized in that it has an antibacterial effect against Cutibacterium acnes 3314. A pharmaceutical composition for preventing or treating acne containing Salvia miltiorrhiza extract enhanced with Salvianolic acid B,
The above Salvia Miltiorrhiza extract is obtained by extracting Salvia Miltiorrhiza ginseng in an extraction solvent 5 to 40 times the weight at 20 to 70°C for 10 minutes to 48 hours and filtering,
The extraction solvent of the Salvia Salvia Salvia extract includes 7 to 15% by weight of propanediol, 3 to 14% by weight of glycerin, 0.5 to 2% by weight of 1,2-hexanediol, and 70 to 85% by weight of purified water,
The content of salvianolic acid B in the extract is 0.7 to 1.5% by weight,
A pharmaceutical composition for preventing or treating acne, characterized in that gene expression of SREBP-1c (Sterol regulatory element-binding transcription factor 1) is reduced to 50-65% by 3(w/w)% treatment of the extract. delete According to clause 6,
The extract is a pharmaceutical composition for preventing or treating acne, characterized in that it inhibits gene expression of AR (Androgen Receptor). delete According to clause 6,
The extract is a pharmaceutical composition for preventing or treating acne, characterized in that it has an antibacterial effect against Cutibacterium acnes 3314.