KR102623896B1 - Composition for reducing body weight, body fat, or blood sugar including neohesperidin dihydrochalcone glycotransferase - Google Patents

Abstract

It relates to a pharmaceutical and/or food composition for preventing, improving, and/or treating obesity, which contains neohesperidin dihydrochalcone glycotransferase as an active ingredient and has the effect of reducing body weight, body fat, and/or blood sugar.

Description

Composition for preventing, improving or treating obesity including neohesperidin dihydrochalcone glycotransferase {Composition for reducing body weight, body fat, or blood sugar including neohesperidin dihydrochalcone glycotransferase}

Neohesperidin dihydrochalcone glycoside, NHDC-O-glycoside (1-(4-((2-O-[6-Deoxy-α-L-mannopyranosyl]-(4-O-α-D-glucopyranosyl]-β Composition for preventing, improving and/or treating obesity containing -D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)-3-[3-hydroxy-4-methoxyphenyl]-1-propanone) (GNHDC) as an active ingredient It's about.

The World Health Organization (WHO) reported that obesity worldwide increased approximately threefold from 1975 to 2016. For this reason, the WHO proposed obesity as a global pandemic in the 21st century at the WHO Consultation on Obesity. Becoming obese is associated with metabolic disorders, including diabetes, cardiovascular disease, and cancer. There are several fat accumulation-related mechanisms, including adipogenesis or adipogenesis, and conversely, β-oxidation and brown fat accumulation are inhibitory mechanisms of fat accumulation.

Sugar consumption has increased rapidly since the mid-1960s, with consumption of sugar-sweetened beverages being one of the main reasons. WHO strongly recommends reducing sugar intake to less than 10% of total energy intake. Previous research has shown that increased sugar intake may increase the prevalence of obesity in children and adults. Alternative sweeteners have been proposed as a solution to reduce sugar consumption. Sweeteners are classified into bulk sweeteners and intense sweeteners, which are divided according to calorie content. Bulk sweeteners produce calories, while intense sweeteners produce no or minimal calories. Additionally, intense sweeteners have a higher relative sweetness than sucrose. Therefore, it is expected that obesity and type 2 diabetes can be prevented by using alternative sweeteners instead of sugar. Neohesperidin dihydrochalcone (NHDC) is one of the intense sweeteners. It is extracted and processed from neohesperidin, the parent flavanone.

Flavanone glycosides are mainly found in orange peels and the dihydrochalcone form is synthesized through hydrogenation. NHDC is a semi-natural compound from bitter orange and citrus aurantium and has high solubility and stability. The relative sweetness of NHDC is 250 to 2000 times higher than that of sucrose solution. Additionally, NHDC can be used to neutralize the bitter taste of other compounds. This functional alternative sweetener has been reported to have antioxidant properties.

Glycosides are compounds that have one or more sugars linked to a non-sugar molecule by a glycosidic bond. Depending on the binding site, there are four types: O-, C-, N-, and S-glycosides. Glycosides are known to exert anti-obesity or anti-diabetic effects. The effects of NHDC and its glycosides on adipose tissue and its mechanisms have not yet been confirmed. The anti-obesity effects of both NHDC and GNHDC and their molecular mechanisms were investigated in vivo and in vitro.

Against the above background, the present inventors conducted repeated studies on the anti-obesity effects of NHDC and GNHDC. As a result, the anti-obesity effect of NHDC and GNHDC was confirmed through confirmation of related markers, and the present invention was completed.

One example provides a pharmaceutical composition for preventing and/or treating obesity, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

Another example provides a pharmaceutical composition for reducing body weight, body fat, and/or blood sugar, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

Another example provides a food composition for preventing and/or improving obesity, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

Another example provides a food composition for reducing body weight, body fat, and/or blood sugar, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

This specification confirms the anti-obesity effect of neohesperidin dihydrochalcone glycotransferase (GNHDC) through identification of related markers, and determines the anti-obesity effect of neohesperidin dihydrochalcone glycotransferase (GNHDC) for obesity prevention, obesity treatment, weight loss, body fat reduction and/or Or it provides a use for reducing blood sugar levels.

Accordingly, one example includes neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and has the effect of reducing the level of one or more genes selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ, and C/EBPα or their coding genes. Provides a composition containing

Another example provides a composition that contains neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and has the effect of increasing the level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, and Prdm16 or their coding genes. .

Another example includes neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and reduces the level of one or more genes selected from the group consisting of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR or their coding genes. An effective composition is provided.

Another example provides a composition that contains neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and has the effect of increasing the level of p-AMPK/AMPK or its coding gene.

The composition may be a composition for preventing, improving and/or treating obesity containing neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient, but is not limited thereto.

The composition contains neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and may have the effect of reducing body weight, body fat, and/or blood sugar, but is not limited thereto.

The composition may be a composition for reducing body weight, body fat, and/or blood sugar containing neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient, but is not limited thereto.

The composition may be a pharmaceutical composition and/or a food composition (e.g., health functional food) containing neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient, but is not limited thereto.

Hereinafter, this application will be described in more detail.

Neohesperidin dihydrochalcone glycotransferase (GNHDC)

In this specification, “NHDC” refers to “neohesperidin dihydrochalcone” or “(1-(4-((2-O-[6-Deoxy-α-L-mannopyranosyl]-β-D-glucopyranosyl)oxy)-2 ,6-dihydroxyphenyl)-3-[3-hydroxy-4-methoxyphenyl]-1-propanone)”, and can be represented by the formula (1) below.

[Formula 1]

In this specification, “GNHDC” refers to “neohesperidin dihydrochalcone glycotransferase” or “(1-(4-((2-O-[6-Deoxy-α-L-mannopyranosyl]-(4-O-α-D -glucopyranosyl]-β-D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)-3-[3-hydroxy-4-methoxyphenyl]-1-propanone)”, and can be expressed in the following formula (2) .

[Formula 2]

The present specification provides a pharmaceutical and/or food composition for preventing obesity, improving obesity, treating obesity, reducing body weight, reducing body fat, and/or reducing blood sugar, containing GNHDC as an active ingredient.

The composition contains GNHDC at 0.001 to 100,000 μM, 0.01 to 100,000 μM, 0.1 to 100,000 μM, 1 to 100,000 μM, 5 to 100,000 μM, 10 to 100,000 μM, 15 to 100,000 μM, 20 to 1 00,000 μM, 25 to 100,000 μM, 30 to 100,000 μM, 35 to 100,000 μM, 40 to 100,000 μM, 45 to 100,000 μM, 0.001 to 50,000 μM, 0.01 to 50,000 μM, 0.1 to 50,000 μM, 1 to 50,000 μM, 5 to 50,000 μM 50,000 μM, 10 to 50,000 μM, 15 to 50,000 μM, 20 to 50,000 μM, 25 to 50,000 μM, 30 to 50,000 μM, 35 to 50,000 μM, 40 to 50,000 μM, 45 to 50,000 μM, 0.001 to 10,000 μM, 0.01 to 10 ,000μM, 0.1 to 10,000μM, 1 to 10,000 μM, 5 to 10,000 μM, 10 to 10,000 μM, 15 to 10,000 μM, 20 to 10,000 μM, 25 to 10,000 μM, 30 to 10,000 μM, 35 to 10,000 μM, 40 to 10,000 μM, 45 to 10,000 μM, 0.001 to 5,000 μM, 0.01 to 5,000 μM, 0.1 to 5,000 μM, 1 to 5,000 μM, 5 to 5,000 μM, 10 to 5,000 μM, 15 to 5,000 μM, 20 to 5,000 μM, 25 to 5,000 μM, 30 to 5,000 μM; 35 to 5,000 μM, 40 to 5,000 μM, 45 to 5,000 μM, 0.001 to 1,000 μM, 0.01 to 1,000 μM, 0.1 to 1,000 μM, 1 to 1,000 μM, 5 to 1,000 μM, 10 to 1,000 μM, 15 to 1,000 μM; 20 to 1,000 μM, 25 to 1,000 μM, 30 to 1,000 μM, 35 to 1,000 μM, 40 to 1,000 μM, 45 to 1,000 μM, 0.001 to 500 μM, 0.01 to 500 μM, 0.1 to 500 μM, 1 to 500 μM μM, 5 to 500 μM; 10 to 500 μM, 15 to 500 μM, 20 to 500 μM, 25 to 500 μM, 30 to 500 μM, 35 to 500 μM, 40 to 500 μM, 45 to 500 μM, 0.001 to 300 μM, 0.01 to 300 μM, 0.1 to 300 μM μM, 1 to 300 μM, 5 to 300 μM 300 μM, 10 to 300 μM, 15 to 300 μM, 20 to 300 μM, 25 to 300 μM, 30 to 300 μM, 35 to 300 μM, 40 to 300 μM, 45 to 300 μM, 0.001 to 100 μM, 0.01 to 100 μM, 0 .1 to 100 μM, 1 to 100 μM, 5 to 100 μM, 10 to 100 μM, 15 to 100 μM, 20 to 100 μM, 25 to 100 μM, 30 to 100 μM, 35 to 100 μM, 40 to 100 μM, 45 to 100 μM, 0.001 to 80 μM, 0.01 to 80 μM, 0.1 to 80 μM, 1 to 80 μM 80 μM, 5 to 80 μM, 10 to 80 μM, 15 to 80 μM, 20 to 80 μM, 25 to 80 μM, 30 to 80 μM, 35 to 80 μM, 40 to 80 μM, 45 to 80 μM, 0.001 to 60 μM, 0.01 to 60 μM, 0.1 to 60 μM, 1 to 60 μM, 5 to 60 μM, 10 to 60 μM, 15 to 60 μM, 20 to 60 μM, 25 to 60 μM, 30 to 60 μM, 35 to 60 μM, 40 to 60 μM, 45 to 60 μM, 0.001 to 55 μM, 0.01 to 55 μM, 0.1 to It may be included at a concentration of 55 μM, 1 to 55 μM, 5 to 55 μM, 10 to 55 μM, 15 to 55 μM, 20 to 55 μM, 25 to 55 μM, 30 to 55 μM, 35 to 55 μM, 40 to 55 μM, or 45 to 55 μM. It is not limited.

medicinal use

One example provides a pharmaceutical composition for preventing or treating obesity, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

Another example provides a pharmaceutical composition for preventing or treating obesity, which contains neohesperidin dihydrochalcone glycosyltransfer as an active ingredient and has an effect of reducing body weight, body fat, or blood sugar.

Another example provides a pharmaceutical composition for reducing body weight, body fat, or blood sugar, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

Another example is a drug that contains neohesperidin dihydrochalcone glycosyltransferase as an active ingredient and has the effect of reducing the level of one or more genes selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ and C/EBPα or their coding genes, preventing obesity or A pharmaceutical composition for therapeutic use is provided.

Another example is a pharmaceutical for preventing or treating obesity, which contains neohesperidin dihydrochalcone glycosyltransfer as an active ingredient and has the effect of increasing the level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, and Prdm16 or their encoding genes. A composition is provided.

Another example is a drug containing neohesperidin dihydrochalcone glycosyltransferase as an active ingredient and having the effect of reducing the level of one or more genes selected from the group consisting of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR or their coding genes. , and provides a pharmaceutical composition for preventing or treating obesity.

Another example provides a pharmaceutical composition for preventing or treating obesity, which contains neohesperidin dihydrochalcone glycosyltransfer as an active ingredient and has the effect of increasing the level of p-AMPK/AMPK and/or its encoding gene.

The decrease or increase in the level of the protein or its encoding gene can be judged by comparing it with the non-administered group of the pharmaceutical composition (before administration or other subjects of the same species who were not administered).

Quantification of the protein or its coding gene level can be performed by conventional quantitative methods such as quantitative real-time PCR, immunohistochemistry, Western blot, ELISA, and mRNA microarray, but is not limited thereto.

In one example, the pharmaceutical composition for preventing or treating obesity is selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ, C/EBPα, p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR. It may be administered to subjects whose levels of one or more genes or their encoding genes are higher than those of individuals not judged to be obese. In another example, the pharmaceutical composition for preventing or treating obesity has a level of at least one selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, Prdm16, and p-AMPK/AMPK or its encoding gene compared to an individual not judged to be obese. It may be intended for administration to low-level subjects. At this time, the individual not determined to be obese may mean an individual with a body mass index (BMI; weight divided by height squared; kg/m ² ) of about 25 kg/m ² or more, but is not limited thereto.

The neohesperidin dihydrochalcone glycosyltransferase is as described above.

The decrease in blood sugar means a decrease in the concentration of glucose in the blood.

In one example, obesity may mean a body mass index (BMI; weight divided by height squared; kg/m ² ) of about 25 kg/m ² or more, but is not limited thereto.

As used herein, “treatment” includes improvement, alleviation or stabilization of disease state or symptoms, partial or complete recovery, prolongation of survival, reduction of disease extent, delay or alleviation of disease progression, and other beneficial treatment results. It is used with meaning. “Prevention” is used to include all mechanisms and/or effects that act on subjects who do not have a specific disease to prevent the specific disease from developing, delay its onset, or reduce the frequency of its occurrence.

The content of neohesperidin dihydrochalcone glycotransferase used as an active ingredient in the pharmaceutical composition provided herein can be appropriately adjusted depending on the form and purpose of use, the condition of the subject, the type and severity of symptoms, etc., and the solid content (extract solid component with solvent removed) 0.001 to 99.9% by weight, 0.001 to 90% by weight, 0.001 to 75% by weight, 0.001 to 50% by weight, 0.01 to 99.9% by weight, 0.01 to 90% by weight, 0.01 to 75% by weight %, 0.01 to 50% by weight, 0.1 to 99.9% by weight, 0.1 to 90% by weight, 0.1 to 75% by weight, 0.1 to 50% by weight, 1 to 99.9% by weight, 1 to 90% by weight, 1 to 75% by weight, 1 to 50% by weight, 5 to 99.9% by weight, 5 to 90% by weight, 5 to 75% by weight, 5 to 50% by weight, 10 to 99.9% by weight, 10 to 90% by weight, 10 to 75% by weight, or 10 It may be from 50% by weight, but is not limited thereto.

In addition, the content of the neohesperidin dihydrochalcone glycosyltransfer is 0.001 to 400 mg/kg (body weight; BW), 1 to 400 mg/kg, and 50 to 400 mg/kg based on the body weight of the subject administering the pharmaceutical composition. kg, 100 to 400 mg/kg, 0.001 to 300 mg/kg, 1 to 300 mg/kg, 50 to 300 mg/kg, 100 to 300 mg/kg, 0.001 to 200 mg/kg, 1 to 200 mg/kg , 50 to 200 mg/kg, 100 to 200 mg/kg, 0.001 to 100 mg/kg, 1 to 100 mg/kg, or 50 to 100 mg/kg, but is not limited thereto.

The pharmaceutical composition or the active ingredient, neohesperidin dihydrochalcone glycotransferase, includes primates such as humans and monkeys, rodents such as mice, rats, and rabbits, as well as dogs, cats, cows, pigs, sheep, horses, and goats. It can be administered by various routes to vertebrates such as mammals, birds including chickens, ducks, and geese, reptiles including snakes, lizards, turtles, and crocodiles, amphibians, and fish.

The method of administration of the pharmaceutical composition may be any commonly used method, for example, oral administration, or parenteral administration such as intravenous, intramuscular, subcutaneous, or intraperitoneal injection. In one example, the pharmaceutical composition may be for oral administration, but is not limited thereto.

The pharmaceutical composition can be formulated and used in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., or parenteral dosage forms in the form of sterile injectable solutions, according to conventional methods. there is.

In addition to the active ingredients described above, the pharmaceutical composition generally consists of pharmaceutically and/or physiologically acceptable carriers, excipients, and diluents selected in consideration of administration method and standard pharmaceutical practice. It can be administered in combination with one or more selected adjuvants. For example, the pharmaceutically and/or physiologically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, It may contain one or more selected from the group consisting of cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. However, it is not limited thereto, and may be any carrier commonly used in the pharmaceutical field.

The pharmaceutically and/or physiologically acceptable diluents and/or excipients are from the group consisting of all fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, etc. commonly used in the appropriate formulation of pharmaceutical compositions. There may be one or more selected types.

For example, in the case of solid preparations for oral administration such as tablets, pills, powders, granules, or capsules, the excipient is at least one type of material for formulating such solid preparations, such as starch and calcium carbonate. It may be one or more types selected from the group consisting of , sucrose, lactose, gelatin, etc. In addition, lubricants such as magnesium styrate talc and the like may also be used. In addition, in the case of formulation of liquid preparations for oral administration such as suspensions, oral solutions, emulsions, syrups, etc., one or more types selected from the group consisting of water, liquid paraffin, etc., which are commonly used simple diluents, may be used. , various commonly used excipients, such as wetting agents, sweeteners, flavoring agents, and/or preservatives, may be included, but are not limited thereto.

For example, the pharmaceutical composition may be administered orally, in the form of tablets containing starch or lactose, in the form of capsules containing appropriate excipients, or in the form of elixirs or suspensions containing flavoring or coloring chemicals. It may be administered intraorally or sublingually. These liquid preparations may contain suspending agents (e.g. methylcellulose, semi-synthetic glycerides such as Witepsol or a mixture of Apricot kernel oil and PEG-6 esters or PEG-8 and caprylic/capric It may be formulated with pharmaceutically acceptable additives such as a mixture of glycerides, but is not limited thereto.

food composition

One example provides a food composition containing neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.

Another example includes neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and has the effect of reducing the level of one or more genes selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ, and C/EBPα or their coding genes, A food composition is provided.

Another example is a food composition containing neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and having the effect of increasing the level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, and Prdm16 or their coding genes. to provide.

Another example includes neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and has the effect of reducing the level of one gene selected from the group consisting of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR or its encoding gene. Provides a food composition containing .

Another example provides a food composition that includes neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient and has the effect of increasing the level of p-AMPK/AMPK or its encoding gene.

The decrease or increase in the level of the protein or its encoding gene can be judged by comparing it with the non-administered group of the food composition (before administration or other non-administered subjects of the same species).

Quantification of the protein or its coding gene level can be performed by conventional quantitative methods such as quantitative real-time PCR, immunohistochemistry, Western blot, ELISA, and mRNA microarray, but is not limited thereto.

In one example, the food composition contains at least one selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ, C/EBPα, p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR, or encoding thereof. It may be intended for administration to subjects whose gene levels are higher than those not judged to be obese. In another example, the food composition is for administering to a subject whose level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, Prdm16, and p-AMPK/AMPK or their encoding genes is lower than that of an individual not determined to be obese. You can do it. At this time, the individual not determined to be obese may mean an individual with a body mass index (BMI; weight divided by height squared; kg/m ² ) of about 25 kg/m ² or more, but is not limited thereto.

The food composition may be a food composition for preventing and/or improving obesity, or a food composition for reducing body weight, body fat, or blood sugar, but is not limited thereto.

In the food composition provided herein, the term "food" refers to an edible natural product or processed product containing one or more nutrients, and in its usual sense, various general foods, health functional foods, beverages, food additives, and beverages. It may be used to mean one or more selected from the group consisting of additives, etc. The term “food composition” may refer to a combination of ingredients for producing the food. In one example, the food may refer to a health functional food.

The content of the neohesperidin dihydrochalcone glycotransferase in the food composition can be appropriately adjusted depending on the type of food use, purpose, etc., for example, 0.00001 to 99.9% by weight, 0.0001 to 99.9% by weight, 0.001 to 99.9% by weight based on the weight of solid content. %, or 0.001 to 50% by weight, but is not limited thereto.

In addition, the content of the neohesperidin dihydrochalcone glycosyltransfer is 0.001 to 400 mg/kg (body weight; BW), 1 to 400 mg/kg, 50 to 400 mg/kg, based on the body weight of the subject administering the food composition. , 100 to 400 mg/kg, 0.001 to 300 mg/kg, 1 to 300 mg/kg, 50 to 300 mg/kg, 100 to 300 mg/kg, 0.001 to 200 mg/kg, 1 to 200 mg/kg, It may be 50 to 200 mg/kg, 100 to 200 mg/kg, 0.001 to 100 mg/kg, 1 to 100 mg/kg, or 50 to 100 mg/kg, but is not limited thereto.

The 'subjects' of administration of the food composition include humans, primates such as monkeys, rodents such as mice, rats, and rabbits, mammals including dogs, cats, cows, pigs, sheep, horses, and goats, chickens, ducks, etc. It may be an individual selected from vertebrates such as birds including geese, reptiles including snakes, lizards, turtles, and crocodiles, amphibians, and fish, and cells, tissues, or cell cultures isolated from the individuals.

NHDC-O-glycoside (1-(4-((2-O-[6-Deoxy-α-L-mannopyranosyl]-(4-O-α-D), a neohesperidin dihydrochalcone glycotransfer provided herein A composition containing -glucopyranosyl]-β-D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)-3-[3-hydroxy-4-methoxyphenyl]-1-propanone) (GNHDC) as an active ingredient is used to measure body weight and body fat. and/or has a blood sugar reduction effect, thereby preventing, treating, and/or improving obesity.

Figure 1 shows neohesperidin dihydrochalcone (1-(4-((2-O-[6-Deoxy-α-L-mannopyranosyl]-β-D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)-3- [3-hydroxy-4-methoxyphenyl]-1-propanone) (NHDC) and NHDC-O-glycoside (1-(4-((2-O-[6-Deoxy-α- L-mannopyranosyl]-(4-O-α-D-glucopyranosyl]-β-D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)-3-[3-hydroxy-4-methoxyphenyl]-1-propanone) ( This is a chemical formula showing the structure of GNHDC).
Figure 2 is a graph showing the effect of NHDC and GNHDC on fasting blood sugar in mice. Ctrl refers to the control group fed with phosphate-buffered saline (PBS) rather than NHDC and GNHDC.
Figure 3 is a photograph and graph showing the effect of NHDC and GNHDC on mouse subcutaneous adipocytes.
Figure 4 is a graph showing the results of quantitative real-time PCR analysis of the effects of NHDC and GNHDC on genes related to fatty acid absorption, lipogenesis, adipogenesis, β-oxidation, and brown fat in mouse subcutaneous adipose tissue.
Figure 5 is a photograph and graph showing the results of oil red O staining analysis of the effect of GNHDC on triglyceride accumulation in 3T3-L1 cells.
Figure 6 is a graph showing the results of analyzing the effect of GNHDC on cell viability in 3T3-L1 cells using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) analysis.
Figures 7 and 8 are graphs showing the results of quantitative real-time PCR analysis of the effects of GNHDC on lipogenesis and adipogenesis.
Figures 9 to 11 are graphs showing the results of Western blot analysis of the effect of GNHDC on the PI3K/AKT/mTOR pathway.

Hereinafter, the present invention will be described in detail by examples. However, the following examples only illustrate the present invention, and the present invention is not limited by the following examples.

Example 1. Preparation of experimental materials and experimental animals

Example 1-1. Preparation of experimental materials

U.S. Neohesperidin dihydrochalcone ((1-(4-((2-O-[6-Deoxy-α-L-mannopyranosyl]-β-D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)- from the Horticultural Research Laboratory. 3-[3-hydroxy-4-methoxyphenyl]-1-propanone), NHDC) and NHDC-O-glycoside (1-(4-((2-O-[6-Deoxy- α-L-mannopyranosyl]-(4-O-α-D-glucopyranosyl]-β-D-glucopyranosyl)oxy)-2,6-dihydroxyphenyl)-3-[3-hydroxy-4-methoxyphenyl]-1-propanone ) (GNHDC) was provided, and the structures of NHDC and GNHDC are shown in Figure 1. For in vitro studies, NHDC was dissolved in 0.2% dimethyl sulfoxide (DMSO) (Sigma-Aldrich, St. Louis, MO, USA). The GNHDC was diluted with 0.1% ethanol (Merck, Darmstadt, Germany) to a concentration of 30, 50, or 100 μM, and separately, the NHDC and GNHDC were dissolved in phosphate-buffered saline (PBS) for in vivo studies.

Example 1-2. Laboratory animal preparation

Central Lab Animal Inc. 5-week-old male C57BLKS/J db/db mice were purchased from (Seoul, Korea), and the mice were individually placed in a light place for 12 hours and a dark place for 12 hours at a temperature of 20 to 22°C and humidity of 45 to 55%. It was prepared according to two cycles. After a 2-week adaptation period under the above conditions, the mice were randomly divided into the following three groups (nine mice per group) based on body weight and fasting blood sugar level: Mice administered orally with PBS (control group) ; Mice (NHDC) to which the NHDC prepared for in vivo research in Example 1-1 was orally administered in an amount of 100 mg per 1 kg of mouse body weight (b.w.); and mice (GNHDC) to which GNHDC prepared for in vivo research in Example 1-1 was orally administered in an amount of 100 mg per 1 kg of mouse body weight. All reagents inoculated into the mice were provided by oral gavage 5 days a week for 4 weeks. The mice were fed according to a modified American Institute of Nutrition (AIN)-93G diet (Raonbio, Yongin, Korea) and allowed to freely consume water. Body weight, food intake, and water intake were recorded twice a week during the experiment. Fasting blood glucose levels were measured using Accu-Check (Roche, Mannheim, Germany) from the tail vein. After sacrificing the mouse, whole blood was centrifuged at 13,000 rpm and 4°C for 15 minutes. Subcutaneous adipose tissue was rinsed with PBS and frozen in liquid nitrogen. All samples were stored at -80°C until further analysis. Research procedures and experiments were approved by the Animal Care Committee of Ewha Womans University Animal Hospital (IACUC approval number: 19-052).

Example 2. Various mouse analysis methods

Example 2-1. oral glucose tolerance test

In Example 1-2, mice in each of the three mouse groups each orally administered with PBS, NHDC, and GNHDC after a 2-week adaptation period were fasted overnight, and 1 g of glucose solution per 1 kg of mouse body weight was orally administered. An oral glucose tolerance test (OGTT) was performed. Fasting blood glucose levels were monitored at 0, 30, 60, 90, and 120 minutes using Accu-Check (Roche) in the tail vein, and the area under the curve (AUC) of OGTT was calculated from the OGTT curve. .

Example 2-2. Analysis of biochemical levels in mice

To measure total cholesterol level, subcutaneous adipose tissue rinsed with PBS in Example 1-2 was used and measured using a commercially available kit (Asan Pharmaceutical, Seoul, Korea).

In Example 1-2, adiponectin levels in mice were measured using an enzyme-linked immunosorbent assay (ELISA) kit (Crystal Chem, Elk Grove Village, IL, USA) using subcutaneous adipose tissue rinsed with PBS. Non-esterified fatty acid (NEFA) levels were measured using an enzymatic colorimetric method assay (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), and insulin levels were also measured using an ELISA kit (FUJIFILM Measured using Wako Pure Chemical Corporation).

Example 2-3. Histological analysis in mice

The subcutaneous adipose tissue rinsed with PBS in Example 1-2 was fixed with 10% formaldehyde and embedded in paraffin, then deparaffinized with xylene, rehydrated, and then treated with hematoxylin and eosin (H&E). Staining was performed. After observing and photographing the stained sections under a microscope (Nikon, Tokyo, Japan), the adipocyte area of subcutaneous adipose tissue was quantified using ImageJ (National Institutes of Health, Bethesda, Maryland, USA).

Example 2-4. Quantitative real-time PCR

Samples were extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA), RNA concentration and quality were checked with Nanodrop (Thermo Scientific, Waltham, MA, USA), and cDNA was purified using RevertAid reverse transcriptase (Thermo Scientific). It was prepared by using it at ℃ for 1 hour and at 72℃ for 3 minutes. Quantitative real-time PCR was performed using Rotor-Gene® Q (Qiagen, Hilden, Germany) and 2X SYBR Green PCR master mix (Qiagen) according to the manufacturer's protocol. Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was used as a control for both in vivo and in vitro studies. Acsl1 (acyl-CoA synthetase long-chain family member 1), Cd36, C/EBPα (CCAAT/enhancer binding protein, alpha), Cpt1α (carnitine palmitoyltransferase 1a), Fas (fatty acid synthase), Lpl ( lipoprotein lipase), Pgc1α (peroxisome proliferative activated receptor, gamma, coactivator 1 alpha), PPARγ (peroxisome proliferator activated receptor gamma), Prdm16 (PR domain containing 16), Srebp1c (sterol regulatory element binding transcription factor 1), Ucp1 (uncoupling protein) 1) and Gapdh (glyceraldehyde-3-phosphate dehydrogenase) primer sequences are shown in Table 1.

gene name Gene ID (NCBI) Base sequence (5’ → 3’) sequence number Acsl1 Forward 14081 tgccagagctgattgacattc One Acsl1 Reverse ggcataccagaaggtggtgag 2 Cd36 Forward 12491 gtgctctcccttgattctgc 3 Cd36 Reverse tgagaatgcctccaaacaca 4 C/EBPα (C/EBPalpha) Forward 12606 ccaagaagtcggtggacaaga 5 C/EBPα (C/EBPalpha) Reverse cggtcattgtcactggtcaact 6 Cpt1α (Cpt1alpha) Forward 12894 aacccagtgccttaacgatg 7 Cpt1α (Cpt1alpha) Reverse gaactggtggccaatgagat 8 Fas Forward 14104 tgtgagtggttcagaggcat 9 Fas Reverse ttctgtagtgccagcaagct 10 Lpl Forward 16956 gagtttgaccgccttccg 11 Lpl Reverse tcccgttaccgtccatcc 12 Pgc1α (Pgc1alpha) Forward 19017 tcgagctgtacttttgtgga 13 Pgc1α (Pgc1alpha) Reverse tcatacttgctcttggtgga 14 PPARγ (PPARgamma) Forward 19016 gagcacttcacaagaaattacc 15 PPARγ (PPARgamma) Reverse gaactccataagtggaagcct 16 Prdm16 Forward 70673 agatgaaccaggcatccact 17 Prdm16 Reverse tctacgtcctctggctttgc 18 Srebp1c Forward 20787 tagagcatatcccccaggtg 19 Srebp1c Reverse ggtacgggccacaagaagta 20 Ucp1 Forward 22227 ccaagccaggatggtgaac 21 Ucp1 Reverse ccagcgggaaggtgatgata 22 Gapdh Forward 14433 aactttggcattgtggaagg 23 Gapdh Reverse tgtgagggagatgctcagtg 24

Example 2-5. cell culture

3T3-L1, a murine pre-adipocyte cell line, was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and incubated with 10% bovine calf serum (Gibco, Grand Island, NY, USA) and 1% penicillin/streptomycin. /streptomycin (P/S)) (Invitrogen) was stored in Dulbecco's modified Eagle's medium (DMEM) (Welgene, Gyeongsan, Korea) at 37°C and 5% CO ₂ environment. The cells were grown in DMEM, 10% fetal bovine serum (FBS) (Gibco), 1% P/S, 500 μM isobutylmethylxanthine (Sigma-Aldrich), 1 μM dexamethasone (Sigma-Aldrich), and 10 μg/ml insulin (Welgene) for 2 days. Differentiated into adipocytes. After differentiation, the adipocytes were cultured in 10% FBS, 1% P/S, and 1 μg/ml insulin for 6 days. The cells were treated with NHDC or GNHDC prepared for the in vitro study in Example 1-1 at a concentration of 30, 50, or 100 μM for 8 days.

Example 2-6. Oil red O staining

Triglyceride accumulation was measured by oil red O staining (Sigma-Aldrich). Specifically, the adipocytes differentiated in Examples 2-5 were rinsed with PBS and fixed with 10% formaldehyde. After washing with 60% isopropyl alcohol, the fixed adipocytes were stained with oil red O staining solution. The oil red O staining solution was washed off with distilled water and the slide was dried. Drops of the stained adipocytes were photographed by Eclipse TS100 (Nikon) before the staining solution was dissolved in 100% isopropyl alcohol, and for quantification, at 500 nm with a microplate reader (Molecular Device, Sunnyvale, CA, USA). Absorbance was recorded.

Example 2-7. Cell viability assay

Cell viability was measured by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) (Sigma-Aldrich) assay. Specifically, 3T3-L1 cells were seeded in a 96-well plate and treated with NHDC or GNHDC prepared for the in vitro study in Example 1-1 at a concentration of 50 μM for 8 days. The culture medium was removed from the NHDC or GNHDC-treated cells, and the cells were treated with a culture medium containing 500 μg/ml MTT solution at 37°C and 5% CO ₂ for 3 hours. Afterwards, the absorbance was recorded using a microplate reader (Molecular Device) at 560 nm.

Example 2-8. western blot

The protein concentration of differentiated adipocytes was measured by Bradford protein analysis using the Bio-Rad Protein Assay Kit (Bio-Rad, Hercules, CA, USA), and the protein samples were analyzed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). ) were denatured and separated by electrophoresis. Afterwards, the protein samples were transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA) and incubated with 5% bovine serum albumin or 5% bovine serum albumin in Tris-buffered saline containing Tween 20 (TBS-T). Blocked with skim milk. The membrane was incubated overnight at 4°C with the following primary antibodies against the proteins: phosphoinositide 3 kinase (PI3K), phospho-phosphoinositide 3 kinase (p-PI3K), protein kinase B (AKT), and phospho-protein kinase B. (p-AKT), mammalian target of rapamycin (mTOR), phospho-mammalian target of rapamycin (p-mTOR), AMP-activated protein kinase (AMPK) and phospho-AMP-activated protein kinase (p-AMPK) (above antibodies all from Cell Signaling Technology, Danvers, MA, USA) and β-actin (Abcam, Cambridge, UK). The membrane was washed with TBS-T and incubated with secondary antibody for 1 hour. The detected protein band was detected using enhanced chemiluminescence (ECL) reagent (Animal Genetics Inc., Suwon, Korea).

Example 2-9. Statistical analysis

The analysis results of Examples 2-1 to 2-8 were expressed as mean ± standard error of the mean (standard error, SEM), and one-way analysis of variance (one-way analysis of variance) was performed using Newman-Keuls's post hoc test or unpaired Student's t-test. way ANOVA). The experiments were performed at least three times. A P value of less than 0.05 was considered a significant result. GraphPad Prism (GraphPad Software Inc., San Diego, CA, USA) software was used to evaluate the significance of data.

Example 3. Results of analysis of the effects of NHDC and GNHDC on mice

Example 3-1. Effects of NHDC and GNHDC on body weight, tissue weight, lipid profile and cytokines in mice

In Example 1-2, each mouse in the three groups of mice received PBS, NHDC, or GNHDC by oral gavage 5 days a week for 4 weeks, and the subcutaneous tissue of the mice prepared in substantially the same manner as in Example 1-2. The measurement targets shown in Table 2 below were measured for fat tissue, and the average values of the results obtained for each group are shown in Table 2 below.

Measurement target control group NHDC GNHDC Final weight (g) 37.75 ± 1.02 ^a 35.23 ± 0.64 ^a 35.32 ± 1.26 ^a Weight gain (g) 9.80 ± 0.67 ^a 8.01 ± 0.69 ^a 6.95 ± 0.79 ^b Daily intake (g/day) 6.25 ± 0.20 ^a 5.90 ± 0.20 ^a 6.00 ± 0.27 ^a Daily water intake (ml/day) 18.31 ± 1.47 ^a 14.68 ± 1.65 ^a 14.92 ± 1.68 ^a Subcutaneous adipose tissue (g) 2.46 ± 0.47 ^a 1.27 ± 0.16 ^b 1.49 ± 0.19 ^b Total adipose tissue (g) 5.66 ± 0.49 ^a 4.42 ± 0.20 ^b 4.57 ± 0.24 ^b Total cholesterol (mg/dl) 159.39 ± 3.60 ^a 158.81 ± 2.57 ^a 146.17 ± 4.03 ^b NEFA (mEq/l) 0.73 ± 0.04 ^a 0.63 ± ^0.02a 0.61 ± 0.04 ^b Adiponectin (ng/dl) 0.54 ± ^0.02ab 0.50 ± ^0.02a 0.62 ± 0.04 ^b Insulin (ng/dl) 1.77 ± 0.28 ^a 2.95 ± 0.36 ^b 1.42 ± 0.24 ^a

Specifically, the final body weight of each group provided with the reagent for 4 weeks was measured, and the increase in final body weight compared to the initial (week 0) body weight (final body weight - initial body weight) was used to determine the weight gain for each group, daily intake, 1 The daily water intake was measured, the weight of the subcutaneous adipose tissue of the mouse was measured, and the weight of the total adipose tissue including kidney fat, visceral fat, epididymal fat, and subcutaneous fat was measured.

Total cholesterol levels were measured for each group using the weight commercially available kit in substantially the same manner as in Example 2-2, and NEFA, adiponectin, and insulin levels were measured using the kit in substantially the same manner as in Example 2-2. was measured for each group, and the subcutaneous fat tissue level was quantified and measured for each group in substantially the same manner as in Example 2-3. The measured values were expressed as analysis results and subjected to statistical analysis in substantially the same manner as in Example 2-9.

Final body weight tended to decrease in both the NHDC-fed group (NHDC group) and the GNHDC-fed group (GNHDC group). The body weight gain of the GNHDC group was significantly reduced by 29.1% (P<0.05) compared to the group fed PBS (control group).

Total cholesterol was significantly reduced by 8.3% (P<0.05) in the GNHDC group compared to the control group. NEFA was significantly decreased by 16.3% (P<0.05) in the GNHDC group compared to the control group. Additionally, adiponectin tended to increase in the GNHDC group, and insulin significantly increased in the NHDC group (P<0.01) and slightly decreased in the GNHDC group compared to the control group. Insulin is a representative anabolic hormone that induces fat accumulation, so reducing insulin levels can help with anti-obesity effects. The anti-obesity effect was confirmed through the results of weight loss, fat weight loss, NEFA decrease, adiponectin increase, and insulin decrease.

Example 3-2. Effects of NHDC and GNHDC on fasting blood glucose levels and OGTT in mice

To evaluate the effect of NHDC and GNHDC on hyperglycemia in mice, fasting blood glucose levels were monitored in substantially the same manner as Example 2-1, and the results are shown in Figure 2. After a 2-week adaptation period, fasting blood sugar levels were significantly reduced by 35.5% (P<0.01) in the GNHDC-fed group compared to the PBS-fed group (control group).

Example 3-3. Effects of NHDC and GNHDC on mouse subcutaneous adipocyte area

H&E staining was performed on the subcutaneous adipose tissue rinsed with PBS in Example 1-2 in substantially the same manner as in Example 2-3, and the area was measured through quantification of the adipocyte area to determine histological changes in the adipose tissue. was observed to evaluate the effect on the adipose tissue of the mouse groups fed with NHDC and GNHDC, and the results are shown in Figure 3. As a result of quantifying the size of the fat cell area, it decreased by 39.2% (P<0.01) in the GNHDC-fed group compared to the PBS-fed control group.

Example 3-4. Gene expression analysis for lipid metabolism in mouse subcutaneous adipose tissue due to NHDC and GNHDC

In order to evaluate the effects of NHDC and GNHDC on genes related to fatty acid absorption, lipogenesis, adipogenesis, β-oxidation, and brown fat in mouse subcutaneous adipose tissue, the subcutaneous adipose tissue of Example 1-2 was used as a sample, and Example 2- Quantitative real-time PCR was performed in substantially the same manner as in 4, and the results are shown in Figure 4.

The mRNA expression levels of Cd36 and Lpl in response to fatty acid absorption were analyzed, and the mRNA expression of Cd36 and Lpl was downregulated by 34.6% and 46.8%, respectively, in the GNHDC-fed group (GNHDC group) compared to the PBS-fed control group (all P <0.05). Srebp1c and Fas were analyzed for adipogenesis-related genes, and the expression of Srebp1c and Fas decreased by 41.0% and 49.7%, respectively, in the GNHDC group compared to the control group (P<0.05).

The mRNA expression levels of β-oxidation-related Acsl1 and Cpt1α genes were analyzed. The expression of Acsl1 was upregulated approximately 1.8-fold in the GNHDC group compared to the control group (P<0.05). The expression of Cpt1α was upregulated approximately 1.5-fold in the GNHDC group (P<0.05).

The mRNA expression of Ucp1, Pgc1α, and Prdm16 genes related to brown localization was analyzed. The expression of Ucp1 was upregulated in the GNHDC group (P<0.01) compared to the control group. The expression of Pgc1α was upregulated approximately 1.6-fold in the GNHDC group (P<0.01). The expression of Prdm16 was upregulated approximately 2.4-fold in the GNHDC group (P<0.01).

Example 3-5. Determination of the effects of GNHDC on lipid accumulation and cell viability of 3T3-L1 cells

To evaluate the effect of GNHDC on triglyceride accumulation, oil red O staining was performed in substantially the same manner as in Example 2-6 using the GHDC-treated adipocytes prepared for the in vitro study prepared in Example 2-5. This was performed, and the results are shown in Figure 5. As a control group, adipocytes not treated with GNHDC were prepared. The amount of stained adipocyte droplets in the GNHDC-treated group was reduced compared to the control group. Compared to the control group, it decreased by 16.0% (P<0.05) in the group treated with GNHDC at a concentration of 50μM and by 20.0% (P<0.01) in the group treated with GNHDC at a concentration of 100μM.

To evaluate cell viability, MTT analysis was performed on the cytotoxicity of 50 μM GNHDC in substantially the same manner as Example 2-7, and the results are shown in Figure 6. There was no significant difference in cell viability between the two sweetener treatments. Therefore, additional in vitro experiments were performed using 50 μM GNHDC.

Example 3-6. Analysis of the effects of GNHDC on lipogenesis and adipogenesis in 3T3-L1 cells

In order to evaluate the effect of GNHDC on lipogenesis and adipogenesis, the above experiments were performed using adipocytes treated for 8 days with 50 μM concentration of GNHDC prepared in Example 2-5 for in vitro study in Example 1-1 as a sample. Quantitative real-time PCR was performed in substantially the same manner as Example 2-4, and the results are shown in Figures 7 and 8. As a control group, adipocytes not treated with GNHDC were prepared. The mRNA expression of Srebp1c and Fas for lipogenesis (Figure 7) and PPARγ and C/EBPα for adipogenesis (Figure 8) were analyzed. The expression of Srebp1c was decreased by 48.5% (P<0.01) in the GNHDC-treated group (GNHDC group) compared to the control group. Fas expression was decreased by 51.8% (P<0.01) in the GNHDC group compared to the control group. The mRNA expression of PPARγ decreased by 27.9% (P<0.01) in the GNHDC group compared to the control group. The mRNA expression of C/EBPα decreased by 44.2% (P<0.01) in the GNHDC group compared to the control group.

Example 3-7. Analysis of effects on PI3K/AKT/mTOR pathway and AMPK in 3T3-L1 cells of GNHDC

Protein concentration of adipocytes treated for 8 days with GNHDC prepared for in vitro study in Example 1-1 at a concentration of 50 μM prepared in Example 2-5 to evaluate the effect of GNHDC on the PI3K/AKT/mTOR pathway was measured by Western blotting in substantially the same manner as Example 2-8, and the results are shown in Figures 9 to 11. As a control group, adipocytes not treated with GNHDC were prepared. Activation of the PI3K/AKT/mTOR pathway increases cell proliferation and lipid synthesis through lipogenesis and adipogenesis. The expression of p-PI3K/PI3K was decreased by 19.3% (P<0.01) in the GNHDC-treated group (GNHDC group) compared to the control group (FIG. 10). The expression of p-AKT/AKT was decreased by 46.1% (P<0.01) in the GNHDC group compared to the control group (FIG. 10). p-mTOR/mTOR expression was decreased by 12.7% (P<0.01) in the GNHDC group compared to the control group (Figure 11). AMPK inhibits the above signaling pathway and inhibits mTOR expression. The expression of p-AMPK/AMPK increased 2.5-fold (P<0.01) in the GNHDC group compared to the control group.

<110> Ewha University - Industry Collaboration Foundation Seoul National University R&DB Foundation <120> Composition for reducing body weight, body fat, or blood sugar including neohesperidin dihydrochalcone glycotransferase <130> DPP20210288KR <160> 24 <170> koPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Acsl1 Forward <400> 1 tgccagagct gattgacatt c 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Acsl1 Reverse <400> 2 ggcataccag aaggtggtga g 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cd36 Forward <400> 3 gtgctctccc ttgattctgc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cd36 Reverse <400> 4 tgagaatgcc tccaaacaca 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C/EBPalpha Forward <400> 5 ccaagaagtc ggtggacaag a 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> C/EBPalpha Reverse <400> 6 cggtcattgt cactggtcaa ct 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cpt1alpha Forward <400> 7 aacccagtgc cttaacgatg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cpt1alpha Reverse <400> 8 gaactggtgg ccaatgagat 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fas Forward <400> 9 tgtgagtggt tcagaggcat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fas Reverse <400> 10 ttctgtagtg ccagcaagct 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Lpl Forward <400> 11 gagtttgacc gccttccg 18 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Lpl Reverse <400> 12 tcccgttacc gtccatcc 18 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pgc1alpha Forward <400> 13 tcgagctgta cttttgtgga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pgc1alpha Reverse <400> 14 tcatacttgc tcttggtgga 20 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma Forward <400> 15 gagcacttca caagaaatta cc 22 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma Reverse <400> 16 gaactccata gtggaagcct 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Prdm16 Forward <400> 17 agatgaacca ggcatccact 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Prdm16 Reverse <400> 18 tctacgtcct ctggctttgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Srebp1c Forward <400> 19 tagagcatat cccccaggtg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Srebp1c Reverse <400> 20 ggtacgggcc acaagaagta 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Ucp1 Forward <400> 21 ccaagccagg atggtgaac 19 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ucp1 Reverse <400> 22 ccagcgggaa ggtgatgata 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gapdh Forward <400> 23 aactttggca ttgtggaagg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gapdh Reverse <400> 24 tgtgaggggag atgctcagtg 20

Claims (17)

A pharmaceutical composition for preventing or treating obesity, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient. The pharmaceutical composition according to claim 1, which has the effect of reducing body weight, body fat, or blood sugar. The pharmaceutical composition according to claim 1, which has the effect of reducing the level of one or more genes selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ, and C/EBPα or their coding genes. The pharmaceutical composition according to claim 1, which has the effect of increasing the level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, and Prdm16 or their encoding genes. The pharmaceutical composition according to claim 1, which has the effect of reducing the level of one or more genes selected from the group consisting of p-PI3K/PI3K, p-AKT/AKT, and p-mTOR/mTOR or their coding genes. The pharmaceutical composition according to claim 1, which has the effect of increasing the level of p-AMPK/AMPK or its encoding gene. A food composition for preventing or improving obesity, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient. The food composition according to claim 7, which has the effect of reducing the level of one or more genes selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ and C/EBPα or their coding genes. The food composition according to claim 7, which has the effect of increasing the level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, and Prdm16 or their encoding genes. The food composition according to claim 7, which has the effect of reducing the level of one or more genes selected from the group consisting of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR or their coding genes. The food composition according to claim 7, which has the effect of increasing the level of p-AMPK/AMPK or its encoding gene. A food composition for reducing body weight, body fat, or blood sugar, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient. The food composition according to claim 12, which has the effect of reducing the level of one or more genes selected from the group consisting of Cd36, Lpl, Srebp1c, Fas, PPARγ and C/EBPα or their coding genes. The food composition according to claim 12, which has the effect of increasing the level of one or more genes selected from the group consisting of Acsl1, Cpt1α, Ucp1, Pgc1α, and Prdm16 or their encoding genes. The food composition according to claim 12, which has the effect of reducing the level of one or more genes selected from the group consisting of p-PI3K/PI3K, p-AKT/AKT and p-mTOR/mTOR or their coding genes. The food composition according to claim 12, which has the effect of increasing the level of p-AMPK/AMPK or its encoding gene. A pharmaceutical composition for reducing body weight, body fat, or blood sugar, comprising neohesperidin dihydrochalcone glycotransferase (GNHDC) as an active ingredient.