KR102610157B1 - Pharmaceutical Composition Comprising Marmelo Extract for Preventing or Treating Obesity - Google Patents

Abstract

A therapeutic and/or food composition that contains marmelo extract as an active ingredient and can be used to prevent, improve, and/or treat related diseases such as reducing body weight and/or body fat, lowering blood sugar, lowering blood cholesterol, and It relates to its manufacturing method.

Description

Pharmaceutical composition for preventing or treating obesity comprising quince extract {Pharmaceutical Composition Comprising Marmelo Extract for Preventing or Treating Obesity}

A composition for reducing body weight and/or body fat, a composition for lowering blood sugar, a composition for lowering blood cholesterol, and/or for preventing, improving, and/or treating obesity and/or metabolic disease, comprising marmelo extract as an active ingredient. It relates to composition.

The number of obese people is rapidly increasing due to frequent consumption of instant food and a meat-centered diet, which causes excessive energy accumulation in the body and reduced energy consumption due to lack of exercise.

In this way, excessive energy accumulated in the body appears not only in obesity but also in various forms of disease, the representative examples of which are metabolic diseases, including diseases such as obesity, diabetes, hyperlipidemia, and metabolic syndrome.

Chlorogenic acid is one of the most commonly consumed phenolic compounds in the human diet. Various studies have been conducted on the physiological activities of chlorogenic acid, and these research results have shown that chlorogenic acid has antioxidant, anti-inflammatory, anti-diabetic, and anti-obesity properties. Various physiological activities have been confirmed.

Anti-obesity drugs and treatments for metabolic diseases that have been developed so far cause side effects by acting on the sympathetic nerves or hormones, but there is a problem in that the effects are minimal in the case of herbal medicine ingredients with few side effects.

Accordingly, there is a need for the development of drugs with low side effects and excellent effectiveness.

Republic of Korea Patent Publication No. 10-2015-0057119 (May 28, 2015)

Against the above background, the present inventors continued research on the anti-obesity effect of chlorogenic acid. As a result, the inclusion of chlorogenic acid in the quince extract was confirmed, and the quince extract containing chlorogenic acid was confirmed to inhibit weight gain, improve lipid metabolism, improve obesity-related hormone levels, reduce blood sugar, and reduce blood cholesterol, etc., and the present invention Completed.

One example provides a composition for reducing body weight and/or body fat containing marmelo extract as an active ingredient.

Another example provides a composition for lowering blood sugar containing quince extract as an active ingredient.

Another example provides a composition for lowering blood cholesterol containing quince extract as an active ingredient.

Another example provides a composition for preventing, improving, and/or treating obesity containing quince extract as an active ingredient.

Another example provides a composition for preventing, improving, and/or treating metabolic diseases containing quince extract as an active ingredient.

The composition may be a pharmaceutical composition or a food composition (eg, health functional food).

Another example provides a method of weight loss comprising administering a pharmaceutically effective amount of quince extract to a subject in need of weight and/or body fat loss.

Another example provides a method of lowering blood sugar comprising administering a pharmaceutically effective amount of quince extract to a subject in need of lowering blood sugar.

Another example provides a method for lowering blood cholesterol comprising administering a pharmaceutically effective amount of quince extract to a subject in need of lowering blood cholesterol.

Another example provides a method of preventing, ameliorating, and/or treating obesity, comprising administering a quince extract to a subject in need thereof.

Another example provides a method of preventing, improving, and/or treating a metabolic disease, comprising administering a quince extract to a subject in need of preventing, improving, and/or treating a metabolic disease.

In this specification, quince extract administered with a high-fat diet effectively suppresses the increase in body weight and/or body fat and adipose tissue weight, blood sugar, blood cholesterol, and blood insulin and leptin content induced by the high-fat diet, and inhibits the growth of fat cells. By confirming that it inhibits size increase, the quince extract is provided for use in anti-obesity, weight and/or body fat reduction, blood sugar reduction, blood cholesterol reduction, and prevention, improvement, and/or treatment of metabolic diseases.

Accordingly, one example provides a composition for reducing body weight and/or body fat containing marmelo extract as an active ingredient.

Another example provides a composition for lowering blood sugar containing quince extract as an active ingredient.

Another example provides a composition for lowering blood cholesterol containing quince extract as an active ingredient.

Another example provides a composition for preventing, improving, and/or treating obesity containing quince extract as an active ingredient.

Another example provides a composition for preventing, improving, and/or treating metabolic diseases containing quince extract as an active ingredient.

The composition may be a pharmaceutical composition or a food composition (eg, health functional food).

Another example provides a method of reducing body weight and/or body fat comprising administering a pharmaceutically effective amount of quince extract to a subject in need of weight loss.

Another example provides a method of lowering blood sugar comprising administering a pharmaceutically effective amount of quince extract to a subject in need of lowering blood sugar.

Another example provides a method for lowering blood cholesterol comprising administering a pharmaceutically effective amount of quince extract to a subject in need of lowering blood cholesterol.

Another example provides a method of preventing, ameliorating, and/or treating obesity, comprising administering a quince extract to a subject in need thereof. Another example provides a method of preventing, improving, and/or treating a metabolic disease, comprising administering a quince extract to a subject in need of preventing, improving, and/or treating a metabolic disease.

Hereinafter, this application will be described in more detail.

Quince Extract

In the present specification, quince extract is provided as an effective ingredient for reducing body weight and/or body fat, reducing blood sugar, reducing blood cholesterol, and preventing, improving, and/or treating obesity and/or metabolic diseases.

Quince (Marmelo; Cydonia oblonga ) is a fruit tree of the Rosaceae family. It is also called quince, Aiva, or European quince. It resembles the fruits of quince and apple, but is distinct from them.

Quince extract is obtained by extracting all or part of quince (e.g., one or more selected from the group consisting of fruits, seeds, pulp, peel, leaves, stems, roots, etc.) as herbal medicine or in a dried and/or heated state using an extraction solvent. It may be a solvent extract extracted using.

The quince extract may be prepared by removing the quince juice after pressing the quince and extracting the remaining solid quince with an extraction solvent, but is not limited thereto.

As used herein, “quince juice” refers to a liquid in the form of juice produced by pressing quince fruits.

The extraction solvent may be one or more selected from the group consisting of water and straight or branched chain alcohols having 1 to 4 carbon atoms (eg, ethanol, fermented alcohol). In one embodiment, the extraction solvent may be at least one selected from the group consisting of water and an aqueous straight-chain or branched-chain alcohol solution having 1 to 4 carbon atoms (e.g., an aqueous ethanol solution, fermented alcohol), and the straight-chain alcohol solution having 1 to 4 carbon atoms. or branched chain alcohol aqueous solution, for example, 10 to 70 (v/v)%, 15 to 70 (v/v)%, 20 to 70 (v/v)%, 25 to 70 (v/v)%, 30 to 70 (v/v)%, 10 to 65 (v/v)%, 15 to 65 (v/v)%, 20 to 65 (v/v)%, 25 to 65 (v/v)%, 30 to 65 (v/v)%, 10 to 60 (v/v)%, 15 to 60 (v/v)%, 20 to 60 (v/v)%, 25 to 60 (v/v)%, 30 to 60 (v/v)%, 10 to 55 (v/v)%, 15 to 55 (v/v)%, 20 to 55 (v/v)%, 25 to 55 (v/v)%, 30 to 55 (v/v)%, 10 to 50 (v/v)%, 15 to 50 (v/v)%, 20 to 50 (v/v)%, 25 to 50 (v/v)% or 30 It may be from 50 (v/v)% of straight or branched chain alcohol having 1 to 4 carbon atoms (e.g., ethanol, alcohol, fermented alcohol).

The amount of extraction solvent used in the extraction is 1 to 10 times the volume, 2 to 10 times the volume, 3 to 10 times the volume, 4 to 10 times the volume, 1 to 9 times the volume, 2 to 9 times the volume, 3 times the volume of quince. to 9 times by volume, 4 to 9 times by volume, 1 to 8 times by volume, 2 to 8 times by volume, 3 to 8 times by volume, 4 to 8 times by volume, 1 to 7 times by volume, 2 to 7 times by volume, 3 to 7 times by volume It may be 2 times the volume, 4 to 7 times the volume, 1 to 6 times the volume, 2 to 6 times the volume, 3 to 6 times the volume, or 4 to 6 times the volume, but is not limited thereto.

The extraction time is not limited to this, but for sufficient extraction of the active ingredient, it is 1 to 24 hours, 1 to 12 hours, 1 to 6 hours, 1 to 5 hours, 3 to 24 hours, 3 to 12 hours, 3 to 6 hours. Time, can be 3 to 5 hours, 5 to 24 hours, 5 to 12 hours or 5 to 6 hours. The extraction temperature is not limited to this, but for effective extraction of the active ingredient, a temperature range selected from room temperature to the boiling point of the extraction solvent, such as 50 to 100°C, 55 to 100°C, 60 to 100°C, 65 to 100°C. , 50 to 95°C, 55 to 95°C, 60 to 95°C, 65 to 95°C, 50 to 90°C, 55 to 90°C, 60 to 90°C, 65 to 90°C, 50 to 85°C, 55 to 85°C , 60 to 85°C, 65 to 85°C, 50 to 80°C, 55 to 80°C, 60 to 80°C, or 65 to 80°C.

The extraction method for obtaining the extract may be selected from among all known extraction methods commonly used in the technical field to which the present invention pertains. For example, commonly used extraction methods such as reflux extraction, immersion extraction, heating extraction, cold immersion, hot water extraction, ultrasonic extraction, filtration, pressure extraction, supercritical extraction, and electrical extraction can be used.

The extraction may be performed once, or may be performed two or more times (e.g., 2, 3, 4, or 5 times) with the same or different extraction solvents and/or conditions. When the extraction is performed two or more times, extraction conditions such as the extraction solvent used in each time, extraction time for each time, and temperature may be adjusted to be the same or different within the range described above, but are not limited thereto.

In one embodiment, the extract has 10 to 100 brix, 20 to 100 brix, 30 to 100 brix, 40 to 100 brix, 50 to 100 brix, 60 to 100 brix, 70 to 100 brix, 80 to 100 brix, 90 to 100 brix. 100 brix, 10 to 90 brix, 20 to 90 brix, 30 to 90 brix, 40 to 90 brix, 50 to 90 brix, 60 to 90 brix, 70 to 90 brix, 80 to 90 brix, 10 to 80 brix, 20 to 90 brix 80 brix, 30 to 80 brix, 40 to 80 brix, 50 to 80 brix, 60 to 80 brix, 70 to 80 brix, 10 to 70 brix, 20 to 70 brix, 30 to 70 brix, 40 to 70 brix, 50 to 50 brix It may have a sugar content of 70 brix or 60 to 70 brix, but is not limited thereto.

In this specification, the quince extract is not only the solvent extract described above, but also the solvent extract is concentrated (e.g., reduced pressure concentration, vacuum concentration, etc.), dried (e.g., spray drying, freeze-drying, etc.), and/ Alternatively, it may include ground (powdered) concentrates, dried products, and/or pulverized products.

The quince extract provided as an active ingredient in this specification has a chlorogenic acid content measured by HPLC of 0.2 mg/g or more, 0.3 mg/g or more, based on the total weight of the extract (e.g., concentrate weight), 0.4 mg/g or more, 0.5 mg/g or more, 0.6 mg/g or more or 0.7 mg/g or more, such as 0.2 to 2 mg/g, 0.3 to 2 mg/g, 0.4 to 2 mg/g, 0.5 to 2 mg/g, 0.6 to 2 mg/g, 0.7 to 2 mg/g, 0.8 to 2 mg/g, 0.2 to 1.5 mg/g, 0.3 to 1.5 mg/g, 0.4 to 1.5 mg/g, 0.5 to 1.5 mg/g, 0.6 to 1.5 mg/g, 0.7 to 1.5 mg/g, 0.2 to 1.2 mg/g, 0.3 to 1.2 mg/g, 0.4 to 1.2 mg/g, 0.5 to 1.2 mg/g, 0.6 to 1.2 mg/g, 0.7 to 1.2 mg/g, 0.2 to 1.0 mg/g, 0.3 to 1.0 mg/g, 0.4 to 1.0 mg/g, 0.5 to 1.0 mg/g, 0.6 to 1.0 mg/g, 0.7 to 1.0 mg /g, 0.2 to 0.8 mg/g, 0.3 to 0.8 mg/g, 0.4 to 0.8 mg/g, 0.5 to 0.8 mg/g, 0.6 to 0.8 mg/g, or 0.7 to 0.8 mg/g.

medicinal use

One example provides a pharmaceutical composition for reducing body weight and/or body fat containing marmelo extract as an active ingredient.

Another example provides a pharmaceutical composition for lowering blood sugar containing quince extract as an active ingredient.

Another example provides a pharmaceutical composition for lowering blood cholesterol containing quince extract as an active ingredient.

Another example provides a pharmaceutical composition for preventing, improving, and/or treating obesity containing quince extract as an active ingredient.

Another example provides a pharmaceutical composition for preventing, improving, and/or treating metabolic diseases containing quince extract as an active ingredient.

Another example provides a method of weight loss comprising administering a pharmaceutically effective amount of quince extract to a subject in need of weight and/or body fat loss.

Another example provides a method of lowering blood sugar comprising administering a pharmaceutically effective amount of quince extract to a subject in need of lowering blood sugar.

Another example provides a method for lowering blood cholesterol comprising administering a pharmaceutically effective amount of quince extract to a subject in need of lowering blood cholesterol.

Another example provides a method for preventing, improving, and/or treating obesity, comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of preventing, improving, and/or treating obesity.

Another example provides a method for preventing, ameliorating, and/or treating a metabolic disease, comprising administering a pharmaceutically effective amount of a quince extract to a subject in need of preventing, ameliorating, and/or treating a metabolic disease. .

The pharmaceutically effective amount of the quince extract is used to (1) reduce body weight and/or body fat, (2) lower blood sugar, (3) lower blood cholesterol, and/or (4) prevent, improve, and/or obesity and/or metabolic disease. Or, in the step of administering to a subject in need of treatment, the content of the quince extract is 1 to 400 mg/kg (body weight; BW), 50 to 400 mg/kg, and 100 to 400 mg based on the body weight of the subject being administered. /kg, 150 to 400 mg/kg, 200 to 400 mg/kg, 1 to 300 mg/kg (body weight; BW), 50 to 300 mg/kg, 100 to 300 mg/kg, 150 to 300 mg/kg , 200 to 300 mg/kg, 1 to 200 mg/kg (body weight; BW), 50 to 200 mg/kg, 100 to 200 mg/kg, 150 to 200 mg/kg, and is limited thereto. It doesn't work.

The pharmaceutically effective amount of the quince extract is used to (1) reduce body weight and/or body fat, (2) lower blood sugar, (3) lower blood cholesterol, and/or (4) prevent, improve, and/or obesity and/or metabolic disease. Alternatively, in the step of administering to a subject in need of treatment, if the subject is a human, the dosage can be determined by calculating by applying the human body conversion coefficient (0.08). Accordingly, in the step of administering to humans in need of prevention, improvement, and/or treatment of obesity and/or metabolic diseases, the content of the quince extract is 0.0048 to 1.92 g based on 60 kg of body weight of the administering human. /day, 0.24 to 1.92 g/day, 0.48 to 1.92 g/day, 0.72 to 1.92 g/day, 0.96 to 1.92 g/day, 0.0048 to 1.44 g/day, 0.24 to 1.44 g/day, 0.48 to 1.44 g/day day, 0.72 to 1.44 g/day, 0.96 to 1.44 g/day, 0.0048 to 0.96 g/day, 0.24 to 0.96 g/day, 0.48 to 0.96 g/day, or 0.72 to 0.96 g/day, It is not limited to this.

The quince extract is as described above.

The lowering of blood sugar refers to a concept including a decrease in blood glucose concentration, a decrease in blood insulin content, a decrease in insulin resistance, and/or an increase in insulin sensitivity. Insulin resistance can be calculated using Equation 2 in Example 6.3 below, and insulin sensitivity can be calculated using Equation 3 in Example 6.3 below.

The lowering of blood cholesterol refers to a decrease in the total cholesterol content or LDL (low-density lipoprotein) cholesterol content in the blood.

The above-mentioned obesity refers to a condition in which body fat is abnormally high, and refers to a state in which a large amount of calories are consumed but not consumed, thereby storing them in the form of fat in the body.

In one example, obesity may mean a body mass index (BMI; weight divided by height squared; kg/m ² ) of about 25 kg/m ² or more, but is not limited thereto.

The metabolic disease may be a general term for diseases that cause abnormalities in each organ as metabolites accumulate throughout the body or in specific organs of the body due to disorders or dysfunction of body organs involved in hormones or metabolism.

In one example, the metabolic disease may be a disease caused by the accumulation of one or more types selected from the group consisting of glucose, cholesterol, and triglycerides in the blood or all of them. For example, the metabolic disease may be diabetes, hyperlipidemia, arteriosclerosis, hyperinsulinemia, or metabolic syndrome.

Diabetes is a type of systemic metabolic disease caused by genetic or environmental factors. It is a disease caused by an absolute or relative lack of insulin in the body, and refers to a condition in which the sugar concentration in the blood is abnormally high. In the present specification, diabetes may include type 1 diabetes, type 2 diabetes, and gestational diabetes, and may especially include type 2 diabetes related to insulin resistance.

Hyperlipidemia can refer to a condition in which excess fatty substances exist in the blood or cause inflammation. For example, if fasting serum cholesterol is more than 220 mg/dl or neutral fat is more than 150 mg/dl, hyperlipidemia can be diagnosed, but is not limited to this. Hyperlipidemia may mean hypercholesterolemia, hypertriglyceridemia, or both.

Arteriosclerosis is a general term for diseases in which blood vessels in the arteries narrow due to the formation of blood clots in the arteries. In this specification, it may be related to high cholesterol and/or neutral fat content in the blood.

Hyperinsulinemia refers to a state in which the level of insulin in the blood is high, and is a functional condition caused by dysfunction of the autonomic nervous system and digestive system without organic hyperinsulinemia caused by proliferation (adenomas, hypertrophy) of the islets of Langerhans or islet adenoma. It can be divided into hyperinsulinemia.

Metabolic syndrome refers to a syndrome in which risk factors such as hyperlipidemia, high blood pressure, abnormal glucose metabolism, and obesity coexist. Metabolic syndrome is a disease believed to be caused by insulin resistance, and can refer to symptoms in which two or more of cholesterol, blood pressure, and blood sugar levels are abnormal.

As used herein, 'treatment' includes improvement, alleviation or stabilization of disease state or symptoms, partial or complete recovery, prolongation of survival, reduction of disease extent, delay or alleviation of disease progression, and other beneficial treatment results. It is used with meaning. 'Prevention' is used to include all mechanisms and/or effects that act on subjects who do not have a specific disease to prevent the specific disease from developing, delay its onset, or reduce the frequency of its occurrence.

The content of the quince extract used as an active ingredient in the pharmaceutical composition provided herein can be appropriately adjusted depending on the form and purpose of use, the condition of the subject, the type and severity of symptoms, etc., and the solid content (after removing the solvent from the extract) Solid component) 0.001 to 99.9% by weight, 0.001 to 90% by weight, 0.001 to 75% by weight, 0.001 to 50% by weight, 0.01 to 99.9% by weight, 0.01 to 90% by weight, 0.01 to 75% by weight, 0.01 to 50% by weight, 0.1 to 99.9% by weight, 0.1 to 90% by weight, 0.1 to 75% by weight, 0.1 to 50% by weight, 1 to 99.9% by weight, 1 to 90% by weight, 1 to 75% by weight, 1 to 50% by weight %, 5 to 99.9% by weight, 5 to 90% by weight, 5 to 75% by weight, 5 to 50% by weight, 10 to 99.9% by weight, 10 to 90% by weight, 10 to 75% by weight, or 10 to 50% by weight. It may be, but is not limited to this.

The quince extract, which is the pharmaceutical composition or active ingredient, can be used in humans, primates such as monkeys, rodents such as mice, rats, and rabbits, mammals including dogs, cats, cows, pigs, sheep, horses, goats, etc., and chickens. , birds including ducks, geese, etc., reptiles including snakes, lizards, turtles, crocodiles, etc., amphibians, and fish. The method of administration of the pharmaceutical composition may be any commonly used method, for example, oral administration, or parenteral administration such as intravenous, intramuscular, subcutaneous, or intraperitoneal injection. In one example, the pharmaceutical composition may be for oral administration, but is not limited thereto.

The pharmaceutical composition can be formulated and used in oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., or parenteral dosage forms in the form of sterile injectable solutions, according to conventional methods. there is.

In addition to the active ingredients described above, the pharmaceutical composition generally consists of pharmaceutically and/or physiologically acceptable carriers, excipients, and diluents selected in consideration of administration method and standard pharmaceutical practice. It can be administered in combination with one or more selected adjuvants. For example, the pharmaceutically and/or physiologically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, It may contain one or more selected from the group consisting of cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. However, it is not limited thereto, and may be any carrier commonly used in the pharmaceutical field.

The pharmaceutically and/or physiologically acceptable diluents and/or excipients are from the group consisting of all fillers, extenders, binders, wetting agents, disintegrants, lubricants, surfactants, etc. commonly used in the appropriate formulation of pharmaceutical compositions. There may be one or more selected types.

For example, in the case of solid preparations for oral administration such as tablets, pills, powders, granules, or capsules, the excipient is at least one type of material for formulating such solid preparations, such as starch and calcium carbonate. It may be one or more types selected from the group consisting of , sucrose, lactose, gelatin, etc. In addition, lubricants such as magnesium styrate talc and the like may also be used. In addition, in the case of formulation of liquid preparations for oral administration such as suspensions, oral solutions, emulsions, syrups, etc., one or more types selected from the group consisting of water, liquid paraffin, etc., which are commonly used simple diluents, may be used. , various commonly used excipients, such as wetting agents, sweeteners, flavoring agents, and/or preservatives, may be included, but are not limited thereto.

For example, the pharmaceutical composition may be administered orally, in the form of tablets containing starch or lactose, in the form of capsules containing appropriate excipients, or in the form of elixirs or suspensions containing flavoring or coloring chemicals. It may be administered intraorally or sublingually. These liquid preparations may contain suspending agents (e.g. methylcellulose, semi-synthetic glycerides such as Witepsol or a mixture of Apricot kernel oil and PEG-6 esters or PEG-8 and caprylic/capric It may be formulated with pharmaceutically acceptable additives such as a mixture of glycerides, but is not limited thereto.

food composition

One example provides a food composition for reducing body weight and/or body fat containing marmelo extract as an active ingredient.

Another example provides a food composition for lowering blood sugar containing quince extract as an active ingredient.

Another example provides a food composition for lowering blood cholesterol containing quince extract as an active ingredient.

Another example provides a food composition for preventing and/or improving obesity containing quince extract as an active ingredient.

Another example provides a food composition for preventing and/or improving metabolic diseases containing quince extract as an active ingredient.

Another example is a food composition containing quince extract as an active ingredient (1) reducing body weight and/or body fat, (2) lowering blood sugar, (3) lowering blood cholesterol, and/or (4) reducing obesity and/or metabolic diseases. A method of weight loss is provided comprising administering to a subject in need of prevention, improvement and/or treatment.

The food composition is used for (1) reducing body weight and/or body fat, (2) lowering blood sugar, (3) lowering blood cholesterol, and/or (4) preventing, improving and/or treating obesity and/or metabolic diseases. In the step of administering to the subject, the content of the quince extract is 1 to 400 mg/kg (body weight; BW), 50 to 400 mg/kg, 100 to 400 mg/kg, 150 to 400 mg/kg, based on the body weight of the subject being administered. mg/kg, 200 to 400 mg/kg, 1 to 300 mg/kg (body weight; BW), 50 to 300 mg/kg, 100 to 300 mg/kg, 150 to 300 mg/kg, 200 to 300 mg/ kg, 1 to 200 mg/kg (body weight; BW), 50 to 200 mg/kg, 100 to 200 mg/kg, and 150 to 200 mg/kg, but is not limited thereto.

The food composition is used for (1) reducing body weight and/or body fat, (2) lowering blood sugar, (3) lowering blood cholesterol, and/or (4) preventing, improving and/or treating obesity and/or metabolic diseases. In the step of administering to a subject, if the subject is a human, the dosage can be determined by calculating by applying the human body conversion coefficient (0.08). Accordingly, in the step of administering to humans in need of prevention, improvement, and/or treatment of obesity and/or metabolic diseases, the content of the quince extract is 0.0048 to 1.92 g based on 60 kg of body weight of the administering human. /day, 0.24 to 1.92 g/day, 0.48 to 1.92 g/day, 0.72 to 1.92 g/day, 0.96 to 1.92 g/day, 0.0048 to 1.44 g/day, 0.24 to 1.44 g/day, 0.48 to 1.44 g/day day, 0.72 to 1.44 g/day, 0.96 to 1.44 g/day, 0.0048 to 0.96 g/day, 0.24 to 0.96 g/day, 0.48 to 0.96 g/day, or 0.72 to 0.96 g/day, It is not limited to this.

The quince extract, lowering blood sugar, lowering blood cholesterol, and metabolic diseases are as described above.

In the food composition provided herein, the term "food" refers to an edible natural product or processed product containing one or more nutrients, and in its usual sense, various general foods, health functional foods, beverages, food additives, and beverages. It may be used to mean one or more selected from the group consisting of additives, etc. The term “food composition” may refer to a combination of ingredients for producing the food. In one example, the food may refer to a health functional food.

The content of the quince extract in the food composition can be appropriately adjusted depending on the type of food use, purpose, etc., for example, 0.00001 to 99.9% by weight, 0.0001 to 99.9% by weight, 0.001 to 99.9% by weight, or 0.001% based on the weight of solid content. It may be from 50% by weight, but is not limited thereto.

The 'subjects' of administration of the food composition include humans, primates such as monkeys, rodents such as mice, rats, and rabbits, mammals including dogs, cats, cows, pigs, sheep, horses, and goats, chickens, ducks, etc. It may be an individual selected from vertebrates such as birds including geese, reptiles including snakes, lizards, turtles, and crocodiles, amphibians, and fish, and cells, tissues, or cell cultures isolated from the individuals.

The quince extract provided herein has an anti-obesity effect and lipid improvement effect on dietary obesity by reducing or effectively suppressing the increase in body weight and/or body fat and adipose tissue weight, blood sugar, blood cholesterol, blood insulin and leptin. It further suggests that it has preventive, treatment, and/or improvement effects on metabolic diseases, and the possibility of developing it as a health functional material with anti-obesity efficacy and/or prevention, treatment, and/or improvement effects on metabolic diseases in the future. presents.

Figures 1a and 1b are graphs showing the results of analyzing the chlorogenic acid content in quince extract by HPLC chromatography. Figure 1a shows the results of the chlorogenic acid standard form, and Figure 1b shows the results of sample c (Table 4 of Example 2.2).
Figure 2 is a graph showing weekly weight change according to type of diet. Group 1 refers to the control diet group, Group 2 refers to the high-fat diet group, and Group 3 refers to the high-fat diet group administered together with mdB-44.
Figure 3 is a photograph of histological changes in epididymal fat tissue observed using an optical microscope (Carl Zeiss).

Hereinafter, the present invention will be described in more detail through examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example 1. Preparation of quince extract

Quince fruits (LICORICE EXTRACT (Tashkent, Republic of Uzbekistan)) were weighed, sorted, washed and degreased. Afterwards, the quince was pressed with a press at a pressure of 1 to 5 kg/cm ² to remove quince juice (liquid in the form of juice produced by pressing quince fruits) and separate the solid matter. The solids were extracted twice with 4 to 6 volumes of 30 to 50 (v/v)% alcohol at 65 to 80°C for 5 to 6 hours. The extract was filtered through a 10 μm standard filter and vacuum concentrated to 65 brix or higher using a vacuum evaporator (EYELA, Tokyo, Japan) to obtain a quince concentrate. The concentrate was powdered through a spray dryer. The extract or powdered quince extract prepared as above was used in the following examples.

Example 2. Analysis of chlorogenic acid content of quince extract

2.1 HPLC analysis method

The chlorogenic acid (CGA) content of the quince extract prepared in Example 1 was analyzed using an LC-20A high-performance liquid chromatography (HPLC) system (Shimadzu, Japan). HPLC analysis conditions are shown in Table 1 (analysis conditions) and Table 2 (mobile phase gradient conditions).

Items Conditions Column Capcell Pak C ₁₈ column (Shiseido, 5μm, 250ｘ4.6mm) Column Temperature 40℃ Flow 1.4 mL/min Detector Diode Array Detector (DAD) 330 nm Injection Volume 5 μL Mobile Phase A: phosphoric acid: water = 0.5: 99.5 (v/v),
B: phosphoric acid: AcN = 0.5: 99.5 (v/v) Run time 40min

Time (Min) A Solvent (%) B Solvent (%) 0 95 5 7 95 5 27 70 30 28 10 90 30 10 90 31 95 5 40 95 5

5 mg of chlorogenic acid standard was weighed and dissolved in 50 mL of methanol. 5 mL of this solution was taken and transferred to a volumetric flask, 5 mL of methanol was added, and 20 mL of distilled water was added and used as a stock standard solution. The stock solution was used as a standard stock solution and diluted step by step to create a calibration curve to create a chlorogenic acid standard solution (final concentration: 0.00833, 0.00416, 0.00208, 0.00104, 0.01666 mg/mL), and the relevant information is shown in Table 3 below. In addition, 30 mg of the powdered quince extract of Example 1 was weighed, dissolved in 5 mL of 30% methanol, filtered through a 0.45 um filter, and used as a test solution (final concentration 30 mg/5 mL) (quince extract). The relevant information is shown in Table 3 below.

sample Pretreatment Concentration Chlorogenic acid standard solution 0.00833, 0.00416, 0.00208, 0.00104, 0.01666 mg/mL in 30% MeOH Quince Extract 30mg/5mL in 30% MeOH (HPLC grade)

2.2 Experiment results

The experiment was performed three times using the HPLC analysis method of 2.1 above, and the obtained values are shown in Table 4 and Figures 1a (chlorogenic acid standard form) and 1b (sample c).

Specimen name Content (mg/g) sample a 0.82 sample b 0.7 sample c 0.73

(The samples a, b, and c refer to test solutions containing quince extract used in each experiment when the experiment was performed three times)

As shown in Table 4 and Figures 1a and 1b, the chlorogenic acid content in the quince extract prepared in Example 1 was 0.82 mg/g for sample a, 0.7 mg/g for sample b, and 0.73 mg for sample c. It was found to be /g, and it was confirmed that the chlorogenic acid content was in the range of ±20% based on sample c, which had an intermediate value. The above results show that the quince extract obtained in Example 1 contains chlorogenic acid in a certain range (e.g., 0.75 (mg/g) ± 20%), and these results show that even if extraction is performed several times, the chlorogenic acid contained in the extract It shows that the acid content is in the same range.

Example 3. Preparation of test substances and experimental animals

3.1 Test material preparation and animal testing approval

As a test material, the powdered quince extract (powder; hereinafter referred to as 'mdB-44') prepared in Example 1 was used, and all animal experiments in the following examples were conducted under the approval of the Animal Experiment Ethics Committee of Hallym University. It was performed according to regulations (Hallym 2019-67).

3.2 Test group and test substance administration

Five-week-old male C57BL/6 mice free of specific pathogens were purchased from Duyeol Biotech Co., Ltd. and used. After one week of quarantine and adaptation, healthy animals without weight loss were selected and used in the experiment. Experimental animals were raised in a breeding environment set at a temperature of 23 ± 3°C, relative humidity of 50 ± 10%, ventilation frequency of 10 to 15 times/hour, lighting time of 12 hours (08:00 to 20:00), and illumination intensity of 150 to 300 Lux. . During the adaptation period, the experimental animals were allowed to freely consume solid feed for experimental animals (Cargill Agri-Purina, Inc.) and drinking water. After a one-week adaptation period, healthy animals were selected and divided into control diet (CD) (Group 1), high-fat diet (HFD) control (Group 2), and high-fat diet + based on egg mass method (randomized block design). They were classified into the group administered 200 mg/kg body weight (BW) mdB-44 (experimental material in Example 3.1 above) (Group 3). During the pre-test period, the energy ratio (kcal%) (protein: carbohydrate: fat) of the control diet was 20:70:10, and the energy ratio (kcal%) (protein: carbohydrate: fat) of the high-fat diet was 20:20: 60, and both diets are from Research Diets, Inc. (New Brunswick, NJ, USA). The composition of the control diet group and the high-fat diet is shown in Table 5, and the experimental design is shown in Table 6.

Control diet (CD) (10 kcal% fat) Content of each composition (g) Control diet (CD) (10 kcal% fat) Calorie content of each composition (kcal) High-fat diet (HFD) (60 kcal% fat) Content of each composition (g) High-fat diet (HFD) (60 kcal% fat) Calorie content of each composition (kcal) Casein, 80 Mesh 200 800 200 800 L-Cystine 3 12 3 12 Corn starch 315 1260 0 0 Maltodextrin 10 35 140 125 500 Sucrose 350 1400 68.8 275.2 Cellulose, BW200 50 0 50 0 Soybean oil 25 225 25 225 Lard* 20 180 245 2205 Mineral mix 10 0 10 0 Dicalcium phosphate 13 0 13 0 Calcium carbonate 5.5 0 5.5 0 Potassium citrate, 1H ₂ O 16.5 0 16.5 0 Vitamin mix V10001 10 40 10 40 Choline bitartrate 2 0 2 0 Sum 1055.05 4057 773.85 4057

(*Lard: Cholesterol calculated as 0.95mg/g)

group 1 group 2 group 3 Control group (normal) Negative control group experimental group experimental diet CD HFD HFD test substance
(mg/kg BW) - - mdB-44 200 Number of animals (animals) 10 10 10

Drinking water was freely consumed during the entire test period, and 200 mg of the test substance of Example 3.1 per 1 kg of experimental animal was dissolved in drinking water and orally administered at regular times for 8 weeks (Group 3). In the following examples using the corresponding experimental animals, statistical processing was expressed as mean ± standard error. The collected results were analyzed using the GraphPad Prism 5.0 (GraphPad software) program. Student's t-test and one-way analysis of variance (ANOVA) were used to compare the differences between the test substance administered group and the control group. It was judged to be statistically significant only when p < 0.05 or higher.

Example 4. Measurement of body weight and dietary intake

The body weight of the experimental animals prepared in Example 3 was measured at 0 and 8 weeks, and food intake was measured every 2 days for 8 weeks. The amount consumed during the period before the test was calculated to calculate daily dietary intake and daily energy intake. Food Efficiency Ratio (FER) was calculated by dividing the weight gain during the test period by the amount of diet consumed during the same period as shown in Equation 1 below.

[Equation 1]

Dietary efficiency = weight gain (g) / dietary intake (g)

The measured weight results and the resulting total weight gain and daily weight gain are shown in Table 7, the dietary intake and dietary efficiency measured over 8 weeks are shown in Table 8, and in particular, the body weight results are shown in Figure 2.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 0 weeks 23.14 ± 0.35 23.06 ± 0.24 23.10 ± 0.27 8 weeks 31.20 ± 0.67 41.91 ± 0.91 ^*** 36.45 ± 0.91 ^### Total weight gain (g) 8.1 ± 0.7 18.9 ± 0.9 ^*** 13.4 ± 1.1 ^## Daily weight gain (g/day) 0.146 ± 0.013 0.343 ± 0.016 ^*** 0.243 ± 0.020 ^##

(The results in Table 8 are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001 Means; Group 1 (normal control group); Group 2 (negative control group); Group 3: experimental group, (mdB-44 administration group)

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 Total dietary intake (g) 145.4 ± 1.4 129.1 ± 1.2 ^*** 112.7 ± 1.5 ^### Daily dietary intake (g/day) 2.64 ± 0.03 2.35 ± 0.02 ^*** 2.05 ± 0.03 ^### Daily energy intake (kcal/day) 10.18 ± 0.10 12.30 ± 0.11 ^*** 10.73 ± 0.15 ^### Dietary efficiency (weight gain/dietary intake) 0.055 ± 0.005 0.146 ± 0.007 ^*** 0.119±0.009 ^#

(The above figures are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001 )

As shown in Tables 7 and 8 above, during the test period, the experimental animals in all test groups continued to gain weight, showing normal body weight changes. Compared to the control diet group (Group 1), the body weight of the high-fat diet control group (Group 2) increased significantly more. On the other hand, in Group 3, the test group administered quince extract, the body weight (weight gain) of the experimental animals increased by high-fat diet was significantly decreased compared to the high-fat diet control group (Group 2). Through this, it was confirmed that even when eating a high-fat diet, body weight gain is suppressed when quince extract is consumed concurrently.

In addition, the dietary intake of Group 3, the test group administered quince extract, significantly decreased compared to the negative control group (Group 2), but dietary efficiency (weight gain/dietary intake) also decreased, which means that body weight increased only by reducing dietary intake. This means that it has not decreased.

Example 5. Body fat measurement

One day before the end of the experimental animal test in Example 3.2, the experimental animals were anesthetized and body composition was measured using dual-energy Shown in 9.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 Fat (%) 29.58 ± 0.84 42.84 ± 1.66 ^*** 37.97±1.46 ^#

(The above figures are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001 )

The body fat percentage significantly increased to 42.84 ± 1.66% in the high-fat diet control group (group 2) compared to 29.58 ± 0.84% in the control diet group (group 1), and compared to the high-fat diet control group (group 2), mdB- 44 Body fat percentage was significantly reduced in the 200mg/kg BW administration group (Group 3).

Example 6. Blood and fat analysis

Example 6.1 Blood collection and tissue extraction

After completion of the test of the experimental animals in Example 3, the experimental animals were sacrificed. Before sacrifice, the patient was anesthetized using an anesthetic prepared by diluting tribromoethanol with tert-amyl alcohol, and then orbital blood was collected. The blood was placed in a separate serum tube (Becton Dickinson) and left at room temperature for 30 minutes, then centrifuged at 5,000 rpm for 10 minutes to separate serum, and stored at -70°C until analysis. After blood collection, the experimental animals were sacrificed and white adipose tissue (epididymal fat, visceral fat, retroperitoneal fat, and inguinal fat) was removed, rinsed with cold saline solution, excess water removed with filter paper, and then weighed. The epididymal adipose tissue was divided into three parts, some were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin for tissue staining, some were subjected to real-time RT-PCR after isolation of total RNA, and some were analyzed for protein. After separation, Western blot was performed and stored at -70°C for further analysis.

6.2 Tissue (fat tissue) weight measurement

In Example 6.1, the weight of adipose tissue was measured and the results are shown in Table 10.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 epididymal fat 1.030 ± 0.070 2.471 ± 0.079 ^*** 2.023 ± 0.109 ^## Retroperitoneal fat 0.447 ± 0.037 1.184 ± 0.063 ^*** 0.954 ± 0.074 ^# Visceral fat 0.603 ± 0.050 1.603 ± 0.114 ^*** 0.975 ± 0.073 ^### inguinal region 0.210 ± 0.031 0.544 ± 0.033 ^*** 0.490 ± 0.052 White fat total weight 2.29 ± 0.14 5.80 ± 0.21 ^*** 4.44 ± 0.21 ^###

(The above figures are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001 )

Body fat is divided into white adipose tissue and brown adipose tissue according to its form and function. White adipose tissue mainly stores excess energy in the body as fat, and brown adipose tissue functions to produce heat, and the weight of white adipose tissue increases. The more you do it, the more your weight increases. The weight of white adipose tissue, epididymal fat, retroperitoneal fat, visceral fat, and inguinal fat, all significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1). On the other hand, Group 3 administered quince extract decreased body fat in all tested items compared to the high-fat diet control group (Group 2).

6.3 Analysis of blood sugar related levels

The glucose content in the blood collected in Example 6.1 was measured using a blood biochemistry analyzer (KoneLab 20 XT, Thermo Fisher Scientific), and the insulin content was measured using a measurement kit purchased from Millipore Corporation as presented by the manufacturer. It was measured according to one method.

Since insulin resistance is the most important factor in metabolic syndrome, measuring blood insulin concentration is very useful in measuring insulin sensitivity and resistance. In this study, blood insulin concentration and fasting blood sugar were used to measure insulin resistance (HOMA-IR) and insulin resistance. Sensitivity (QUICKI) was calculated. Insulin resistance (homeostatic model assessment for insulin resistance, HOMA-IR) and insulin sensitivity (quantitative insulin sensitivity check index, QUICKI) were calculated using the following equations 2 and 3 using fasting blood sugar and blood insulin content, and the measurements were The results are shown in Table 11.

[Equation 2]

Insulin resistance (HOMA-IR) = [insulin (mU/L) × glucose (mg/dL)] / 405

[Equation 3]

Insulin sensitivity (QUICKI) = 1 / [log insulin (mU/L) + log glucose (mg/dL)]

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 Glucose (mg/dL) 149.0 ± 10.8 196.8 ± 7.8 ^** 185.2 ± 7.5 Insulin (ng/mL) 2.62 ± 0.21 9.12 ± 0.97 ^*** 5.67±0.81 ^# HOMA-IR 22.9 ± 2.2 107.1 ± 12.4 ^*** 62.3 ± 9.3 ^## QUICKI 0.253 ± 0.002 0.218 ± 0.004 ^*** 0.230 ± 0.003 ^#

Glucose significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and decreased in Group 3 compared to the high-fat diet control group (Group 2).

Blood insulin content significantly increased to 9.12 ± 0.97 ng/mL in the high-fat diet control group (group 2) compared to 2.62 ± 0.21 ng/mL in the control diet group (group 1), whereas in the mdB-44 administration group (group 3). It was significantly reduced to 5.67 ± 0.81ng/mL compared to the high-fat diet control group.

Insulin resistance significantly increased to 107.1 ± 12.4 in the high-fat diet control group (group 2) compared to 22.9 ± 2.2 in the control diet group (group 1), while it decreased in the mdB-44 administration group (group 3) compared to the high-fat diet control group. . Insulin sensitivity was significantly decreased to 0.218 ± 0.004 in the high-fat diet control group (Group 2) compared to 0.253 ± 0.002 in the control diet group (Group 1), while in the mdB-44 administered group (Group 3) compared to the high-fat diet control group. increased. Through this, it was confirmed that in the quince extract administered group, insulin resistance caused by a high-fat diet was suppressed and glucose tolerance impairment was improved.

6.4 Fat-related numerical analysis

The contents of triglyceride (TG), total cholesterol (CHOL), and HDL-cholesterol (HDL-CHOL) in the blood collected in Example 6.1 were measured using a blood biochemical analyzer (KoneLab 20 XT, Thermo Fisher Scientific). was measured, and the arteriosclerosis index was calculated using the blood cholesterol content and HDL-cholesterol content using Equation 4 below.

[Equation 4]

Arteriosclerosis index = total cholesterol content / HDL-cholesterol content

The obtained results are shown in Table 12.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 TG (mg/dL) 77.1 ± 3.3 90.4 ± 3.4 ^* 77.3±3.2 ^# CHOL (mg/dL) 165.7 ± 8.4 188.4 ± 4.7 ^* 171.8±5.3 ^# HDL-CHOL (mg/dL) 151.6 ± 6.2 126.9 ± 5.8 ^** 150.9±6.1 ^# arteriosclerosis index 1.09 ± 0.04 1.52 ± 0.11 ^** 1.15 ± 0.04 ^##

In general, when consuming a high-fat diet, the supply of fatty acids increases, increasing the concentration of triglycerides and total cholesterol in the blood, while the blood concentration of HDL-cholesterol tends to decrease, which causes cardiovascular and coronary vascular diseases.

Blood triglycerides and blood total cholesterol contents were significantly increased in the high-fat diet control group (group 2) compared to the control diet group (group 1), while group 3 administered mdB-44 significantly increased compared to group 2. It decreased, and in particular, blood triglyceride levels were measured very similarly to the control diet group (Group 1). Blood HDL-cholesterol content was significantly decreased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), while it was significantly increased in Group 3 administered mdB-44 compared to Group 2. The measurements were very similar to the control diet group (Group 1). The result of calculating arteriosclerosis index (see Equation 4), which is the most effective predictor of the occurrence of coronary artery disease, using blood cholesterol content and HDL-cholesterol content, was compared with 1.09 ± 0.04 in the control diet group (group 1). The control group (Group 2) significantly increased to 1.52 ± 0.11, while the mdB-44 200mg/kg BW administration group (Group 3) significantly decreased to 1.15 ± 0.04 (Group 3) compared to Group 2.

6.5 Serum leptin and adiponection content analysis

Adipose tissue is recognized not only as a place to store excess energy, but also as an endocrine organ that affects metabolic processes throughout the body by synthesizing and secreting various adipokines that play a very important physiological role. Leptin, one of the representative adipokines secreted from adipose tissue, is an important substance that regulates energy intake and storage, insulin sensitivity, and metabolic rate. It is known that leptin secretion increases in obesity. Adiponectin, another major adipokines, is known to be an important hormone that increases fat oxidation in muscles and prevents chronic diseases such as diabetes and metabolic syndrome through its role as an anti-inflammatory cytokine.

The contents of leptin and adiponectin in the serum of the blood collected in Example 6.1 were measured using a measurement kit purchased from R&D Systems according to the method suggested by the manufacturer, and the results are shown in Table 13 below.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 Adiponectin (ng/mL) 10.45 ± 0.26 9.45 ± 0.25 ^* 10.84 ± 0.37 ^## Leptin (ng/mL) 21.14 ± 2.96 116.04 ± 9.49 ^*** 69.53 ± 5.13 ^###

Blood leptin content was significantly increased in the high-fat diet control group (Group 2) compared to the control diet group (Group 1), and it was significantly decreased in the mdB-44 administration group (Group 3) compared to Group 2. Blood adiponectin content was significantly decreased in the high-fat diet control group (group 2) compared with the control diet group (group 1), and in the mdB-44 administration group (group 3) compared with the high-fat diet control group (group 2). increased. It is known that the increase in the size, number, and quantity of adipocytes in visceral adipose tissue is positively correlated with the secretion amount of leptin, and is negatively correlated with the secretion amount of adiponectin. As a result, the mdB-44 administration group was observed in obese mice. It significantly reduced the increased level of leptin in the blood and increased adiponectin secretion, showing an anti-obesity effect.

6.6 Histological analysis of epididymal adipose tissue

In Example 6.1, epididymal adipose tissue extracted and fixed from the experimental animal was embedded in paraffin, and tissue sections of 5 μm were prepared from the embedded tissues. After removal of paraffin, the tissue was hydrated by sequentially lowering the percentage of alcohol starting from 100% alcohol to 0% alcohol (H ₂ O). Afterwards, tissues were stained using Accustain® Hematoxylin and Eosin Stains (Sigma-Aldrich Co.) according to the method suggested by the manufacturer (hematocylin & eosin staining, H&E staining), and each tissue was examined using an optical microscope (Carl Zeiss). Histological changes were observed. In addition, the size and number of adipocytes were measured using the AxioVision Imaging analysis System in epididymal fat tissue photographs obtained by H&E staining. Histological changes in the epididymal adipose tissue are shown in Figure 3, and the number of cells according to the size of adipocytes in the measured adipose tissue is shown in Table 14.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 <80μm 161.0 ± 7.1 1.0 ± 1.0 ^*** 41.7 ± 2.2 ^### 80~100μm 16.0 ± 1.7 9.3 ± 1.5 ^* 45.0 ± 3.5 ^### 100~120μm 0.0 ± 0.0 28.0 ± 4.0 ^* 12.7±1.2 ^# >120μm 0.0 ± 0.0 12.7 ± 1.2 ^** 0.0 ± 0.0 ^## Number of fat cells in the same area 177.0 ± 8.7 51.0 ± 5.7 ^*** 99.3 ± 5.2 ^## Average fat globule size (μm) 80.9 ± 0.1 108.5 ± 1.0 ^*** 88.3±0.4 ^###

(The above figures are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001 )

As shown in Figure 3, compared to the control diet group (Group 1), the size of adipocytes in the epididymal adipose tissue of the high-fat diet control group (Group 2) was significantly increased, and in the mdB-44 administration group (Group 3), the size of adipocytes was significantly increased. The size showed a tendency to decrease.

In addition, as shown in Table 14 showing the results of measuring the number of cells according to the size of adipocytes in epididymal adipose tissue, the control diet group (Group 1) had 161.0 ± 7.1 cells with an adipocyte size of <80μm, whereas the number of cells was 161.0 ± 7.1. The number of adipocytes >100μm was not observed, confirming that the adipocytes were generally small in size. In the high-fat diet control group (Group 2), the number of adipocytes with a size of 100-120μm was 28.0 ± 4.0, and the number of cells with a size >120μm was 12.0 ± 2.1, confirming that the size of adipocytes was large. As a result of comparing the number of cells by size of adipocytes in the test substance administered group (group 3) compared to the high-fat diet control group (group 2), the number of adipocytes with a size of <80μm and 80-100μm increased significantly. , the number of cells with a size of 100 to 120 μm was significantly decreased. The number of adipocytes >120μm in size was not observed in the group administered mdB-44 200mg/kg BW (Group 3).

The total number of adipocytes compared to the same area was significantly reduced to 51.0 ± 5.7 in the high-fat diet control group (group 2) compared to 177.0 ± 8.7 in the control diet group (group 1), and in the mdB-44 200mg/kg BW administered group (group 3) increased significantly. The average fat globule size was 80.9 ± 0.1 μm in the control diet group (Group 1), compared to 108.5 ± 1.0 μm in the high-fat diet control group (Group 2), which significantly increased the fat globule size at 200 mg/kg of mdB-44. In the BW administration group (Group 3), the size of fat globules was significantly reduced to 88.3 ± 0.4μm (Group 3).

From the above results, it was confirmed that administration of quince extract not only has an anti-obesity effect, but is especially effective in suppressing hypertrophy of white adipose tissue caused by a high-fat diet.

6.6 Analysis of mRNA expression of genes related to energy metabolism in adipose tissue

Total RNA was isolated from the epididymal fat tissue obtained in Example 6.1 using TRIzol® Reagent (Thermo Fisher Scientific) and then quantified using a micro-volume spectrophotometer (BioSpec-nano, SHIMADZU), and the OD260/280 value was 1.8. The above RNA was used in the experiment. cDNA was obtained from total RNA (2 μg) using the HyperScriptTM RT master mix kit (GeneAll Biotechnology), followed by real-time PCR using Rotor-Gene 300 PCR (Corbett Research) and Rotor-GeneTM SYBR Green kit (QIAGEN) was carried out. Information on the primers used in the experiment is shown in Table 15. Quantitative analysis of gene expression was performed using the Rotor-Gene 6000 Series System Software program (Corbett Research).

mRNA Base sequence (5’ → 3’) Genebank No. sequence number C/EBPα-FOR primer TGGACAAGAACAGCAACGAGTAC XM_021168520.2 One C/EBPα-REV primer GCAGTTGCCCATGGCCTTGAC XM_021168520.2 2 PPARγ-FOR primer CAAAACACCAGTGTGAATTA XM_021164279.2 3 PPARγ-REV primer ACCATGGTAATTTCTTGTGA XM_021164279.2 4 SREBP-1c-FOR primer CACTTCTGGAGACATCGCAAAC NM_011480.4 5 SREBP-1c-REV primer ATGGTAGACAACAGCCGCATC NM_011480.4 6 CPT1β-FOR primer GTGCTGGAGGTGGCTTTGGT NM_009948.2 7 CPT1β-REV primer TGCTTGACGGATGTGGTTCC NM_009948.2 8 FAS-FOR primer AGGGGTCGACCTGGTCCTCA NM_007988.3 9 FAS-REV primer GCCATGCCCAGAGGGTGGTT NM_007988.3 10 aP2-FOR primer GGATTTGGTCACCATCCGGT NM_024406.3 11 aP2-REV primer TTCACCTTCCTGTCGTCTGC NM_024406.3 12 HSL-FOR primer CCGTTCCTGCAGACTCTCTC XM_030242181.1 13 HSL-REV primer CCACGCAACTCTGGGTCTAT XM_030242181.1 14 GAPDH-FOR primer AGGTTGTCTCCTGCGACT XM_029478683.1 15 GAPDH-REV primer TGCTGTAGCCGTATTCATTGTCA XM_029478683.1 16 ACC1-FOR primer GGAGATGTACGCTGACCGAGAA AY451393.1 17 ACC1-REV primer ACCCGACGCATGGTTTTCA AY451393.1 18 ACL-FOR primer TGGATGCCACAGCTGACTAC BC056378.1 19 ACL-REV primer GGTTCAGCAAGGTCAGCTTC BC056378.1 20

The effects of the test substances on the expression of mRNA related to fat synthesis, decomposition, and energy metabolism in epididymal adipose tissue were analyzed, and the results are shown in Table 16.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 C/EBPα 1.00 ± 0.36 4.10 ± 0.05 ^*** 2.20 ± 0.48 ^## PPARγ 1.00 ± 0.12 2.25 ± 0.20 ^** 1.11 ± 0.06 ^## SREBP-1c 1.00 ± 0.12 2.41 ± 0.23 ^** 1.51±0.17 ^# CPT1 1.00 ± 0.19 0.37 ± 0.07 ^* 2.28 ± 0.14 ^### FAS 1.00 ± 0.52 2.90 ± 0.39 ^* 0.25 ± 0.10 ^### aP2 1.00 ± 0.11 1.98 ± 0.38 ^* 0.94±0.13 ^# HSL 1.00 ± 0.07 0.45 ± 0.04 ^*** 0.78 ± 0.07 ^## ACC1 1.01 ± 0.08 3.66 ± 0.42 ^*** 2.82 ± 0.35 ACL 0.96 ± 0.14 1.49 ± 0.15 ^* 0.75±0.16 ^#

(The above results were calculated as the expression amount of each substance compared to the expression amount of GAPDH, (expression amount of each substance / expression amount of GAPDH), and are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** means p < 0.001, # p < 0.05, ## p < 0.01, ### means p < 0.001)

Differentiation from preadipocytes into mature adipocytes occurs when transcriptional activating factors are activated in the adipocyte gene regulatory region. Transcription factors that regulate adipocyte differentiation include SREBPs (sterol-regulatory element-binding proteins) and PPARs (Peroxisome Proliferator- Activated Receptor), C/EBPs (CCAAT/enhancer binding protein), etc. SREBPs include SREBP-1 and SREBP-2. Among them, SREBP-1 is rapidly induced in the early stages of preadipocyte differentiation, promotes adipocyte differentiation, and plays a role in promoting fat metabolism by increasing the expression of genes related to fat metabolism. do.

As shown in Table 16, SREBP-1c mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (group 2) compared to the control diet group (group 1), and in the high-fat diet control group (group 2) Compared to mdB-44 200mg/kg BW administration group (group 3), it significantly decreased. In the early stage of adipocyte differentiation, C/EBPβ is expressed by hormonal induction (insulin, dexamethasone, etc.), and when C/EBPβ is activated, the expression of adipocyte transcription factors C/EBPα and PPARγ is induced in the late stage of differentiation. C/EBPα interacts with PPARγ to influence it. C/EBPα increases before the expression of specific genes in adipose tissue and regulates energy homeostasis. PPARγ is a major regulator of adipogenesis and is highly expressed in white adipose tissue. In epididymal adipose tissue, C/EBPα and PPAR-γ mRNA expression was significantly increased in the high-fat diet control group (group 2) compared to the control diet group (group 1), and compared to the high-fat diet control group (group 2). mdB-44 significantly decreased in the 200mg/kg BW administration group (Group 3).

FAS (fatty acid synthase) is an enzyme involved in fatty acid biosynthesis. When fatty acids are synthesized in the liver, they are converted into neutral fat and travel through blood vessels in the form of VLDL to deliver neutral fat to adipose tissue. FAS mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (group 2) compared with the control diet group (group 1), and mdB-44 200 mg/kg BW compared with the high-fat diet control group (group 2). There was a significant decrease in the administration group (Group 3).

aP2, known as a target gene for fat synthesis, is expressed in adipocytes and macrophages and is known to be involved in inflammation and metabolic reactions. aP2 mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (group 2) compared with the control diet group (group 1), and mdB-44 200 mg/kg compared with the high-fat diet control group (group 2). aP2 mRNA expression was significantly decreased in the BW administration group (Group 3) (Table 16).

CPT-1 (Carnitine palmitoyl transferase-1) is the rate-limiting enzyme that allows fatty acids to enter the mitochondria. In order for fatty acids to enter the cell and be oxidized, a transferase within the membrane is required. CPT-1 is one of these transferases, It plays a major role in utilization. CPT-1 mRNA expression in epididymal adipose tissue was significantly decreased in the high-fat diet control group (group 2) compared to the control diet group (group 1), and CPT-1 mRNA expression in the mdB-44 administration group (group 3) was significantly decreased. It significantly increased compared to the high-fat diet control group (Group 2).

HSL (hormone-sensitive lipase) is distributed in various organs, but is mainly activated in adipose tissue. It becomes activated HSL by secretion of hormones such as epinephrine or glucagon. Active HSL converts the triglycerides of lipoprotein into one glycerol and three molecules. It acts to break down fatty acids. HSL mRNA expression in epididymal adipose tissue was significantly decreased in the high-fat diet control group (group 2) compared to the control diet group (group 1). HSL mRNA expression was significantly increased in the mdB-44 200mg/kg BW administered group (Group 3) compared to the high-fat diet control group (Group 2) (Table 16).

ACC1 mainly exists in adipose tissue, where fatty acid synthesis is important, and ACC2 mainly exists in oxidative tissues such as skeletal muscle and heart, regulating fatty acid synthesis and oxidation. ACC1 mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (group 2) compared to the control diet group (group 1), and mdB-44 200 mg/kg compared to the high-fat diet control group (group 2). ACC1 mRNA expression was decreased in the BW treated group (Group 3)

ACL is an enzyme involved in the synthesis of cytoplasmic acetyl-CoA by converting citrate to acetyl-CoA, and is used in important biosynthetic pathways such as fatty acids and cholesterol. ACL mRNA expression in epididymal adipose tissue was significantly increased in the high-fat diet control group (group 2) compared with the control diet group (group 1), and mdB-44 200 mg/kg compared with the high-fat diet control group (group 2). ACL mRNA expression was significantly decreased in the BW administration group (Group 3).

6.7 Protein expression analysis in adipose tissue

To investigate protein expression in epididymal fat tissue, lysis buffer (Pierce® IP Lysis buffer, Thermo Scientific) was added to epididymal fat and then homogenized with a homogenizer. The homogenized solution was centrifuged at 12,000 rpm for 10 minutes, and the supernatant was taken to obtain epididymal adipose tissue lysates. The amount of protein in tissue lysate was measured using the BCA protein assay kit (Thermo Scientific).

Proteins (50 μg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene difluoride membrane (Milipore). After blocking the membrane in 5% skim milk-TBST (20 mmol/L Tris·HCl, pH 7.5, 150 mmol/L NaCl, 0.1% Tween 20) for 1 hour, each antibody to be measured was added and incubated at 4°C. It was stirred for 16 hours or at room temperature for 1 hour. Information on the antibodies used in the experiment is shown in Table 17. Afterwards, horseradish peroxidase (HRP)-linked anti-rabbit IgG or HRP-linked anti-mouse IgG was added and stirred for 1 hour, and each protein band was visualized using the enhanced chemiluminscence method using LuminataTM Forte Western HRP Substrate (Millipore). . Protein expression levels were quantified using ImageQuantTM LAS 500 imaging systems (GE Healthcare Bio-Sciences AB).

Antibody name Details manufacture company p-AMPK Phospho-AMPKα (Thr172) #2535 Cell Signaling Technology AMPK AMPKα #2532 Cell Signaling Technology β-actin Beta-actin #3700 Cell Signaling Technology

AMP-activated protein kinase (AMPK) is a factor that improves insulin resistance. Activated AMPK is known to block ATP consumption pathways such as fat and cholesterol synthesis, while activating ATP generation pathways such as glycolysis and fatty acid oxidation. . In particular, in relation to lipid metabolism, it is reported to play an important role in reducing body fat due to increased fatty acid oxidation by inhibiting the activity of the acetyl-CoA carboxylase (ACC) enzyme through protein phosphorylation.

To investigate the effect of the test substance on AMPK activity in epididymal adipose tissue, Western blot was performed and quantified using epididymal adipose tissue lysate, and the results are shown in Table 18.

group 1 group 2 group 3 experimental diet CD HFD HFD Test substance (mg/kg BW) - - mdB-44 200 p-AMPK/AMPK Ratio 1.00 ± 0.0 0.64 ± 0.04 ^* 1.50±0.22 ^#

(The above figures are expressed as mean ± standard error, ^* p < 0.05, ** p < 0.01, *** p < 0.001, # p < 0.05, ## p < 0.01, ### p < 0.001 )

As shown in Table 18, as a result of evaluating AMPK activity through the ratio of p-AMPK/AMPK, the activity of AMPK decreased in the high-fat diet control group (group 2) in the mdB-44 200mg/kg BW administration group (group 3). It increased significantly.

As confirmed above, quince extract administered with a high-fat diet effectively suppresses the increase in body weight, liver and adipose tissue weight, blood cholesterol, and blood insulin and leptin content induced by the high-fat diet, and increases the It was confirmed that size increase was suppressed. This suggests that quince has an anti-obesity effect and a lipid-improving effect on dietary obesity, and further has a prevention, treatment, and/or improvement effect on metabolic diseases. In the future, it has anti-obesity effects and/or prevention of metabolic diseases, It suggests the possibility of developing health functional materials with therapeutic and/or improving effects.

<110> BnG Inc. <120> Pharmaceutical Composition Comprising Marmelo Extract for Preventing or Treating Obesity <130> DPP20204136KR <160> 20 <170> koPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C/EBPalpha-FOR primer <400> 1 tggacaagaa cagcaacgag tac 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> C/EBPalpha-REV primer <400> 2 gcagttgccc atggccttga c 21 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma-FOR primer <400> 3 caaaacacca gtgtgaatta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PPARgamma-REV primer <400> 4 accatggtaa tttcttgtga 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> SREBP-1c-FOR primer <400> 5 cacttctgga gacatcgcaa ac 22 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SREBP-1c-REV primer <400> 6 atggtagaca acagccgcat c 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CPT1beta-FOR primer <400> 7 gtgctggagg tggctttggt 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CPT1beta-REV primer <400> 8 tgcttgacgg atgtggttcc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS-FOR primer <400> 9 aggggtcgac ctggtcctca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FAS-REV primer <400> 10 gccatgccca gagggtggtt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aP2-FOR primer <400> 11 ggatttggtc accatccggt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> aP2-REV primer <400> 12 ttcaccttcc tgtcgtctgc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HSL-FOR primer <400> 13 ccgttcctgc agactctctc 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HSL-REV primer <400> 14 ccacgcaact ctgggtctat 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-FOR primer <400> 15 aggttgtctc ctgcgact 18 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-REV primer <400> 16 tgctgtagcc gtattcattg tca 23 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ACC1-FOR primer <400> 17 ggagatgtac gctgaccgag aa 22 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ACC1-REV primer <400> 18 acccgacgca tggttttca 19 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACL-FOR primer <400> 19 tggatgccac agctgactac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ACL-REV primer <400> 20 ggttcagcaa ggtcagcttc 20

Claims (7)

A pharmaceutical composition for preventing or treating obesity, comprising marmelo extract,
The quince is a quince fruit,
The extract is prepared by removing the quince juice after pressing the quince and extracting the remaining solid quince with an extraction solvent,
The extraction solvent is 30 to 50 (v/v)% ethanol,
A pharmaceutical composition wherein the extraction is performed by adding 4 to 6 times the volume of ethanol at 65 to 80°C for 5 to 6 hours. delete delete delete delete The pharmaceutical composition for preventing or treating obesity according to claim 1, wherein the extract has a sugar content of 10 to 100 brix. The pharmaceutical composition for preventing or treating obesity according to claim 1, which has a weight or body fat reducing effect.