KR102115657B1 - Composition for anti-obesity including geranic acid as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for anti-obesity containing geranic acid as an active ingredient, and more specifically, the present invention is a pharmaceutical composition for preventing or treating anti-obesity or metabolic disease comprising geranic acid as an active ingredient, quasi-drug composition and health Functional food composition.

Description

Composition for anti-obesity containing geranic acid as an active ingredient {Composition for anti-obesity including geranic acid as an active ingredient}

The present invention relates to a composition for anti-obesity containing geranic acid as an active ingredient, and more specifically, the present invention is a pharmaceutical composition for preventing or treating anti-obesity or metabolic disease comprising geranic acid as an active ingredient, quasi-drug composition and health Functional food composition.

It is reported that around 300 million adults are obese and around 1.7 billion are overweight worldwide. According to a report by the Samsung Economic Research Institute, in 2011, it is estimated that the direct and indirect social costs caused by obesity in Korea are close to 3,400 trillion won. In addition, obese people have hypertension, diabetes, It is said that the risk of dyslipidemia is more than doubled, which increases the cost of health care. In the United States, as of 2006, obese people are reported to pay 42% more medical expenses than those who are normal, and 80% of diabetics and 69% of non-alcoholic fatty liver patients are known to be obese. .

The therapeutic market for obesity and metabolic diseases is expected to continue to increase. In particular, it is an area that is highly related to diabetes, various types of cancer, and bone diseases, which is an increasing burden on medical expenses in the country. In addition, the development of safe and effective obesity treatments as unmet medical needs that are not addressed by current treatments can reduce enormous socio-economic losses.

However, medicines that can solve the market situation are limited to appetite suppressants and fat absorption inhibitors, so they do not meet expectations, and there are various side effects presented below. Obesity treatments that have been approved for long-term use by the US FDA and sold to date are the only generic drugs (main ingredient, Orlistat; Roche, Korea), and inhibit fat absorption by inhibiting lipase in the small intestine. It shows side effects of gastrointestinal system such as decreased vitamin absorption. 'Reductil' (Abbott), which is based on the appetite suppressant Sibutramine, has been sold worldwide for a long time until the patent expires in 2009 after being approved by the U.S. FDA, but has headache, cramping, anorexia, insomnia, constipation. It has been reported that it shows side effects, and the sale was stopped in 2010. In addition, many products that have been developed as anti-obesity drugs have been banned due to serious side effects. As such, as Western medicine has shown limitations in overcoming side effects and chronic diseases of synthetic medicines, the value of natural foods is emerging.

Non-alcoholic fatty liver disease (NAFLD) refers to a disease in which triglycerides accumulate in the liver irrespective of drinking, and includes simple fatty liver and non-alcoholic steatohepatitis. NASH). Simple fatty liver is thought to be a benign disease with good clinical prognosis, but NASH, which is accompanied by inflammation or fibrosis with fatty liver, is a progressive liver disease and is recognized as a prostate disease that causes cirrhosis or liver cancer.

Obesity and insulin resistance are risk factors for typical non-alcoholic fatty liver disease. Risk factors for hepatic fibrosis progression include, for example, obesity (BMI> 30), blood liver function index ratio (AST / ALT> 1) and diabetes, especially if hepatitis C carriers are non-alcoholic fatty liver. Therefore, the need for prevention and treatment is emerging. 69 to 100% of non-alcoholic fatty liver patients are obese, and 20 to 40% of obese patients are accompanied by non-alcoholic fatty liver. In particular, the prevalence of liver disease among male obese patients is higher than that of female obese patients. It has been reported in Western society that 3 to 30% of obese patients as well as normal-weight adults exhibit nonalcoholic fatty liver lesions. The prevalence of non-alcoholic fatty liver in Japan, which is similar to our diet, is estimated at about 20%, of which 1% is estimated to be NASH. Non-alcoholic fatty liver is a problem not only in adults but also in obese children. Non-alcoholic fatty liver lesions occur in 10 to 77% of obese children (residents in Europe, the United States and Asia) because obesity is the most important risk factor for non-alcoholic liver disease.

The causes of nonalcoholic fatty liver disease can be explained by two mechanisms. The first is that the increase in free fatty acids inhibits fatty acid oxidation in hepatocytes, which leads to the accumulation and development of fatty acids in hepatocytes, and the second mechanism is known to be caused by all mechanisms of action in the body associated with inflammation and fibrosis progression. In other words, an increase in fatty acids increases the expression of cytochrome peroxidase 2E1 (CYP2E1), and generates free radicals to induce lipid peroxidation of the hepatocyte membrane, and an increase in LPS and oxidative stress leads to TNF-α. Increase to induce apoptosis of liver cells and progress liver damage. Insulin resistance and accumulation of fatty acids cause mitochondrial dysfunction, the latter increases reactive oxygen species and nitric oxide synthase (NOS), resulting in apoptosis.

The best way to treat NAFLD is through weight loss through lifestyle changes (typically exercise). However, if it is difficult to heal with exercise alone, treatment with drugs may be selected in parallel, and the therapeutic agents used in non-alcoholic fatty liver patients are largely classified into two concepts. The first is drugs that treat and improve fatty liver through the correction of risk factors, such as obesity drugs (orlistat), insulin resistance drugs (metformin, pioglitazone, rosiglitazone), and hyperlipidemia drugs (clofibrate, gemfibrozil, bezafibrate, atorvastatin, simvastatin). Belongs to That is, metformin increases the oxidation of fatty acids, reduces fat-forming enzymes, and improves insulinemia and insulin resistance. On the other hand, chiazolidinedione, rosiglitazone and pioglitazone activate the nuclear hormone receptor PPARγ to promote sugar absorption in muscles. The second type of treatment is a drug responsible for restoring liver cell damage independent of correcting risk factors for non-alcoholic fatty liver, hepatocellular protective agents (ursodioxycholic acid and taurine), antioxidants (vitamins E and C), and nutrition Adjuvants (lecithin, betaine, N-acetylcysteine) and the like belong to this, but until now, there are no ideal drugs that are effective in treatment without side effects.

Throughout this specification, a number of papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated by reference into the present specification as a whole, and the level of the technical field to which the present invention pertains and the content of the present invention are more clearly described.

The present inventors have made extensive efforts to develop a plant-derived substance that can effectively prevent or treat obesity, diabetes, hyperlipidemia or fatty liver, and are safe for the human body, and geranic acid is very effective in preventing or treating obesity, diabetes, hyperlipidemia or fatty liver. By discovering that, the present invention has been completed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition, quasi-drug composition and health functional food composition for the prevention or treatment of anti-obesity or metabolic diseases comprising geranic acid as an active ingredient.

The present invention is to solve the above-mentioned problems, and provides a pharmaceutical composition for preventing or treating anti-obesity or metabolic disease comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present inventors tried to develop a substance capable of effectively preventing or treating obesity and the like without side effects. As a result, when a high-fat diet containing geranic acid was ingested, the amount of visceral fat and triglyceride compared to a high-fat control diet alone. Plasma lipid concentrations such as concentration, total cholesterol concentration, and free fatty acid concentration were decreased, and a significant improvement was found as a result of measuring changes in lipid concentration and liver function levels in liver tissue.

Geranic acid used as an active ingredient in the composition of the present invention is a monoterpene (monoterpene) -based compound, IUPAC name is (2E) -3,7-dimethyl-2,6-octadienoic acid [(2E) -3,7-Dimethyl-2,6-octadienoic acid], the structural formula is C ₁₀ H ₁₆ O ₂ and the molecular weight is 168 g / mol. Other names are (E) -3,7-dimethylocta-2,6-dienoic acid, 3,7-dimethyl-2E, 6-octadienoic acid, 3,7-dimethylocta-2,6-dienoate, geranilyc acid, geranoic Also called acid, trans-3,7-dimethyl-2,6-octadien-1-oic acid, trans-geranic acid and trans-geranoic acid, and has a stereoisomer called nerolic acid. Geranic acid is a colorless or pale pale yellow, transparent oily liquid, insoluble in water and soluble in alcohol and propylene glycol.

Geranic acid is mainly contained in plants such as lemongrass ( Cymbopogon citratus), laurel (Chinese rose, Rosa chinensis ), and ginger ( Zingiber officinale Roscoe ), and is also an essential oil component of these plants. Geranic acid is known as an edible safe substance, and it is Flavor and Extract Manufacturers'Association (FEMA), Food and Drug Administration (FDA), Korea Food and Drug Administration (KFDA), Council of Europe (COE), and Joint FAO (JECFA). / WHO Expert Committee on Food Additives) has been approved as a flavor and fragrance agents component, and has been used for the purpose of industrial taste and aroma. Geranic acid has been used as a flavoring agent in perfumery and foods that produce geranium, rose, and scent.

According to oral toxicity test results, the half-lethal dose (LD ₅₀ value) of geranic acid was reported to be 3,700 mg / kg in rats and 4,000 mg / kg in mice. On the other hand, according to the results of a percutaneous toxicity test on rabbits, the LD50 value was 1,750 mg / kg. In addition, clinical trial results: It was reported that no skin irritation or sensitization reaction (sensitization) occurred in the 4% solution.

In addition, geranic acid has been reported as one of the components constituting pheromones (Pickett et al. Nasonov pheromone of the honey bee, Apis mellifera LJ Chemical Ecology, 6, 1980), browning of food and accumulation of melanin pigment in skin, etc. It is known to cause the enzyme, and it has been reported to exhibit inhibitory activity against tyrosinase. That is, geranic acid increased the inhibitory activity against tyrosinase concentration-dependently and the IC ₅₀ value was found to be 0.14 mM (Masuda et al. Identification of geranic acid, a tyrosinase inhibitor in lemongrass (Cymbopogon citratus). J. Agric. Food. Chem. 56: 597-601, 008). It has also been reported that geranic acid exhibits antifungal activity against Fusarium graminearum and Colletotrichum graminicola , which are representative fungi that cause disease in corn to reduce quality and yield (Yang et al. Metabolic engineering of geranic acid in maize to achieve fungal resistance is compromised by novel glycosylation patterns.Metabolic Engineering 13: 414-425, 2011).

However, the anti-obesity effect of geranic acid and the metabolic disease prevention or treatment effect associated with obesity are unknown.

The term "obesity" as used herein refers to an excessive accumulation of body fat in the body, and the term "metabolic disease" as used herein refers to a phenomenon in which various cardiovascular diseases and risk factors of type 2 diabetes form a cluster. Is conceptualized as a disease group, and it is a concept that encompasses insulin resistance and related complex and various metabolic abnormalities and clinical aspects. In 1988, Reaven insisted that the common cause of these symptoms was insulin resistance, which does not work well in the body, and named it insulin resistance syndrome, but in 1998 the World Health Organization (WHO) explained all the elements of these symptoms. The term metabolic syndrome or metabolic disease was introduced. Specifically, it includes, but is not limited to, diabetes, hyperlipidemia, non-alcoholic fatty liver, and the like.

As used herein, the term "diabetes" or "diabetes" refers to a disease characterized by high blood glucose concentration as a type of metabolic disease such as lack of insulin secretion or normal function.

The term "hyperlipidemia" as used herein refers to a disease caused by a large amount of fat in the blood because fat metabolism such as triglyceride and cholesterol is not properly performed. More specifically, hyperlipidemia includes hypercholesterolemia or hypertriglyceridemia with a high incidence of increased lipid components such as triglycerides, LDL cholesterol, phospholipids and free fatty acids in the blood.

The term "fatty liver" as used herein refers to a condition in which fat is accumulated in excessive amounts in liver cells due to liver metabolism disorder, which causes various diseases such as angina, myocardial infarction, stroke, arteriosclerosis, and pancreatitis. In particular, "non-alcoholic fatty liver" refers to a similar liver dysfunction and tissue damage seen in alcoholic liver disease in patients with no drinking history, and more specifically, in patients with no drinking history, accumulation of fat in the liver causes liver weight. It means that it accounts for more than about 5 to 10%.

According to a preferred embodiment of the invention, the composition of the invention reduces liver fat or visceral fat.

In the present invention, the terms "liver" and "intestine" include cells or tissue, respectively.

The term "reduction" or "increase" in the present specification means that the concentration of the substance, the value of the biochemical index, the expression level of the gene or protein is significantly reduced or increased compared to the control group without administration of the composition of the present invention. And, preferably means reduced or increased by 30% or more, more preferably means reduced or increased by 20% or more, and even more preferably means reduced or increased by 10% or more.

According to the present invention, the composition intake group of the present invention significantly decreased the lipid concentration in the blood and liver tissues compared to the high fat diet (HFD) control group, and the total visceral fat weight was significantly reduced by 35%.

According to a more preferred embodiment of the invention, the fat of the invention comprises triglycerides, cholesterol and free fatty acids. According to a more preferred embodiment of the present invention, the visceral fat of the present invention comprises one or more fats selected from epididymal fat, kidney peripheral fat, mesenteric fat and posterior abdominal fat.

According to a preferred embodiment of the present invention, the composition of the present invention can reduce blood glucose concentration or insulin concentration.

According to a preferred embodiment of the present invention, the composition of the present invention reduces the activity of alanine aminotransferase (ALT) in the blood.

In the present invention, the term "ALT (alanine aminotransferase)" is an enzyme that increases the levels in the blood, respectively, when the liver is damaged, an enzyme that is utilized as an indicator of liver function by using these properties.

It was confirmed that the composition of the present invention significantly improves fatty liver by significantly alleviating fatty liver, more preferably, non-alcoholic fatty liver phenomenon by significantly reducing ALT activity in the blood by 34% compared to the control group. Therefore, the composition of the present invention ultimately has the effect of significantly improving the fatty liver appearing in obesity induced by a high-fat diet.

According to a preferred embodiment of the present invention, the composition of the present invention increases the expression of genes related to heat generation or decreases the expression of genes related to fat accumulation. Preferably, the gene for heat generation may be selected from the group consisting of Uncoupling protein 1 (UCP1), Uncoupling protein 3 (UCP3) and Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC1-α), but is not limited thereto. . In addition, preferably, the fat accumulation-related gene includes C / EBPα (CCAAT / enhancer binding protein alpha), PPARγ2 (Peroxisome proliferator activated receptor gamma 2), CD36 (Cluster of differentiation 36), FAS (Fatty acid synthase) and leptin (Leptin, Lipoprotein lipase), but is not limited thereto.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is commonly used in formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but is not limited thereto It does not work. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19 th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, and is preferably applied by oral administration.

Suitable dosages of the pharmaceutical compositions of the present invention are variously prescribed by factors such as formulation method, administration method, patient's age, weight, sex, morbidity, food, administration time, route of administration, excretion rate and response sensitivity. Can be. The preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001 to 100 mg / kg on an adult basis.

The pharmaceutical composition of the present invention is prepared in a unit dose form by formulating using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by a person skilled in the art to which the present invention pertains. Or it can be manufactured by incorporating into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or may be in the form of ex-agent, powder, granule, tablet or capsule, and may further include a dispersant or stabilizer.

According to another aspect of the present invention, the present invention provides a quasi-drug composition for preventing or improving anti-obesity or metabolic disease comprising geranic acid or a salt thereof as an active ingredient.

When the composition of the present invention is used as a quasi-drug composition, the geranic acid or a pharmaceutically acceptable salt thereof may be added as it is or used with other quasi-drug components, and may be suitably used according to a conventional method. The mixing amount of the active ingredient can be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). According to one embodiment of the present invention, the quasi-drug composition of the present invention may be a disinfecting cleanser, toothpaste, shower foam, gagreen, wipes, detergent soap, hand wash, humidifier filler, mask, ointment or filter filler.

According to another aspect of the present invention, the present invention provides a health functional food composition for preventing or improving anti-obesity or metabolic disease comprising geranic acid or a salt thereof as an active ingredient.

When the composition of the present invention is made of a functional food composition or a food composition, it contains not only geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient, but also a component commonly added in the production of a functional food or food, for example For example, it contains proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the aforementioned carbohydrates include monosaccharides, such as glucose, fructose, and the like; Disacaride, for example maltose, sucrose, oligosaccharides, etc .; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents such as taumatin, stevia extract (eg, rebaudioside A, glycyrrhizine, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

When the functional food or food composition of the present invention is prepared as a drink agent, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, worm extract, in addition to geranic acid or a pharmaceutically acceptable salt thereof, which is an active ingredient of the present invention, Jujube extract or licorice extract may be additionally included.

Since the quasi-drug and nutraceutical composition of the present invention share the above-described pharmaceutical composition and active ingredient and use, common contents in relation to the pharmaceutical composition are omitted in order to avoid excessive complexity of the present specification. do.

The composition of the present invention exerts an effect of remarkably alleviating obesity induced by a high fat diet by inducing a decrease in body weight and visceral fat, a decrease in blood triglyceride, total cholesterol, free fatty acid concentration and liver tissue triglyceride concentration, and obesity It is effective for prevention and treatment of diabetes, hyperlipidemia or non-alcoholic fatty liver.

Figure 1 shows the change in weight gain (a), cumulative weight gain (b), and dietary intake (c) according to the breeding period of the mice fed the experimental diet (hereinafter, the result data in the figure is average of 8 animals) ± standard deviation, other letters on the bar show a significant difference at P <0.001).
Figure 2 shows the visceral fat tissue picture (a) by region and visceral fat weight (b) by region of the mice fed the experimental diet ( P <0.001).
Figure 3 shows the blood lipid concentration and insulin resistance index of the mice fed the experimental diet: triglyceride concentration (a), total cholesterol concentration (b), HDL-cholesterol concentration (c), free fatty acid concentration (d), Glucose concentration (e), and insulin concentration (f) ( P <0.05).
Figure 4 shows the indicators related to non-alcoholic fatty liver in mice fed the experimental diet: liver tissue photo (a), liver weight (b), triglyceride concentration (c), cholesterol concentration (d), free fatty acid concentration ( e), Alanine aminotransferase concentration (f) ( P <0.05).
FIG. 5 shows the expression change of the gene (a) related to heat generation (thermogenesis) and the gene related to adiogenesis (b) in mouse visceral adipose tissue ( P <0.05).

Below, The present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1: Efficacy of reducing the weight and visceral fat of geranic acid in dietary obese mice

1-1. Preparation of experimental diet and breeding of experimental animals

The obesity-induced diet used in this experiment was a high fat diet (HFD: 40% fat calories, 17 g lard + 3% corn oil / 100 g diet), and geranic acid The supplemented diet (geranic acid-supplemented high fat diet, Geranic acid) had the same composition as HFD, but contained geranic acid at a level of 0.2% [Table 1]. The normal diet (Chow) consumed commercial rodent feed. Geranic acid was purchased from Sigma-Aldrich.

Experimental formula composition table ingredient High fat diet
(HFD) (g / kg diet) Dietary supplements with geranic acid
(Geranic acid) (g / kg diet) Casein 200 200 DL-methionine 3 3 Corn starch 111 109 Sucrose 370 370 cellulose 50 50 Corn oil 30 30 Raad 170 170 Vitamin complex 12 12 Mineral complex 42 42 Choline bitartrate 2 2 cholesterol 10 10 tert-butyhydroquinone 0.04 0.04 Test substance - 2 Total (g) 1,000 1,000 Fat (% calorie) 39.0 39.0 Total calories, kJ / kg diet 19,315 19,315

Male C57BL / 6J mice (Orient, Korea), 5 weeks of age, were adapted to the laboratory environment for 1 week as solid feed, and were randomly placed into high-fat diet and experimental groups according to the egg mass method, and then reared for a total of 11 weeks. The diet was supplied daily with water between 10 am and 11 am, the dietary intake was measured daily, and the weight was measured weekly. In order to prevent sudden changes in body weight due to feed intake, the feeder was removed and the body weight was measured 2 hours later. After fasting the test animals for more than 12 hours, blood, liver and visceral fat tissues (eg, epididymal fat, kidney peripheral fat, mesenteric fat, and posterior abdominal fat) are collected under anesthesia with diethyl ether and 0.1 M phosphoric acid. After washing with a buffer solution (pH 7.4), the weight was measured. Blood collected from the abdominal aorta was centrifuged at 1,000 × g for 15 minutes to separate plasma.

1-2. Weight and visceral fat weight changes

When the experimental diet was ingested for 11 weeks, and the weight gain of the final body weight and 11 weeks was examined, the cumulative weight gain was significantly reduced by 40% in the group supplemented with geranic acid (Geranic acid) compared to the high-fat diet (HFD). ( P <0.001, FIGS. 1A, 1B). It was found that the intake of geranic acid did not cause a significant change in daily dietary intake (FIG. 1C), and thus, the weight loss efficacy of geranic acid was not due to appetite suppression.

After ingesting the experimental diet for 11 weeks, the testicular fat, kidney peripheral fat, mesenteric fat, and posterior abdominal fat constituting visceral fat were individually extracted and weighed, and the group supplemented with geranic acid compared to the control group (HFD) ( Geranic acid) significantly decreased epididymal fat, kidney peripheral fat, mesenteric fat, and posterior abdominal fat weight, and the total visceral fat weight of all four sites was also significantly reduced ( P <0.001, FIG. 2). Therefore, it was confirmed that geranic acid has a very excellent weight and visceral fat reduction effect.

Example 2: Hyperlipidemia prevention and treatment efficacy of geranic acid in dietary obese mice

2-1. Methods for biochemical analysis of blood

To evaluate plasma cholesterol, triglyceride, free fatty acid, and glucose concentrations on an empty stomach of laboratory animals raised for 11 weeks, each was measured twice using a commercial measurement kit (Bio Clinical System).

2-2. Changes in blood lipid levels and blood sugar

Looking at the plasma lipid concentration of the mice fed the experimental diet for 11 weeks, the triglyceride concentration in the geranic acid group was significantly reduced by 24%, the total cholesterol concentration by 26%, and the free fatty acid concentration by 32%, respectively. Meanwhile, HDL-cholesterol concentration in blood was not significantly different between the experimental groups. In addition, blood glucose and insulin concentrations in the fasting group were significantly reduced in the geranic acid group by 30% and 45%, respectively, compared to the HFD group ( P <0.05, FIG. 3). Therefore, it was found that geranic acid has an effect of significantly alleviating the symptoms of hyperlipidemia, hyperglycemia and insulin resistance in obesity induced by the high-fat diet.

Example 3: Non-alcoholic fatty liver prevention and treatment efficacy of geranic acid in dietary obese mice

3-1. Method for analyzing lipid concentration in liver tissue

Lipid components of liver tissues according to the method of Folch et al. (Folch J, Lees M, Sloane Stanley GH.A simple method for the isolation and purification of total lipides from animal tissues.J Biol Chem. 1957; 226: 497-509) It was extracted as follows. After adding 1 ml of distilled water to the liver tissue (0.25 g), it was homogenized using a Polytron homogenizer (IKA-WERKE GmbH & Co., Ultra-Turrax, Staufen, Germany). To the homogeneous solution, 5 ml of chloroform: methanol solution (2: 1, v / v) was added and mixed well, followed by centrifugation at 1000 × g for 10 minutes to separate the lower layer solution, and the supernatant was again chloroform: methanol solution (2 : 1, v / v) After adding 2 ml, the same process was repeated to completely separate lipid components from the liver. 3 ml of a solution of chloroform: methanol: 0.05% CaCl ₂ (3:48:47, v / v / v) was added to the obtained lower layer liquid, mixed for 1 minute, and centrifuged at 1000 × g for 10 minutes, and the final lower layer liquid was After taking and completely drying with nitrogen gas, the dried lipid was dissolved in 1 mL of methanol and used for lipid composition analysis.

The triglyceride, cholesterol and free fatty acid concentrations of the liver tissue lipid extract were measured using the same commercial lipid analysis kit (Bio Clinical System) used for plasma lipid analysis.

3-2. Changes in lipid concentration and liver function in liver tissue

Looking at the liver weight of mice fed the experimental diet for 11 weeks, the absolute liver weight (g) in the geranic acid group was significantly reduced by 31% compared to the HFD group (FIGS. 4A and 4B). When looking at the lipid concentration in the liver tissue, in the geranic acid group, the triglyceride concentration was 23%, the cholesterol concentration was 29%, and the free fatty acid concentration was significantly reduced compared to the HFD group (FIG. 4c, 4d, 4e). In addition, the activity of alanine aminotransferase, a liver function level measured in blood, was significantly reduced in the geranic acid group by 34% compared to the HFD group (FIG. 4F). Therefore, it can be seen that geranic acid has an effect of significantly alleviating the fatty liver phenomenon in obesity induced by the high-fat diet.

Example 4: Regulation of gene expression related to fat accumulation and heat generation by geranic acid

4-1. RNA isolation and real-time PCR analysis

After adding 1 ml of Trizol solution per 0.1 g of visceral adipose tissue, the tissue was crushed, and centrifuged at 4 ° C and 12,000 × g for 10 minutes. After transferring the supernatant to a new tube, 200 μl of chloroform was added and vortexed. After repeating this process twice, the supernatant was transferred to a new tube, and then isopropanol and supernatant were added in a 1: 1 ratio. After shaking ten times and standing at room temperature for 10 minutes, the supernatant was removed by centrifugation at 12,000 × g, 4 ° C for 10 minutes, and 1 ml of 70% ethanol was added to the remaining precipitate at 7,500 × g, 5 at 4 ° C. Centrifuge for minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 5 minutes, and the RNA pellet was dissolved using water containing no nuclease. The concentration of RNA samples extracted at wavelengths of 260 nm and 280 nm was measured using a UV / VIS spectrometer (Beckman coulter, DU730), and agarose gel electrophoresis was performed to confirm the purity of the RNA samples.

In order to measure the expression of genes, real-time quantitative PCR was performed using SYBR Green (Bio-Rad, Hercules, CA, USA), and the instrument was real-time PCR (CFX Connect® Real-Time PCR Detection System, Bio-Rad). Was used. The base sequence of PCR primers for each gene is shown in [Table 2] below. In the real-time PCR reaction, 2 μL of cDNA and 10 μL of 2X SYBR mixture in a total of 20 μL, and 10-20 pmol / μL of each of the forward and reverse primers were added in 1 μL, and the rest was filled with water. The PCR amplification step was as follows, and the amplification cycle was 35 cycles. To start at high temperature, 1 minute at 95 ° C, the denaturation step of the amplification step is repeated at 95 ° C for 15 seconds, the annealing step at 55 ° C for 30 seconds, and the extension step is repeated at 72 ° C for 1 minute. It was recorded. After all the cycles were completed, a melting curve analysis was performed to confirm the specificity of the primers.

Primer sequences used for semi-quantitative RT-PCR analysis Gene description Primers Sequences (5 '→ 3') Annealing temperature (℃) PCR product (bp) Peroxisome proliferator activated receptor gamma 2 (PPARγ2) F TTCGGAATCAGCTCTGTGGA 55 148 R CCATTGGGTCAGCTCTTGTG CCAAT / enhancer binding protein alpha
(C / EBPα) F TCGGTGCGTCTAAGATGAGG 55 187 R TCAAGGCACATTTTTGCTCC Cluster of differentiation 36
(CD36) F ATGACGTGGCAAAGAACAGC 55 160 R GAAGGCTCAAAGATGGCTCC Fatty acid synthase
(FAS) F AGGGGTCGACCTGGTCCTCA 65 132 R GCCATGCCCAGAGGGTGGTT Lipoprotein lipase
(Leptin) F CTCCAAGGTTGTCCAGGGTT 55 143 R AAAACTCCCCACAGAATGGG Uncoupling protein 1
(UCP1) F GGTTTGCACCACACTCCTG 70 108 R ACATGGACATCGCACAGCTT Uncoupling protein 3
(UCP3) F ATGCTGAAGATGGTGGCTCA 55 179 R TTGCCTTGTTCAAAACGGAG Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha
(PGC1-α) F TAAATCTGCGGGATGATGGA 67 109 R GTTTCGTTCGACCTGCGTAA Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) F AGAACATCATCCCTGCATCC 55 321 R TCCACCACCCTGTTGCTGTA

4-2. Changes in gene expression in visceral fat tissue

As a result of measuring the expression of genes (UCP1, UCP3) and transcription regulators (PGC-1α) involved in heat generation in visceral adipose tissue using real-time PCR experiments, HFD group related to heat generation compared to Chow group All of the genes were significantly reduced in expression. Supplementation with geranic acid significantly increased UCP1, UCP3, and PGC-1α gene expression, which were decreased by high-fat diet intake (Figure 5A).

In the case of the HFD group, the expressions of nuclear transcription factors C / EBPα and PPARγ2, which play an important role in adiogenesis, and the target genes of these transcription factors, CD36, FAS, and leptin, are significantly increased compared to the Chow group. Did. As a result of supplementing and ingesting geranic acid to the mice ingesting the high-fat diet, the nuclear transcript factor and its target gene expression, which were increased by high-fat diet intake in the visceral fat tissue, were all significantly reduced again (FIG. 5B). Therefore, it was found that the supplementation of geranic acid prevented the accumulation of visceral fat by increasing the gene expression related to heat generation in visceral fat tissue and decreasing the nuclear transcription factor and its target gene expression, which play a pivotal role in fat production.

Since the specific parts of the present invention have been described in detail above, it is clear that for those skilled in the art, this specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Composition for anti-obesity including geranic acid as an active          ingredient <130> 1062793 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Peroxisome proliferator activated receptor gamma 2_F primer <400> 1 ttcggaatca gctctgtgga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Peroxisome proliferator activated receptor gamma 2_R primer <400> 2 ccattgggtc agctcttgtg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCAAT / enhancer binding protein alpha_F primer <400> 3 tcggtgcgtc taagatgagg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CCAAT / enhancer binding protein alpha_R primer <400> 4 tcaaggcaca tttttgctcc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cluster of differentiation 36_F primer <400> 5 atgacgtggc aaagaacagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cluster of differentiation 36_R primer <400> 6 gaaggctcaa agatggctcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fatty acid synthase_F primer <400> 7 aggggtcgac ctggtcctca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Fatty acid synthase_R primer <400> 8 gccatgccca gagggtggtt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lipoprotein lipase_F primer <400> 9 ctccaaggtt gtccagggtt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lipoprotein lipase_R primer <400> 10 aaaactcccc acagaatggg 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Uncoupling protein 1_F primer <400> 11 ggtttgcacc acactcctg 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Uncoupling protein 1_R primer <400> 12 acatggacat cgcacagctt 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Uncoupling protein 3_F primer <400> 13 atgctgaaga tggtggctca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Uncoupling protein 3_R primer <400> 14 ttgccttgtt caaaacggag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Peroxisome proliferator-activated receptor-gamma coactivator 1          alpha_F primer <400> 15 taaatctgcg ggatgatgga 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Peroxisome proliferator-activated receptor-gamma coactivator 1          alpha_R primer <400> 16 gtttcgttcg acctgcgtaa 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glyceraldehyde-3-phosphate dehydrogenase_F primer <400> 17 agaacatcat ccctgcatcc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glyceraldehyde-3-phosphate dehydrogenase_R primer <400> 18 tccaccaccc tgttgctgta 20

Claims (11)

A pharmaceutical composition for preventing or treating diabetes, comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
According to claim 1,
The composition is a pharmaceutical composition that will reduce liver fat or visceral fat.
According to claim 2,
The fat is a pharmaceutical composition comprising triglycerides, cholesterol or free fatty acids.
According to claim 1,
The composition is a pharmaceutical composition, characterized in that for reducing blood glucose concentration or insulin concentration.
According to claim 1,
The composition is a pharmaceutical composition, characterized in that to reduce the activity of ALT (alanine aminotransferase) in the blood.
According to claim 1,
The composition is characterized by increasing the expression of genes related to heat generation,
The heat-generating gene UCP1 (Uncoupling protein 1), UCP3 (Uncoupling protein 3) and PGC1-α (Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha) is selected from the group consisting of at least one pharmaceutical composition.
delete According to claim 1,
The composition is characterized by reducing the expression of fat accumulation-related genes,
The fat accumulation related genes include C / EBPα (CCAAT / enhancer binding protein alpha), PPARγ2 (Peroxisome proliferator activated receptor gamma 2), CD36 (Cluster of differentiation 36), FAS (Fatty acid synthase) and leptin (Leptin, Lipoprotein lipase). At least one pharmaceutical composition selected from the group consisting of.
delete A quasi-drug composition for preventing or improving diabetes, comprising geranic acid or a salt thereof as an active ingredient.
A health functional food composition for preventing or improving diabetes, comprising geranic acid or a salt thereof as an active ingredient.

Images