KR102614382B1 - Pharmaceutical composition and health functional food composition for the treatment of muscle weakness - Google Patents

Abstract

The present invention relates to a pharmaceutical composition and a health functional food composition for treating muscle weakness diseases. More specifically, the present invention relates to a synergistic effect on improving muscle fibers, enhancing muscle cell differentiation, skeletal muscle synthesis, and improving muscle function by mixing a plant extract and a honeysuckle extract. It relates to pharmaceutical compositions and health functional food compositions for treating muscle weakness diseases that can be provided.
This result was researched with support from the Technology Commercialization Support Project of the Agriculture, Food and Rural Affairs Technology Planning and Evaluation Institute funded by the Ministry of Agriculture, Food and Rural Affairs (821059-03).

Description

Pharmaceutical composition and health functional food composition for the treatment of muscle weakness diseases {Pharmaceutical composition and health functional food composition for the treatment of muscle weakness}

The present invention relates to a pharmaceutical composition and a health functional food composition for treating muscle weakness diseases. More specifically, the present invention relates to a synergistic effect on improving muscle fibers, enhancing muscle cell differentiation, skeletal muscle synthesis, and improving muscle function by mixing a plant extract and a honeysuckle extract. It relates to pharmaceutical compositions and health functional food compositions for treating muscle weakness diseases that can be provided.

Skeletal muscle is the largest organ in the human body, accounting for 40 to 50% of total body weight, and plays an important role in various metabolic functions in the body, including energy homeostasis and heat production. A person's muscle begins to decrease by more than 1% per year after the age of 40, and decreases to 50% of maximum muscle mass by the age of 80, so muscle loss in old age is recognized as the most important cause of overall decline in physical function.

It has been reported that the morbidity rate of overweight or obesity increases rapidly as aging progresses, and not only do older adults with obesity have more difficulty moving than those with normal weight, but their mortality rate also increases rapidly.

Obesity in old age is known to be one of the causes of muscle loss. In other words, when obesity is induced, mast cell-derived inflammatory factors increase along with a decrease in muscle mass due to intramuscular fat deposition, and muscle mass and muscle function are further weakened due to a decrease in muscle mitochondrial function. Additionally, if there is an abnormality in insulin secretion due to obesity, energy cannot be properly supplied to cells, which can lead to muscle development problems and the development of sarcopenia.

Sarcopenia is known to be closely related to geriatric chronic diseases such as osteoporosis, insulin resistance, and arthritis, and the decline in physical activity caused by aging can be alleviated by preventing or improving sarcopenia. The global market for treatments for progressive ataxia and muscle weakness recorded approximately $14 billion in 2011, and is expected to grow at a compound annual growth rate of 9.4% thereafter, reaching approximately $23.5 billion in 2017.

Treatment methods for sarcopenia include increasing mitochondrial production, inhibiting the breakdown of muscle proteins, and using anti-inflammatory drugs, but there is currently no clear treatment.

A diet of consuming 25 to 30 g of high-quality protein per meal has been proposed to prevent sarcopenia, but this can only be achieved by consuming 4 to 5 eggs or about 120 g of chicken breast with each meal. In reality, it is very difficult for the general public to practice.

Therefore, many people have recently chosen protein supplements as an alternative, but intake of protein supplements can cause excessive protein intake, which increases the likelihood of side effects. Moreover, if you have kidney disease, you cannot follow a high-protein diet, and as aging progresses, kidney function also decreases, so alternatives other than high-protein intake are needed to prevent sarcopenia.

To solve this problem, Republic of Korea Patent No. 10-1913828 discloses a composition for promoting differentiation from muscle stem cells to muscle cells containing Lithospermum erythrorhizon extract as an active ingredient.

Meanwhile, the present inventors developed a Lithospermum erythrorhizon complex by studying various types of extracts that can be used in combination with the Lithospermum erythrorhizon extract disclosed in the above registered patent to further maximize the efficacy against sarcopenia, etc.

Republic of Korea Patent No. 10-1913828 Republic of Korea Patent No. 10-1944985 Republic of Korea Patent Publication No. 10-2005-0005633 Republic of Korea Patent No. 10-1719709

Accordingly, the present invention was devised to solve the above problems, and the purpose of the present invention is to provide a synergistic effect on improving muscle fibers, enhancing muscle cell differentiation, skeletal muscle synthesis, and improving muscle function by administering the plant extract and honeysuckle extract in combination. The aim is to provide a pharmaceutical composition for preventing or treating muscle weakness diseases and a health functional food composition for suppressing muscle loss.

The problems to be solved by the present invention are not limited to those mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

As a means to achieve the purpose of the present invention, the pharmaceutical composition and health functional food composition for treating muscle weakness diseases according to the present invention are characterized by containing plant extract and honeysuckle extract as active ingredients.

The forage extract according to the present invention includes a solvent crude extract of forage and its solvent fraction, and the honeysuckle extract includes a solvent crude extract of honeysuckle and its solvent fraction. Hereinafter, the present invention will be described in more detail.

“Jicho” as used in this specification has red roots and has long been known to have excellent effects on the stomach, tonicity, detoxification, antipyretics, and blood purification. It is not only used as a natural pigment, but is currently also used as a raw material for Jindo Hongju. It has been reported that ground grass has various effects, including antioxidant, anti-inflammatory, anticancer, and antibacterial activities.

“Lonicera japonica Thunb.” in the present specification has a scientific name, Lonicera japonica Thunb., and may refer to a semi-evergreen broad-leaved vine shrub, and “Lonicera japonica Thunb.” may be the stem of Lonicera japonica Thunb. The growing environment is semi-shade with good drainage and high soil fertility. It grows up to 2~4m tall. The leaves are oval, 3~8cm long, 1~3cm wide, and have no teeth. It is reported that Indong has preventive and therapeutic effects on obesity and metabolic diseases.

The 'extract' includes a solvent crude extract, a specific solvent-soluble extract (solvent fraction), and a solvent fraction of the solvent crude extract, and the forage extract may be in the form of a solution, concentrate, or powder.

In the present invention, differentiation from muscle stem cells to muscle cells can be promoted, and the muscle stem cells may be satellite cells or myoblasts, for example, myoblasts, and the muscle cells may be myoblasts. It may be a myocyte or a myotube, for example, a myotube cell, but is not limited thereto.

The forage extract may be a forage root extract, but is not limited thereto, and the honeysuckle extract may be a forage leaf or stem extract, but is not limited thereto.

The groundweed extract or honeysuckle extract may be a crude extract obtained by extracting the groundweed or honeysuckle with water and one or more solvents selected from the group consisting of straight-chain or branched alcohols having 1 to 4 carbon atoms.

When a mixture of water and alcohol is used as a solvent used in the production of crude extracts of ground grass or honeysuckle, 10% or more to less than 100% (v/v), 20% or more to less than 100% (v/v), 30 % or more to less than 100% (v/v), 40% or more to less than 100% (v/v), 50% or more to less than 100% (v/v), 60% or more to less than 100% (v/v) , 70% or more to less than 100% (v/v), 10% or more to less than 90% (v/v), 20% or more to less than 90% (v/v), 30% or more to 90% (v/v) ) less than 40% to less than 90% (v/v), more than 50% to less than 90% (v/v), more than 60% to less than 90% (v/v) or more than 70% to 90% (v/v) /v) may be an aqueous solution of a straight-chain or branched alcohol having 1 to 4 carbon atoms, for example, 80% (v/v) of an aqueous solution of a straight-chain or branched alcohol having 1 to 4 carbon atoms.

Additionally, the alcohol aqueous solution may be one or more selected from the group consisting of an aqueous methanol solution, an aqueous ethanol solution, an aqueous propanol solution, and an aqueous butanol solution. For example, it may be an aqueous ethanol solution, but is not limited thereto.

The weed extract or honeysuckle extract according to the present invention may be a solvent fraction obtained by fractionating a crude solvent extract with an additional solvent. For example, the crude solvent extract may be mixed with at least one selected from the group consisting of ethyl ether, ethyl acetate, and butanol. It may be a solvent fraction using a solvent.

For example, the crude solvent extract obtained by extracting the forage with one or more solvents selected from the group consisting of water and straight-chain or branched alcohols having 1 to 4 carbon atoms is mixed with one or more solvents selected from the group consisting of ethyl ether, ethyl acetate, and butanol. It may be a solvent fraction using a solvent.

One aspect of the present invention relates to a production method of mixing ground root extract and honeysuckle extract at a specific weight ratio.

The forage extract or honeysuckle extract includes the solvent crude extract and solvent fraction of the forage as described above.

The forage extract may be a crude extract obtained by extracting one or more species selected from the group consisting of leaves, stems and roots of forage with one or more solvents selected from the group consisting of water and straight-chain or branched alcohols having 1 to 4 carbon atoms. there is.

The honeysuckle extract may be a crude extract obtained by extracting one or more species selected from the group consisting of leaves, stems and roots of honeysuckle with water and one or more solvents selected from the group consisting of straight-chain or branched alcohols having 1 to 4 carbon atoms. there is.

The solvent is 10% to less than 100% (v/v), 20% to less than 100% (v/v), 30% to less than 100% (v/v), and 40% to 100% (v/v). /v), 50% or more to less than 100% (v/v), 60% or more to less than 100% (v/v), 70% or more to less than 100% (v/v), 10% or more to 90% Less than (v/v), 20% or more to less than 90% (v/v), 30% or more to less than 90% (v/v), 40% or more to less than 90% (v/v), 50% or more Less than 90% (v/v), more than 60% to less than 90% (v/v), or more than 70% to 90% (v/v) of an aqueous solution of straight-chain or branched alcohol having 1 to 4 carbon atoms, for example, It may be an 80% (v/v) aqueous solution of straight-chain or branched alcohol having 1 to 4 carbon atoms.

The manufacturing process of the weed extract in the present invention will be described in more detail as follows. After cutting the forage and washing with water to remove contaminants, reflux extraction is performed with an extraction solvent of about 10 to 20 times the weight of the forage. After extraction, filter and collect the filtrate. The extraction temperature is not particularly limited, but is preferably 15 to 110 degrees Celsius, preferably 20 to 90 degrees Celsius.

The extraction process can be repeated once or several times, and in a preferred example of the present invention, a method of re-extraction after the first extraction can be adopted, which means that even if the herbal medicine extract is effectively filtered when mass-producing the herbal medicine extract, the herbal medicine itself is damaged. This is to prevent loss as the moisture content is high, which reduces extraction efficiency through primary extraction alone. In addition, as a result of verifying the extraction efficiency at each stage, it was found that about 80 to 90% of the total extraction amount was extracted through secondary extraction.

In one example of the present invention, when the extraction process is repeated twice, the obtained residue is refluxed and extracted again with about 5 to 15 times the volume of the extraction solvent, preferably 8 to 12 times the volume. After extraction, it is filtered, combined with the previously obtained filtrate, and concentrated under reduced pressure to prepare a forage extract. In this way, extraction efficiency can be increased by performing two extractions and mixing the filtrate obtained after each extraction, but the extract of the present invention is not limited to extraction recovery.

If the amount of solvent used in preparing the forage extract is too small, stirring becomes difficult and the solubility of the extract decreases, resulting in lower extraction efficiency. If it is too large, the amount of solvent used in the next purification step increases, making it uneconomical. Since handling problems may occur, it is recommended that the amount of solvent used be within the above range.

The filtered extract obtained in this way is about 10 to 30 times by weight, preferably 15 to 25 times by weight, more preferably about 15 to 25 times the total amount of the concentrate in order to control the content of remaining lower alcohol to be suitable for use as a pharmaceutical raw material. It can be prepared as a powdered forage extract by azeotropically concentrating 1 to 5 times, preferably 2 to 3 times, with 20 times the weight of water, suspending it homogeneously by adding the same amount of water again, and then freeze-drying.

The extraction method used in the present invention may be any commonly used method, for example, cold immersion, hot water extraction, ultrasonic extraction, or reflux cooling extraction, but is not limited thereto.

In the present invention, the manufacturing process of the honeysuckle extract can be applied in the same manner as the manufacturing process of the weed extract described above.

The term “muscle weakness disease” as used herein refers to any disease in which muscle tissue or muscle cells are reduced or lost. The muscle weakness may be limited to one muscle, one side of the body, upper or lower extremities, etc., or may appear throughout the entire body. Additionally, subjective symptoms of muscle weakness, including muscle fatigue or muscle pain, can be quantified objectively through physical examination.

The disease related to muscle weakness may be sarcopenia, muscular dystrophy, muscle dystrophy, or cardiac atrophy, but is not limited thereto.

Sarcopenia of the present invention refers to a gradual decrease in skeletal muscle mass due to aging, which directly causes a decrease in muscle strength and, as a result, refers to a condition that can cause a decrease in various body functions and disorders, for example, obesity. It may be sexual sarcopenia, but is not limited to this.

The above-mentioned obese sarcopenia refers to a phenomenon in which obesity in old age further aggravates muscle loss. Due to obesity, fat is deposited within the muscles, resulting in a decrease in muscle mass, an increase in inflammatory factors derived from mast cells, and an increase in the number of mitochondria in the muscles. Decreased function may further weaken muscle function, and if insulin secretion abnormalities occur due to obesity, energy may not be properly supplied to cells, which may cause muscle development disorders.

The muscular atrophy is a gradual atrophy of the muscles of the extremities, causing progressive degeneration of motor nerve fibers and cells in the spinal cord, resulting in amyotrophic lateral sclerosis (ALS) and spinal progressive muscular atrophy (SPMA). ) can cause.

The muscle dystrophy is a disease in which progressive muscle atrophy and muscle weakness occur, and refers to a degenerative myopathy pathologically characterized by necrosis of muscle fibers.

Cardiac atrophy is a condition in which the heart atrophies due to external or internal factors. It appears as a symptom in which myocardial fibers dry out and become thinner due to starvation, wasting disease, and aging, causing a decrease in adipose tissue.

The pharmaceutical composition for preventing or treating muscle weakness diseases and the health functional food composition for suppressing muscle loss of the present invention contain 0.1 to 2.0, 0.1 to 1.5, 0.1 to 1.0, 0.2 to 2.0, 0.2 to 1.5, respectively. It may include 0.2 to 1.0, 0.5 to 2.0, 0.5 to 1.5 or 0.5 to 1.0, for example, 0.5 to 1.0 ug/ml, but is not limited thereto.

The pharmaceutical composition of the present invention can be used as a pharmaceutical composition containing a pharmaceutically effective amount of a plant extract or honeysuckle extract and/or a pharmaceutically acceptable carrier.

As used herein, the term “pharmaceutically effective amount” refers to an amount sufficient to achieve the efficacy or activity of the above-mentioned plant extract or honeysuckle extract.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Includes, but is limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. It doesn't work. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

The pharmaceutical composition according to the present invention can be administered to mammals, including humans, through various routes. The administration method may be any commonly used method, for example, oral, dermal, intravenous, intramuscular, subcutaneous, etc. administration, and is preferably administered orally.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, body weight, gender, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. Usually, a skilled physician can easily determine and prescribe an effective dosage for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-1000 mg/kg.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule, or gel (e.g., hydrogel), and may additionally contain a dispersant or stabilizer. .

One aspect of the present invention relates to a health functional food composition for improving exercise performance containing a plant extract and a honeysuckle extract as active ingredients.

The term “improving exercise performance” as used herein means enhancing physical performance, enhancing maximum endurance, increasing muscle mass, enhancing muscle recovery, reducing muscle fatigue, or a combination of these effects.

The forage extract and honeysuckle extract include solvent crude extracts and solvent fractions of forage and honeysuckle and are as described above.

When using the health functional food composition of the present invention as a food additive, the health functional food composition may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods.

In general, when manufacturing a food or beverage, the health functional food composition of the present invention may be added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials.

There are no special restrictions on the types of foods above. Examples of foods to which the above substances can be added include meat, sausages, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, etc. These include alcoholic beverages and vitamin complexes, and include all foods in the conventional sense.

The beverage may contain various flavors or natural carbohydrates as additional ingredients. The above-mentioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. . The ratio of the natural carbohydrates can be appropriately determined by the selection of a person skilled in the art.

In addition to the above, the health functional food composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, and glycerin. , alcohol, and carbonating agents used in carbonated beverages. In addition, the health functional food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These ingredients can be used independently or in combination. The proportions of these additives can also be appropriately selected by those skilled in the art.

According to the pharmaceutical composition and health functional food composition for treating muscle weakness diseases according to the present invention having the above composition, the synergistic effect on improving muscle fiber, enhancing muscle cell differentiation, skeletal muscle synthesis, and improving muscle function by mixing the plant extract and honeysuckle extract. It has the effect of providing.

The effects of the present invention are not limited to those mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.

Figure 1 is a graph measuring the cytotoxicity of candidate materials for the composite composition of the present invention.
Figure 2 is a graph showing the effect of Eucommia extract (EU) on the expression of muscle disintegration markers.
Figure 3 is a graph showing the effect of honeysuckle extract (LJ) on the expression of muscle disintegration markers.
Figure 4 is a graph showing the effect of Chrysanthemum extract (CO) on the expression of muscle disintegration markers.
Figure 5 is a graph showing the effect of arrowroot extract (PL) on the expression of muscle disintegration markers.
Figure 6 is a graph showing the effect of Chunma extract (GB) on the expression of muscle disintegration markers.
Figure 7 is the HPLC standard curve of Shikonin, and Figure 8 is the HPLC standard curve of Lithospermic acid and rosmarinic acid.
Figure 9 is a chromatogram showing the contents of five types of shikonin, lithospermic acid, and rosmarinic acid analyzed by HPLC.
Figure 10 is a graph showing the cytotoxicity of dungweed standard extract (DGL).
Figure 11 is a graph showing the effect of dried grass extract (DGL) on the expression of muscle atrophy markers.
Figure 12 is a graph showing the IC50 measurement results of muscle atrophy marker inhibition of dried grass extract (DGL).
Figure 13 is a graph showing the effect of fatty acid complex (Cx) on the expression of muscle atrophy markers.
Figure 14 is a Colby equation for verifying the synergistic effect of the complex of the present invention.
Figure 15 is a graph showing the effect of Cx considering IC50 on the expression of muscle atrophy markers.
Figure 16 is an immunofluorescence staining microscopic observation photo and fusion index to confirm the efficacy of the sheath complex (Cx) in improving muscle cell atrophy.
Figure 17 shows the effect of plant complex (Cx) on MHC expression.
Figure 18 is an immunofluorescence staining microscopic observation photo and fusion index to confirm the effect of the sheath complex (Cx) in promoting muscle cell differentiation.
Figure 19 shows the level of muscle cell differentiation marker mRNA expression of the plant complex (Cx).
Figure 20 shows experimental data showing the effect of soil composites on improving body mass.
Figure 21 is a graph showing the effect of the ground composite on improving muscle strength and exercise capacity.
Figure 22 shows experimental data showing the effect of the ground composite on increasing muscle fiber size.
Figure 23 shows experimental data showing the effect of ground composite on increasing muscle weight.

Hereinafter, embodiments of the present invention will be described in detail as follows.

In describing the present invention, if a detailed description of a related known function or configuration is judged to unnecessarily obscure the gist of the present invention, the detailed description will be omitted. In addition, the terms described below are terms defined in consideration of functions in the present invention, and may vary depending on the user's intention or precedent. Therefore, the definition should be made based on the contents throughout this specification.

The pharmaceutical composition for preventing or treating muscle weakness diseases and the health functional food composition for suppressing muscle loss according to the present invention contain as active ingredients extracts of the plant extract and honeysuckle extract extracted from the plant and honeysuckle as shown in Table 1 below, Korea Food Research Institute Patent for technology transfer from "Title of the invention: Composition for promoting differentiation from muscle stem cells to muscle cells containing plant extract as an active ingredient, pharmaceutical composition for preventing or treating diseases related to muscle weakness, and health function for improving exercise performance. We went through the process of developing ingredients that can maximize efficacy when used in combination with "Food Composition" (Patent No. 10-1913828), and were derived through the research and development process as follows.

Raw materials Raw material name scientific name origin Shape (part of use) ground Lithospermum erythrorhizon Sieb. et Zucc. Made in Korea root Indong Lonicera japonica Thunberg Made in Korea Use of leaves and stems

[Experimental Example 1] Ground extraction method

① Method of producing groundhog extract powder lab scale sample

-「Manufacturing method in the patent data: Grind the dried roots of the weeds, add 10 times the weight of 80 (v/v)% ethanol, extract at room temperature for 12 hours, and then concentrate the filtered supernatant with a reduced pressure dryer. “Soil extract was prepared by freeze-drying.”

- In order to apply it to the future production process, in the present invention, dextrin was added to increase the efficiency and yield of the drying operation, and a heat sterilization process was added before the drying operation to prepare the sample.

- 10 times the weight of 80 (v/v)% ethanol was added to 1kg of raw material (made in China/domestic) and subjected to primary/secondary extraction at room temperature for 12 hours. The primary and secondary extracts were filtered through a 1um filter, concentrated (40°C) using a vacuum concentrator, mixed with 20% of dextrin compared to the solid content of the concentrate, heat sterilization/non-heat sterilization process was added, and then freeze-dried to prepare agar extract powder.

(Process diagram: Raw material (ground grass) > primary extraction > primary filtration > secondary extraction > secondary filtration > 1st and 2nd concentration > dextrin mixing > sterilization (heating) > rapid freezing > freeze-drying > sample (ground grass extract powder) )

Yield confirmation test according to crude grinding and extraction time of raw materials

- Solvents were prepared at different ethanol concentrations (40%, 80%) to about 100 g of the raw weed material, 10 times the weight was added, and primary and secondary extractions were performed at room temperature over time (6 hours, 14 hours). The first and second extracts are filtered through a 1um filter, concentrated (40°C) using a reduced pressure concentrator, and the yield is checked.

Yield, shikonin and derivative content test according to ethanol concentration

- Solvents were prepared at different ethanol concentrations (40%, 50%, 60% and 70%) to about 100g of the raw material (domestic), 10 times the weight was added, and primary and secondary extractions were performed at room temperature for 6 hours. The primary and secondary extracts are filtered through a 1um filter, concentrated (40°C) using a reduced pressure concentrator, and then the yield and shikonin and derivative content are checked.

② Result of forage extract powder lab scale sample manufacturing

○ Test results according to manufacturing method in technology transfer patent data

- The yield and sum of shikonin and derivatives for 1 kg of raw materials (made in China/domestic) are shown in [Table 2] below.

- As a result of checking the yield of Chinese/domestic weeds, the yield of Chinese raw materials was found to be 13-14%, which is higher than domestically produced weeds. The reason for the low yield of domestically produced weeds is that Chinese weeds were extracted twice, but domestic weeds were extracted once, so the yield was low. It is believed that it came out. It appears that the extraction yield twice is higher than once, so extraction will be performed twice in future experiments.

Regarding the results of the content of shikonin and derivative compounds, in the case of samples that were (heat) sterilized, the content of shikonin and derivatives was not detected, confirming that shikonin and derivative compounds are affected by temperature.

In order to increase the yield content, there are many factors such as ethanol concentration, extraction time, extraction temperature, and extraction order. However, since safety issues arise for shikonin and derivative compounds, it is necessary to check the yield according to the extraction time and ethanol concentration in the extraction conditions. It is understandable.

Raw quantity (g) Concentrate amount (g) Concentrate_Solid content (%) FD powder amount (g) Final yield (%) Shikonin and
Derivative content
(mg/g) A. Made in China
(non-sterilized) 500 516 12.7 67 13.4 1.12 B. Made in China
(sterilization) 500 501 14.1 70 14 N.D. C.Domestic*
(non-sterilized) 1,000 848 5.2 45 4.5 0.9

* Only the first extraction is performed on domestically produced weeds. Primary and secondary extraction is performed on raw materials from China.

Yield confirmation results according to raw material crude grinding and extraction time

- Solvents were prepared at different ethanol concentrations (40%, 80%) to approximately 100g of the raw weed material, and 10 times the weight was added to perform first and second extractions at room temperature over time (6 hours, 14 hours). The first and second extracts were filtered through a 1um filter and concentrated (40°C) using a vacuum concentrator. The results of confirming the yield are shown in [Table 3] below.

As a result of crudely grinding the raw materials and testing with samples less than 1 cm in size, the yield was highest at 47.2% under 40% ethanol concentration and 6-hour extraction conditions. It is believed that when the ethanol concentration is 40% rather than 80%, the water content is higher and more solids are eluted during extraction. When extracting, the size of the raw material is considered to be within 1 cm, and it is believed that it will be helpful in setting the size for the standard standard for raw materials in the future. The yield was higher when the extraction time was 6 hours than 14 hours. Therefore, it is judged that 6 to 14 hours is the appropriate extraction time for scale up testing.

Extraction test conditions transference number(%) 6 hours, room temperature, 40%, 2 extractions 47.2 14 hours, room temperature, 40%, 2 extractions 44.1 6 hours, room temperature, 80%, 2 extractions 19.3 14 hours, room temperature, 80%, 2 extractions 16.9

Yield, shikonin and derivative content results according to ethanol concentration

- In order to establish extraction conditions using ground grass, the extraction temperature (room temperature), extraction time (6 hours), and number of extractions (2 times) were kept constant, and each concentration of ethanol was (40%, 50%, 60%, and 70%). The yield and shikonin and derivative content results of the sample concentrated (40°C) after extraction are shown in [Table 4] below. Extraction conditions were 6 hours, room temperature, 40%, performed twice, resulting in the highest yield of 40.6%, but the content of shikonin and derivatives was the lowest at 0.2 mg/g. In terms of extraction conditions, the yield and shikonin and derivative content were the highest when the ethanol concentration was 50%, and the reason why the shikonin and derivative content was low when the ethanol concentration was 60% was that the color of the sample changed (reddish) during the concentration process. It is thought that the shikonin derivative component has been reduced due to the change in color from purple to purple. The color of the extract was all red, but it was confirmed that the color changed during the concentration process. Such color changes are believed to affect the components and content of shikonin derivatives. Considering the yield and shikonin and derivative content, it is considered appropriate to extract at an ethanol concentration of 50% or more.

Extraction test conditions transference number(%) Shikonine and derivative content (mg/g) 6 hours, room temperature, 40%, 2 extractions 40.6 0.2 6 hours, room temperature, 50%, 2 extractions 35.1 0.7 6 hours, room temperature, 60%, 2 extractions 34.7 0.2 6 hours, room temperature, 70%, 2 extractions 31.4 0.5

[Experimental Example 2] Efficacy evaluation and selection of composite candidates for inhibiting skeletal muscle disintegration

A) Preparation of composite candidate material extract to be mixed with forage extract

- Extraction method

180 g of the sample was extracted with 10 times 70% alcohol at a temperature of 70 degrees for 6 hours, concentrated under reduced pressure, freeze-dried, and stored frozen at -20 degrees until use.

- result

The yields of extracts of the five candidate materials are shown in Table 5 below.

Material name transference number (%) Duchong (EU) 8.56 Indong (LJ) 13.30 Celestial Palace (CO) 26.16 Kudzu (PL) 25.65 Cheonma (GB) 37.10

B) Cytotoxicity evaluation of composite candidate materials

- Experimental method

C2C12 cells, a mouse myoblast cell line, were cultured in high glucose DMEM medium supplemented with 10% FBS and 1% PS in a 5% CO ₂ incubator at 37°C. Five candidate materials were prepared by dissolving them in DMSO at a concentration of 0.5 - 10 mg/mL. For cytotoxicity evaluation, C2C12 cells were seeded in a 96 well plate at 1x10^4/well, and after 24 hours, five types of extracts were treated at various concentrations with a final concentration of 0.5 - 10 μg/mL. After reacting in a 37°C 5% CO ₂ incubator for 24 hours, the reaction mixture was treated with 1/10 volume of MTT solution (5 mg in PBS). After 4 hours of reaction, the medium was completely removed, 200 μL of DMSO was added, and the mixture was shaken for 1 minute. Absorbance values were measured at 570 nm.

- Experiment result

As shown in Figure 1, all five candidate materials did not show cytotoxicity at concentrations of 0.5 - 10 μg/mL.

c) Evaluation of inhibition of skeletal muscle disintegration of candidate materials

- Experimental method

C2C12 cells, a mouse myoblast cell line, were cultured in high glucose DMEM medium supplemented with 10% FBS and 1% PS in a 5% CO ₂ incubator at 37°C. To differentiate into myotubes, seeds were seeded at 4x10^5/well in a 6 well plate. When confluency reached 100%, differentiation was induced by changing the medium every day for 4 days with high glucose DMEM medium supplemented with 2% HS and 1% PS. On the 4th day of differentiation, after treatment with the candidate material extract and 50 μM dexamethasone, which induces muscle disintegration, for 24 hours, the mRNA expression levels of muscle disintegration biomarkers Atrogin-1 and Murf-1 were confirmed through qRT-PCR. Primer information for Atrogin-1 and Murf-1 is shown in Table 6 below.

Gene Primer Sequence Atrogin-1 Forward 5'-AAGGCTGTTGGAGCTGATAGCA-3' Reverse 5'- CACCCACATGTTAATGTTGCCC -3' Murf-1 Forward 5'- TGTCTCACGTGTGAGGTGCCTA -3' Reverse 5'-CACCAGCATGGAGATGCAGTTAC-3' 18s Forward 5'- CTCAACACGGGA AACCTCAC -3' Reverse 5'- CGCTCCACCAACTAAGAACG -3'

- Experiment result

As shown in Figure 2, Euchani extract (EU) showed efficacy at low concentrations in terms of Atrogin-1 and Murf-1 inhibitory activity, which was increased by dexamethasone (DEX) treatment, but as the concentration increased, efficacy tended to decrease. It was not suitable as candidate material.

As shown in Figure 3, honeysuckle extract (LJ) was selected as a candidate composite material as it was shown to reduce Atrogin-1 and Murf-1, which were increased by DEX treatment, in a concentration-dependent manner at a concentration of 0.1 - 1 ug/mL.

As shown in Figure 4, Aseptic extract (CO) increased the muscle atrophy markers of Atrogin-1 and Murf-1, which were increased by DEX treatment, at concentrations of 0.1 and 0.25, and significantly decreased the expression only at a concentration of 1 ug/mL. It was excluded from the composite candidate materials.

As shown in Figure 5, arrowroot extract (PL) had no effect on Atrogin-1, which was increased by DEX treatment, and significantly reduced it only at a concentration of 2.5 ug/mL, and for Murf-1 at 1 and 2.5 ug/mL. /mL concentration was significantly reduced. It was excluded from the composite candidate material as it showed efficacy at higher concentrations compared to other candidate materials.

As shown in Figure 6, Chunma extract (GB) was found to increase gene expression of Atrogin-1 and Murf-1, which were increased by DEX treatment, at concentrations of 0.1 and 2.5 ug/mL. In addition, only at a concentration of 1 ug/mL, the expression of both Atrogin-1 and Murf1 were significantly suppressed, so it was excluded as a candidate composite material.

[Experimental Example 3] Measurement of synergistic effect according to mixing ratio of forage extract and honeysuckle extract

A) Characteristic analysis of forage standard extract

In order to analyze the characteristics of the ground standard (DGL) manufactured according to the mass production process, candidate indicators/functional ingredients were analyzed by HPLC.

- HPLC analysis method

A standard curve was created for each compound for five types of Shikonin, lithospermic acid, and rosmarinic acid, and the content of each component was determined using the external standard method. HPLC analysis was performed using a photodiode array (PDA) system equipped with an ODS-column (YMC-Triart C18, 4.6 × 250 mm, 5 μYMC, Kyoto, Japan) and a detector (MD-2010 Plus DAD, Jasco, Tokyo). , Japan) were analyzed at 520 nm (shikonin) and 330 nm (lithospermic acid and rosmarinic acid). 1% acetic acid (solvent A) and 100% acetonitrile (solvent B) were used as mobile phases, and the analysis was performed under the conditions of a column oven temperature of 40°C and a flow rate of 1.0 mL/min. Detailed solvent conditions are listed below and in Table 7.

- Shikonin: 70% B isocratic.

- Lithospermic acid and rosmarinic acid: see Table 7

Time(min) A B 0 95 5 5 80 20 15 80 20 30 65 35 35 65 35

- HPLC analysis results

For the analysis of shikonins, conditions for the analysis of five types of shikonin derivatives, shkionin, b-hydroxyisovalerylshikonin, Acethyshikonin, isobutyrylshikonin, and b,b-dimethylacrylshikonin, were established, and the standard curve is presented in Figure 7.

In addition, the analysis conditions for lithospermic acid and rosmarinic acid, which are candidate ground indicators/functional ingredients, were established, and the standard curve is presented in Figure 8. To set the indicators/functional ingredients of ground standard extract (DGL), five types of shikonin and lithospermic acid were established. The contents of acid and rosmarinic acid were analyzed by HPLC, and the chromatogram is shown in Figure 9.

Referring to Table 8 below, as a result of the analysis, shikonin and rosmarinic acid were not detected, but lithospermic acid was analyzed to contain 0.47 mg per g of extract.

Composition (mg/g) shkionin lithospermic acid rosmarinic acid DGL N.D. 0.47 N.D.

B) Inhibitory activity of muscle cell atrophy of Jiacho standard extract

- Experimental method

C2C12 cells, a mouse myoblast cell line, were cultured in high glucose DMEM medium supplemented with 10% FBS and 1% PS in a 5% CO ₂ incubator at 37°C. The weed standard extract (DGL) was prepared by dissolving it in DMSO at 0.1 - 1 mg/mL. For cytotoxicity evaluation, C2C12 cells were seeded in a 96 well plate at 1x10^4/well, and after 24 hours, they were treated with DGL) at various concentrations, with a final concentration of 0.1 - 1 μg/mL. After reacting in a 37°C 5% CO ₂ incubator for 24 hours, the reaction mixture was treated with 1/10 volume of MTT solution (5 mg in PBS). After 4 hours of reaction, the medium was completely removed, then 200 μL of DMSO was added and shaken for 1 minute. Absorbance values were measured at 570 nm.

To evaluate myocyte atrophy inhibition activity, C2C12 cells were seeded at 4x10^5/well in a 6 well plate. When confluency reached 100%, myotube differentiation was induced by changing the medium every day for 4 days to high glucose DMEM medium supplemented with 2% HS and 1% PS.

On the 4th day of differentiation, the mRNA expression levels of Atrogin-1 and Murf-1, which are muscle atrophy biomarkers, were confirmed through qRT-PCR after treatment with DGL standard extract (DGL) and 50 μM dexamethasone, which induces muscle atrophy, for 24 hours.

- Experiment result

As a result of measuring the cytotoxicity of forage standard extract (DGL), cell activity was slightly increased at concentrations of 0.5 and 1 ug/mL, as shown in Figure 10.

As a result of measuring the effect of ground root extract (DGL) on muscle cell disintegration, as shown in Figure 11, DGL 0.1 ug/mL significantly reduced only Murf1 expression, but at a concentration of 0.25 - 1 ug/mL, Atrogin- The increase in expression of both genes, 1 and Murf-1, was effectively suppressed simultaneously.

c) Muscle atrophy marker inhibition IC50 of dried grass extract (DGL)

As a result of IC50 measurement of the expression inhibitory activity of Atrogin1 and Murf1, two representative muscle atrophy markers, of DGL, as shown in Figure 11, 0.44 ug/mL for Atrogin-1 and 0.34 ug/mL for Murf-1. appeared.

D) Comparison of muscle atrophy marker inhibition activity according to mixing ratio

1:1 combination of ground root extract (DGL) and linden (LJ)

The activity of a composite (Cx) in which DGL and LJ were mixed at a concentration ratio of 1:1 and a concentration ratio of 0.125 to 1 was compared with the activity of a group administered with DGL or LJ alone. The composition of the experimental treatment group is shown in Table 9 below.

DGL L.J. DGL 0.125 0.25 0.5 One L.J. 0.125 0.25 0.5 One DGL+LJ (Cx) 0.125 0.125 0.25 0.25 0.5 0.5 One One

Inhibitory activity of muscle disintegration markers of 1:1 herbal complex (Cx)

When DGL and LJ were administered alone, the increase in muscle atrophy markers Atrogin-1 and Murf-1 caused by DEX was effectively suppressed. In the case of Cx, a 1:1 mixture of DGL and LJ, the expression of muscle atrophy markers Atrogin-1 and Murf-1 was reduced in a concentration-dependent manner at a concentration of 0.125 - 1 ug/mL (see Figure 13).

Synergistic effect of 1:1 herbal complex (Cx) to improve muscle atrophy

As a method of verifying the synergistic effect of the complex, the Colby method of Figure 14 (COLBY S. R., Calculating synergistic and antagonistic response of herbicide combinations, Weeds 15, 20-22, 1967) was used.

To evaluate the presence or absence of a synergistic effect of 1:1 Cx, the inhibitory activity efficiency of Atrogin-1 or Murf-1 when administered alone with DGJ and LJ was calculated as %, and then the inhibition of Atrogin-1 or Murf-1 by 1:1 Cx was calculated. The activity efficiency was compared to %.

As a result, as shown in Table 10 below, in the case of Atrogin-1, the 1:1 Cx 1 ug/mL treatment group showed 90.12%, a value similar to the E value of 92.13%, but no synergistic effect was observed.

Atrogin-1 ug/mL 0.125 0.25 0.5 One DGL 29.79 32.88 74.66 63.62 L.J. 40.09 63.01 68.54 78.36 E 57.94 75.17 92.03 92.13 1:1 Cx 15.46 64.18 73.40 90.12

Next, as a result of calculating the synergistic effect of 1:1 Cx on Murf-1 inhibition, it was found that the 1:1 Cx 1 ug/mL treatment group increased to 136.3%, which was significantly higher than the E value of 97.05% (see Table 11). Therefore, it was confirmed that the complex (Cx), which is a 1:1 mixture of DGL and LJ, exhibits a synergistic effect at a concentration of 1 ug/mL of each.

Murf-1 ug/mL 0.125 0.25 0.5 One DGL 10.81 54.25 101.24 88.17 L.J. 25.79 38.67 54.26 75.10 E 33.81 71.94 100.57 97.05 1:1 Cx 56.09 92.29 102.24 136.30

Evaluation of muscle atrophy improvement efficacy of Cx based on IC50

Considering the IC50 of DGL against Murf-1, a mixture of DGL and LJ was prepared as shown in Table 12 below.

DGL L.J. Cx considering IC50 0.3 0.3 0.2 0.1 0.1 0.2 0 0.3

As a result, as shown in Figure 15, it was observed that the muscle disintegration marker inhibitory activity was decreased in LJ alone or Cx compared to the DGL alone administration group.

According to the above results, the optimal ratio of forage composite was derived as DGL:LJ = 1:1.

[Experimental Example 4] Verification of muscle fiber improvement activity of ground grass and phosphorus composite

1. Experimental method

C2C12 cells, a mouse myoblast cell line, were cultured in high glucose DMEM medium supplemented with 10% FBS and 1% PS in a 5% CO2 incubator at 37°C. To evaluate the activity of improving muscle cell atrophy, C2C12 cells were seeded at 4x10^5/well in a 6 well plate. When confluency reached 100%, myotube differentiation was induced by changing the medium every day for 4 days to high glucose DMEM medium supplemented with 2% HS and 1% PS. On the 4th day of differentiation, the cells were treated with Cx (2 μg/mL) and 50 μM of dexamethasone, which induces muscle atrophy, for 24 hours. After 24 hours, samples were harvested for mechanism analysis and IF stain was performed to confirm phenotype.

IF stain was performed in the following order. After removing the medium, the cells were washed twice with 1 mL of PBS each. 1 mL of 4% formaldehyde solution was added and reacted at RT for 30 minutes. After removing the solution, the solution was washed twice with 1 mL each of PBS. 1 mL of cold methanol solution was added and reacted at -20°C for 10 minutes. After removing the solution, the solution was washed twice with 1 mL each of PBS. 1 mL of 0.05% saponin solution was added and reacted at RT for 30 minutes. After removing the solution, the solution was washed twice with 1 mL each of PBS. 1 mL of 1% BSA solution was added and reacted at RT for 30 minutes. After removing the solution, 1 mL of primary T-MHC antibody (1:200 in 1% BSA solution) was added and incubated overnight at 4°C. After removing the primary antibody and washing twice with 1 mL each of PBS, secondary Goat anti-Mouse IgG Secondary Antibody (1:500 in 1% BSA solution) was added and reacted at RT for 60 minutes. After removing the secondary antibody and washing twice with 1 mL each of PBS, DAPI (1:10000 in PBS) solution was added and reacted for 1 minute. After removing the solution, the solution was washed three times with 1 mL of PBS each, dried, and observed under a microscope.

In addition, to verify the muscle atrophy improvement activity, the protein expression levels of T-MHC, MHCⅠ, MHCⅡα, MHCⅡβ, and β-actin were confirmed through western blot.

2. Experiment results

As a result of measuring the effect of soil composite (Cx), which is a mixture of soil and seed at 1 ug/mL each, on DEX-induced muscle atrophy, as shown in the left photo of Figure 16, Cx effectively inhibits muscle cell atrophy caused by DEX. did. The Fusion index on the right side of Figure 16 decreased by 23.16% from 79.11% in the control group to 55.95% in the DEX treatment, but recovered to 79.28% with Cx treatment. Cx was also observed to have the activity of suppressing the reduction of total myosin heavy chain (T-MHC), MHCIIa, and MHCIIb by DEX, as shown in Figure 17.

[Experimental Example 5] Verification of the muscle cell differentiation enhancing ability of the ground herb and indong composite

1. Experimental method

C2C12 cells, a mouse myoblast cell line, were cultured in high glucose DMEM medium supplemented with 10% FBS and 1% PS in a 5% CO2 incubator at 37°C. To evaluate the activity of improving muscle cell atrophy, C2C12 cells were seeded at 4x10^5/well in a 6 well plate. When confluency reached 100%, myotube differentiation was induced by changing the medium every day for 2 days to high glucose DMEM medium supplemented with 2% HS and 1% PS. At this time, complex Cx (2 μg/mL) was treated together. On the second day of differentiation induction, IF staining to confirm the phenotype and the mRNA expression levels of MyoG and MyoD, biomarkers for promoting myocyte differentiation, were confirmed through qRT-PCR. Primer information for MyoG and MyoD is shown in Table 13 below.

Gene Primer Sequence MyoG Forward 5'-GTAGTAGGCGGTGTCGTAGC-3' Reverse 5'-CCACGATGGACGTAAGGGAG-3' MyoD Forward 5'-CCGTGTTTCGACTCACCAGA-3' Reverse 5'- GTAGTAGGCGGTGTCGTAGC -3' 18s Forward 5'- CTCAACACGGGA AACCTCAC -3' Reverse 5'- CGCTCCACCAACTAAGAACG -3'

2. Experiment results

As shown in Figures 18 and 19, the sheath complex (Cx) promoted differentiation of C2C12 myoblasts, increasing the fusion index by 141% from 55.95% to 79.28%. Additionally, the expression of MyoG and MyoD, which are muscle cell differentiation regulators, were increased by 196% and 141%, respectively, compared to the control group.

[Experimental Example 6] Effect of ground herb and indong complex on improving skeletal muscle synthesis and muscle function

1. Experimental method

1) Animal model and test method

In order to verify the efficacy of the fiber complex in improving muscle atrophy, the efficacy of improving muscle atrophy by dexamethasone administration was evaluated using C57BL/6 mice. Five-week-old C57BL/6 mice were acclimatized for one week and then fed the experimental diet for 10 weeks. The experimental diet was prepared according to the composition of the AIN-93M diet, and the experimental groups included a normal mouse group (Con), a dexamethasone-administered group (Dexa), and a diet group that added 0.1%, 0.2% 0.2% aquaculture complex while administering dexamethasone. The experiment was divided into groups (indicated as C1 and C2, respectively). Starting 38 days before the end of the experiment, dexamethasone was injected intraperitoneally at a concentration of 15 mg/kg/day to induce muscle atrophy, and the normal mouse group was injected with the same dose of water for injection. All animals were raised in an animal breeding room maintained at a temperature of 23℃, humidity of approximately 50%, and a 12-hour light/dark cycle (light; 8:00~20:00, dark; 20:00~8:00) during the experiment period. The body weight of the experimental animals was measured at regular times once a week, and food intake was measured every two days. At the completion of experimental breeding, blood and muscle tissue were collected, weighed, and stored at -80°C until analysis.

2) Changes in muscle mass due to ground and joint complexes

2-1) Experiment method

Body composition was measured in the last week of rearing. To prevent movement during measurement, the mouse was anesthetized with 2% isoflurane, and the image was scanned using InAlyzer, which uses DEXA (Dual Energy Measured.

2-2) Experiment results

As shown in Figure 20, there was no significant difference in lean body mass (%) between the normal mouse group and the dexamethasone administration group, but in the grass complex ingestion group, the lean mass (%) was confirmed to significantly increase compared to the dexamethasone administration group. did.

3) Changes in muscle strength and exercise performance due to ground and articular complexes

3-1) Experiment method

- Grip strength test of mice: The grip strength of mice was measured in the last week of rearing using a grip strength meter for mice. Specifically, the force with which the mouse grips the wire mesh was measured by placing the mouse's feet on a wire mesh attached with a dashboard that can monitor the strength of the force, grabbing the tail and pulling it backwards. The test was measured five times consecutively, and the average was calculated by subtracting the highest value from the lowest value. To standardize the experimental results, grip strength was calculated by dividing it by body weight.

- Muscular endurance test through running (treadmill test): To measure the muscular endurance of mice, the running time and distance were measured in the last week of breeding. The main experiment was conducted after practicing on a mouse treadmill for a total of two days. On the first day of practice, the subjects practiced for 10 minutes at a speed of 5 m/min without a ramp, and on the second day, they practiced for 10 minutes at a speed of 5 m/min at a 5° incline. On the day of this experiment, they started at a speed of 5 m/min at a 5° incline and ran for 5 minutes, then increased the speed by 2 m/min every 2 minutes, not exceeding a maximum of 20 minutes. Maximal exercise performance was converted into the running time and distance from stopping exercise to remaining on the grid for more than 10 seconds.

3-2) Experiment results

Grip strength and running tests were performed to check muscle strength as well as body fat weight (%). As a result of performing grip strength and running tests at the 10th week of rearing, it was confirmed that the grip strength and running test time and distance were significantly reduced in the dexamethasone administered group compared to the normal mouse group. On the other hand, the grip strength, which measures the maximum instantaneous pulling force of mice that ingested the agar complex, was measured and showed a significant increase compared to the grip strength of the dexamethasone administered group. In addition, the running time (min) and distance (m) were measured to measure the muscle endurance of mice, and it was confirmed that both time and distance significantly increased in the ground composite group compared to the dexamethasone administered group. Through this, it was confirmed that there was an effect of suppressing the decrease in muscle strength caused by dexamethasone in the ground complex group (see Figure 21).

4) Improvement effect of cross-sectional area change due to ground and cement composites

4-1) Experiment method

To measure cross-sectional area (CSA), the gastrocnemius muscle was fixed using Tissue-Tek OCT compound, rapidly frozen in liquid nitrogen, and stored at -80°C. On the day of the experiment, frozen tissue blocks were cut into 7 μm sections using a cryo-microtome at -20°C and mounted on slides. Tissue sections were fixed with cold 20% acetone for 20 minutes, blocked with 10% FBS for 1 hour at room temperature, then overnight at 4°C with laminin, the primary antibody, and Alexa Fluro 488 goat anti-rabbit IgG, the secondary antibody. It was attached for 30 minutes at room temperature. After washing the tissue twice with PBS, a cover glass was mounted using fluoroshield. Images of stained tissue were obtained using a confocal microscope (Digital Eclipse C1 plus, Nikon, Tokyo, Japan).

4-2) Experiment results

In order to confirm the effect of increasing muscle mass by the ground fiber complex group, the cross-sectional area size of the muscle fibers corresponding to the normal mouse group, the dexamethasone administered group, and the ground fiber complex group were confirmed. As a result, as shown in Figure 22, as a result of staining the muscle tissue of the mouse and analyzing the muscle fiber size, it was confirmed that the size ratio of the cross-sectional area of the muscle fiber was decreased in the group administered dexamethasone compared to the normal mouse group. On the other hand, it was confirmed that the size ratio of the muscle fiber cross-sectional area increased in the ground composite group compared to the dexamethasone administered group.

5) Effect of improving muscle weight by ground root and sindong complex

In order to check the muscle loss due to dexamethasone administration, the muscle weight corrected by body weight was checked, and as shown in Figure 23, most skeletal muscles (tibialis anterior, extensor digitorum longus) in the dexamethasone-administered group compared to the normal mouse group. extensor digitorum longus, gastrocnemius, quadriceps, and triceps] were confirmed to be significantly reduced. On the other hand, it was confirmed that the muscle weight loss caused by dexamethasone was alleviated in the ground composite group, especially in the quadriceps muscle.

It will be understood that the present invention is not limited to the forms mentioned in the above detailed description. Therefore, the true scope of technical protection of the present invention should be determined by the technical spirit of the attached patent claims. In addition, the present invention should be understood to include all modifications, equivalents and substitutes within the spirit and scope of the present invention as defined by the appended claims.

Claims (3)

Contains ground root extract and honeysuckle extract as active ingredients, and mixes the ground root extract and honeysuckle extract at a concentration of 0.125 to 1 ug/mL, respectively, to treat muscle weakness caused by sarcopenia, muscular dystrophy, muscle dystrophy, and cardiac atrophy. A pharmaceutical composition for preventing or treating disease.
delete Contains ground root extract and honeysuckle extract as active ingredients, and mixes the ground root extract and honeysuckle extract at a concentration of 0.125 to 1 ug/mL to have at least one effect among improving muscle fibers, enhancing muscle cell differentiation, skeletal muscle synthesis, and improving muscle function. Health functional food composition.