KR102597907B1 - Primer set for detecting bifidobacterium and use thereof - Google Patents

Abstract

The present invention relates to a qPCR-specific primer set and its use for accurate quantification of intestinal Bifidus strains. When identifying Bifidus strains using the primer set of the present invention, Bifidus strains can be distinguished more simply, accurately, and economically than the NGS method using the existing 16S ribosomal RNA gene.

Description

Primer set for quantification of Bifidus strains and use thereof {PRIMER SET FOR DETECTING BIFIDOBACTERIUM AND USE THEREOF}

The present invention relates to a qPCR-specific primer set for accurate quantification of intestinal bifidance bacteria and its use.

Currently, new awareness and importance of Bifidobacterium, also known as Bifidus, are emerging. Bifidobacterium is a dominant species not only in the intestinal tract of breastfed infants but also in the intestinal flora of healthy adults, accounting for approximately 25% of fecal microorganisms.

Bifidobacterium is an anaerobic, gram-positive, non-porous bacillus, has a characteristic V- or Y-shape, and the optimum temperature for viable cells is 36 to 38 degrees. These bacteria perform hetero-fermentation, producing acetic acid and lactic acid in a ratio of 3:2, and have the characteristic of not producing gas during sugar metabolism. In particular, unlike other lactic acid bacteria, it does not cause acidosis in infants by specifically producing L(+)-lactic acid, which is easily absorbed in the human body. In addition, Bifidobacterium bacteria are ingested into the body and settle in the intestinal tract while passing through the digestive tract, thereby influencing the various existing intestinal bacterial flora, affecting human nutrition, aging, carcinogenesis, immune function, intestinal infections, and drugs. In addition to its effectiveness, it inhibits the growth of intestinal putrefactive bacteria, detoxifies toxic substances such as nitrosoamine produced by protein decomposition and other harmful bacteria, synthesizes vitamins, and digests lactose and proteins through the action of phospatase. The expected health effects of Bifidobacterium bacteria have come into the spotlight as they are known to have many beneficial effects, such as promoting the absorption of Ca in the body, reducing blood cholesterol, and anti-cancer effects. Therefore, the current market size for dairy products such as yogurt and cheese using Bifidobacterium and probiotics is rapidly expanding. In Korea, functional foods, health supplements, or intestinal supplements containing Bifidobacterium are on the market, and its use as a probiotic is also valuable as an additive to powdered milk to normalize the intestinal flora of artificial infants and as a probiotic when added to aquaculture feeds such as poultry. It is highly regarded. In addition, bifidobacteria are one of the beneficial bacteria present in the intestines, and different clinical responses may appear depending on the proportion of bifidobacteria in the intestine.

Meanwhile, next-generation sequencing (NGS) is a technology that enables high output of base sequence read data of the genome or gene group to be identified. This technology has led to the development of various molecular genetic research fields, from reading the entire genome of various biological species to identifying the frequency of genes expressed in specific tissues. At the same time, the introduction of NGS brought about significant changes in the field of microbiology research. In existing microbial research, microbial identification was limited to 16S identification through Sanger sequencing for culture-dependent bacteria. However, with the introduction of NGS technology, classification of all microorganisms present in a sample became possible, making it possible to identify previously unknown egg-bearing microorganisms. As mentioned above, identifying all microbial genome groups existing in a given environment based on NGS technology is called 'metagenome profiling'. The most popular method used in metagenomic profiling is the method of analyzing microbial communities by reading partial sequence information of the 16S ribiosomal RNA gene, which is commonly conserved in the genomes of all bacteria. Within the gene, there is a 'hypervariable region', which is a base sequence region that differs from species to species. Therefore, NGS-based 16S metagenomic profiling identifies microbial communities by reading this variable region. However, although the development of NGS has led to advancements in various microbiology research, it still has the disadvantage of requiring high costs for experimentation and analysis and a considerable amount of time to obtain results. In addition, there is a critical research barrier in that it is difficult to accurately target strains at the species level due to the high base sequence similarity between species within the 16S rRNA gene. To overcome these difficulties, an approach is being taken to use a real-time gene amplification device (quantitative real-time PCR) that can detect only specific probiotic strains identified based on NGS and confirm their relative frequencies in a short time.

qRT-PCR is a second-generation gene amplification device that can monitor the polymerization chain reaction for a specific target gene in real time. qRT-PCR is mainly used for the purpose of relative or absolute quantification of target genes present in a sample. Recently, the photometric sensitivity and accuracy of the equipment are so high that qRT-PCR diagnosis using specific primers is recognized as the gold standard for molecular diagnosis of the coronavirus that causes COVID-19. . In addition, in the field of microbiology research, qRT-PCR is used to confirm the presence of microbial strains that are difficult to culture by producing primers targeting the specific protein coding region possessed by the strain rather than the 16S rRNA gene region. For example, designing primers in the gene coding region of a specific bacterial species for a protein essential for bacterial cell wall formation. This approach can reduce the time and financial cost burden of NGS and has the advantage of high sensitivity of the equipment and accurate strain targeting that can avoid the nucleotide sequence similarity problem of the 16S rRNA gene.

Therefore, in order to overcome the existing problems, the present invention designs qRT-PCR-specific primers in the specific protein coding region rather than the 16S rRNA region for strains of the genus Bifidus classified through NGS-based 16S metagenomic analysis technology. The analysis provides an approach to confirm the presence or absence of Bifidus strains in the intestine.

The object of the present invention is a primer represented by SEQ ID NO: 1; and a primer set for detection of intestinal microorganisms, including the primer represented by SEQ ID NO: 2.

In addition, another object of the present invention is to provide a composition for detecting or quantifying intestinal microorganisms comprising the primer set.

In addition, another object of the present invention is to provide a kit for detecting or quantifying intestinal microorganisms including a primer set.

In addition, another object of the present invention is to provide a method for detecting or quantifying microorganisms inhabiting the intestines, which includes performing and analyzing a polymerase chain reaction on a sample using the primer set.

Therefore, the present invention provides a primer represented by SEQ ID NO: 1; and a primer set for detection of intestinal microorganisms, including the primer represented by SEQ ID NO: 2.

Additionally, the present invention provides a composition for detecting or quantifying intestinal microorganisms comprising the primer set.

Additionally, the present invention provides a kit for detecting or quantifying intestinal microorganisms including the primer set.

In addition, the present invention provides a method for detecting or quantifying microorganisms inhabiting the intestines, comprising performing and analyzing a polymerase chain reaction on a sample using the primer set.

When identifying Bifidus strains using the primer set of the present invention, Bifidus strains living in the intestine can be distinguished more simply, accurately, and economically than the NGS method using the existing 16S ribosomal RNA gene.

Figure 1 is an overall experimental schematic diagram for detecting Bifidus strains of the present invention.
Figure 2 is a diagram showing the results of an in silico test demonstrating the specificity of the primer set of the present invention to Bifidus strains.
Figure 3 is a diagram comparing the effectiveness of detection and quantification of Bifidus strains of the qPCR method using the primer set of the present invention and the method using NGS.

Hereinafter, a primer set for detecting Bifidus strains according to an embodiment of the present invention, a composition containing the same, and a kit will be described in detail.

Hereinafter, terms used in the present invention are defined.

The terminology used herein is for describing embodiments and is not intended to limit the invention. As used herein, singular forms also include plural forms, unless specifically stated otherwise in the context. As used herein, “and/or” includes each and all combinations of one or more of the mentioned elements.

As used herein, the terms “comprises” and/or “comprising” mean that a referenced component, step, operation and/or element is one or more other components, steps, operations and/or elements. does not exclude the presence or addition of

In the present invention, the term "microbiome" refers to microorganisms that inhabit the human body and refers to the intestinal microorganisms themselves or the entire genetic information of the intestinal microorganisms.

Additionally, the term “discrimination” used herein means distinguishing a Bifidus genus strain from other strains from a sample using the primer set of the present invention.

Additionally, the term “primer” used herein refers to a single-stranded oligonucleotide sequence complementary to the nucleic acid strand to be copied, and serves as a starting point for the synthesis of the primer extension product. The length and sequence of the primers should be sufficient to initiate synthesis of the extension product, and the specific length and sequence of the primers will depend on the conditions of primer use, such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target. something to do.

The primer set of the present invention consists of forward and reverse primers to amplify genes specifically present in intestinal strains. The primer set of the present invention sufficiently considers conditions such as primer length, Tm value, GC content of the primer, and prevention of primer complex (dimer) formation by self-complementary sequences in the primer, and is used for detection of intestinal strains. It was carefully designed to maximize sensitivity and specificity. The primer set of the present invention can be chemically synthesized using phosphoramidite solid support synthesis or other well-known methods. These base sequences can also be modified through various methods known in the art. Examples of such modifications include methylation, capping, substitution of a native nucleotide with one or more homologs, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) ) or modifications to charged linkages (e.g. phosphorothioate, phosphothioate, etc.). Additionally, the base sequence of the primer set of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The probe of the present invention may be labeled with a fluorescent substance at the end of the probe. A fluorescent reporter dye may be bound to the 5'-end of the probe, and a fluorescence quencher may be bound to the 3'-end. Any material developed to date may be used as the fluorescent marker, for example, FAM (6-carboxyfluorescein), HEX (hexachloro-6-carboxyfluorescein), TET (tetrachlorofluorescein), and Texas Red. , rhodamine green, rhodamine red, tetramethylrhodamine, N-(1-naphthyl) ethylenediamine (NED), cyanine-5 (Cy5) or cyanine-3 (Cy3). can be used, preferably FAM (6-carboxyfluorescein).

The fluorescence suppressors include TAMRA (6-carboxytetramethylrhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), DDQ (Deep Dark Quencher), and Blackberry Quencher. Alternatively, Iowa black may be used, and preferably TAMRA (6-carboxytetramethylrhodamine) may be used.

In the present invention, the polymerase chain reaction includes (i) an initial denaturation step; (ii) repeating one cycle of denaturation, annealing, and extension several to dozens of times; and (iii) a final heat treatment step; Alternatively, these steps may be performed through an appropriately modified thermal cycle program. Specifically, the PCR conditions in the present invention include initial denaturation by heat treatment at 90-95°C for 5-20 minutes, and then 90-95°C. Denaturation at 95°C for 10 seconds to 2 minutes; Annealing at 54-60°C (Tm) for 10 seconds to 2 minutes; And PCR amplification can be performed by repeating the synthesis step (extension) a total of 10 to 50 times for 10 seconds to 2 minutes at 70 to 75°C, and the reaction temperature and reaction time conditions can be appropriately modified by those skilled in the art. .

In the present invention, any method known in the art can be used to analyze the size of the PCR amplification product. For example, the size of the amplification product can be determined through comparison with a target size marker using agarose or polyacrylamide gel electrophoresis.

In the present invention, real-time polymerase chain reaction is an experimental method that allows absolute or relative quantification of target DNA by fluorescence emission simultaneously with amplification of the target DNA. The step of electrophoresis and analysis is omitted, and the degree of amplification of the amplification product is automated. By quantifying it, it is possible to detect and quantify it quickly and accurately. When performing the above method, it can be performed using a probe that specifically binds to the amplified sequence in the target DNA and is tagged with a fluorescent marker and a fluorescent suppressor, and can be performed using a fluorescent substance such as SYBR-Green without the use of a probe. It can also be performed using The results of real-time polymerase chain reaction can be analyzed using Ct (cycle threshold) values.

Hereinafter, the present invention will be described in detail through examples.

Example 1. Preparation of primer set of the present invention

Candidate genes were selected by searching papers containing metagenome-related research related to the genus to be searched through various websites such as Google/NAVER.

Afterwards, for the selected gene list, we searched the gene name and genus name in the 'identical protein' category on the NCBI website, downloaded all summary files for the listed gene list, and organized them into an Excel file.

Afterwards, hypothetical proteins, incorrect protein names, and bacterial names were deleted, and after filtering, if the information on the species for the genus exceeded 100, the number of strains for the species was set to 2 to 5. After filtering was completed, the Protein ID in the row called Protein in the summary file was pasted into a text file and saved. Afterwards, the downloaded CDS sequence was imported using the 'Bio edit' tool, the sequence information was converted to amino acid format, Clustal multiple alignment was performed, and then converted to sequence format. After alignment was completed, sequences that appeared to be completely different proteins or had no correlation were removed and alignment was performed again. After alignment, primers meeting the conditions for real-time PCR were derived within the conserved sequence region. Afterwards, the suitability of the designed primer was checked using the 'Oligo calc' and 'Oligo Analysis' tools. After this, we first checked whether there was any overlap with the sequences of other bacteria through the NCBI Nucleotide BLAST test, and then checked with a tool called 'In silico ( http://insilico.ehu.es/PCR/ )', and then used primers. A set was produced and its information is shown in Table 1 (see Figures 1 and 2).

Bacterial taxon Rank Target gene Forward primer (5'-3') Reverse primer (5'-3') Tm℃ GC%
(F/R) Amplicon Size (bp) Bifidobacterium Genus Transaldolase AAGGGCATCTCCGTCAACG GGAGACGAAGAAGGAAGCGA 59.5/60.5 58/55 146

Example 2. Confirmation of detection of Bifidus genus from human feces using the primer set of the present invention

In order to confirm the effectiveness of the primer set derived in Example 1 in detecting intestinal Bifidus strains, the following experiment was performed.

First, full-length microbial genomes were extracted from 10 human feces. After extracting the DNA of the microbiome using a commercially available microbial genome extraction kit from QIAGEN, the yield and quality of the extracted DNA were confirmed (using Qubit assay equipment provided by ThermoFisher). Afterwards, the double-stranded DNA concentration of each DNA sample was diluted and standardized to 10ng/ul, and then real-time gene amplification was performed using strain-specific primers from the standardized microbiome DNA, and the results were confirmed. (PCR composition: Template DNA (microbial genomic DNA; 10ng/ul)-1ul; Forward primer-1ul, Reverse primer-1ul; SYBR Green taq pol-10ul/ D.W- 7ul).

Example 3. Comparison of the primer set of the present invention with the set targeting 16s rRNA

1. Quantitative standardization of dsDNA from microbial genomic DNA samples isolated from the feces of 100 healthy people

Table 2 below shows standard curve calculation using qRT-PCR assay, which confirms that the bacterial genomic dsDNA quantity, which must be performed to evaluate the relative frequency in the sample of a specific target microbial strain, is standardized to the same concentration conditions. method). In theory, all microbial genomes contain a sequence (about 1.5 kbp) encoding 16S ribosomal RNA. Considering that the optimal amplicon size for qRT-PCR is about 100-200bp, qRT was performed by targeting the V4 region, the fourth hyper-variable region (about 150-180bp) present in the 16S sequence. -PCR was performed. The order of the experiment is as follows.

First, the amount of double-stranded DNA in the DNA sample mixed with DNA from various strains was confirmed using ThermoFisher's Qbit 4.0 equipment. After this, the dsDNA concentration of all samples was diluted and standardized to 10ng/ul. Afterwards, for standard curve calculation using qRT-PCR, all diluted dsDNA samples (100 samples diluted to 10ng/ul) were 10^-1, 10^-2, and 10^-3. It was serially diluted in doubly. Each diluted sample (300 serially diluted samples) was used as template DNA and 16S V4 region universal primer pairs (515F: 5'-GTGCCAGCMGCCGCGGTAA-3' / 806R: 5'-GGACTACHVGGGTWTCTAAT-3') were used for qRT- PCR was performed.

2. Comparison of the frequency of specific strains in the sample measured by NGS and the frequency of microorganisms in the same sample calculated from the Ct value of qRT-PCR

From the Ct value, the relative frequency of specific microorganisms was calculated as follows.

(1)relative bacterial frequency value = 1/2^(Ct value)

(2) relative bacterial proportion value (%) = relevant frequency data/sum of 100 frequency data

Through this comparative data, it can be confirmed that the NGS frequency and qPCR frequency are similar, which means that the relative proportion of specific strains detected and quantified through NGS in the sample can be significantly detected and quantified even using Qrt-PCR dedicated primers. You can check that.

3. When using the primers of the present invention, verify the specificity of the strain through Sanger sequencing.

Bacterial taxonomy identification was performed through Sanger sequencing and NCBI BLAST using part of the Qpcr amplicon product produced using the primer set of the present invention.

More specifically, some of the amplicon products applied to Qrt-PCR were purified to obtain pure DNA. The amplicon size of the Qrt-pcr product was about 100-150bp, so it met the appropriate library size for sanger sequencing. Therefore, the library size was expanded to approximately 400bp through gene ligation using a TA cloning vector containing the M13 sequence. Afterwards, plasmid DNA was transformed into CP-cells (E-coli) and plated on LB medium. White colonies (potentially transformed CP-cells) formed on LB medium were extracted and colony PCR was performed. The PCR primer used at this time was the M13 universal sequence. sanger sequencing was performed using the purified Colony PCR amplicon product as template DNA. Afterwards, using the sequence data output as a result of Sanger sequencing, bacterial identification was performed through NCBI nucleotide BLAST to confirm the genus of the target strain. Through the above method, it was confirmed that a strain of the genus Bifidus was detected (Table 3).

Sample ID Target gene *Ct value (10^-3) CT value (10^-2) CT alue (10^-1) Candidate 1 16S rRNA V4 region 26.24 22.17 19.27 Candidate 2 16S rRNA V4 region 26.28 22.48 19.38 Candidate 3 16S rRNA V4 region 26.09 22.66 19.03 Candidate 4 16S rRNA V4 region 26.01 22.78 19.15 Candidate 5 16S rRNA V4 region 26.58 22.03 19.23 Candidate 6 16S rRNA V4 region 26.56 22.07 19.18 Candidate 7 16S rRNA V4 region 26.47 22.08 19.80 Candidate 8 16S rRNA V4 region 27.38 22.11 19.57 Candidate 9 16S rRNA V4 region 26.92 22.22 19.75 Candidate 10 16S rRNA V4 region 26.78 22.26 19.84 Candidate 11 16S rRNA V4 region 26.46 22.39 19.63 Candidate 12 16S rRNA V4 region 26.96 22.43 19.36 Candidate 13 16S rRNA V4 region 26.79 22.47 19.85 Candidate 14 16S rRNA V4 region 26.50 22.54 19.04 Candidate 15 16S rRNA V4 region 26.72 22.59 19.45 Candidate 16 16S rRNA V4 region 27.03 22.59 19.20 Candidate 17 16S rRNA V4 region 26.57 22.59 18.70 Candidate 18 16S rRNA V4 region 27.13 22.60 19.00 Candidate 19 16S rRNA V4 region 26.91 22.66 18.91 Candidate 20 16S rRNA V4 region 26.26 22.78 19.00 Candidate 21 16S rRNA V4 region 26.68 22.83 19.23 Candidate 22 16S rRNA V4 region 26.96 22.85 19.62 Candidate 23 16S rRNA V4 region 26.58 22.96 19.89 Candidate 24 16S rRNA V4 region 26.97 23.03 19.50 Candidate 25 16S rRNA V4 region 27.32 23.11 19.34 Candidate 26 16S rRNA V4 region 27.22 23.13 19.29 Candidate 27 16S rRNA V4 region 27.00 23.27 19.30 Candidate 28 16S rRNA V4 region 26.90 23.29 19.04 Candidate 29 16S rRNA V4 region 27.37 23.31 19.96 Candidate 30 16S rRNA V4 region 27.55 23.32 20.72 Candidate 31 16S rRNA V4 region 27.54 23.35 18.63 Candidate 32 16S rRNA V4 region 26.95 23.40 19.38 Candidate 33 16S rRNA V4 region 27.46 23.42 19.03 Candidate 34 16S rRNA V4 region 27.37 23.48 19.02 Candidate 35 16S rRNA V4 region 27.56 23.48 19.98 Candidate 36 16S rRNA V4 region 27.14 23.52 19.11 Candidate 37 16S rRNA V4 region 27.94 23.52 19.97 Candidate 38 16S rRNA V4 region 26.97 23.67 20.12 Candidate 39 16S rRNA V4 region 27.38 23.67 19.25 Candidate 40 16S rRNA V4 region 27.18 23.70 18.32 Candidate 41 16S rRNA V4 region 27.28 23.71 19.92 Candidate 42 16S rRNA V4 region 27.53 23.73 19.96 Candidate 43 16S rRNA V4 region 27.76 23.77 19.70 Candidate 44 16S rRNA V4 region 27.93 23.83 19.07 Candidate 45 16S rRNA V4 region 27.93 23.83 19.40 Candidate 46 16S rRNA V4 region 27.46 23.84 19.66 Candidate 47 16S rRNA V4 region 27.28 23.85 20.27 Candidate 48 16S rRNA V4 region 27.07 23.86 19.22 Candidate 49 16S rRNA V4 region 27.77 23.89 20.07 Candidate 50 16S rRNA V4 region 27.62 23.91 20.69 Candidate 51 16S rRNA V4 region 27.05 23.98 19.63 Candidate 52 16S rRNA V4 region 27.90 23.98 20.21 Candidate 53 16S rRNA V4 region 27.99 23.99 20.06 Candidate 54 16S rRNA V4 region 27.59 23.03 19.75 Candidate 55 16S rRNA V4 region 27.44 23.07 19.75 Candidate 56 16S rRNA V4 region 27.58 23.08 20.20 Candidate 57 16S rRNA V4 region 26.96 23.09 20.61 Candidate 58 16S rRNA V4 region 27.90 23.09 19.91 Candidate 59 16S rRNA V4 region 27.27 23.10 20.69 Candidate 60 16S rRNA V4 region 27.54 23.12 19.76 Candidate 61 16S rRNA V4 region 27.75 23.13 20.15 Candidate 62 16S rRNA V4 region 27.27 23.16 20.49 Candidate 63 16S rRNA V4 region 27.48 23.16 19.62 Candidate 64 16S rRNA V4 region 26.94 23.18 20.82 Candidate 65 16S rRNA V4 region 27.20 23.19 20.02 Candidate 66 16S rRNA V4 region 27.37 23.23 20.18 Candidate 67 16S rRNA V4 region 27.56 23.24 20.23 Candidate 68 16S rRNA V4 region 27.29 23.26 20.70 Candidate 69 16S rRNA V4 region 28.06 23.26 19.96 Candidate 70 16S rRNA V4 region 27.96 23.26 19.97 Candidate 71 16S rRNA V4 region 27.96 23.27 20.05 Candidate 72 16S rRNA V4 region 27.43 23.29 20.61 Candidate 73 16S rRNA V4 region 27.58 23.30 19.92 Candidate 74 16S rRNA V4 region 27.35 23.31 20.77 Candidate 75 16S rRNA V4 region 27.66 23.31 19.87 Candidate 76 16S rRNA V4 region 27.93 23.35 20.16 Candidate 77 16S rRNA V4 region 27.12 23.38 19.37 Candidate 78 16S rRNA V4 region 27.36 23.51 20.01 Candidate 79 16S rRNA V4 region 27.34 23.54 20.83 Candidate 80 16S rRNA V4 region 27.99 23.59 20.52 Candidate 81 16S rRNA V4 region 27.86 23.61 19.76 Candidate 82 16S rRNA V4 region 27.81 23.67 20.31 Candidate 83 16S rRNA V4 region 27.73 23.71 20.00 Candidate 84 16S rRNA V4 region 27.96 23.76 20.33 Candidate 85 16S rRNA V4 region 28.02 23.78 20.65 Candidate 86 16S rRNA V4 region 27.43 23.85 20.30 Candidate 87 16S rRNA V4 region 27.95 23.87 19.87 Candidate 88 16S rRNA V4 region 27.20 23.96 20.37 Candidate 89 16S rRNA V4 region 27.16 23.97 20.93 Candidate 90 16S rRNA V4 region 27.45 23.98 21.76 Candidate 91 16S rRNA V4 region 27.92 24.11 20.62 Candidate 92 16S rRNA V4 region 27.32 23.22 21.23 Candidate 93 16S rRNA V4 region 27.12 23.25 21.24 Candidate 94 16S rRNA V4 region 27.52 23.25 20.49 Candidate 95 16S rRNA V4 region 27.94 23.38 19.83 Candidate 96 16S rRNA V4 region 27.63 23.60 19.03 Candidate 97 16S rRNA V4 region 27.62 23.63 19.39 Candidate 98 16S rRNA V4 region 27.64 23.63 20.73 Candidate 99 16S rRNA V4 region 27.79 23.83 20.52 Candidate 100 16S rRNA V4 region 27.40 23.88 19.61

Bifidobacterium BLAST Results
Sample Colony no. Description Accession Sample 1 One Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 2 Bifidobacterium adolescentis strain ZJ2 chromosome, complete genome CP047129.1 Bifidobacterium adolescentis strain P2P3 chromosome, complete genome CP024959.1 Bifidobacterium adolescentis strain 6 chromosome, complete genome CP023005.1 Bifidobacterium adolescentis strain 1-11 chromosome, complete genome CP028341.1 Bifidobacterium adolescentis isolate MGYG-HGUT-02395 genome assembly, chromosome: 1 LR698990.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 4 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 5 Fail Sample 2 One Bifidobacterium longum strain 51A chromosome, complete genome CP026999.1 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 LR134369.1 Bifidobacterium longum subsp. longum strain BORI chromosome, complete genome CP031133.1 Bifidobacterium longum subsp. longum strain AH1206, complete genome CP016019.1 Bifidobacterium longum subsp. longum strain CCUG30698, complete genome CP011965.1 2 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp . kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 4 Fail 5 Fail Sample 3 One Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium longum strain BXY01, complete genome CP008885.1 Bifidobacterium longum subsp. suillum strain JCM 19995 chromosome, complete genome CP070996.1 2 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 4 Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium longum strain BXY01, complete genome CP008885.1 Bifidobacterium longum subsp. suillum strain JCM 19995 chromosome, complete genome CP070996.1 5 Fail Sample 4 One Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 2 Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 Bifidobacterium breve isolate B.breve_1_mod genome assembly, chromosome: BILOC7D69C13_1 LR655209.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 4 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 5 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 Sample 5 One Bifidobacterium adolescentis strain P2P3 chromosome, complete genome CP024959.1 Bifidobacterium adolescentis strain 6 chromosome, complete genome CP023005.1 Bifidobacterium adolescentis isolate MGYG-HGUT-02395 genome assembly, chromosome: 1 LR698990.1 Bifidobacterium adolescentis strain PRL2019 chromosome, complete genome CP053072.1 Bifidobacterium adolescentis strain ZJ2 chromosome, complete genome CP047129.1 2 Bifidobacterium longum strain 51A chromosome, complete genome CP026999.1 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 LR134369.1 Bifidobacterium longum subsp. longum strain BORI chromosome, complete genome CP031133.1 Bifidobacterium longum subsp. longum strain AH1206, complete genome CP016019.1 Bifidobacterium longum subsp. longum strain CCUG30698, complete genome CP011965.1 3 Bifidobacterium longum strain 51A chromosome, complete genome CP026999.1 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 LR134369.1 Bifidobacterium longum subsp. longum strain BORI chromosome, complete genome CP031133.1 Bifidobacterium longum subsp. longum strain AH1206, complete genome CP016019.1 Bifidobacterium longum subsp. longum strain CCUG30698, complete genome CP011965.1 4 Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium longum strain BXY01, complete genome CP008885.1 Bifidobacterium longum subsp. suillum strain JCM 19995 chromosome, complete genome CP070996.1 5 Fail

<110> Industry-Academic Cooperation Foundation, Dankook University <120> PRIMER SET FOR DETECTING BIFIDOBACTERIUM AND USE THEREOF <130>P-1 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Transaldolase <400> 1 aagggcatct ccgtcaacg 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Transaldolase <400> 2 ggagacgaag aaggaagcga 20

Claims (8)

Base sequence represented by SEQ ID NO: 1; And a primer set for detection of Bifidus strains containing the base sequence represented by SEQ ID NO: 2. delete The primer set of claim 1 is a primer set for detection of Bifidus strains, characterized in that it amplifies the Transaldolase gene. A composition for detection or quantitation of Bifidus strains comprising the primer set of claim 1. A kit for detection or quantification of Bifidus strains comprising the primer set of claim 1. A method for detecting or quantifying strains of the genus Bifidus comprising performing and analyzing a polymerase chain reaction on a sample using the primer set of claim 1. delete The method of claim 6, wherein the sample is feces.