KR20230025223A - Primer set for detecting bifidobacterium and use thereof - Google Patents

Abstract

The present invention relates to a qPCR-only primer set for the accurate quantification of strains of the genus Bifidobacterium in the intestine, and a use thereof. In the case of discriminating the strains of the genus Bifidobacterium using the primer set of the present invention, it is possible to distinguish the strains of the genus Bifidobacterium more conveniently, accurately, and economically than a conventional NGS method using a 16S ribosomal RNA gene.

Description

Primer set for quantification of bifidus strains and its use {PRIMER SET FOR DETECTING BIFIDOBACTERIUM AND USE THEREOF}

The present invention relates to a qPCR-only primer set for accurate quantification of intestinal bifidence bacteria and its use.

Currently, a new awareness and importance of Bifidobacterium, also called bifidus, is emerging. Bifidobacterium is a dominant species in the intestinal flora of healthy adults as well as the intestinal flora of breastfeeding infants, accounting for about 25% of the fecal microorganisms.

Bifidobacterium is an anaerobic bacterium, a gram-positive, nonporous bacillus, and shows a unique V- or Y-shaped shape, and the optimal temperature for living bacteria is 36-38 degrees. These bacteria perform hetero-fermentation to produce acetic acid and lactic acid at a ratio of 3:2, and are characterized by no gas production during sugar metabolism. In particular, unlike other lactic acid bacteria, it specifically produces only L(+)-lactic acid that is easily absorbed in the human body, so it does not cause acidosis in infants. In addition, Bifidobacterium is ingested into the body and settles in the intestinal tract while passing through the digestive tract, mutually influencing various intestinal bacterial flora that are already inhabited, thereby improving human nutrition, aging, carcinogenesis, immune function, intestinal infection and drugs. In addition to other effects, it inhibits the proliferation of decaying bacteria in the intestines, decomposes proteins and detoxifies toxic substances such as nitrosoamine produced by other harmful bacteria, synthesizes vitamins, and digests lactose and protein by the action of phospatase. Bifidobacterium is known to have many beneficial effects such as enhancement of calcium absorption in the body, reduction of cholesterol in the blood, and anti-cancer activity, so the expected health effects of Bifidobacterium bacteria have come into the limelight. Therefore, the current market size of dairy products such as yogurt and cheese and probiotics using Bifidobacterium is rapidly expanding. In Korea, functional food containing Bifidobacterium, health supplements, or intestinal supplements are on the market, and powdered milk additives for the normalization of the intestinal flora of artificial infants and feeds for aquaculture such as poultry are useful as probiotics. It is highly rated. In addition, bifidobacteria are one of the beneficial bacteria present in the intestine, and different clinical responses may appear depending on the ratio of bifidobacteria in the intestine.

On the other hand, next-generation sequencing (NGS) is a technology capable of high output of sequencing data of a genome or gene group to be identified. This technology has led to the development of various fields of molecular genetic research, ranging from reading the whole genome of various species to identifying the frequency of genes expressed in specific tissues. At the same time, the introduction of NGS brought great changes to the field of microbial research. In existing microbial studies, microbial identification was limited to 16S identification through Sanger sequencing for culture-dependent bacteria. However, with the introduction of NGS technology, it became possible to classify all microorganisms present in a sample, and it became possible to identify previously unknown non-culturable microorganisms. As described above, identifying all microbial genome groups existing in a given environment based on NGS technology is called 'metagenome profiling'. As the most popular method used for metagenome profiling, there is a method of analyzing a microbial community by reading some nucleotide sequence information of the 16S ribiosomal RNA gene, which is commonly conserved in the genome of all bacteria. Within the gene, there is a 'variable region', which is a nucleotide sequence region that differs from species to species. Therefore, NGS-based 16S metagenome profiling identifies the microbial community by reading this variable region region. However, although the development of NGS has led to the development of various microbiological studies, it still has disadvantages in that expensive costs are required for experiments and analysis and considerable time is consumed until results are obtained. In addition, there is a fatal research barrier in that it is difficult to accurately target strains at the species level due to high nucleotide sequence similarity between species existing in the 16S rRNA gene. In order to overcome these difficulties, an approach is being made to use a quantitative real-time PCR that can detect only specific probiotics strains identified based on NGS and quickly check the relative frequency.

qRT-PCR is a second-generation gene amplification device that can monitor the polymerization chain reaction for a specific target gene in real time. qRT-PCR is mainly used for the purpose of relative or absolute quantification of a target gene present in a sample. Recently, it can be seen that the photometric sensitivity and accuracy of the equipment are high enough that qRT-PCR diagnosis using specific primers is recognized as the gold standard for molecular diagnosis of the coronavirus that causes COVID-19. . In addition, in the field of microbial research, qRT-PCR is used to confirm the existence of difficult-to-cultivate microbial strains by preparing primers targeting a specific protein coding region possessed by the strain, rather than the 16S rRNA gene region. For example, designing primers in genetic coding regions possessed by specific bacterial species for proteins essential for bacterial cell wall formation. This approach can reduce the time and financial burden of NGS, and can be an advantage of accurate strain targeting that can avoid the high sensitivity of the equipment and the nucleotide sequence similarity problem of the 16S rRNA gene.

Therefore, in order to overcome the existing problems, the present invention designs qRT-PCR-only primers for a specific protein coding region rather than the 16S rRNA region for strains of the genus Bifidobacteria classified through NGS-based 16S metagenomic analysis technology, thereby performing qRT-PCR The assay provides an approach to confirm the presence or absence of strains of the genus Bifidobacteria in the intestine.

An object of the present invention is a primer represented by SEQ ID NO: 1; And to provide a primer set for detecting microorganisms inhabiting the intestine including the primer represented by SEQ ID NO: 2.

Another object of the present invention is to provide a composition for detecting or quantifying intestinal microorganisms comprising the primer set.

In addition, another object of the present invention is to provide a kit for detecting or quantifying microorganisms inhabiting the intestine including a primer set.

In addition, another object of the present invention is to provide a method for detecting or quantifying microorganisms inhabiting the intestine, comprising the step of performing and analyzing a polymerase chain reaction using the primer set in a sample.

Accordingly, the present invention is a primer represented by SEQ ID NO: 1; and a primer set for detecting microorganisms inhabiting the intestine, including the primer represented by SEQ ID NO: 2.

In addition, the present invention provides a composition for detecting or quantifying intestinal microorganisms comprising the primer set.

In addition, the present invention provides a kit for detecting or quantifying intestinal microorganisms, including the primer set.

In addition, the present invention provides a method for detecting or quantifying intestinal microorganisms, comprising the step of performing and analyzing a polymerase chain reaction using the primer set in a sample.

When Bifidos strains are identified using the primer set of the present invention, it is possible to distinguish Bifidos strains inhabiting the intestine more easily, accurately, and economically than the existing NGS method using 16S ribosomal RNA gene.

1 is a schematic diagram of an overall experiment for detecting strains of the genus Bifidus of the present invention.
Figure 2 is a diagram showing the results of an in silico assay demonstrating the specificity of the Bifidos genus strain for the primer set of the present invention.
3 is a diagram comparing the effects of the qPCR method using the primer set of the present invention and the method using NGS in detecting and quantifying Bifidos genus strains.

Hereinafter, a primer set for detecting a Bifidos sp. strain according to an embodiment of the present invention, a composition and a kit including the same will be described in detail.

Hereinafter, terms used in the present invention are defined.

Terminology used herein is for describing the embodiments and is not intended to limit the present invention. In this specification, singular forms also include plural forms unless specifically stated otherwise in a phrase. As used herein, “and/or” includes each and every combination of one or more of the recited elements.

As used herein, the terms "comprises" and/or "comprising" means that a stated component, step, operation, and/or element is one or more other components, steps, operations, and/or elements. does not exclude the presence or addition of

As used herein, the term "microbiome" refers to microorganisms living in the human body, and refers to the intestinal microorganisms themselves or the entire genetic information of the intestinal microorganisms.

In addition, the term "discrimination" used herein means to distinguish a Bifidos genus strain from other strains from a sample by the primer set of the present invention.

In addition, the term "primer" used herein refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and serves as a starting point for synthesis of a primer extension product. The length and sequence of the primers should permit the synthesis of the extension product to begin, and the specific length and sequence of the primers depend on the required complexity of the DNA or RNA target as well as the conditions of use of the primers, such as temperature and ionic strength. something to do.

The primer set of the present invention consists of forward and reverse primers, respectively, in order to amplify genes specifically present in the strains inhabiting the intestine. The primer set of the present invention takes into consideration conditions such as the length of the primer, the Tm value, the GC content of the primer, and the prevention of dimer formation of the primer by the self-complementary sequence in the primer, and is suitable for detecting strains inhabiting the intestine. It is carefully designed to maximize sensitivity and specificity. The primer set of the present invention can be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods. These nucleotide sequences can also be modified through various methods known in the art. Examples of such modifications are methylation, capping, substitution of one or more natural nucleotides with homologs, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc. ) or to charged linkages (e.g. phosphorothioates, phosphorothioates, etc.). In addition, the nucleotide sequence of the primer set of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The probe of the present invention may be labeled with a fluorescent substance at the end of the probe. A fluorescent marker (reporter dye) may be coupled to the 5'-end of the probe, and a fluorescence quencher may be coupled to the 3'-end. Any material developed to date may be used as the fluorescent marker, for example, FAM (6-carboxyfluorescein), HEX (hexachloro-6-carboxyfluorescein), TET (tetrachlorofluorescein), Texas red , rhodamine green, rhodamine red, tetramethylrhodamine, NED (N-(1-naphthyl) ethylenediamine), Cy5 (cyanine-5) or Cy3 (cyanine-3) can be used, preferably FAM (6-carboxyfluorescein) can be used.

Examples of the fluorescence inhibitor include 6-carboxytetramethylrhodamine (TAMRA), black hole quencher 1 (BHQ1), black hole quencher 2 (BHQ2), black hole quencher 3 (BHQ3), deep dark quencher (DDQ), and blackberry quencher. Alternatively, Iowa black may be used, and preferably TAMRA (6-carboxytetramethylrhodamine) may be used.

In the present invention, the polymerase chain reaction includes (i) an initial denaturation step; (ii) repeating one cycle consisting of denaturation, annealing, and extension several to dozens of times; and (iii) a final heat treatment step; Alternatively, it may be performed through a thermal cycle program that appropriately modifies these steps. Specifically, as the PCR conditions in the present invention, initial denaturation is performed by heat treatment at 90 to 95 ° C. for 5 to 20 minutes, followed by denaturation at 95° C. for 10 seconds to 2 minutes; an annealing step at 54 to 60° C. (Tm) for 10 seconds to 2 minutes; And PCR amplification can be performed by repeating the synthesis step (extension) for 10 seconds to 2 minutes at 70 to 75 ° C. a total of 10 to 50 times, and the reaction temperature and reaction time conditions can be appropriately modified by those skilled in the art. .

In the present invention, any method known in the art may be used to analyze the size of the PCR amplification product. For example, the size of the amplification product can be determined by comparison with a target size marker by agarose or polyacrylamide gel electrophoresis.

In the present invention, real-time polymerase chain reaction is an experimental method capable of absolute or relative quantification of target DNA by fluorescence emission simultaneously with amplification of target DNA. By digitizing, it is possible to detect and quantify quickly and accurately. In the case of performing the above method, it can be performed using a probe that specifically binds to the amplified sequence in the target DNA and is tagged with a fluorescent marker and a fluorescent suppressor, and a fluorescent substance such as SYBR-Green is used without using a probe. It can also be done using Results for real-time polymerase chain reaction can be analyzed using Ct (cycle threshold) values.

Hereinafter, the present invention will be described in detail by examples.

Example 1. Preparation of the primer set of the present invention

Candidate genes were selected by examining papers containing metagenome-related research in relation to the genus to be found through various websites such as Google/NAVER.

After that, for the selected gene list, the gene name and genus name were investigated in the 'identical protein' category on the NCBI homepage, and the summary file was downloaded for the listed gene list and organized into an Excel file.

Thereafter, hypothetical proteins, incorrect protein names, and bacterial names were deleted, and after filtering, the number of strains for the species was set to 2 to 5 when information on species for the genus exceeded 100. After filtering was completed, the Protein ID of the row called Protein in the summary file was pasted into a text file and saved. After that, after loading the downloaded CDS sequence using the 'Bio edit' tool, the sequence information was converted into an amino acid format, Clustal multiple alignment was performed, and then converted into a sequence format. After alignment was complete, sequences that appeared to be completely different proteins or had no correlation were removed, and alignment was performed again. After alignment, primers suitable for real-time PCR were derived within the conserved sequence region between sequences. After that, it was confirmed whether the primer was suitable using 'Oligo calc' and 'Oligo Analysis' tools for the designed primer. After this, through the NCBI Nucleotide BLAST test, it was first checked whether there was an overlap with the sequence of other bacteria, and then, after checking with a tool called 'In silico ( http://insilico.ehu.es/PCR/ )', the primer A set was produced and its information is shown in Table 1 (see FIGS. 1 and 2).

Bacterial taxon Rank Target gene Forward primer (5'-3') Reverse primer (5'-3') Tm ℃ GC %
(F/R) Amplicon Size (bp) Bifidobacterium Genus Transaldolase AAGGGCATCTCCGTCAACG GGAGACGAAGAAGGAAGCGA 59.5/60.5 58/55 146

Example 2. Confirmation of Bifidos genus detection from human feces using the primer set of the present invention

In order to confirm the effect of the primer set derived in Example 1 on detecting intestinal Bifidobacterium strains, the following experiment was performed.

First, microbial genomes were extracted from 10 human feces. After extracting the DNA of the microbiome using a commercially available QIAGEN microbial genome extraction kit, the yield and quality of the extracted DNA were confirmed (using Qubit assay equipment provided by ThermoFisher). Thereafter, the double-stranded DNA concentration of each DNA sample was diluted to 10 ng / ul to standardize, and real-time gene amplification was performed using non-genus strain-specific primers from the DNA of the standardized microbiome, and the results were confirmed. (PCR composition: Template DNA (microbial genomic DNA; 10ng/ul)-1ul; Forward primer-1ul, Reverse primer-1ul; SYBR Green taq pol-10ul/ D.W-7ul).

Example 3. Comparison of the primer set of the present invention with a set targeting 16s rRNA

1. Quantitative standardization of dsDNA of microbial genomic DNA samples isolated from feces of 100 healthy people

Table 2 below shows that the bacterial genomic dsDNA quantity, which must be performed to evaluate the relative frequency in a sample of a specific target microbial strain, has been standardized under the same concentration conditions. Standard curve calculation using qRT-PCR assay method) is the result. Theoretically, all microbial genomes contain a sequence (about 1.5 kbp) encoding 16S ribosomal RNA. Considering that the optimal amplicon size for qRT-PCR is about 100-200 bp, qRT targets the V4 region, the fourth hyper-variable region (about 150-180 bp) on the 16S sequence. - PCR was performed. The order of the experiment is as follows.

First, the amount of double-stranded DNA in DNA samples in which DNAs of various strains were mixed was confirmed through ThermoFisher's Qbit 4.0 equipment. After this, the dsDNA concentration of all samples was diluted and normalized to 10 ng/ul. Then, for standard curve calculation using qRT-PCR, all diluted dsDNA samples (100 samples diluted to 10 ng/ul) were sampled at 10^-1, 10^-2 and 10^-3 It was serially diluted by 2x. Each diluted sample (300 serially diluted samples) was used as a template DNA and qRT-Q4 using 16S V4 region universal primer pairs (515F: 5′-GTGCCAGCMGCCGCGGTAA-3′ / 806R: 5′-GGACTACHVGGGTWTCTAAT-3′). PCR was performed.

2. Comparison of the frequency of specific strains in a sample measured by NGS and the frequency of microorganisms in the same sample calculated from the Ct value of qRT-PCR

The relative frequency occupied by a specific microorganism from the Ct value was calculated as follows.

(1) relative bacterial frequency value = 1/2^(Ct value)

(2) relative bacterial proportion value (%) = corresponding frequency data/sum of 100 frequency data X 100

Through this comparison data, it can be confirmed that the NGS frequency and the qPCR frequency are similar, which indicates that the relative proportion of the specific strain detected and quantified through NGS in the sample can be significantly detected and quantified even using primers dedicated to Qrt-PCR. can check that

3. When using the primers of the present invention, the specificity of the strain is verified through Sanger sequencing

Bacterial taxonomy identification was performed through Sanger sequencing and NCBI BLAST using some of the Qpcr amplicon products prepared using the primer set of the present invention.

More specifically, pure DNA was obtained by purifying a part of the amplicon product applied to qrt-PCR. Since the amplicon size of the qrt-pcr product is about 100-150bp, it conformed to the appropriate library size for Sanger sequencing. Therefore, the library size was expanded to about 400 bp through gene ligation using a TA cloning vector containing the M13 sequence. Thereafter, the plasmid DNA was transfected into CP-cell (E-coli) and plated on LB medium. Colony PCR was performed by extracting a white colony (potential transformed CP-cell) formed on LB medium. The PCR primers used at this time were M13 universal sequence. Sanger sequencing was performed using the purified Colony PCR amplicon product as template DNA. After that, bacterial identification was performed using NCBI nucleotide BLAST using the sequence data output from Sanger sequencing to determine whether the target strain was the right genus. Through the above method, it was confirmed that a strain of the genus Bifidus was detected (Table 3).

Sample ID Target gene *Ct value (10^-3) Ct value (10^-2) Ct alue (10^-1) Candidate 1 16S rRNA V4 region 26.24 22.17 19.27 Candidate 2 16S rRNA V4 region 26.28 22.48 19.38 Candidate 3 16S rRNA V4 region 26.09 22.66 19.03 Candidate 4 16S rRNA V4 region 26.01 22.78 19.15 Candidate 5 16S rRNA V4 region 26.58 22.03 19.23 Candidate 6 16S rRNA V4 region 26.56 22.07 19.18 Candidate 7 16S rRNA V4 region 26.47 22.08 19.80 Candidate 8 16S rRNA V4 region 27.38 22.11 19.57 Candidate 9 16S rRNA V4 region 26.92 22.22 19.75 Candidate 10 16S rRNA V4 region 26.78 22.26 19.84 Candidate 11 16S rRNA V4 region 26.46 22.39 19.63 Candidate 12 16S rRNA V4 region 26.96 22.43 19.36 Candidate 13 16S rRNA V4 region 26.79 22.47 19.85 Candidate 14 16S rRNA V4 region 26.50 22.54 19.04 Candidate 15 16S rRNA V4 region 26.72 22.59 19.45 Candidate 16 16S rRNA V4 region 27.03 22.59 19.20 Candidate 17 16S rRNA V4 region 26.57 22.59 18.70 Candidate 18 16S rRNA V4 region 27.13 22.60 19.00 Candidate 19 16S rRNA V4 region 26.91 22.66 18.91 Candidate 20 16S rRNA V4 region 26.26 22.78 19.00 Candidate 21 16S rRNA V4 region 26.68 22.83 19.23 Candidate 22 16S rRNA V4 region 26.96 22.85 19.62 Candidate 23 16S rRNA V4 region 26.58 22.96 19.89 Candidate 24 16S rRNA V4 region 26.97 23.03 19.50 Candidate 25 16S rRNA V4 region 27.32 23.11 19.34 Candidate 26 16S rRNA V4 region 27.22 23.13 19.29 Candidate 27 16S rRNA V4 region 27.00 23.27 19.30 Candidate 28 16S rRNA V4 region 26.90 23.29 19.04 Candidate 29 16S rRNA V4 region 27.37 23.31 19.96 Candidate 30 16S rRNA V4 region 27.55 23.32 20.72 Candidate 31 16S rRNA V4 region 27.54 23.35 18.63 Candidate 32 16S rRNA V4 region 26.95 23.40 19.38 Candidate 33 16S rRNA V4 region 27.46 23.42 19.03 Candidate 34 16S rRNA V4 region 27.37 23.48 19.02 Candidate 35 16S rRNA V4 region 27.56 23.48 19.98 Candidate 36 16S rRNA V4 region 27.14 23.52 19.11 Candidate 37 16S rRNA V4 region 27.94 23.52 19.97 Candidate 38 16S rRNA V4 region 26.97 23.67 20.12 Candidate 39 16S rRNA V4 region 27.38 23.67 19.25 Candidate 40 16S rRNA V4 region 27.18 23.70 18.32 Candidate 41 16S rRNA V4 region 27.28 23.71 19.92 Candidate 42 16S rRNA V4 region 27.53 23.73 19.96 Candidate 43 16S rRNA V4 region 27.76 23.77 19.70 Candidate 44 16S rRNA V4 region 27.93 23.83 19.07 Candidate 45 16S rRNA V4 region 27.93 23.83 19.40 Candidate 46 16S rRNA V4 region 27.46 23.84 19.66 Candidate 47 16S rRNA V4 region 27.28 23.85 20.27 Candidate 48 16S rRNA V4 region 27.07 23.86 19.22 Candidate 49 16S rRNA V4 region 27.77 23.89 20.07 Candidate 50 16S rRNA V4 region 27.62 23.91 20.69 Candidate 51 16S rRNA V4 region 27.05 23.98 19.63 Candidate 52 16S rRNA V4 region 27.90 23.98 20.21 Candidate 53 16S rRNA V4 region 27.99 23.99 20.06 Candidate 54 16S rRNA V4 region 27.59 23.03 19.75 Candidate 55 16S rRNA V4 region 27.44 23.07 19.75 Candidate 56 16S rRNA V4 region 27.58 23.08 20.20 Candidate 57 16S rRNA V4 region 26.96 23.09 20.61 Candidate 58 16S rRNA V4 region 27.90 23.09 19.91 Candidate 59 16S rRNA V4 region 27.27 23.10 20.69 Candidate 60 16S rRNA V4 region 27.54 23.12 19.76 Candidate 61 16S rRNA V4 region 27.75 23.13 20.15 Candidate 62 16S rRNA V4 region 27.27 23.16 20.49 Candidate 63 16S rRNA V4 region 27.48 23.16 19.62 Candidate 64 16S rRNA V4 region 26.94 23.18 20.82 Candidate 65 16S rRNA V4 region 27.20 23.19 20.02 Candidate 66 16S rRNA V4 region 27.37 23.23 20.18 Candidate 67 16S rRNA V4 region 27.56 23.24 20.23 Candidate 68 16S rRNA V4 region 27.29 23.26 20.70 Candidate 69 16S rRNA V4 region 28.06 23.26 19.96 Candidate 70 16S rRNA V4 region 27.96 23.26 19.97 Candidate 71 16S rRNA V4 region 27.96 23.27 20.05 Candidate 72 16S rRNA V4 region 27.43 23.29 20.61 Candidate 73 16S rRNA V4 region 27.58 23.30 19.92 Candidate 74 16S rRNA V4 region 27.35 23.31 20.77 Candidate 75 16S rRNA V4 region 27.66 23.31 19.87 Candidate 76 16S rRNA V4 region 27.93 23.35 20.16 Candidate 77 16S rRNA V4 region 27.12 23.38 19.37 Candidate 78 16S rRNA V4 region 27.36 23.51 20.01 Candidate 79 16S rRNA V4 region 27.34 23.54 20.83 Candidate 80 16S rRNA V4 region 27.99 23.59 20.52 Candidate 81 16S rRNA V4 region 27.86 23.61 19.76 Candidate 82 16S rRNA V4 region 27.81 23.67 20.31 Candidate 83 16S rRNA V4 region 27.73 23.71 20.00 Candidate 84 16S rRNA V4 region 27.96 23.76 20.33 Candidate 85 16S rRNA V4 region 28.02 23.78 20.65 Candidate 86 16S rRNA V4 region 27.43 23.85 20.30 Candidate 87 16S rRNA V4 region 27.95 23.87 19.87 Candidate 88 16S rRNA V4 region 27.20 23.96 20.37 Candidate 89 16S rRNA V4 region 27.16 23.97 20.93 Candidate 90 16S rRNA V4 region 27.45 23.98 21.76 Candidate 91 16S rRNA V4 region 27.92 24.11 20.62 Candidate 92 16S rRNA V4 region 27.32 23.22 21.23 Candidate 93 16S rRNA V4 region 27.12 23.25 21.24 Candidate 94 16S rRNA V4 region 27.52 23.25 20.49 Candidate 95 16S rRNA V4 region 27.94 23.38 19.83 Candidate 96 16S rRNA V4 region 27.63 23.60 19.03 Candidate 97 16S rRNA V4 region 27.62 23.63 19.39 Candidate 98 16S rRNA V4 region 27.64 23.63 20.73 Candidate 99 16S rRNA V4 region 27.79 23.83 20.52 Candidate 100 16S rRNA V4 region 27.40 23.88 19.61

Bifidobacterium BLAST Results
Sample Colony no. Description Accession Sample 1 One Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 2 Bifidobacterium adolescentis strain ZJ2 chromosome, complete genome CP047129.1 Bifidobacterium adolescentis strain P2P3 chromosome, complete genome CP024959.1 Bifidobacterium adolescentis strain 6 chromosome, complete genome CP023005.1 Bifidobacterium adolescentis strain 1-11 chromosome, complete genome CP028341.1 Bifidobacterium adolescentis isolate MGYG-HGUT-02395 genome assembly, chromosome: 1 LR698990.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 4 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 5 Fail Sample 2 One Bifidobacterium longum strain 51A chromosome, complete genome CP026999.1 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 LR134369.1 Bifidobacterium longum subsp. longum strain BORI chromosome, complete genome CP031133.1 Bifidobacterium longum subsp. longum strain AH1206, complete genome CP016019.1 Bifidobacterium longum subsp. longum strain CCUG30698, complete genome CP011965.1 2 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp . kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 4 Fail 5 Fail Sample 3 One Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium longum strain BXY01, complete genome CP008885.1 Bifidobacterium longum subsp. suillum strain JCM 19995 chromosome, complete genome CP070996.1 2 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium pseudocatenulatum strain N2 chromosome, complete genome CP072504.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 4 Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium longum strain BXY01, complete genome CP008885.1 Bifidobacterium longum subsp. suillum strain JCM 19995 chromosome, complete genome CP070996.1 5 Fail Sample 4 One Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 2 Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 Bifidobacterium breve isolate B.breve_1_mod genome assembly, chromosome: BILOC7D69C13_1 LR655209.1 3 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 4 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 5 Bifidobacterium pseudocatenulatum strain 12 chromosome, complete genome CP025199.1 Bifidobacterium pseudocatenulatum DSM 20438 = JCM 1200 = LMG 10505 DNA, complete genome AP012330.1 Bifidobacterium kashiwanohense PV20-2, complete genome CP007456.1 Bifidobacterium catenulatum subsp. kashiwanohense strain APCKJ1 chromosome, complete genome CP026729.1 Bifidobacterium breve strain IDCC4401 chromosome CP045532.1 Sample 5 One Bifidobacterium adolescentis strain P2P3 chromosome, complete genome CP024959.1 Bifidobacterium adolescentis strain 6 chromosome, complete genome CP023005.1 Bifidobacterium adolescentis isolate MGYG-HGUT-02395 genome assembly, chromosome: 1 LR698990.1 Bifidobacterium adolescentis strain PRL2019 chromosome, complete genome CP053072.1 Bifidobacterium adolescentis strain ZJ2 chromosome, complete genome CP047129.1 2 Bifidobacterium longum strain 51A chromosome, complete genome CP026999.1 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 LR134369.1 Bifidobacterium longum subsp. longum strain BORI chromosome, complete genome CP031133.1 Bifidobacterium longum subsp. longum strain AH1206, complete genome CP016019.1 Bifidobacterium longum subsp. longum strain CCUG30698, complete genome CP011965.1 3 Bifidobacterium longum strain 51A chromosome, complete genome CP026999.1 Bifidobacterium longum strain NCTC11818 genome assembly, chromosome: 1 LR134369.1 Bifidobacterium longum subsp. longum strain BORI chromosome, complete genome CP031133.1 Bifidobacterium longum subsp. longum strain AH1206, complete genome CP016019.1 Bifidobacterium longum subsp. longum strain CCUG30698, complete genome CP011965.1 4 Bifidobacterium longum Jih1 DNA, complete genome AP022868.1 Bifidobacterium longum strain Su859 genome assembly, chromosome: I LT629712.1 Bifidobacterium longum subsp. longum GT15, complete genome CP006741.1 Bifidobacterium longum strain BXY01, complete genome CP008885.1 Bifidobacterium longum subsp. suillum strain JCM 19995 chromosome, complete genome CP070996.1 5 Fail

<110> Industry-Academic Cooperation Foundation, Dankook University <120> PRIMER SET FOR DETECTING BIFIDOBACTERIUM AND USE THEREOF <130> P-1 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer for Transaldolase <400> 1 aagggcatct ccgtcaacg 19 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> reverse primer for Transaldolase <400> 2 gggacgaag aaggaagcga 20

Claims (8)

The nucleotide sequence represented by SEQ ID NO: 1; and a primer set for detecting microorganisms living in the intestine comprising the nucleotide sequence represented by SEQ ID NO: 2. The primer set according to claim 1, wherein the microorganisms inhabiting the intestine are strains of the genus Bifidosus. The primer set of claim 1 is characterized by amplifying the Transaldolase gene, the primer set. A composition for detecting or quantifying intestinal microorganisms comprising the primer set of claim 1. A kit for detecting or quantifying intestinal microorganisms comprising the primer set of claim 1. A method for detecting or quantifying intestinal microorganisms comprising the step of performing and analyzing a polymerase chain reaction using the primer set of claim 1 on a sample. The method of claim 6, wherein the microorganisms inhabiting the intestines are strains of the genus Bifidosus. The method of claim 6, wherein the sample is feces.

Images