KR102589946B1 - NEW COSMETICS COMPOSITION FOR INHIBITING MELANIN PIGMENT PRODUCTION WITH BOTH α-MSH COMPETITIVE EFFECT AND TYROSINASE INHIBITION EFFECT - Google Patents

Abstract

The present invention relates to a novel cosmetic composition for inhibiting melanin pigment formation, which acts to inhibit excessive melanin production due to aging and skin irritation, and has both an α-MSH competitive effect and a tyrosinase inhibitory effect.
The cosmetic composition for inhibiting melanin pigment formation according to the present invention can effectively improve spots, freckles, and dark skin by controlling whitening mechanism factors without causing side effects on the human body.

Description

A novel cosmetic composition for inhibiting melanin pigment formation that has both α-MSH competitive effect and tyrosinase inhibitory effect {NEW COSMETICS COMPOSITION FOR INHIBITING MELANIN PIGMENT PRODUCTION WITH BOTH α-MSH COMPETITIVE EFFECT AND TYROSINASE INHIBITION EFFECT}

The present invention is a whitening cosmetic composition that acts to suppress excessive melanin production due to aging and skin irritation, and has both an α-MSH competitive effect and a tyrosinase inhibitory effect. It has no side effects on the human body and prevents spots, freckles, and dark spots. It relates to a novel cosmetic composition for inhibiting melanin pigment formation that shows great efficacy in improving skin.

Melanin is a phenolic biopolymer widely distributed in nature and is a complex of black pigment and protein. It is a human defense substance that protects the skin from various skin irritations. However, when it is secreted excessively, hyperpigmentation such as spots and freckles is formed on the skin, and melanin precursors are known to cause cell death, acceleration of skin aging, and skin cancer.

Among the signal transduction pathways that regulate melanin production, the 3'5'-cyclic adenosine monophosphate (cAMP) pathway plays an important role. Cytokines produced due to ultraviolet rays or inflammatory reactions induce the expression of α-melanocyte stimulating hormone (α-MSH) through keratinocytes. Increased α-MSH induces the activation of melanocytes in the basal layer of the epidermis and activates adenylate cyclase by binding to the mleanocotin-1 receptor (MC1R) receptor present in the membrane of melanocytes. Adenylate cyclase promotes the change process from adenosine triphosphate (ATP) to cAMP, increasing the concentration of cAMP in the cell, and increased cAMP increases the transcription of microphthalmia associated transcription factor (MITF), thereby increasing tyrosinase, tyrosianse related protein (TRP-1) , it promotes the melanin production process by increasing the expression of related proteins such as dopachrome tautomerase (TRP-2). The tyrosinase expressed at this time oxidizes tyrosine to DOPA in the intracellular melanosome, oxidizes DOPA to DOPA chrome, and is divided into black-brown eumelanin and red-brown pheomelanin via dopaquinon. The produced melanin is delivered to the keratinocyte through dendrite in the form of melanosome. It deposits pigment into the skin.

Currently, various attempts are being made to inhibit melanogenesis, such as inhibiting the production and action of tyrosinase, developing a tyrosinase antagonist for DOPA, inhibiting melanosome transfer, reducing and decomposing melanin, promoting skin turn-over, and blocking ultraviolet rays. However, most studies target inhibition of tyrosinase activity, and currently known tyrosinase inhibitors include hydroquinone, 4-hydoroxyanisole, kojic acid, and azelaic acid, but their use is difficult due to problems with safety and economic feasibility. In addition, Vitamin C has been developed as a skin turn-over accelerator and Niacinamide as a melanosome transfer inhibitor, but its whitening effect is minimal and its efficacy is limited. Therefore, it is urgent to discover raw materials for strong whitening activity, and it is even more necessary to discover safer raw materials to meet demand.

Therefore, the present invention seeks to develop a cosmetic composition with high safety and strong whitening activity using the functional peptide D-Phenylalanyl Tripeptide-75 and kava kava root extract as active ingredients. D-phenylalanyl tripeptide-75 is a synthetic peptide composed of four amino acids: arginine, cysteine, leucine, and D-phenylalanine. In addition, kava kava root extract is extracted from Piper Methysticum root, and both raw materials are registered with the Korean Cosmetic Association (KKCA). As a result, the biggest goal of the present invention is to prevent freckles by containing as active ingredients functional peptides and natural product extracts that have both an α-MSH competitive effect on melanin production and a tyrosinase inhibitory effect on melanin production caused by aging and skin irritation. The goal is to develop a variety of new cosmetics for inhibiting melanin pigment formation that are highly effective in improving freckles and dark skin.

To this end, the present invention is a new whitening cosmetic composition that has both an α-MSH competitive effect and a tyrosinase inhibitory effect on the melanin production mechanism generated due to aging and skin irritation, and is highly effective in improving spots, freckles, and dark skin. The purpose is to provide a cosmetic composition for inhibiting melanin pigment formation. However, these tasks are illustrative and do not limit the scope of the present invention.

In order to achieve the above object, according to the present invention, a cosmetic composition containing 0.0001 to 1.0% by weight of D-phenylalanyl tripeptide-75 and 0.0001 to 1.0% by weight of kava kava root extract is provided.

In another form, the present invention provides a whitening cosmetic composition containing one or more selected peptides or natural product extracts. The peptide or natural product extract may be included in the cosmetic composition in an amount of 0.0001 to 1.0% by weight. The cosmetic may be selected from lotions, emulsions, gels, creams, essences, packs, ampoules, lotions, cleansers, soaps, body products, soaps, oils, lipsticks, and foundations.

The peptides and natural product extracts of the present invention have a skin whitening effect.

According to a preferred embodiment of the present invention, the composition of the present invention may be provided as a cosmetic composition for skin whitening.

The cosmetic composition of the present invention contains not only peptides and natural extracts, which are the active ingredients, but also ingredients commonly used in cosmetic compositions, such as antioxidants, stabilizers, solubilizers, vitamins, conventional auxiliaries such as pigments and fragrances, And it includes a carrier. In addition, as the carrier, purified water, monohydric alcohols (ethanol or propyl alcohol), polyhydric alcohols (glycerol, 1,3-butylene glycol or propylene glycol), higher fatty acids (palmitic acid or linolenic acid), oils (wheat germ) Oil, camellia oil, jojoba oil, olive oil, squalene, sunflower oil, Macadamia peanut oil, Avogard oil, or fatty acid glycerides) can be used, but are not limited to these. Additionally, surfactants, moisturizers, preservatives, antioxidants, etc. can be added as needed.

Surfactants that can be used in the cosmetic composition of the present invention include anionic surfactants such as alkylbenzene sulfonates, polyoxyalkylene alkyl sulfuric acid ester salts, alkyl sulfuric acid ester salts, olefin sulfonate salts, alkyl phosphates, and polyoxyalkylene salts. Examples include alkyl ether phosphate, dialkyl sulfosuccinate, fatty acid salt, etc., and nonionic surfactants include polyoxyethylene alkyl ether, polyoxyethylene fatty acid ester, polyhydric alcohol fatty acid partial ester, and polyoxyethylene polyhydric alcohol fatty acid partial ester. Examples include esters, polyglycerol fatty acid esters, polyoxyethylene hydrogenated castor oil derivatives, and fatty acid diethanolamide. In addition, cationic surfactants include tertiary aliphatic amine salts, alkyl trimethyl ammonium halides, dialkyl dimethyl ammonium halides, etc., and examples of amphoteric surfactants include amide betaine type, imidazolinium betaine type, and sulfo betaine type. etc. can be mentioned. Examples of the moisturizing agent include glycerin, propylene glycol, 1,3-butylene glycol, dipropylene glycol, and sorbitol. Examples of the preservative include benzoic acid, dehydroacetic acid, paraoxybenzoic acid esters (methyl paraoxybenzoate, butyl paraoxybenzoate, etc.), and phenoxyethanol. In addition, the antioxidants include ascorbic acid, BHA, etc., and in addition, ultraviolet absorbers, anti-inflammatory agents, fresheners, etc. can be added.

The peptide of the present invention may preferably be contained in an amount of 0.0001 to 10.0 wt%, more preferably 0.001 to 10.0 wt%, and most preferably 0.001 to 0.1% by weight based on the total weight of the cosmetic composition, but is not limited thereto. .

Additionally, the types of cosmetics are not particularly limited, and include, for example, lotions, emulsions, gels, creams, essences, packs, ampoules, lotions, cleansers, soaps, body products, skin care cosmetics such as soaps and oils, lipsticks, Examples include makeup cosmetics such as foundation, and the formulation is not particularly limited.

The cosmetic composition of the present invention can be used every day and can also be used for an indefinite period of time. Preferably, the amount, frequency and period of use can be adjusted depending on the user's age, skin condition or skin type, and concentration of peptide.

The present invention manufactures a whitening cosmetic composition that acts to suppress excessive melanin production due to aging and skin irritation, and has both an α-MSH competitive effect and a tyrosinase inhibitory effect, thereby providing whitening mechanism factors without side effects on the human body. You can effectively improve spots, freckles, and dark skin by adjusting .

In order to confirm the cytotoxicity and melanin production inhibition effect of D-phenylalanyl tripeptide-75 of the present invention, the results of cytotoxicity test and melanin production measurement experiment were evaluated and schematized in a graph. In order to confirm the cytotoxicity and melanin production inhibition effect of the kava kaba extract of the present invention, the results of the cytotoxicity test and the melanin production measurement experiment were evaluated and schematized in a graph. In order to confirm the effect of suppressing melanin production in Preparation Examples 1 to 4 of the composition of the present invention, the results of the melanin production measurement experiment were evaluated and schematized in a graph. In order to specify the effect of suppressing melanin production for Preparation Example 1 of the composition of the present invention, the results of cell photographs and melanin production measurement experiments are shown. In order to confirm the effect of inhibiting cAMP production in Preparation Examples 1 to 4 of the composition of the present invention, the results of the cAMP production measurement experiment were evaluated and schematized in a graph. In order to confirm the effect of inhibiting tyrosinase mRNA production in Preparation Examples 1 to 4 of the composition of the present invention, the results of an experiment measuring tyrosinase mRNA production were evaluated and schematized in a graph. In order to confirm the effect of suppressing melanin production in Preparation Examples 5 to 6 of the composition of the present invention, the results of an experiment measuring melanin production were evaluated and schematized in a graph. The improvement effectiveness rate of Preparation Example 7 of the composition of the present invention was evaluated through human application testing and schematized in a graph.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the content introduced here is provided to be thorough and complete, and to sufficiently convey the spirit of the present invention to those skilled in the art.

Cytotoxicity evaluation and melanin production inhibition effect of D-phenylalanyl tripeptide-75 and kava kava root extract

To confirm the whitening effect of the active ingredient of the present invention, cytotoxicity and melanin production were measured. Specifically, MTT assay was performed to determine the survival rate of B16F10 cells in response to D-phenylalanyl tripeptide-75 and kava kava root extract. Melanocytes (B16F10) were cultured in a 96-well plate at 2×10 ⁵ cells/ml for 24 hours, then samples of each concentration were processed and cultured for another 24 hours. The cultured medium was removed and treated with MTT solution (0.5 mg/ml in PBS). After 4 hours, the MTT solution was removed, DMSO was added to each well to dissolve formazan at 37°C for 30 minutes, and the absorbance was measured at 570 nm using a microplate reader (Molecular Devices Spectra MAX, Sunnyvale, CA, USA). . All experiments were statistically processed by taking the average value of 3 wells for each concentration, and expressed as relative survival rate (%) compared to the untreated sample group.

Melanin synthesis assay was performed to measure melanin production in B16F10 cells in response to D-phenylalanyl tripeptide-75 and kava kava root extract. B16F10 cells were cultured in a 6-well plate at 1×10 ⁵ cells/ml for 24 hours. Based on the results of the MTT assay, samples of each concentration containing 1 nM α-melanocyte stimulating hormone (α-MSH, Sigma, USA) were treated in each well, and the medium was collected 48 hours later to measure the extracellular melanin content (405 nm). In the case of intracellular melanin, cells in each well were collected using trypsin-EDTA, centrifuged at 12,000× for 10 minutes, and the supernatant was removed. The remaining cell pellet was dried at 65°C for 1 hour, then 1N NaOH solution was added and reacted at 65°C for 1 hour to dissolve the melanin in the cells. The absorbance of the cell lysate was measured at 405 nm using a microplate reader, and the amount of melanin production was expressed as a percentage (%) compared to the group treated with 1 nM α-MSH alone. As a result, both D-phenylalanyl tripeptide-75 and kava kava root extract were shown to be non-cytotoxic at concentrations below 100 uM, and the effect of inhibiting melanin production was also shown to be suppressed in a concentration-dependent manner at non-cytotoxic concentrations. (Figure 1 and Figure 2).

Manufacturing Examples 1 to 4. Preparation of a cosmetic composition containing D-phenylalanyl tripeptide-75 and kava kava root extract

A liquid composition containing D-phenylalanyl tripeptide-75 and kava kava root extract in the weight ratio shown in Table 1 below was prepared according to a conventional method.

Weight ratio of the cosmetic composition containing D-phenylalanyl tripeptide-75 and kava kava root extract of the present invention Sample name weight ratio Manufacturing Example 1 Production example 2 Production example 3 Production example 4 D-phenylalanyl tripeptide-75 One 2 3 4 Kava Kava Extract 10 8 6 4

Effect of suppressing melanin production for Preparation Examples 1 to 4 of cosmetic compositions

The effect of treating the liquid composition samples of Preparation Examples 1 to 4 on suppressing melanin production in B16F10 was evaluated through a melanin production measurement experiment. As a result, there was an effect of inhibiting melanin production in all groups, but among them, Preparation Example 1 was the most effective with an inhibition rate of 48% compared to the control group (α-MSH) (P<0.05) (Figure 3). In addition, in order to specify the effect of treatment of the liquid composition sample of Preparation Example 1 on the inhibition of melanin production in B16F10, cell photographs and melanin production measurement experiment results were shown (FIG. 4).

Effect of inhibiting cAMP production on Preparation Examples 1 to 4 of cosmetic compositions

The effect of treatment of the liquid composition samples of Preparation Examples 1 to 4 on inhibition of cAMP production in B16F10 was evaluated. Measuring cAMP production is an experimental method that shows the competitive effect of α-MSH on the higher-level α-MSH receptor. If cAMP production decreases after sample treatment, the sample has a stronger affinity for α-MSH receptor and dominates α-MSH. It can be evaluated as combined. Specifically, B16F10 cells were cultured at 1×10 ⁵ cells/ml in a 24-well plate and treated with 1 nM α-MSH and samples of each concentration. After 24 hours, the culture medium was removed, the cells were washed with cold PBS, and then treated with 0.1N HCl and the lysis reagent of the cAMP assay kit (diluted 1:5). After reacting at room temperature for 10 minutes, it was neutralized with 1N NaOH solution, centrifuged at 600× for 10 minutes at 2-8°C, and the supernatant was transferred to a microtube. Samples and standard solutions were diluted with calibrator diluent RD5-55 solution from the cAMP assay kit. The microplate strip included in the cAMP assay kit was washed using wash buffer. 50 ㎕ of primary antibody was added to each well, reacted at room temperature for 1 hour, and then washed. 50 ㎕ of mouse/rat cAMP conjugate and 100 ㎕ each of standard and sample were added and reacted at room temperature for 2 hours. After repeating the washing four times, 100 ㎕ of substrate solution was added and reacted at room temperature for 30 minutes without exposure to light. After adding 100 ㎕ of Stop solution to each well, the absorbance was measured and compared at 450 nm using a microplate reader within 30 minutes. As a result, there was an inhibitory effect on cAMP production in all groups, but among them, Preparation Example 1 was the most effective with an inhibition rate of 54% compared to the control group (α-MSH) (P<0.05) (FIG. 5).

Effect of suppressing tyrosinase mRNA production on Preparation Examples 1 to 4 of cosmetic compositions

The effect of treatment of the liquid composition samples of Preparation Examples 1 to 4 on inhibition of tyrosinase mRNA production in B16F10 was evaluated. Specifically, B16F10 cells were cultured at 1×10 ⁵ cells/ml in a 6-well plate and samples were processed. After culturing for 24 hours, the medium was removed, 1 ml of easy-BLUE total RNA extraction kit (INTRON BIOTECH, KOREA) was added, and cells were collected using a scraper and placed in a microtube. 200 ㎕ of chloroform was added thereto, vortexed for about 10 seconds, and then centrifuged at 4°C and 12,000 rpm for 10 minutes to obtain the supernatant. After adding the same amount of cold isopropanol as the supernatant, centrifugation was performed at 4°C and 12,000 rpm for 10 minutes, and the supernatant was removed, leaving only the pellet. The RNA pellet was washed with 70% ethanol, centrifuged at 4°C and 12000 rpm for 5 minutes, and the supernatant was removed. 30 ㎕ of 0.1% RNase-free water was added here. The total RNA thus prepared was reverse transcribed into complementary DNA (cDNA) using a cDNA synthesis kit (BIORAD, USA). To amplify DNA by PCR, the reverse transcribed cDNA was subjected to PCR amplification with primers (BIONEER, KOREA) and Taq PCR Pre-Mix (BIOFACT, KOREA). Cycling conditions were 95°C once for 2 minutes, 95°C for 30 seconds, 60°C for 30 seconds, 72°C 30 times for 1 minute, and 72°C once for 5 minutes and then at 4°C. The primer sequence is in Table 1. Same as The amplified RT-PCR product was mixed with Dyne LoadingSTAR (Dyne Bio, KOREA) and electrophoresed on a 1.5% agarose gel. The band was confirmed using a UV transilluminator, and the band was quantified using the ImageJ program.

Primer types and base sequences used in PCR gene order Forward primer (5' -> 3') Reverse primer (5' -> 3') Tyrosinase GACGGTCACTGCAGACTTTG (SEQ ID NO: 1) GCCATGACCAGGATGAC (SEQ ID NO: 2) GAPDH TGAAGGTCGGTGTGAACGGATTTCGC (SEQ ID NO: 3) CATGTAGGCCATGAGGTCCACCAC (SEQ ID NO: 4)

As a result, there was an effect of suppressing tyrosinase mRNA production in all groups, but among them, Preparation Example 1 was the most effective with an inhibition rate of 82% compared to the control group (α-MSH) (P<0.05) (FIG. 6).

Manufacturing Examples 5 to 7. Preparation of a cream containing D-phenylalanyl tripeptide-75 and kava kava root extract

A cream containing the liquid composition of Preparation Example 1 was prepared according to a conventional method with the composition and content shown in Table 2 below.

Ingredients and contents of cream containing D-phenylalanyl tripeptide-75 and kava kava root extract of the present invention ingredient Content (% by weight) Production example 5 Production example 6 Production example 7 D-phenylalanyl tripeptide-75 0.0002 0.002 0.02 Kava Kava Root Extract 0.002 0.02 0.2 Lipophilic glycerin monostearate 2.0 2.0 2.0 stearyl alcohol 2.2 2.2 2.2 stearic acid 1.5 1.5 1.5 beeswax 1.0 1.0 1.0 Polysorbate 60 1.5 1.5 1.5 Sorbitan Stearate 0.6 0.6 0.6 purified vegetable oil 1.0 1.0 1.0 squalane 3.0 3.0 3.0 mineral oil 5.0 5.0 5.0 Trioctanoin 5.0 5.0 5.0 Dimethicone 1.0 1.0 1.0 Sodium Magnesium Silicate 0.1 0.1 0.1 glycerin 5.0 5.0 5.0 Betaine 3.0 3.0 3.0 Triethanolamine 1.0 1.0 1.0 Sodium Hyaluronate 4.0 4.0 4.0 Preservatives, fragrance, coloring a very small amount a very small amount a very small amount Purified water to 100 to 100 to 100

Effect of suppressing melanin production in Preparation Examples 5 to 7 of cosmetic compositions

As a result of evaluating the treatment of the cosmetic composition of Preparation Examples 5 to 7 through a melanin production measurement experiment to confirm the effect of suppressing melanin production in B16F10 cells, the effect of suppressing melanin production compared to the control group (α-MSH) was found in all Preparation Examples 5 to 7. appeared, and among them, Preparation Example 7 was the most effective (Figure 7).

Whitening improvement effect for Preparation Example 7 of cosmetic composition

In order to evaluate whether the treatment of the cosmetic composition of Preparation Example 7 had a whitening effect, it was confirmed through a human application test. The test was conducted on healthy adult women aged 20 to 55 years (average age 36.27 years) without any skin diseases or allergic symptoms, and 22 people (0 people dropped out) completed the test. Measurements were made before using the product, 2 weeks after using the product, and 4 weeks after using the product. The measurement methods were SkinColorCatch (DCC, Delfin) for skin redness and brightness, Translucency Meter (TLS 850, Dia-Stron) for transparency, and Glossiness (Dia-Stron) for transparency. Measurements were made using a SkinGlossMeter (SGM, Delfin) device. As a result, after 4 weeks of using the product, skin redness decreased by 20.08%, brightness increased by 2.05%, transparency increased by 2.3%, and shine significantly increased by 37.37% (P<0.05) (Figure 8).

Claims (5)

A cosmetic composition comprising 0.0001 to 1% by weight of D-phenylalanyl tripeptide-75 and 0.0001 to 1% by weight of kava kava root extract.
The cosmetic composition according to claim 1, wherein the cosmetic composition has both an α-MSH competitive effect and a tyrosinase inhibitory effect for skin whitening.
The cosmetic composition according to claim 1, wherein the cosmetic composition is used to inhibit melanin pigment formation, which is characterized by improving blemishes, freckles, and dark skin.
The cosmetic composition according to claim 1, wherein the cosmetic composition improves skin redness, brightness, transparency, and gloss.
The cosmetic composition according to claim 1, wherein the D-phenylalanyl tripeptide-75 is included in the cosmetic composition in an amount of 0.0001 to 10.0% by weight, and the cosmetic composition is for skin whitening,
The cosmetic composition is selected from lotions, emulsions, gels, creams, essences, packs, ampoules, lotions, cleansers, soaps, body products, soaps, oils, lipsticks, and foundations.