KR102582262B1 - Transgenic Ardisia pusilla with Increased Toluene Purification using CYP2E1 Gene and Use thereof - Google Patents

Abstract

The present invention relates to transgenic coral water with improved toluene purification ability using the CYP2E1 gene and its use. Coral water transformed with the CYP2E1 gene has a significantly better toluene reduction rate than general coral water, so it can be usefully used for purifying toluene in the atmosphere. You can.

Description

Transgenic Ardisia pusilla with Increased Toluene Purification using CYP2E1 Gene and Use thereof}

The present invention relates to transgenic coral aquatic plants with improved toluene purification ability using the CYP2E1 gene and their uses.

As environmental pollution gradually worsens, various harmful substances such as fine dust and exhaust fumes are gradually increasing in densely populated urban areas. Recently, more and more people are spending time indoors, including at home or in offices, but as indoor air pollution is worsening due to problems such as lack of ventilation and increasing sources of indoor pollutants, the demand for proper management of indoor air is increasing. In the case of outdoors, pollutants are diluted by natural wind or atmospheric circulation, while indoors, the concentration of pollutants is increasing as pollutants continue to circulate due to lack of ventilation and cleaning in enclosed spaces.

Increased exposure to such pollutants causes various diseases such as atopy and asthma, so recently, many homes and workplaces are trying to remove these pollutants by using air purifiers. However, although these air purifiers are highly effective in purifying fine particles such as fine dust, they are known to be ineffective in purifying toxic chemicals such as toluene. In addition, since general air purifiers use physical filters, they require periodic filter cleaning and replacement. However, if the filter replacement period is missed, there is a problem in that worse air than when the air purifier is not used can be supplied to the user.

Therefore, air purification plants are placed not only in public places but also in ordinary homes to purify indoor pollutants. However, it is difficult to sufficiently purify pollutants with only a small number of air purifying plants, and there are limits to growing a large number of air purifying plants in living spaces due to space constraints.

Accordingly, the present inventors conducted research to develop transgenic plants with improved air purification ability and completed the present invention.

Republic of Korea Patent Registration No. 10-1152617

One object of the present invention is to provide coral water ( Ardisia pusilla ) with improved air purifying ability containing the CYP2E1 (Cytochrome P450 2E1) gene.

Another object of the present invention is to provide a coral conglomerate analogue with improved air purification ability containing the CYP2E1 gene.

Another object of the present invention is to transform coral aqueous cells with a recombinant vector containing the CYP2E1 gene consisting of the base sequence of SEQ ID NO: 1; And to provide a method for producing transformed coral water with improved air purifying ability, including the step of re-differentiating the transformed coral water from the transformed coral water cells.

Another object of the present invention is to provide a method for improving the air purification ability of coral water, comprising the step of expressing the CYP2E1 gene by transforming coral cells with a recombinant vector containing the CYP2E1 gene, which consists of the base sequence of SEQ ID NO: 1. It is done.

Another object of the present invention is to provide coral water with improved air purifying ability prepared by the above method.

One aspect of the present invention provides coral water ( Ardisia pusilla ) with improved air purifying ability containing the CYP2E1 (Cytochrome P450 2E1) gene.

The coral water with improved air purification ability of the present invention has been transformed with the CYP2E1 gene to have an improved purification ability of harmful substances in the air. In particular, the toluene reduction rate is significantly excellent, so it can be usefully used for purifying toluene in the atmosphere. .

The transgenic coral tree into which the CYP2E1 gene of the present invention has been introduced can obtain redifferentiated plants through induction of mass analogues, induction of redifferentiated shoots, and growth using standard techniques known in the art, and proliferate through in-flight node culture and distribution. You can do it. In addition, after rooting and purifying the soil, indoor plants can be moved to a greenhouse and produced by asexual propagation methods such as cuttings and grafting.

The term used in the present invention, 'protocorm like body (PLB)', is a sphere formed by germinating the seeds of orchid plants, which do not have the ability to germinate on their own due to undifferentiated embryos and endosperm, through symbiosis with fungi in a natural state. It is a tissue similar to the protocorm, which is the upper body tissue, and is formed when growing point tissue is cultured in orchid plants.

As used in the present invention, the term 'in-flight introduction' refers to cultivating a part of a plant in a controlled environment by injecting an artificial medium into a container such as a test tube, and the 'in-flight culture object' refers to the part of the plant introduced into the aircraft. refers to a plant obtained by culturing.

According to one embodiment of the present invention, the CYP2E1 gene may consist of the base sequence of SEQ ID NO: 1.

According to one embodiment of the present invention, the air purification may be toluene purification.

The transgenic coral aqueous CYP2E1-2-2 line into which the CYP2E1 gene was introduced according to one embodiment of the present invention has a toluene reduction ability 1.86 to 6.09 times better than that of general coral aquatic plants after 5 hours of toluene treatment, and is therefore useful for purifying toluene in the atmosphere. It can be.

Another aspect of the present invention provides a coral conglomerate analogue with improved air purification ability containing the CYP2E1 gene.

A coral mass analog with improved air purification ability containing the CYP2E1 gene of the present invention can be obtained through a method for producing from plants (node fragments) known in the art.

Another aspect of the present invention includes the steps of transforming coralline cells with a recombinant vector containing the CYP2E1 gene consisting of the base sequence of SEQ ID NO: 1; And it provides a method for producing transformed coral water with improved air purifying ability, including the step of re-differentiating the transformed coral water from the transformed coral water cells.

As used in the present invention, the term 'recombinant vector' refers to a DNA preparation containing the base sequence of a polynucleotide encoding the target protein operably linked to a suitable control sequence to enable expression of the target protein in a suitable host. .

The term 'transformation' used in the present invention refers to introducing a vector containing two base sequences encoding a target protein into a plant so that the protein encoded by the base sequence can be expressed within the plant. As long as the transformed base sequence can be expressed in the plant, it can be inserted and located within the chromosome of the plant, or can be located outside the chromosome, and can include all of these. Additionally, the base sequence may include DNA and/or RNA encoding the target protein. For example, the base sequence can be introduced into the plant in the form of an expression cassette, which is a genetic structure containing all elements necessary for self-expression. The expression cassette may typically include a promoter, transcription termination signal, ribosome binding site, and/or translation termination signal operably linked to the base sequence. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the base sequence can be introduced into the plant by Agrobacterium transformed with the vector, or the base sequence can be introduced into the plant in its own form and operably linked to the sequence required for expression in the plant. It may exist, but it is not limited to this. The base sequence encoding the target protein is specifically the CYP2E1 gene, and may specifically be the base sequence consisting of SEQ ID NO: 1.

The vector used in the present invention can be used without limitation as long as it can replicate within the host cell, and any vector known in the art can be used. Since the vector according to the present invention is a vector for plant transformation, various plant-functional promoters known in the art can be used, for example, cauliflower mosaic virus (CaMV) 35S promoter, pigwort mosaic virus 35S promoter, sugar cane Bacilliform virus promoter, Comerina yellow mottle virus promoter, light-inducible promoter from the subunit of ribulose-1,5-bis-phosphate carboxylase (ssRUBISCO), rice cytosolic triocytophosphate isomerase (TPI) ) promoter, adenine phosphoribosyltransferase (APRT) promoter from Arabidopsis, ubiquitin promoter of maize, rice actin 1 gene promoter, alpha-amylase, 3D promoter, globulin promoter, Gluterin A or B promoter, floramine promoter, mannopine synthase and octopine synthase promoter may be used, but are not limited thereto.

In addition, the vector may contain an antibiotic resistance gene, a herbicide resistance gene, a metabolism-related gene, a luminescence gene, a GFP (green fluorescence protein) gene, a GUS (β gene), a GAL (β-galactosidase) gene, etc. as selection marker genes. , but is not limited to this. Specifically, neomycin phosphotransferase II (NPT II) gene, hygromycin phosphotransferase gene, phosphinothricin acetyltransferase gene, or dihydrofolate reductase gene, etc. may be used. However, it is not limited to this.

The method of transforming coralline cells with a recombinant vector containing the CYP2E1 gene can be performed without limitation by introducing a base sequence encoding the target protein into the plant, and can be performed by selecting an appropriate standard technique known in the art. You can. For example, transformation using Agrobacterium sp. microorganisms, particle gun bombardment, silicon carbide whiskers, sonication, and electroporation. and precipitation with PEG (Polyethylenglyco l) may be used, and preferably, Agrobacterium-mediated transformation may be used, but is not limited thereto.

According to one embodiment of the present invention, the air purification may be toluene purification.

Another aspect of the present invention provides a method for improving the air purification ability of coral water, comprising the step of expressing the CYP2E1 gene by transforming coral cells with a recombinant vector containing the CYP2E1 gene, which consists of the base sequence of SEQ ID NO: 1. do.

In the method of improving the air purifying ability of coral water of the present invention, parts that overlap with the above-described content may be used with the same meaning as the above-mentioned meaning.

Another aspect of the present invention provides coral water with improved air purification ability produced by the above method.

According to transgenic coral water with improved toluene purification ability using the CYP2E1 gene and its uses, coral water transformed with the CYP2E1 gene has a significantly better toluene reduction rate than general coral water, so it can be useful for purifying toluene in the atmosphere.

Figure 1 is a diagram showing the CYP2E1 insertion pCM2300PMN vector map.
Figure 2 is a photograph showing coral shoots 170 days (A) and 250 days (B) after culture.
Figure 3 is a photograph showing the proliferation of coral mother plants into which the CYP2E1 gene was introduced.
Figure 4 is a photograph showing the replacement of the redifferentiation selection medium derived from a coral stem fragment into which the CYP2E1 gene was introduced and the progress of plant redifferentiation.
Figure 5 is a photograph showing the proliferation of transgenic corals into which the CYP2E1 gene has been introduced.
Figure 6 shows the genomic DNA PCR results of transgenic coral in which introduction of (A) CYP2E1 gene and (B) NPTII gene was confirmed.
Figure 7 is a photograph showing (A) a transgenic coral tree growing in a greenhouse (B) after acclimation.
Figure 8 shows the results of Southern blot analysis of transgenic coral showing (A) total DNA after EcoRI digestion and (B) CYP2E1 gene copy number.
Figure 9 is a graph showing the number of copies of the CYP2E1 gene introduced into transgenic coral.
Figure 10 shows the results of Northern blot analysis of transgenic corals showing (A) CYP2E1 mRNA and (B) total RNA. NC is total RNA extracted from non-transformed corals, and 1 to 25 are total RNAs extracted from transformed corals into which the CYP2E1 gene was introduced.
Figure 11 shows (A) SDS-PAGE analysis results and (B) Western blot analysis results confirming CYP2E1 protein expression in transgenic corals. M is a pre-stained protein marker (Bio-Rad), PC is a recombinant rabbit CYP2E1 protein derived from E. coli, NC is a whole leaf protein of non-transformed coral tree, and 1 to 12 are each transgenic. Coral lines (CYP2E1-2-1, CYP2E1-2-2, CYP2E1-3-3, CYP2E1-3-4, CYP2E1-6-1, CYP2E1-6-2, CYP2E1-6-5, CYP2E1-20- 3, CYP2E1-24-3, CYP2E1-35-1, CYP2E1-54-1, CYP2E1-54-2) leaf proteins.
Figure 12 shows (A) conversion of aniline to 4-aminophenol by CYP2E1 , (B) standard curve of 4-aminophenol at OD630nm, and (C) CYP2E1 enzyme activity of transgenic coral. These are pictures and graphs.
Figure 13 is the result of adjacent DNA sequencing of the CYP2E1 gene-inserted transgenic coral, showing the number of gene insertions using restriction enzymes and the surrounding base sequences in the genome of the CYP2E1 gene-transformed coral.
Figure 14 is a graph showing the results of testing the toluene reduction ability per leaf area of transgenic coral trees.

Hereinafter, the present invention will be described in more detail through one or more examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1. CYP2E1 Gene cloning and insertion into plant transformation expression vectors

The pCambia2300-PMN carrier was constructed by inserting the constitutive expression promoter P35S promoter (0.8kb) and nopaline synthase terminator (0.2kb) into the pCambia2300 carrier, and the CYP2E1 (Cytochrome P450 2E1) gene in Table 1 (Genbank No. M15061). The entire sequence (full length, 1,995bp) was synthesized. For subcloning, the CYP2E1 gene was cut with XbaI and KpnI restriction enzymes and inserted into pCambia2300-PMN, ultimately creating pCambia2300-CYP2E1 (Figure 1). At this time, transformation was performed using DH5α (Invitrogen) competent cells. The constructed plant expression carrier, pCambia2300-CYP2E1, was used to transform Agrobacterium tumefaciens strain GV3101 and introduce it into coral water.

CYP2E1 gene ATGGCTGTTCTGGGCATCACCGTCGCCCTGCTGGGGTGGATGGTCATCCTCCTGTTCATATCCGTCTGGAAGCAGATCCACAGCAGCTGGAACCTGCCCCCAGGACCTTTCCCACTGCCCATCATCGGGAATCTTCTCCAGTTGGATTTGAAGGATATTCCCAAGTCCTTTGGCAGGCTGGCAGAGCGCTTTGGGCCGGTGTTCACTGTGTACCTGGGCTCCAGGCGTGTTGTGGTTCTGCACGGGCTACAA GGCGGTGAGGGAGATGCTGTTGAACCACAAGAACGAGTTCTCTGGGCGTGGCGAGATCCCTGCTTTCCGGGAGTTTAAGGACAAGGGGATCATTTTCAACAATGGACCCACCTGGAAGGACACTCGGCGGTTCTCCCTGACCACCCTCCGGGACTATGGGATGGGGAAACAGGGCAACGAGGACCGGATCCAGAAGGAGGCCCACTTCCTGCTGAGGAGCTCAGGAAGACCCAGGGCCAGCCCTTCGACC CCACCTTTGTCATCGGCTGCACACCCTTCAACGTCATCGCCAAAATCCTCTTCAATGACCGCTTTGACTATAAGGACAAGCAGGCTCTGAGGCTGATGAGTTTGTTCAACGAGAACTTCTACCTGCTCAGTACTCCTTGGCTGCAGGTTTACAATAATTTTTCAAAACTATCTACAGTACATGCCTGGAAGTCACAGGAAAGTAATAAAAAATGTGTCTGAAATAAAAGAGTACACACTCGCAAGAGTGAAGGAGCACCACAA GTCGCTGGACCCCAGCTGCCCCCGGGACTTCATTGACAGCCTGCTCATAGAAATGGAGAAGGACAAACACAGCACGGAGCCCCTGTACACGCTGGAAAACATTGCTGTGACTGTGGCGGACATGTTCTTTGCGGGCACGGAGACCACCAGCACCACGCTGCGATATGGGCTCCTGATCCTGCTGAAGCACCCCGAGATCGAAGAGAAACTTCATGAAGAAATCGACAGGGTGATTGGGCCGAGCCGAATGCCTTCTG TCAGGGACAGGGTGCAGATGCCCTACATGGACGCTGTGGTACATGAGATTCAGCGATTCATCGATCTCGTGCCCTCCAATCTGCCGCACGAAGCCACACGGGACACCACCTTCCAAGGATACGTCATCCCCAAGGGCACTGTTGTAATCCCGACTCTGGACTCCCTTTTGTATGACAAGCAAGAATTCCCTGATCCCGAGAAGTTCAAACCAGAGCACTTTCTGAATGAGGAGGGGAAGTTCAAGTATAGCGACTACT TCAAGCCGTTTTCCGCAGGAAAACGCGTGTGTGTTGGAGAAGGCCTGGCTCGCATGGAGTTGTTTCTGCTCCTGTCTGCCATTCTGCAGCATTTTAACCTCAAGCCTCTCGTTGACCCAGAGGACATTGACCTTCGCAATATTACGGTGGGCTTTGGCCGTGTCCCACCACGCTACAAACTCTGTGTCATTCCCCGCTCGTAA SEQ ID NO: 1

Example 2. CYP2E1 Obtaining genetically introduced coral regeneration plants

2-1. Preparation of coral material for CYP2E1 gene introduction

In order to develop coral tree with improved indoor air purification ability, coral tree, which is commercially used as a native indoor plant, was purchased from the Urban Agriculture Department of the National Institute of Horticultural and Herbal Science, and 50 shoots were disinfected and purified on January 15, 2015. (approximately 3 mm) was cultured in a test tube filled with 1/2 MS (Duchefa) solid medium [pH 5.7, 0.7% agar (Duchefa)] supplemented with 2% sucrose (Duchefa).

Shoot disinfection was performed in the following manner: the shoots were soaked in running water for about 10 minutes, then surface sterilized with 70% ethanol (EtOH) for 30 seconds and rinsed with sterile water. Afterwards, the pressure was lowered using a vacuum pump to remove air from the surface of the sample, and the sample was disinfected for 10 minutes to allow 1% NaOCl solution to penetrate well. Then, the sample was moved to a sterile container, rinsed three times with sterilized water, and soaked in sterilized water for 5 minutes. Then, the sample was covered with sterilized filter paper. Sterile water was removed from the laid dish. Next, the side branches were propagated through subculture in which the side branches were transferred to the same medium at 4-week intervals and used as material to obtain toluene-purified transgenic plants (Figures 2 and 3). Jugular culture and subsequent subculture were cultured in a culture room maintained at 25°C ± 2°C.

2-2. Obtaining coral re-differentiation plants into which the CYP2E1 gene was introduced

In March 2016, 332 pieces (explants, about 1 mm thick) cut from the coral stem prepared in Example 2-1 were cultured in pre-culture medium [1/2 MS components + TDZ (MBcell) 0.5 mg·L ^-1 + After pre-culturing for 1 to 4 days in [IBA (Duchefa) 0.5mg·L ^-1 + sucrose 30g·L ^-1 + plant agar 7g·L ^-1 , pH 5.7], Agrobacteria prepared in Example 1 An attempt was made to introduce the CYP2E1 gene into coral stem fragments through co-cultivation with the Leeum strain for 2 to 4 days [medium composition: pre-culture medium + acetosyringone (aldrich) 50 μM, pH 5.2]. The Agrobacterium strain was cultured in LB liquid medium (OD ₆₀₀ = 0.6 to 0.8) and then diluted in liquid medium (MS components + sucrose 30 g·L ^-1 , pH 5.2). After co-culture, the explants were washed with MS liquid medium (pH 5.7) and cultured in nutrient medium (pre-culture medium + cefotaxim 200 mg·L ^-1 ) for 7 days. Afterwards, redifferentiated shoots were obtained at the end of 2016 by changing the medium in the selection medium [nutrient medium + kanamycin (Sigma) 5 mg·L ^-1 ] (Figure 4). Afterwards, the redifferentiated shoots were grown on a growth selection medium (1/2 MS + sucrose 30g·L ^-1 + cefotaxime 100mg·L ^-1 + kanamycin 5mg·L ^-1 + plant agar 7g·L ^-1 , pH 5. 7) and grown and multiplied into plants, and redifferentiated shoots were obtained from 121 explants out of 332.

Example 3. CYP2E1 Confirmation of gene introduction, and purification and propagation of coralline plants

3-1. Confirmation of CYP2E1 gene introduction based on in-flight growth and PCR analysis of CYP2E1 gene-introduced corals

The coral regeneration shoots obtained in Example 2-2 were grown on a shoot growth selection medium, and 178 coral regeneration plantlets were obtained from 65 coral explants. Afterwards, in order to analyze whether the CYP2E1 gene was introduced, coralline regenerated seedlings were propagated in vitro (Figure 5).

The target gene, CYP2E1 , is present in coral regeneration plants grown in vitro. To confirm whether it was introduced, PCR (Polymerase Chain Reaction) analysis was performed.

Specifically, genomic DNA was extracted using DNeasy Mini Plant Kit (Qiagen, USA) from 178 corals that were initially selected on a medium supplemented with kanamycin and expected to be transformants, and NanoVue (GE healthcare) , UK) was used to quantify the extracted genomic DNA. For the PCR reaction, 20 ㎕ of reagent mixed with 200 to 500 ng of DNA, 0.2mM dNTP, primers from Table 2, and 0.2U Taq polymerase were denatured at 95°C for 1 minute, primer annealed at 58°C for 1 minute, and at 72°C. After amplifying the primer extension process 30 times for 1 minute, gene introduction was confirmed under UV by electrophoresis on a 1% agarose gel mixed with a loading star (DYNEBIO, Korea).

primer Primer base sequence (5'→3') sequence number note Os-CYP2E1F1 TCTAGAATGGCTGTTCTGGGCAT SEQ ID NO: 2 Target gene specific primer Oc-CYP2E1 R1 TTGGTACCTTACGAGCGGGGAAT SEQ ID NO: 3 NPTII F GAGGCTATTCGGCTATGACTG SEQ ID NO: 4 Selected gene-specific primers NPTII R1 ATCGGGAGCGGCGATACCGTA SEQ ID NO: 5

As a result, it was confirmed that the target and selection genes were introduced in 50 of 178 corals, and the transformation rate was confirmed to be 28.0% (Figure 6).

3-2. Purification and proliferation of coral plants into which the CYP2E1 gene has been introduced.

In order to perform enzyme activity analysis and toluene gas purification analysis on coral water into which the CYP2E1 gene was introduced, the 50 coral line transformants confirmed to have been transformed in Example 3-1 were purified and then used as a shading film in the hot summer. The plants were grown as semi-shade plants in a greenhouse (Figure 7).

Example 4. CYP2E1 Molecular biological analysis of coral plants with introduced genes

4-1. Check the copy number of CYP2E1 gene introduction

Southern blot analysis was performed to confirm the copy number of the CYP2E1 gene introduction.

Specifically, in order to confirm the copy number of the CYP2E1 gene inserted into the genomic DNA of the transgenic coral, DNA was extracted from leaves of 25 lines of the transgenic coral of Example 3-2 grown in a greenhouse and the concentration was confirmed. 40㎍ of DNA was treated with 100 units of EcoRI, loaded on a 0.9% agarose gel in 0.5X TBE solution, and run at 30V for 17 hours. DNA developed on an agarose gel was blotted onto a Hybond-N+ membrane (Amersham Life Science, UK) using the capillary transfer method. After cross-linking the membrane with UV 2,000J, it was placed in a hybridization bottle and 10 ml of hybridization buffer (1mM EDTA, 250 mM Na ₂ HPO ₄ ·7H ₂ O, 1% casein) hydrolysate, 7% SDS, 85% H3PO4, pH 7.4) was added and pre-hybridization was performed at 65°C for 3 hours. After eluting the PCR product of the pCAMBIA2300 vector into which the CYP2E1 gene was inserted, 30ng DNA was labeled with [α-32P]dCTP using the Redyprime II Random Prime Labeling System (Amersham Life Science, UK). ) was added and hybridized at 65°C for 18 hours. After removing the hybridization buffer from the vessel, 2 After washing the membrane, a BSA-1800II Bio-Imaging analyzer (FUJIFILM, Japan) was used for label recognition.

As a result, it was confirmed that 1 to 3 copies of the CYP2E1 gene were inserted into 25 lines of transgenic coralline plants (FIGS. 8 and 9).

4-2. Expression analysis of CYP2E1 gene

Northern blot analysis was performed to analyze the expression of CYP2E1 gene in transgenic coralline plants.

Specifically, total RNA was extracted from leaves of 25 lines of transgenic coralline plants in which the insertion of the CYP2E1 gene was confirmed in Example 4-1 using Fruit-mate for RNA prep and RNAiso (Takara, Japan). To isolate RNA, 2 g of transgenic coral leaves were crushed in a mortar using liquid nitrogen, then transferred to a 2.0 mL tube, mixed with 1 mL Fruit mate, and then centrifuged at 15,000 rpm for 5 minutes. The supernatant was transferred to a new tube, 1 ml RNAiso was added, mixed vigorously, and left at room temperature for 5 minutes. After adding 200㎕ of chloroform, it was vigorously mixed again and allowed to react at room temperature for 10 minutes. After the reaction was completed, centrifuge the EP tube at 15,000 rpm for 15 minutes, transfer 600㎕ of the supernatant to a new EP tube, add 300㎕ High-salt Solution (Takara), mix briefly, and then add an equal amount of isopropanol. It was reacted at room temperature for 10 minutes. After centrifugation at 15,000 rpm for 8 minutes at 4°C, the supernatant was discarded, the pellet was washed and dried using 1 ml of DEPC-treated 70% ethanol, and the RNA pellet was mixed with 50 ㎕ of DEPC-treated ethanol. Dissolved in water. After drying at 65°C for 5 minutes to remove starch, centrifugation was performed and the supernatant was transferred to a new EP tube. RNA was quantified using NanoVue (GE healthcare), and then 20㎍ of total RNA was electrophoresed on a formaldehyde agarose gel and then transferred to Hybond using the capillary transfer method (Lehrach, H. et al., 1977). Transferred to -N+ membrane (Amersham Pharmacia Biotech). The subsequent process was performed in the same manner as the Southern blot analysis method in Example 4-1.

As a result, it was confirmed that mRNA was stably expressed in 12 of the 25 lines (Figure 10), and it was confirmed that mRNA expression did not increase in proportion to the number of copies of the inserted CYP2E1 gene. Meanwhile, genes were introduced in some transgenic lines, but mRNA expression was not confirmed.

4-3. CYP2E1 protein expression analysis

To analyze the expression of CYP2E1 protein in transgenic coralline plants, SDS-PAGE (odium dodecyl sulfate polyacryl amide gel electrophoresis) and Western blot analysis were performed.

Specifically, the total protein was extracted from the leaves of transgenic coral trees of 12 lines in which stable expression of mRNA for the CYP2E1 gene was confirmed in Example 4-2, and then quantified using Bradford's method. Transformed coralline leaf proteins were extracted using a buffer of 50mM Tris (pH7.4), 1mM EDTA, 1% PVP (40,000), 0.001% PMSF, 5% mercaptoethanol, and 0.05% Tween-20. 20 μg of total protein was separated by SDS-PAGE using a 12% poly acrylamide gel under reducing conditions based on the method of Laemmli (1970), and the separated proteins were Stained and visualized with Coomassie brilliant blue.

Meanwhile, in order to perform Western blot analysis, proteins separated on an acrylamide gel were electroblotted on a Hybond-C membrane (Amersham) at 20V for 40 minutes, and then incubated in TBST buffer (100mM Tris pH7.5, 0.9%). Blocking was performed with 10% skim milk in NaCl, 0.1% Tween 20) for approximately 16 hours. After washing the membrane three times with TBST buffer, it was reacted with rabbit anti-CYP2E1 polyclonal antibody (MyBiosource, CA, USA) as the primary antibody for 4 hours, and anti-rabbit IgG (H+L) alkaline phosphatase conjugated (Sigma). Used as a secondary antibody, it was diluted 1:7,000 in TBST buffer containing 5% skim milk and reacted at room temperature for 2 hours. After washing three times with TBST buffer and once with TMN buffer (100mM Tris pH9.5, 100mM NaCl, 5mM MgCl ₂ ), BCIP (5-bromo-4-chloro-3-indolylphosphate) and NBT (nitro blue tetrazolium) Color was developed in TMN buffer.

As a result, after the signal peptide from line 12 to the endoplasmic reticulum was cleaved, the mature form of the protein at 53 kDa was confirmed (Figure 11), confirming that the CYP2E1 protein was expressed.

4-4. Confirmation of CYP2E1 protein enzyme activity

To analyze the enzymatic activity of CYP2E1 protein in transgenic coralline plants, aniline hydroxylase activity was evaluated.

Specifically, the leaves of the transgenic coralline plants confirmed to express CYP2E1 protein in Example 4-3 were collected, ground finely using liquid nitrogen, and then mixed with a buffer (1mM EDTA in 50mM Tris-HCl buffer (pH7.4), Whole leaf proteins were extracted using 1% PVP, 0.001% PMSF (pH 8.0)). Add 5% mercaptoethanol, centrifuge at 4°C for 30 minutes using a 15,000g centrifuge, transfer the supernatant to a new Ep tube, and centrifuge at 15,000g at 4°C for 10 minutes to collect the upper layer. The liquid was collected. After protein quantification using Bradford's method (Bradford 1976), 10 μg of whole leaf protein was used for CYP2E1 activity analysis.

To be used in the enzyme activity reaction analysis, an enzyme activity buffer containing 5mM aniline, 5mM MgCl ₂ , 5mM isocitrate, and 100mM Tris-HCl was prepared, and 0.5mM NADPH was added before reaction with the sample. For the enzyme activity reaction, 10 ㎍ of whole leaf protein was added with an enzyme activity buffer prepared in the presence of 100 ㎕ of NADPH, reacted at 37°C for 1 hour, and then reacted using 10% trichloroacetic acid, and the remaining The materials precipitated out. After reacting on ice for 5 minutes, centrifuge at 15,000 g at 4°C for 10 minutes to collect the supernatant, add 100 μl sample and 100 μl 2.5N NaOH solution, and react in a water bath at 58° C. for 20 p. -Aminophenol was used to develop color. Aniline hydroxylase activity was evaluated by measuring p-aminophenol, which is formed when aniline used as a substrate is hydroxylated by CYP2E1 enzyme, at 630 nm.

As a result, compared to the control group, the activity of transgenic coralline CYP2E1-2-2 increased by 2.02%, and it was confirmed that CYP2E1 activity increased compared to the control group except for CYP2E1-3-3 and CYP2E1-6-2 (Figure 12).

4-5. Analysis of base sequences surrounding the introduced gene

Flanking DNA sequencing was performed to analyze the base sequence surrounding the introduced gene in transgenic coralline plants.

Specifically, genomic DNA from transgenic coralline plants CYP2E1-27-5 and CYP2E1-54-4 lines was extracted, and then commissioned by Green Gene Bio to analyze the base sequences surrounding the introduced gene. Afterwards, the nucleotide sequence in the genome of coralline plants into which the CYP2E1 gene was introduced was compared for similar sequences with plants whose entire genome sequences were revealed using NCBI Blast.

As a result, sequence similarity with other plants was not confirmed, and it was confirmed that the CYP2E1 gene was inserted into the unique gene of coral aquatic plants. In addition, the transgenic coralline CYP2E1-27-5 and CYP2E1-54-4 lines were each confirmed to have been inserted into the coralline genome with a single copy (Figure 13).

Example 5. Test of toluene purification ability of transgenic coralline plants

Non-transformed corals and CYP2E1-2-2 coral plants confirmed to have increased aniline hydroxylase activity in Example 4-4 were grown in the environmental control room of the Urban Agriculture Department of the National Institute of Horticultural and Herbal Science at a temperature of 23 ± 2°C and a light intensity of approximately 1500 Lux. After light acclimatization for about a week, it was placed in a chamber (0.02㎥) and pretreated by injecting toluene at a concentration of 0.5ppm into the chamber three times at 3-hour intervals. To test the toluene purification ability, toluene and air were made into gases in a Tedler bag at a ratio of 1:6 and injected into the chamber so that the initial concentration of toluene in the chamber was 0.5 ppm. GC/MS measurements were performed for 12 hours at 3-hour intervals per chamber, and were repeated 3 times under the same conditions.

As a result, the toluene removal ability of two CYP2E1 gene-transduced coral aquatic plants CYP2E1-2-2 lines, which were confirmed to have the best enzyme activity in Example 4-4, was tested in the same method, the transgenic coral aquatic plants compared to the control group It was confirmed that the toluene reduction ability was improved by 1.86 to 6.09 times after 5 hours of treatment (Table 3 and Figure 14).

Measurement time (min) Common coral
(㎍/m ³ ) Transgenic coral water
(CYP2E1-2-2-(1))
(㎍/m ³ ) Transgenic coral water
(CYP2E1-2-2-(2))
(㎍/m ³ ) 0 0.0±0.0 0.0±0.0 0.0±0.0 60 136.3±30.6 286.3±31.8 831.0±64.6 120 187.3±34.1 354.8±37.8 976.0±66.0 180 206.2±31.2 384.6±33.9 1060.4±47.8 240 169.2±38.7 332.3±22.1 902.9±47.4 300 156.9±28.4 314.6±5.0 841.3±14.9

So far, the present invention has been examined focusing on its embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims, not the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Transgenic Ardisia pusilla with Increased Toluene Purification using CYP2E1 Gene and Use thereof <130>RDA-P190093 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 1482 <212> DNA <213> Artificial Sequence <220> <223> Cytochrome P450 2E1 <400> 1 atggctgttc tgggcatcac cgtcgccctg ctggggtgga tggtcatcct cctgttcata 60 tccgtctgga agcagatcca cagcagctgg aacctgcccc caggaccttt cccactgccc 120 atcatcggga atcttctcca gttggatttg aaggatattc ccaagtcctt tggcaggctg 180 gcagagcgct ttgggccggt gttcactgtg tacctgggct ccaggcgtgt tgtggttctg 240 cacggctaca aggcggtgag ggagatgctg ttgaaccaca agaacgagtt ctctgggcgt 300 ggcgagatcc ctgctttccg ggagtttaag gacaagggga tcattttcaa caatggaccc 360 acctggaagg acactcggcg gttctccctg accaccctcc gggactatgg gatggggaaa 420 cagggcaacg aggaccggat ccagaaggag gcccacttcc tgctggagga gctcaggaag 480 acccagggcc agcccttcga ccccaccttt gtcatcggct gcacaccctt caacgtcatc 540 gccaaaatcc tcttcaatga ccgctttgac tataaggaca agcaggctct gaggctgatg 600 agtttgttca acgagaactt ctacctgctc agtactcctt ggctgcaggt ttacaataat 660 ttttcaaact atctacagta catgcctgga agtcacagga aagtaataaa aaatgtgtct 720 gaaataaaag agtacacact cgcaagagtg aaggagcacc acaagtcgct ggaccccagc 780 tgcccccggg acttcattga cagcctgctc atagaaatgg agaaggacaa acacagcacg 840 gagcccctgt acacgctgga aaacattgct gtgactgtgg cggacatgtt ctttgcgggc 900 acggagacca ccagcaccac gctgcgatat gggctcctga tcctgctgaa gcaccccgag 960 atcgaagaga aacttcatga agaaaatcgac agggtgattg ggccgagccg aatgccttct 1020 gtcagggaca gggtgcagat gccctacatg gacgctgtgg tacatgagat tcagcgattc 1080 atcgatctcg tgccctccaa tctgccgcac gaagccacac gggacaccac cttccaagga 1140 tacgtcatcc ccaagggcac tgttgtaatc ccgactctgg actccctttt gtatgacaag 1200 caagaattcc ctgatcccga gaagttcaaa ccagagcact ttctgaatga ggaggggaag 1260 ttcaagtata gcgactactt caagccgttt tccgcaggaa aacgcgtgtg tgttggagaa 1320 ggcctggctc gcatggagtt gtttctgctc ctgtctgcca ttctgcagca ttttaacctc 1380 aagcctctcg ttgacccaga ggacattgac cttcgcaata ttacggtggg ctttggccgt 1440 gtcccaccac gctacaaact ctgtgtcatt ccccgctcgt aa 1482 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Os-CYP2E1 F1 <400> 2 tctagaatgg ctgttctggg cat 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223>Oc-CYP2E1 R1 <400> 3 ttggtacctt acgagcgggg aat 23 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NPTII F <400> 4 gaggctattc ggctatgact g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NPTII R1 <400> 5 atcgggagcg gcgataccgt a 21

Claims (3)

delete delete The CYP2E1 (Cytochrome P450 2E1) gene, which consists of the base sequence of SEQ ID NO: 1, is artificially introduced, and the CYP2E1 gene is expressed and overexpressed in general coral water where the CYP2E1 gene does not exist and the CYP2E1 gene has not been artificially introduced, and toluene is consumed more than general coral water. A method for producing transgenic coral water with 5.1 to 6.1 times improved purification ability,
The method for producing the transgenic coral water is,
After synthesizing the entire CYP2E1 gene sequence consisting of the base sequence of SEQ ID NO: 1, cutting the CYP2E1 gene with XbaI and KpnI restriction enzymes;
Inserting the cleaved CYP2E1 gene into the pCAMBIA2300 plasmid and then transforming the plasmid into Agrobacterium tumefaciens GV3101;
After disinfecting the above-mentioned Agrobacterium tumefaciens GV3101 strain and the jugular part of a general coral tree previously planted and growing in pots in a greenhouse and introducing it into the aircraft, the growing coral tree shoot stem fragment was 1/2 MS, thidiazuron (TDZ) 0.5 mgL ^-1 , indole-3-butyl acid (IBA) 0.5 mgL ^-1 , sucrose 30g·L ^-1 , plant agar 7g·L ^-1 , acetosyringone 50μM were added and 2 to 4 in a medium adjusted to pH 5.2. Co-culturing for one day, transforming the coralline shoot stem fragment to contain 1 to 3 copies of the CYP2E1 gene;
After washing the transformed coralline shoot stem fragment with a liquid medium of pH 5.7, 1/2 MS, thidiazuron 0.5mgL ^-1 , indole-3-butyl acid 0.5 mgL ^-1 , sucrose 30g·L ^-1 , cells. Growing and proliferating plants under conditions of pH 5.7 in a growth selection medium containing Taxime 200 mg·L ^-1 , kanamycin 5 mg·L ^-1 , and plant agar 7g·L ^-1 ;
Primary selection of the propagated plants in a medium containing kanamycin;
After extracting the genomic DNA of the first selected coral plants, selecting transgenic corals into which CYP2E1 has been introduced through PCR reaction using primers of SEQ ID NOs: 2 to 5;
A step of confirming whether the CYP2E1 gene is expressed and whether the protein is expressed in the leaves of the selected coralline plants, wherein the expression of the CYP2E1 protein is confirmed through the formation of a band in the 53 kDa region in Western blot analysis; and
It sequentially consists of: analyzing the activity of CYP2E1 protein in the leaves of the transgenic coralline plant in which expression of the CYP2E1 protein was confirmed,
Method for producing transgenic coral water whose toluene purification ability is 5.1 to 6.1 times higher than that of regular coral water through expression of the exogenous CYP2E1 gene and protein.