KR102580788B1 - Functional feed additive composition containing novel microorganisms as active ingredients - Google Patents

Abstract

The present invention relates to a functional feed additive composition containing a novel microorganism as an active ingredient, and more specifically, to amylase, a digestive enzyme that decomposes carbohydrates for the Limosilactobacillus reuteri NI37 strain isolated and identified in the present invention. It was confirmed that there was an increase in the activity of amylase, an increase in the activity of lysozyme, an enzyme with an antibacterial effect, and phosphatase activity, an enzyme involved in regulating cell function. Since intestinal survival ability was confirmed through verification of intestinal attachment ability, it can be used as a functional feed additive composition.

Description

Functional feed additive composition containing novel microorganisms as active ingredients}

The present invention relates to a functional feed additive composition containing novel microorganisms as active ingredients. More specifically, it relates to a functional feed additive composition containing the novel Limosilactobacillus reuteri NI37 strain as an active ingredient.

Currently, in Korea, households with one or two people are moving beyond nuclear families, and the number of people raising companion animals is increasing. According to reports, more than 10 million people in Korea are raising pets, and as a result, consumer interest in products related to pets is increasing. Dogs make up the largest portion of companion animals. Dogs are generally known to live for 11 to 13 years on average, but recently, their lifespan has been extended to 15 to 20 years due to improvements in public health and medical care. Additionally, as the level of public awareness has improved, pets are now often viewed as beings on a similar level to humans.

However, since most dogs in Korea live at home, they lack exercise and are under a lot of stress, so they tend to be easily exposed to metabolic diseases. The most representative thing is obesity in dogs, and it is reported that about 30-53% of dogs in Korea are overweight or obese. If a dog suffers from metabolic obesity, similar to humans, it can cause more fatal internal and surgical diseases in the future, such as cardiovascular disease, joint disease, and immune disease, which can greatly reduce the quality of life of the dog and its owner. Currently, interest in animal medicine in Korea is increasing, but realistic treatment costs are high and the burden of medical expenses is high. Therefore, there is an urgent need to develop agents that can easily prevent the occurrence and progression of diseases such as constipation and obesity due to lack of exercise in dogs. am.

Meanwhile, in the companion animal industry, the market size of probiotics, which are replacement items following the ban on antibiotics since July 2011, accounts for 44% of 17 supplementary feeds. Previously, supplementary feed for pets was mainly sold on major functional products such as fur, bones, and joints, but recently, demand for functional and specialized products such as lactic acid bacteria, stress relief, and eye health has been increasing. In the domestic market, imported products, including expensive organic products and premium products, account for most of the market, and pet food imports continue to increase, growing from 36,308 tons in 2011 to 53,292 tons in 2016, according to data from the Korea Customs Service. According to , pet food imports were much higher than exports. As consumer demand for imported products increases, the number of purchasing agencies that import and sell famous overseas products is increasing, but the difference with local prices has been confirmed to be significant. Accordingly, there is a need to develop domestic products comparable to imported products, thoroughly analyze specification experiments, salary effects, and cases, while maintaining price competitiveness and organically responding to market conditions that are expected to increase in the future.

In the present invention, for the novel Limosilactobacillus reuteri NI37 strain that was isolated and identified, the activity of amylase, a digestive enzyme that decomposes carbohydrates, is increased, and the activity of Lysozyme, an enzyme with an antibacterial effect, is increased. Since it was confirmed to have phosphatase activity, an enzyme involved in the growth and regulation of cell function, and its intestinal viability was confirmed through verification of acid resistance, bile resistance, and intestinal adhesion ability, the Rimosyllactobacillus of the present invention Reuteri ( Limosilactobacillus reuteri ) NI37 strain may be used as a functional feed additive composition.

10-2022-0054071

One object of the present invention to solve the above problems is to provide a new Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP).

One object of the present invention to solve the above problems is to provide a functional feed additive composition containing the novel Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP) as an active ingredient.

In order to achieve the above object, the present invention provides Limosilactobacillus reuteri NI37 strain deposited under the accession number KCTC15477BP.

In one embodiment of the present invention, the “strain” may have the functionality of increasing amylase activity, but is not limited thereto.

In one embodiment of the present invention, the “strain” may have a functional substance that increases lysozyme activity, but is not limited thereto.

In one embodiment of the present invention, the “strain” may have the functionality of increasing phosphatase activity, but is not limited thereto.

In one embodiment of the present invention, the “strain” may have acid resistance functionality, but is not limited thereto.

In one embodiment of the present invention, the “strain” may have bile-resistant functionality, but is not limited thereto.

In one embodiment of the present invention, the “strain” may have the functionality of tenon attachment ability, but is not limited thereto.

In addition, in order to achieve the above object, the present invention provides a functional feed additive composition for companion animals containing the above strain or its culture medium as an active ingredient.

Finally, in order to achieve the above object, the present invention provides a functional feed for companion animals containing the feed additive composition as an active ingredient.

The present invention relates to a functional feed additive composition containing a novel microorganism as an active ingredient, and more specifically, to the Limosilactobacillus reuteri NI37 strain isolated and identified in the present invention: ① a digestive enzyme that decomposes carbohydrates; It was confirmed that ② increased activity of amylase, ② increased activity of lysozyme, an enzyme with antibacterial effect, ③ phosphatase activity, an enzyme involved in regulating cell function, ④ acid resistance, Intestinal viability was confirmed through verification of ⑤ bile resistance and ⑥ intestinal adhesion ability. It can help pets digestion through amylase activity, and can especially help aging pets with poor digestive power digest and absorb nutrients. Lysozyme activity can suppress harmful bacteria in the intestines of pets and thus contribute to improving immunity. Through phosphatase activity, it can be expected to suppress the production of mutant cells caused by reactive oxygen species within the cells of companion animals. In addition, through acid resistance and bile resistance functionality, the strain ingested by the pet was confirmed to have the ability to survive in the gastric acid and bile secreted during the digestive process of the pet, and through intestinal adhesion functionality, the strain was able to enter the intestinal cells of the pet. It was confirmed that it can adhere and stay in the intestines for a long time, suppressing harmful bacteria for a long time.

Figure 1 shows a plate on which Limosilactobacillus reuteri NI37 strain was streaked, in one embodiment of the present invention.

Hereinafter, the present invention will be described in detail through embodiments of the present invention with reference to the attached drawings. However, the following implementation examples are provided as examples of the present invention, and if it is judged that a detailed description of a technology or configuration well known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , the present invention is not limited thereby. The present invention is capable of various modifications and applications within the description of the patent claims described below and the scope of equivalents interpreted therefrom.

In addition, terminology used in this specification is a term used to appropriately express preferred embodiments of the present invention, and may vary depending on the intention of the user or operator or the customs of the field to which the present invention belongs. Therefore, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part is said to “include” a certain element, this means that it may further include other elements rather than excluding other elements, unless specifically stated to the contrary.

Throughout this specification, '%' used to indicate the concentration of a specific substance means (w/w) % for solid/solid, (w/v) % for solid/liquid, and Liquid/Liquid is (v/v) %.

The present invention relates to Limosilactobacillus reuteri NI37 strain deposited with accession number KCTC15477BP.

As a result of identification, the "strain" of the present invention has 99% similarity to Limosilactobacillus reuteri , 98% similarity to Limosilactobacillus caviae , and Limosilactobacillus frumenti. frumenti ) has 97% similarity.

The “strain” of the present invention has the functionality of increasing amylase activity. Amylase is a digestive enzyme that decomposes carbohydrates, and the strain of the present invention has amylase activity, so it can help with the digestion of pets. In particular, it can help with the digestion and absorption of nutrients in aging pets with poor digestive power.

The “strain” of the present invention has the functionality of increasing lysozyme activity. Lysozyme is an enzyme that has an antibacterial effect, and the strain of the present invention has lysozyme activity, so it can suppress harmful intestinal bacteria in companion animals and thereby contribute to improving immunity.

The “strain” of the present invention has the functionality of increasing phosphatase activity. Phosphatase is an enzyme involved in the regulation of cell function, and since the strain of the present invention has phosphatase activity, it can contribute to the inhibition of the production of mutant cells caused by reactive oxygen species within the cells of companion animals.

The “strain” of the present invention has the functionality of acid resistance and bile resistance. Therefore, the strain of the present invention has the ability to survive in gastric acid and bile secreted during the digestive process of the companion animal when ingested by the companion animal.

The “strain” of the present invention has the functionality of tenon attachment ability. Therefore, the strain of the present invention can attach to the intestinal cells of companion animals and stay in the intestines for a long time, suppressing harmful bacteria for a long time.

In one aspect, the strain of the present invention can be used as a functional feed additive composition and feed containing the same.

Limosilactobacillus reuteri NI37 strain, deposited under accession number KCTC15477BP, which is the active ingredient of the feed additive composition of the present invention and the feed containing the same, has various functionalities, improves the health of the animal, and increases the weight gain of livestock. It can be expected to improve fruit quality and increase milk production and immunity. The feed composition of the present invention can be manufactured in the form of fermented feed, compounded feed, pellet form, silage, etc. The fermented feed can be manufactured by fermenting organic matter by adding various microorganisms or enzymes other than the peptide of the present invention, and the compounded feed can be manufactured by mixing various types of general feed with the peptide of the present invention. Pellet-type feed can be manufactured by applying heat and pressure to the above-mentioned mixed feed, etc. in a pellet machine, and silage can be manufactured by fermenting the green feed with the microorganism according to the present invention. Wet fermented feed collects and transports organic matter such as food waste, mixes excipients for sterilization and moisture control in a certain ratio, and then ferments for more than 24 hours at a temperature suitable for fermentation to ensure that the moisture content is about 70%. It can be manufactured by adjusting it. Fermented dried feed can be manufactured by adjusting wet fermented feed to an additional drying process so that the moisture content is about 30% to 40%.

The feed additive composition of the present invention and feed containing it may further include ingredients added to conventional feed. Examples of ingredients added to such feed may include grain powder, meat powder, and beans. In the above, the grain powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour. In the above, the meat powder may be a meat powder obtained by pulverizing any one or more selected from chicken, beef, pork, and ostrich meat. In the above, the pulses may be one or more types selected from soybeans, kidney beans, peas, and black beans.

The feed additive composition of the present invention and the feed containing the same may add one or more selected from nutrients and minerals to increase the nutrition of the feed in addition to the grain powder, meat powder, and pulses that are added to the conventional feed mentioned above. It may contain one or more types selected from anti-fungal agents, antioxidants, anti-coagulants, emulsifiers, and binders to prevent deterioration of feed quality.

In one aspect, the strain of the present invention can be used as a functional food/health functional food composition.

The food/health functional food composition of the present invention not only contains the active ingredient Limosilactobacillus reuteri NI37 strain deposited under accession number KCTC15477BP, but also contains various flavoring agents or natural carbohydrates like ordinary food compositions. It may be contained as an additional ingredient.

Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The above-described flavoring agents include natural flavoring agents (thaumatin), stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.). The food composition of the present invention can be formulated in the same way as the pharmaceutical composition described below and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, health supplements, etc. There is.

In addition, the food/health functional food composition contains, in addition to the extract as the active ingredient, various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, colorants and thickening agents (cheese, chocolate, etc.), and pectic acid. and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the food composition of the present invention may contain pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages.

The health functional food composition of the present invention can be manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. In the present invention, 'health functional food composition' refers to food manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with Act No. 6727 on Health Functional Food, and refers to food that is manufactured and processed with respect to the structure and function of the human body. It means taking it for the purpose of controlling nutrients or obtaining useful health effects such as physiological effects. The health functional food of the present invention may contain common food additives, and its suitability as a food additive is determined in accordance with the general provisions and general test methods of the food additive code approved by the Food and Drug Administration, unless otherwise specified. Judgment is made according to specifications and standards. Items listed in the 'Food Additive Code' include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as dark pigment, licorice extract, crystalline cellulose, high-quality pigment, and guar gum; Examples include mixed preparations such as sodium L-glutamate preparations, noodle additive alkaline preparations, preservative preparations, and tar coloring preparations. For example, the health functional food in the form of a tablet is made by granulating a mixture of the active ingredient of the present invention with excipients, binders, disintegrants and other additives in a conventional manner, and then adding a lubricant and compression molding, or The mixture can be directly compression molded. In addition, the health functional food in the form of tablets may contain flavoring agents, etc., if necessary. Among capsule-type health functional foods, hard capsules can be manufactured by filling a regular hard capsule with a mixture of the active ingredient of the present invention mixed with additives such as excipients, and soft capsules can be prepared by mixing the active ingredient of the present invention with additives such as excipients. It can be manufactured by filling the mixture with a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary. The health functional food in the form of a pill can be prepared by molding a mixture of the active ingredient of the present invention and excipients, binders, disintegrants, etc., using a known method. If necessary, it can be coated with white sugar or other coating agent. Alternatively, the surface can be coated with substances such as starch or talc. Health functional food in the form of granules can be manufactured into granules by mixing a mixture of excipients, binders, disintegrants, etc. of the active ingredients of the present invention by a known method, and may contain flavoring agents, flavoring agents, etc., if necessary. You can.

Hereinafter, embodiments of the present invention will be described in more detail with reference to the attached drawings. However, the following examples are only intended to embody the content of the present invention, and the present invention is not limited thereto.

<Example 1> Isolation of new functional strains

To isolate the functional strain of the present invention, the following procedure was performed.

[Step 1] The collection of fecal samples for strain isolation was conducted on infant dogs (breastfeeding dogs) within 3 weeks of birth, and the samples were collected immediately upon defecation to prevent fecal contamination. At this time, the fecal samples collected contained the mother dog's tongue or Care was taken to avoid contact with saliva.

[Step 2] The collected fecal samples were placed in a sterilized container containing pepton water, properly secured, and then refrigerated and transported.

[Step 3] After dispersing the Lactobacilli MRS agar medium in water, sterilize at 121°C for 15 minutes, cool to 53°C, and dispense 10 to 15 ml into empty Petri dishes. The medium was left at room temperature until it hardened. Afterwards, it was sufficiently dried.

[Step 4] Two times more peptone water was added to the sample and then vortexed to completely disperse.

[Step 5] 100 ㎕ of the dispersed sample was dispensed onto the previously prepared Lactobacilli MRS agar plate, and then mixed using a glass spreader until the moisture disappeared.

[Step 6] The plate was cultured in a constant temperature incubator at 37°C for 24 to 48 hours.

[Step 7] The cultured plate was checked to confirm microbial colonies. At this time, different colonies were identified depending on their shape, size, and color.

[Step 8] The colonies identified in [Step 7] above were collected using a sterilized platinum tooth and then inoculated onto a new Lactobacilli MRS agar plate.

[Step 9] The process of [Step 7] to [Step 8] above was repeated 2 to 3 times, and if the colonies identified on the plate were all of the same shape and confirmed to be identical under a microscope, the process proceeded to the next step. .

[Step 10] After dispersing the Lactobacilli MRS liquid medium in water, 10 ml each was dispensed into culture tubes, sterilized at 121°C for 15 minutes, and then cooled to room temperature.

[Step 11] One colony from the plate on which strain isolation was completed was taken with a sterilized platinum tooth and inoculated into 10 ml of Lactobacilli MRS liquid medium.

[Step 12] The inoculated medium was cultured in a shaking incubator at 37°C and 200 rpm for 24 to 48 hours.

[Step 13] The culture was taken with a sterilized platinum tube and inoculated onto a new Lactobacilli MRS agar plate.

[Step 14] If all colonies identified on the plate had the same shape and were confirmed to be identical under a microscope, the process from [Step 11] to [Step 12] was repeated.

[Step 15] 1 ml of the culture-complete solution was placed in a sterilized e-tube and centrifuged at 5,000 rpm for 5 minutes.

[Step 16] After removing 0.5 ml of the centrifuged supernatant, 0.5 ml of sterilized 50% glycerol solution was added and mixed well.

[Step 17] The solution in [Step 16] was determined as the glycerol solution of the strain and was stored at -21°C or lower and used for subsequent cultivation and experiments.

Through the above separation experiment, a total of 10 strains were isolated, and then a total of 5 final strains with distinct colony shape, size, and color were selected in each subculture medium, and among these, the NI37 strain, which had the best effect, was isolated from the 16S rRNA gene. Analysis was conducted, and microorganism identification was completed as shown in Table 1 below.

sample name Type of identification primer Identification result Similarity (%) NI37 16S rRNA 518F:CCAGCAGCCGCGGTAATAC

805R:GACTACCAGGGTATCTAATC Limosilactobacillus reuteri
( Lactobacillus reuteri ) 99 Limosilactobacillus caviae
( Lactobacillus caviae ) 98 Limosilactobacillus frumenti
( Lactobacillus frumenti ) 97

The NI37 strain was judged to have the best functionality through the following experiments and was deposited with the Korea Research Institute of Bioscience and Biotechnology on June 22, 2023 and given the accession number of KCTC15477BP.

<Experimental Example 1> Amylase enzyme activity of the isolated strain

To confirm the amylase enzyme activity of the five strains isolated in the present invention, ab102523 Amylase Assay Kit (Colorimetric) sold by abcam was used and the results are shown in Table 2 below (OD 405nm) (ST : Standard, PC: Positive Control). At this time, comparative strains 1 to 4 were 4 strains, excluding the NI37 strain of the present invention, out of a total of 5 strains isolated in Example 1, and were used as a comparison group.

ST_0 nM ST_4nM ST_8 nM ST_12nM ST_16nM ST_20 nM 0.0 ± 0.0 0.14 ± 0.00 0.29 ± 0.01 0.45 ± 0.00 0.57 ± 0.02 0.71 ± 0.03 PC NI37 Comparison strain 1 Comparison strain 2 Comparison strain 3 Comparison strain 4 1.31 ± 0.02 1.12 ± 0.02 0.35 ± 0.03 0.12 ± 0.02 0.65 ± 0.05 0.42 ± 0.01

As can be seen in Table 2 , the Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP) of the present invention was confirmed to have very high amylase enzyme activity compared to comparative strains 1 to 4. Therefore, through this, the NI37 strain of the present invention can help the digestion of companion animals, and in particular, may help the digestion and absorption of nutrients in aging companion animals with poor digestion.

<Experimental Example 2> Lysozyme enzyme activity of the isolated strain

To confirm the lysozyme enzyme activity of the strain isolated in the present invention, the Lysozyme Assay Kit (E-22013) sold by abcam was used and the results are shown in Table 3 below (Fluorescence Ex/Em = 550 /595nm)(ST: Standard). At this time, comparative strains 1 to 4 were 4 strains, excluding the NI37 strain of the present invention, out of a total of 5 strains isolated in Example 1, and were used as a comparison group.

ST_0U ST_15.5U ST_31U ST_62.5U ST_125U ST_250U ST_500U 0.0 ± 0.0 631.5 ± 125.9 1607.5 ± 461.0 3540.5 ± 455.4 10295.5 ± 83.4 25463.5 ± 1365.4 46602.5 ± 549.4 NI37 Comparison strain 1 Comparison strain 2 Comparison strain 3 Comparison strain 4 12577.5 ± 243.1 3012.3 ± 153.5 8362.8 ± 382.0 4632.1 ± 224.3 5372.1 ± 184.1

As can be seen in Table 3, the Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP) of the present invention was confirmed to have very high lysozyme enzyme activity compared to comparative strains 1 to 4. Therefore, through this, the NI37 strain of the present invention can suppress harmful intestinal bacteria in companion animals and thereby contribute to improving immunity.

<Experimental Example 3> Phosphatase enzyme activity of the isolated strain

To confirm the phosphatase enzyme activity of the strain isolated in the present invention, the E12020 Phosphatase Assay Kit (Colorimetric) sold by EnzChek was used and the results are shown in Table 4 below (Fluorescence Ex/ Em =494/518nm)(ST: Standard, PC: Positive Control). At this time, comparative strains 1 to 4 were 4 strains, excluding the NI37 strain of the present invention, out of a total of 5 strains isolated in Example 1, and were used as a comparison group.

ST_0 μM ST_25 μM ST_50 μM ST_100 μM PC(1U/ml) 98.5 ± 7.8 18246.5 ± 128.0 32328.0 ± 738.2 51276.5 ± 1192.9 47824.5 ± 1035.2 NI37 Comparison strain 1 Comparison strain 2 Comparison strain 3 Comparison strain 4 6976.5 ± 108.3 2364.2 ± 65.2 4126.3 ± 85.2 2975.5 ± 31.5 3847.1 ± 92.4

As can be seen in Table 4 , the Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP) of the present invention was confirmed to have very high phosphatase enzyme activity compared to comparative strains 1 to 4. Therefore, through this, the NI37 strain of the present invention can be expected to inhibit the production of mutant cells caused by intracellular reactive oxygen species in companion animals.

<Experimental Example 4> Confirmation of intestinal viability of isolated strains

4-1. Acid resistance verification

에서 2시간 동안 배양 후 Lactobacilli MRS 한천배지에 도말하여 생균수를 측정하였고, 하기 표 5에 나타내었다(생균수 측정 후 Log값 변환).After inoculating the NI37 strain of the present invention verified in Experimental Examples 1 to 3 in 0.05M sodium phosphate buffer pH 7.0 and pH 2.5, respectively, 37

After culturing for 2 hours, the number of viable cells was measured by plating on Lactobacilli MRS agar medium, and is shown in Table 5 below (Log value conversion after measurement of number of viable cells).

sample name pH 7.0 pH 2.5 pH 2.5 viable cell count / pH 7.0 * 100 NI37 8.08 ± 0.05 8.13 ± 0.04 100%

As can be seen in Table 5, the Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP) of the present invention was confirmed to have very high acid resistance functionality. Therefore, through this, the NI37 strain of the present invention was confirmed to have the ability to survive in stomach acid secreted during the digestion process of the strain ingested by the companion animal.

4-2. Bile tolerance test

에서 8시간 동안 배양 후 Lactobacilli MRS 한천배지에 도말하여 생균수를 측정하였고, 하기 표 6에 나타내었다(생균수 측정 후 Log값 변환).After inoculating the NI37 strain of the present invention verified in Experimental Examples 1 to 3 into 0.3% Oxgall-added medium, 37

After culturing for 8 hours, the number of viable cells was measured by plating on Lactobacilli MRS agar medium, and is shown in Table 6 below (Log value conversion after measuring number of viable cells).

sample name Untreated 0.3% Oxgall 0.3% Oxgall / Untreated*100 NI37 10.29 ± 0.01 7.40 ± 0.03 71.9%

As can be seen in Table 6, the Limosilactobacillus reuteri NI37 strain (accession number: KCTC15477BP) of the present invention was confirmed to have very high bile resistance functionality. Therefore, through this, the NI37 strain of the present invention was confirmed to have the ability to survive in the bile secreted during the digestive process of the strain ingested by the companion animal.

4-3. Verification of tenon ability

의 CO₂ 배양기에서 2시간 동안 배양 후 Lactobacilli MRS 한천배지에 도말하여 생균수를 측정하였고, 하기 표 7에 나타내었다(생균수 측정 후 Log값 변환).The NI37 strain of the present invention verified in Experimental Examples 1 to 3 was diluted to 1/10 and 1 ㎖ (based on 10 ⁷ or more microorganisms) was attached to the HT-29 cell line and then 37

After culturing for 2 hours in a CO ₂ incubator, the number of viable cells was measured by plating on Lactobacilli MRS agar medium, and the number of viable cells was measured, and is shown in Table 7 below (Log value conversion after measurement of number of viable cells).

division sample name Untreated HT-29 cell attachment HT-29 cell attached / untreated*100 control group Lactobacillus rhamnosus GG
(Control) 8.11 ± 0.06 7.03 ± 0.17 86.6% Sample NI37 10.29 ± 0.01 7.40 ± 0.03 87.8%

As can be seen in Table 7 above, the Limosilactobacillus reuteri NI37 strain (Accession number: KCTC15477BP) of the present invention was confirmed to have a very high adhesive ability. Therefore, through this, it was confirmed that the NI37 strain of the present invention can attach to the intestinal cells of companion animals and stay in the intestine for a long time, suppressing harmful bacteria for a long time.

As seen above, specific embodiments of the present invention have been described in detail, but those skilled in the art who understand the spirit of the present invention can add, change, delete, etc. other components within the scope of the same spirit, thereby creating other regressive inventions. However, other embodiments that are included within the scope of the present invention can be easily proposed. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive. The scope of the present invention is indicated by the scope of the claims described below rather than the detailed description above, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts are included in the scope of the present invention. It should be interpreted as

Korea Research Institute of Bioscience and Biotechnology Biological Resources Center (KCTC) KCTC15477BP 20230622

Claims (5)

Limosilactobacillus reuteri NI37 strain deposited with accession number KCTC15477BP.
According to paragraph 1,
The strain is characterized in that it has the functionality of increased amylase activity, increased lysozyme activity, and increased phosphatase activity.
Limosilactobacillus reuteri NI37 strain.
According to paragraph 1,
The strain is characterized by having the functionality of acid resistance, bile resistance, and intestinal adhesion ability,
Limosilactobacillus reuteri NI37 strain.
A feed additive composition for companion animals comprising the strain or culture medium thereof according to any one of claims 1 to 3 as an active ingredient.
Pet food containing the feed additive composition of paragraph 4 as an active ingredient.