KR102539398B1 - Composition for Inhibiting Inflammation containing Sous Vide-treated Okra - Google Patents

Abstract

The present invention relates to a composition for inhibiting inflammation containing okra treated with sous vide, and has excellent anti-inflammatory and antioxidant effects, and in particular, since the anti-inflammatory effect can be improved by sous vide treatment, various inflammatory diseases can be prevented, improved, or It can be usefully used as a material for treatment.

Description

Composition for Inhibiting Inflammation containing Sous Vide-treated Okra {Composition for Inhibiting Inflammation containing Sous Vide-treated Okra}

The present invention relates to a composition for inhibiting inflammation containing sous vide-treated okra.

Recently, the occurrence of inflammatory diseases is increasing due to environmental pollution, irregular meals, lack of exercise, stress, fatigue, drinking, smoking, and nutritional intake imbalance due to rapid industrial development. Inflammation is one of the defense responses of biological tissues to tissue damage, external stimuli, or various infectious agents. Enzyme activation, secretion of inflammatory mediators, and cell infiltration due to organic interactions of various inflammatory mediators and various immune cells in blood vessels and body fluids and a series of complex pathological phenomena such as body fluid exudation, circulatory disorder, tissue deterioration and overgrowth. In the process of inflammatory reaction, macrophages initially flock to the wound site to attack the invading bacteria, then blood plasma accumulates in the wound site and blood flow increases, leading to external symptoms such as fever, erythema, edema, and pain. When such an inflammatory reaction occurs continuously or excessively, it progresses to a major pathological phenomenon of the disease (hypersensitivity allergic disease, chronic inflammatory disease), and causes serious abnormal disorders.

On the other hand, as the incidence of inflammatory diseases increases, the standard of living of modern people improves, and interest in health increases, natural materials that can be used for the prevention and treatment of these inflammatory diseases are attracting attention. In particular, among natural materials, food materials Demand for materials with maximized health-related functionality is increasing.

Food materials known to exhibit conventional anti-inflammatory activity include turmeric ( Curcuma longa ), onion ( Allium cepa ), and noni ( Morinda citrifolia ), but turmeric cannot be used for pregnant women, and onion has little anti-inflammatory effect, Noni has a high potassium content, so it is not suitable for people with kidney disease or high blood pressure. Therefore, the need for the discovery of new food materials with excellent anti-inflammatory efficacy and the need for pretreatment methods for improving the anti-inflammatory effects of food materials are increasing.

Accordingly, the present inventors completed the present invention by conducting research on a new food material having excellent anti-inflammatory activity and a pretreatment method thereof.

One object of the present invention is to provide a composition for inhibiting inflammation containing an okra ( Abelmoschus esculentus L. ) extract.

Another object of the present invention is to provide a cosmetic composition comprising the composition.

Another object of the present invention is to provide a food composition comprising the composition.

Another object of the present invention is to provide a pharmaceutical composition comprising the composition.

One aspect of the present invention provides a composition for inhibiting inflammation comprising an okra ( Abelmoschus esculentus L. ) extract.

Okra is a plant belonging to the Malvaceae family, and all parts such as pods, leaves, stems, etc. can be eaten. Among them, the pods are known to be rich in polysaccharides, dietary fiber, minerals, vitamins and antioxidants. In the present invention, the excellent anti-inflammatory effect of okra was confirmed, and in particular, the sous vide treatment method was confirmed as a pre-treatment method to maximize the anti-inflammatory effect of okra.

The okra used in the present invention may be one from which the pods or stems thereof have been removed.

According to one embodiment of the present invention, an excellent anti-inflammatory effect was confirmed even in raw okra that was not subjected to pretreatment, and it was confirmed that the anti-inflammatory effect of okra could be improved through sous vide treatment among various pretreatment methods.

The pretreatment method may be a sous vide treatment, a blanching treatment, or a steaming treatment, preferably a sous vide treatment.

The term 'sous vide' used in the present invention refers to a method of vacuum-packing a material and cooking it under constant temperature conditions, for example, by applying heat in a constant temperature water bath for a certain period of time. The sous vide treatment may be performed under vacuum packaging conditions using polyethylene, polypropylene, polyester or polyamide.

According to one embodiment of the present invention, the extract may be extracted with a solvent selected from the group consisting of water, alcohol having 1 to 4 carbon atoms, and mixtures thereof.

The solvent may preferably be an ethanol aqueous solution, more preferably ethanol.

According to one embodiment of the present invention, okra may be pretreated at 70 ° C to 90 ° C for 100 to 140 seconds.

If the pretreatment is performed at less than 70 ° C, the heat treatment of okra is not sufficient, so that the expression of anti-inflammatory components is not sufficient. Therefore, it is preferable that the heat treatment is performed at 80°C.

The extract included in the composition according to the present invention can be obtained as follows. Okra is pretreated at 70 ° C. to 90 ° C. for 100 to 140 seconds and dried. At this time, okra can be used as it is in a dried state or ground and used in powder form. It can be extracted by adding an appropriate amount of extraction solvent to dried okra, and preferably, (a) anhydrous or hydrous lower alcohol having 1 to 4 carbon atoms (eg, methanol, ethanol, propanol, butanol, normal-propanol, iso -propanol and normal-butanol, etc.), (b) a mixed solvent of the lower alcohol and water, (c) acetone, (d) ethyl acetate, (e) chloroform, (f) 1,3-butylene glycol, ( g) hexane, (h) diethyl ether, (i) butyl acetate, (j) chloroform-methanol, or (k) water, and more preferably, ethanol. Extraction can be performed once or repeatedly, preferably twice.

The composition of the present invention may be prepared in a conventional formulation in the art, and may be, for example, powder, granule, tablet, capsule, or liquid formulation, but is not limited thereto.

Another aspect of the present invention provides a cosmetic composition comprising the composition.

The cosmetic composition of the present invention, for example, creams, emulsions, anhydrous compositions, aqueous dispersions, oils, balsams, foams, lotions, gels, cream gels, hydroalcoholic solutions, hydroglycolic solutions, liniments, soaps , shampoos, emollients, serums, polysaccharide films, ointments, mousses, pomades, powders, sticks, pencils, sprays, and any solid, liquid or semi-solid formulations.

In addition, the cosmetic composition of the present invention, for example, a hydrogel, an adhesive patch, a non-adhesive patch, a microelectronic patch, or other types of solid materials such as a face mask using techniques known to those skilled in the art. or can be included in other makeup products such as makeup foundations such as fluid foundations and compact foundations, makeup removal lotions, makeup removal milks, concealers, eye shadows, lipsticks, lip protectors, lip glosses and powders. there is.

Another aspect of the present invention provides a food composition comprising the composition.

In addition to okra, the food composition of the present invention may include ingredients commonly added during food preparation, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavors. Examples of carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agent, natural flavoring agents [thaumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

For example, when the food composition of the present invention is prepared as a drink, in addition to the okra of the present invention, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, Eucalyptus extract, jujube extract, and/or licorice extract, etc. can be included

In addition, the food composition of the present invention contains various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and It may contain salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and the like.

These components may be used independently or in combination, and the ratio of these additives may be selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.

Another aspect of the present invention provides a pharmaceutical composition comprising the composition.

The pharmaceutical composition of the present invention may contain various bases and/or additives necessary and appropriate for formulation of the dosage form, and may include nonionic surfactants, silicone polymers, extender pigments, fragrances, and preservatives within a range that does not impair its effectiveness. , biocides, oxidative stabilizers, organic solvents, ionic or nonionic thickeners, softeners, antioxidants, free radical destroyers, opacifying agents, stabilizers, emollients, silicones, α-hydroxy acids, antifoaming agents, humectants , vitamins, insect repellents, fragrances, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basicizing or acidifying agents, or colorants.

A suitable dosage of the pharmaceutical composition of the present invention is variously prescribed depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and response sensitivity. It can be. The dosage of the pharmaceutical composition of the present invention may be 0.001 to 1000 mg/kg based on adults.

The pharmaceutical composition of the present invention may be administered orally or parenterally.

The pharmaceutical composition of the present invention may be administered in various formulations for oral administration, and may be administered in the form of solid formulations such as pills, powders, granules, tablets or capsules, and may be administered in various excipients such as wetting agents, Sweetening agents, flavoring agents, preservatives, and the like may be further included. Specifically, when the composition of the present invention is formulated in the form of a powder, granule, tablet or capsule, it may further include appropriate carriers, excipients and diluents commonly used in its preparation. Such carriers, excipients and diluents include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and/or mineral oil may be used, but are not limited thereto. In addition, it may be prepared by including diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants commonly used in formulation, and may further include a lubricant such as magnesium stearate or talc in addition to the above excipients. .

The pharmaceutical composition of the present invention can be administered in various formulations for parenteral administration. Solid formulations include tablets, pills, powders, granules, capsules, etc., and liquid formulations include suspensions, solutions, emulsions, and syrups. In addition to water, liquid, and paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Specifically, preparations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions and freeze-dried preparations. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. In addition, calcium or vitamin D3 may be added to enhance the efficacy of the treatment.

Such compositions may be presented in unit-dose (single-dose) or multi-dose (multiple-dose) containers, such as sealed ampoules and vials, and added immediately before use in a sterile liquid carrier, such as water for injection. It can be stored under freeze-drying conditions requiring only the addition of Extemporaneous preparations and suspensions may be prepared from sterile powders, granules and tablets.

A composition for inhibiting inflammation containing sous vide-treated okra has excellent anti-inflammatory and antioxidant effects, and is particularly useful as a material for preventing, improving, or treating various inflammatory diseases because the anti-inflammatory effect can be improved by sous vide treatment. can be utilized

1 is a graph showing the cytotoxicity of sous-vide-treated okra extract (SVOE), non-pretreated raw okra extract (ROE), blanched-treated okra extract (BOE), and steamed okra extract (SOE).
Figure 2 is a sous vide-treated okra extract (SVOE), non-pretreated raw okra extract (ROE), blanched okra extract (BOE), and steamed okra extract (SOE) to inhibit nitric oxide (NO) production is a graph showing
3 shows (A) fresh okra extract without pretreatment (ROE), (B) blanched okra extract (BOE), (C) steamed okra extract (SOE), and (D) sous vide treated okra. These are Western blot results showing the effect of the extract (SVOE) on the expression levels of COX-2 and iNOS proteins.
4 shows (A) non-pretreated fresh okra extract (ROE), (B) blanched okra extract (BOE), (C) steamed okra extract (SOE), and (D) sous vide-treated okra These are RT-PCR results showing the effect of the extract (SVOE) on the expression levels of iNOS, TNF-α, IL-6 and IL-1β.
5 is a sous vide-treated okra extract (SVOE), non-pretreated fresh okra extract (ROE), blanched okra extract (BOE), and steamed okra extract (SOE). Reactive oxygen species (ROS) of okra extracts. It is a graph showing the erasure ability.

Hereinafter, the present invention will be described in more detail through one or more embodiments. However, these examples are intended to illustrate the present invention by way of example, and the scope of the present invention is not limited to these examples.

Example 1. Preparation of sous vide-treated okra extract (SVOE)

1-1. Pretreatment of Okra

100 g of okra ( Abelmoschus esculentus L. ) (origin: Gangjin, Chungcheongnam-do) with the stem removed was vacuum-sealed in a polyethylene vacuum seal bag for food, treated with sous vide for 2 minutes at 80 ° C in a bath cooker (Fusion chef, Germany) It was rapidly cooled in running water.

1-2. Preparation of okra extract

The okra prepared in Example 1-1 was freeze-dried at -75 ° C to -80 ° C for 48 hours with a lyophilizer (Ilsin Lab Co., Seoul, Korea), and then pulverized (Hanil Electric, HMF-3100S, Seoul, Korea). ) and pulverized with a 30 mesh standard mesh sieve. 10 g of okra powder was extracted by stirring with 100 ml of ethanol at 25 ° C. and 150 rpm for 24 hours using a temperature shaker incubator (SI-900R, JEIO TECH, Kimpo, Korea), and Whatman No. Filtered with 4 filter paper. Extraction was repeated in the same manner by adding 100 ml of ethanol to the residue. The prepared ethanol extract was evaporated to dryness at 40° C. using a rotary eva-porator (NVC-2100, EYELA, Tokyo, Japan), and then dissolved in ethanol at a concentration of 50 mg/ml to prepare an okra extract (SVOE).

Comparative Example 1. Preparation of Raw Okra Extract (ROE)

An okra extract (ROE) was prepared in the same manner as in Example 1-2, using okra not subjected to a pretreatment step of heating the okra.

Comparative Example 2. Preparation of Blanched Okra Extract (BOE)

100 g of okra with the tap removed was added to 500 ml of boiling distilled water, blanched for 2 minutes, then placed in a plastic bag and rapidly cooled in running water for 2 minutes. Then, an okra extract (BOE) was prepared in the same manner as in Example 1-2.

Comparative Example 3. Preparation of Steamed Okra Extract (SOE)

500 ml of distilled water was put in a steam cooker (Tefal, Model S07, Groupe SEB-France), and when the distilled water boiled, 100 g of okra with the top removed was put, covered, and steamed for 2 minutes. Then, an okra extract (SOE) was prepared in the same manner as in Example 1-2.

Example 2. Confirmation of excellent anti-inflammatory effect of okra extract according to MTT assay

2-1. Cell lines and cell culture

In order to confirm the anti-inflammatory effect of the okra extracts prepared in Example 1 and Comparative Examples 1 to 3, 3T3-L1 preadipocyte and RAW 264.7 macrophage were distributed from Korea Cell line Bank (KCLB, Seoul, Korea) used They were cultured at 37°C and 5% CO ₂ using DMEM (Dulbecco's modigies Eagle's medium) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Gibco, Gran Island, NY, USA).

2-2. Confirmation of cell safety of okra extract according to toxicity evaluation (MTT assay)

In order to confirm the toxicity of the okra extracts prepared in Example 1 and Comparative Examples 1 to 3 against RAW 264.7 cells, 3-(4,5-dimethylthiazol-2-yl)-2,5- A diphenyltetrazolium bromide (MTT) assay was performed.

Specifically, RAW264.7 cells were treated with 20, 50, 100 or 200 μg/ml of the okra extract prepared in Example 1 and Comparative Examples 1 to 3, respectively, and cultured for 24 hours. The control group was treated with DMSO 0.1% and cultured for 24 hours in the same manner. Thereafter, a total of 20 μl of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) solution was added to each well and incubated at 37 °C. After incubation for 1 hour, absorbance was measured at 490 nm using a microplate reader (SPETRA max 340 PC; Molecular Devices, LLC, Silicon Valley, CA, USA), and the results are shown in Table 1 and FIG. 1.

okra extract
(μg/ml) Comparative Example 1
(ROE) Comparative Example 2
(BOE) Comparative Example 3
(SOE) Example 1
(SVOE) F-value
( p ) 0 100±4.28 100±3.31 100±1.62 100±2.63 0
(-One) 25 106.55± ^8.27aA 108.980±4.33 ^aA 103.09±7.26 ^aA 113.3±7.1 ^aAB 1.156
(-0.385) 50 105.76± ^7.07aA 113.85± ^9.20aA 107.25±7.89 ^aA 115.55±2.38 ^aB 1.374
(-0.319) 100 101.72±15.39 ^aA 110.58± ^1.81abA 104.44± ^1.35abA 118.68±5.60 ^bB 2.488
(-0.135) 200 103.46± ^13.44abA 118.30±11.32 ^bA 99.01±1.13 ^aA 104.91± ^3.50abA 2.572
(-0.127) F-value
( p ) 2.02
(-0.932) 2.82
(-0.84) 1.39
(-0.31) 8.54
(0.003) a, b: significance level for each treatment method
A, B: significance level for each concentration
^* : p<0.01

As a result of the measurement, there was no significant difference in cell viability by concentration of each extract, and it was confirmed that there was no cytotoxicity up to 200 μg/ml. In addition, it was found that there was no significant difference between each Example 1 and Comparative Examples 1 to 3.

Through these results, it was confirmed that the okra extract was not cytotoxic and could be safely applied as a food material.

2-3. Confirmation of excellent NO production inhibitory effect of okra extract according to the Griess Reagent System

In order to confirm the NO production inhibitory effect of the okra extracts prepared in Example 1 and Comparative Examples 1 to 3, the RAW 264.7 cell line was prepared according to the Griess Reagent System method at 1×10 ⁵ cells/2 ml/well in a 6 well plate and left overnight, 20, 50, 100 and 200 μg/ml of the okra extract of Example 1 and Comparative Examples 1, 2, or 3 were treated with 1 μg/ml of LPS (lipopolysaccharide), an inflammation inducer, for 8 hours cultured for a while. 100 μl of the cell culture supernatant was mixed with 100 μl of Griess reagent, incubated at room temperature for 30 minutes, and the absorbance was measured at 540 nm using a microplate reader (SPECTRA max 340PC; Molecular Devices, LLC), and the results are shown in the table. 2 and shown in FIG. 2 . Nitrite concentration (μM) was calculated by comparison with a standard curve obtained using sodium nitrite (NaNO ₂ ).

okra extract
(μg/ml) Comparative Example 1
(ROE) Comparative Example 2
(BOE) Comparative Example 3
(SOE) Example 1
(SVOE) F-value
( p ) control group
200 100.00±2.16
74.86±8.80 100.00±20.55
43.78±1.02 100.00±1.40
47.85±3.04 100.0.490±8
54.26±0.10 LPS+1 264.67 ± 9.57 ^bC 221.36±36.7 ^ac 254.06± ^0.52abD 267.52±12.82 ^bD 3.47
(-0.47) LPS+50 206.7±35.3 ^bB 179.0± ^17.88abB 172.55±8.18 ^aB 200.43± ^6.83abC 3.611
(-0.58) LPS+100 191.49±8.37 ^bB 182.85±1.53 ^bB 194.63 ± 3.81 ^bC 132.71±15.26 ^aB 43.17 ^***
(0.000) LPS+200 141.34±8.80 ^cA 92.43±1.02 ^aA 112.51±3.04 ^bA 97.56±3.23 ^aA 68.83 ^***
(0.000) F-value
( p ) 35.88 ^**
(0.000) 21.24 ^***
(0.000) 451217 ^***
(0.000) 149.592 ^***
(0.000) ac: significance level for each treatment method
AD: significance level for each concentration
^** : p<0.01
^*** : p<0.001

As a result of the measurement, compared to the control group, the LPS-treated group was 264.67% in Comparative Example 1, 220.70% in Comparative Example 2, 254.05% in Comparative Example 3, and 267.52% in Example 1, indicating that the inflammatory response by LPS was well induced for each extract. In addition, the group treated with okra simultaneously with LPS was 50 μg/day in Comparative Example 1 (p<0.01), Comparative Example 2 (p<0.000), Comparative Example 3 (p<0.000), and Example 1 (p<0.000). From the ㎖ treatment group, NO production was significantly inhibited in a concentration-dependent manner. At a concentration of 200 μg/ml, the NO production reduction rate compared to the LPS alone treatment group was 46.6% in Comparative Example 1, 58.12% in Comparative Example 2, 55.71% in Comparative Example 3, and 63.55% in Example 1, respectively. showed excellent NO production inhibitory ability, and in particular, in the case of 100 μg/ml concentration and 200 μg/ml concentration, it was confirmed that the NO production inhibitory effect of Example 1 was excellent (p<0.000).

Through these results, it was confirmed that among the okra pretreated by various methods, the sous vide-treated okra had a particularly excellent NO production inhibitory effect.

2-4. Confirmation of anti-inflammatory effect of okra extract according to western blot

2-4-1. Protein sample preparation

The RAW 264.7 cell line was dispensed into a 6 well plate at 1×10 ⁵ cells/2 ml/well, and the okra extract of Example 1 and Comparative Example 1, 2, or 3 was added at 20, 50, 100 or 200 μg/ml as an inflammation inducer. Phosphorus LPS (lipopolysaccharide) was treated with 1 μg/ml and cultured for 8 hours. The control group was cultured for 8 hours without treatment with LPS. After washing the cells twice with PBS, modified RIPA buffer (50 mM Tris-Cl (pH 7.4), 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 0.25% sodium deoxycholate, 1% Triton X-100, 1% Protein was extracted using Nonidet P-40, 1 mM EDTA, 1 mM EGTA and protease inhibitor cocktail (PIC) (1X)). The cell lysate was centrifuged at 12,074 × g for 20 minutes at 4°C, and the supernatant was collected to measure protein concentration using a bicinconic acid protein assay kit (Thermo Fisher Scientific, Inc., Waltham, Waltham, MA). did

2-4-2. Western blot analysis

In order to confirm the anti-inflammatory effect of the okra extract prepared in Example 1 and Comparative Examples 1 to 3, the effect of the okra extract on the expression of COX-2 and iNOS protein, which are factors expressed in the inflammatory response, was confirmed through Western blotting. did

Specifically, 10% polyacrylamide gel electrophoresis (SDS-PAGE) was performed on 30 g of the protein treated in Example 2-4-1. The isolated protein was transferred using a polyvinylidene difluoride membrane (PVDF) (Milipore, Bedford, MA, USA), and then incubated in TBS (Tis Buffered Saline) containing 0.1% Tween 20 (TBST) for 1 hour at room temperature for 5 % (w/v) of skim milk. Membranes were incubated with COX-2 antibody (1:2000) (Cayman Chemical, USA), iNOS antibody (1:2000) (Santa Cruz Biotechnology, USA), or actin antibody (1:10,000) (Sigma, USA) overnight at 4 °C. was treated, and then detected with anti-goat IgG, anti-mouse IgG, or anti-rabbit IgG combined with horseradish peroxidase for 2 hours at room temperature. Then, the membrane was washed three times with TBST and checked with ECL reagent. The results are shown in Figure 3, and actin was used as a control.

As a result of the detection, a significant increase in COX-2 and iNOS protein expression was confirmed in the LPS-treated group, whereas in Example 1 and Comparative Examples 1 to 3, compared to the control group not treated with LPS, COX-2 and iNOS protein expression decreased in a concentration-dependent manner. confirmed to be In particular, it was confirmed that the effect of inhibiting the expression of COX-2 and iNOS proteins in Raw 264.7 cells induced by LPS under the condition of 200 μg/ml of Example 1 was the most excellent.

Through these results, it was confirmed that the anti-inflammatory effect of sous vide-treated okra was particularly excellent among okra pre-treated by various methods.

2-5. Confirmation of anti-inflammatory effect of okra extract by RT-PCR

RT-PCR ( Reverse-Transcription-Polymerase Chain Reaction) was performed.

Total cellular RNA was isolated from RAW 264.7 cells treated with the okra extracts of Example 1 and Comparative Examples 1 to 3 according to the manufacturer's protocol using TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and RT PCR was performed. Specifically, 8 μl Molony Murine Leu-kemia Virus reverse transcriptase (MLVRT) 5× buffer, 3 μl 10 mM dNTPs, 0.45 μl 40 U/μl RNase inhibitor, 0.3 μl M MLV RT (Promega Corporation) and 3.75 μl 20 μM oligo dT The same amount of total RNA (5 μg) was reverse transcribed in 40 μl of a reaction solution containing (Bioneer Corporation, Oakland, CA, USA). Single-stranded cDNA was prepared by mixing 4 μl 5 Green Go Taq Flexi reaction buffer, 0.4 μM 10 mM dNTPs, 0.1 μl 5 U/μl Taq polymerase, 1.2 μl 25 mM MgCl2 (Promega Corporation) and 0.4 μl primer (20 pM/μl). was amplified by PCR using The primers used are shown in Table 3 for iNOS, TNF-α, IL-6 and IL-1β related to the inflammatory response, and the results of performing 30 cycles of RT-PCR under the PCR conditions in Table 4 are shown in FIG. .

primer Primer nucleotide sequence (5'→3') sequence number iNOs forward GACAAGCTGCATGTGACATC SEQ ID NO: 1 reverse GCTGGTAGGTTCCTGTTGTT SEQ ID NO: 2 TNF-α forward GGCAGGTCTACTTTGGAGTCATTGC SEQ ID NO: 3 reverse ACATTCGAGGCTCCAGTGAATTCG SEQ ID NO: 4 IL-6 forward GTCGGAGGCTTAATTACACATGTTC SEQ ID NO: 5 reverse ACTCCTTCTGTGACTCCAGCTTATC SEQ ID NO: 6 IL-1β forward TGCAGAGTTCCCCAACTGGTACATC SEQ ID NO: 7 reverse GTGCTGCCTAATGTCCCCTTGAAT SEQ ID NO: 8

denaturation annealing extension iNOs 95 ℃ 1 minute 50 ℃ 1 minute 72 ℃ 1 minute TNF-α 95 ℃ 30 seconds 58 ℃ 1 minute 72 ℃ 30 seconds IL-6 95 ℃ 30 seconds 59 ℃ 1 minute 72 ℃ 1 minute IL-1β 95 ℃ 30 seconds 60 ℃ 1 minute 72 ℃ 30 seconds β-actin 95 ℃ 30 seconds 63 ℃ 1 minute 72 ℃ 1 minute

In Examples 1 and 1 to 3, the expression levels of iNOS and inflammatory cytokines (TNF-α, IL-6, IL-1β) were decreased in each okra extract 200 μg/ml treatment group compared to the control group, whereas the LPS treatment group amount increased markedly. In addition, it was confirmed that the expression of inflammatory cytokines (TNF-α, IL-6, IL-1β) was clearly suppressed in both Example 1 and Comparative Examples 1 to 3 in a concentration-dependent manner, and iNOS mRNA induced by LPS of Example 1. Expression inhibition effect was found to be the most excellent.

Through these results, it was confirmed that the anti-inflammatory effect of sous vide-treated okra was particularly excellent among okra pre-treated by various methods.

Example 3. Confirmation of antioxidant effect of okra extract according to measurement of active oxygen scavenging activity

In order to confirm the effect of the okra extracts of Example 1 and Comparative Examples 1 to 3 on intracellular reactive oxygen species (ROS) production, the RAW 264.7 cell line was prepared in a 96 well plate at a concentration of 2.4×10 ⁴ cells/well. After aliquoting and leaving overnight, incubation was performed at 37° C. for 30 minutes with a solution of CM-H2DCFDA (10 μM, Abcam, Cambridge, MA, USA). After removing the CM-H2DCFDA solution, the cells were washed with phosphate buffered saline (PBS), and the okra extracts of Example 1 and Comparative Examples 1 to 3 were treated with H ₂ O ₂ (200 μM) for 30 minutes, and the control was DMSO ( 0.1%). The fluorescence intensity of DCF was quantified at 488 nm and 520 nm, respectively, using a Victor3 (Perkin Elmer, CT, USA).

okra extract
(μg/ml) Comparative Example 1 Comparative Example 2 Comparative Example 3 Example 1 F-value
( p ) control group
200 100±2.00
76.17±5.52 76.17±5.64
88.07±5.20 100.00±8.83
81.3±12.08 100±4.56
88.02±8.40 H ₂ O ₂ (200 uM) 531.38± ^50.87abA 514.25 ± 60.19 ^ac 605.85± ^21.83bcC 628.35±32.93 ^cC 5.680 ^*
(0.016) H ₂ O ₂ +50 433.61±8.98 ^aB 423.36±19.30 ^aB 679.68±44.7 ^bD 531.30±14.04 ^cB 80.059 ^***
(0.000) H ₂ O ₂ +100 420.81±9.65 ^aB 440.67±31.06 ^aB 526.33±22.52 ^bB 535.43±14.72 ^bB 32.174 ^***
(0.000) H ₂ O ₂ +200 423.00±20.84 ^bB 333.35±29.36 ^aA 463.77±2.82 ^cA 329.29 ± 19.79 ^aA 35.408 ^***
(0.000) F-value
( p ) 44.23 ^***
(0.000) 11.39 ^**
(0.000) 35.43 ^***
(0.000) 280.56 ^***
(0.000) ac: significance level for each treatment method
AD: significance level for each concentration
^* : p<0.05
^*** : p<0.001

As can be seen in Table 5 and FIG. 5, ROS production was strongly induced in the H ₂ O ₂ treatment group, 531.387% of Comparative Example 1, 514.25% of Comparative Example 2, 605.85% of Comparative Example 3, and Example 3 at 0 μg/ml conditions. The level of ROS production increased by 1 628.35%. In addition, the H ₂ O ₂ and okra extract treatment groups were Comparative Example 1 ( p <0.000), Comparative Example 2 (p <0.005), Comparative Example 3 (p <0.000) and Example 1 (p <0.000) _. Compared to the group not treated with O ₂ , the amount of ROS produced was significantly lower in a concentration-dependent manner. Specifically, compared to the H ₂ O ₂ alone treatment group at a concentration of 200 μg/ml, Comparative Example 1 showed a reduction of 20.40%, Comparative Example 2 35.18%, Comparative Example 3 23.45%, and Example 1 47.60%, showing a reduction rate of ROS generation in all treatment methods. It was confirmed that this was reduced, and in particular, Example 1 showed the highest reduction rate, confirming that the antioxidant effect was excellent.

Through these results, it was confirmed that among the okra pretreated by various methods, the antioxidant effect of sous vide-treated okra was particularly excellent.

So far, the present invention has been examined focusing on the embodiments. Those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the equivalent range should be construed as being included in the present invention.

<110> Sookmyung Women's university industry-academic cooperation foundation <120> Composition for Inhibiting Inflammation containing Sous Vide-treated Okra <130> SP21-0026KR <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> iNOs_forward <400> 1 gacaagctgc atgtgacatc 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> iNOs_reverse <400> 2 gctggtaggt tcctgttgtt 20 <210> 3 <211> 25 <212> DNA <213> artificial sequence <220> <223> TNF-a_forward <400> 3 actccttctg tgactccagc ttatc 25 <210> 4 <211> 24 <212> DNA <213> artificial sequence <220> <223> TNF-a_reverse <400> 4 acattcgagg ctccagtgaa ttcg 24 <210> 5 <211> 25 <212> DNA <213> artificial sequence <220> <223> IL-6_forward <400> 5 gtcggaggct taattacaca tgttc 25 <210> 6 <211> 25 <212> DNA <213> artificial sequence <220> <223> IL-6_reverse <400> 6 actccttctg tgactccagc ttatc 25 <210> 7 <211> 25 <212> DNA <213> artificial sequence <220> <223> IL-1b_forward <400> 7 tgcagagttc cccaactggt acatc 25 <210> 8 <211> 24 <212> DNA <213> artificial sequence <220> <223> IL-1b_reverse <400> 8 gtgctgccta atgtcccctt gaat 24

Claims (7)

In the composition for inhibiting inflammation,
The composition comprises okra ( Abelmoschus esculentus L. ) extract,
The okra is pretreated at 70 ° C to 90 ° C for 100 to 140 seconds
A composition for inhibiting inflammation.
According to claim 1,
The extract is a composition for inhibiting inflammation that is extracted with a solvent selected from the group consisting of water, alcohol having 1 to 4 carbon atoms, and mixtures thereof.
delete According to claim 1,
The composition is a composition for inhibiting inflammation, which is a powder, granule, tablet, capsule or liquid formulation.
A cosmetic composition comprising the composition of claim 1.
A food composition comprising the composition of claim 1.
A pharmaceutical composition comprising the composition of claim 1.

Images