KR20220135990A - Composition for Inhibiting Inflammation containing Sous Vide-treated Okra - Google Patents

Abstract

The present invention relates to a composition for inhibiting inflammation, which contains sous vide-treated okra, and has excellent anti-inflammatory and antioxidant effects. In particular, since the anti-inflammatory effect can be improved by sous vide treatment, the composition can be usefully used as a material for preventing, alleviating or treating various inflammatory diseases.

Description

Composition for Inhibiting Inflammation containing Sous Vide-treated Okra

The present invention relates to a composition for inhibiting inflammation containing sous vide-treated okra.

Recently, the incidence of inflammatory diseases is increasing due to environmental pollution caused by rapid industrial development, irregular eating, lack of exercise, stress, fatigue, drinking, smoking, and nutritional imbalance. Inflammation is one of the defense responses of living tissues against tissue damage, external stimuli, or various infectious agents. and a series of complex pathologies such as exudation of body fluids, circulatory disorders, and tissue deterioration and hyperproliferation. In the process of the inflammatory reaction, macrophages initially gather at the wound site and attack the invading bacteria, and then plasma is accumulated in the wound site and blood flow is increased, leading to external symptoms such as fever, erythema, edema, and pain. If such an inflammatory reaction occurs continuously or excessively, it progresses to a major pathological phenomenon of the disease (hypersensitivity allergic disease, chronic inflammatory disease), resulting in serious abnormalities.

On the other hand, along with the increase in the incidence of inflammatory diseases, as the living standards of modern people improve and interest in health increases, natural materials that can be used for the prevention and treatment of these inflammatory diseases are attracting attention. The demand for substances that maximize health-related functionality is increasing.

Food materials known to exhibit anti-inflammatory activity in the prior art include turmeric ( Curcuma longa ), onion ( Allium cepa ), noni ( Morinda citrifolia ), etc., but turmeric cannot be used for pregnant women, and onion has insignificant anti-inflammatory effect, Noni has a high potassium content, making it unsuitable for patients with kidney disease or high blood pressure. Accordingly, there is an increasing need for a new food material having excellent anti-inflammatory effect and a need for a pretreatment method for improving the anti-inflammatory effect of food material.

Accordingly, the present inventors completed the present invention by conducting research on a novel food material having excellent anti-inflammatory activity and a pretreatment method thereof.

One object of the present invention is to provide a composition for inhibiting inflammation comprising an okra ( Abelmoschus esculentus L. ) extract.

Another object of the present invention is to provide a cosmetic composition comprising the composition.

Another object of the present invention is to provide a food composition comprising the composition.

Another object of the present invention is to provide a pharmaceutical composition comprising the composition.

One aspect of the present invention provides a composition for inhibiting inflammation comprising an okra ( Abelmoschus esculentus L. ) extract.

Okra is a plant belonging to the Malvaceae family, and can be eaten from all parts including pods, leaves, stems, etc. Among them, pods are known to be rich in polysaccharides, dietary fiber, minerals, vitamins and antioxidants. In the present invention, the excellent anti-inflammatory effect of okra was confirmed, and in particular, the sous vide treatment method was confirmed as a pre-treatment method for maximizing the anti-inflammatory effect of okra.

Okra used in the present invention may be a pod or a stem thereof removed.

According to one embodiment of the present invention, excellent anti-inflammatory effect was confirmed even in raw okra that was not pre-treated, and it was confirmed that the anti-inflammatory effect of okra could be improved, especially through sous vide treatment among various pre-treatment methods.

The pretreatment method may be a sous vide treatment, a blanching treatment, or a steaming treatment, and preferably a sous vide treatment.

As used herein, the term 'sous vide' refers to a method of vacuum-packing materials and cooking them under constant temperature conditions, for example, in a constant temperature water bath by applying heat for a certain period of time. The sous vide treatment may be performed under vacuum packaging conditions using polyethylene, polypropylene, polyester, or polyamide.

According to one embodiment of the present invention, the extract may be extracted with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, and mixtures thereof.

The solvent may be an aqueous ethanol solution, more preferably ethanol.

According to one embodiment of the present invention, okra may be pre-treated at 70 ° C. to 90 ° C. for 100 to 140 seconds.

If the pretreatment is performed at less than 70 ° C, the heat treatment of okra is not sufficient and the expression of the anti-inflammatory component is not sufficient, and when it is performed at more than 90 ° C, the activity is rather halved due to the destruction of the anti-inflammatory component. Therefore, it is preferable that the heat treatment be performed at 80°C.

The extract included in the composition according to the present invention can be obtained as follows. Okra is pretreated at 70°C to 90°C for 100 to 140 seconds and dried. It can be extracted by adding an appropriate amount of an extraction solvent to the dried okra, preferably (a) anhydrous or hydrous lower alcohols having 1 to 4 carbon atoms (eg, methanol, ethanol, propanol, butanol, n-propanol, iso -propanol and normal-butanol, etc.), (b) a mixed solvent of the lower alcohol and water, (c) acetone, (d) ethyl acetate, (e) chloroform, (f) 1,3-butylene glycol, ( The extraction may be performed using g) hexane, (h) diethyl ether, (i) butyl acetate (j) chloroform-methanol or (k) water, and more preferably, ethanol. The extraction may be carried out once or repeatedly, preferably twice.

The composition of the present invention may be prepared in a conventional formulation in the art, for example, may be a powder, granule, tablet, capsule or liquid formulation, but is not limited thereto.

Another aspect of the present invention provides a cosmetic composition comprising the composition.

The cosmetic composition of the present invention may be, for example, a cream, emulsion, anhydrous composition, aqueous dispersion, oil, balsam, foam, lotion, gel, cream gel, hydroalcoholic solution, hydroglycolic solution, liniment, soap , shampoo, emollient, serum, polysaccharide film, ointment, mousse, pomade, powder, stick, pencil, spray, in any solid, liquid or semi-solid formulation.

In addition, the cosmetic composition of the present invention can be prepared using techniques known to those skilled in the art for other types of solid devices such as, for example, hydrogels, adhesive patches, non-adhesive patches, microelectronic patches or face masks. may be included in makeup foundations, such as fluid and compact foundations, makeup removal lotions, makeup removal milk, concealers, eye shadows, lipsticks, lip protectors, lip glosses and other makeup products such as powders. have.

Another aspect of the present invention provides a food composition comprising the composition.

In addition to okra as an active ingredient, the food composition of the present invention may include ingredients commonly added during food production, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of carbohydrates include monosaccharides such as glucose, fructose, and the like; disaccharides such as maltose, sucrose, oligosaccharides and the like; and polysaccharides, for example, conventional sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As the flavoring agent, natural flavoring agents [taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)] and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

For example, when the food composition of the present invention is prepared as a drink, in addition to the okra of the present invention, citric acid, fructose, sugar, glucose, acetic acid, malic acid, fruit juice, cephalothorax extract, jujube extract and/or licorice extract, etc. are additionally added. may be included.

In addition, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.

These components may be used independently or in combination, and the ratio of these additives may be selected from 0 to about 20 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.

Another aspect of the present invention provides a pharmaceutical composition comprising the composition.

The pharmaceutical composition of the present invention may contain various bases and/or additives necessary and appropriate for the formulation of the dosage form, and nonionic surfactants, silicone polymers, extenders, fragrances, and preservatives within a range that does not impair their effectiveness. , disinfectant, oxidative stabilizer, organic solvent, ionic or non-ionic thickener, emollient, antioxidant, free radical scavenger, opacifier, stabilizer, emollient, silicone, α-hydroxy acid, defoamer, humectant , vitamins, insect repellents, fragrances, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basifying or acidifying agents, or coloring agents.

A suitable dosage of the pharmaceutical composition of the present invention is variously prescribed depending on factors such as formulation method, administration method, age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and reaction sensitivity of the patient. can be The dosage of the pharmaceutical composition of the present invention may be 0.001 to 1000 mg/kg based on an adult.

The pharmaceutical composition of the present invention may be administered orally or parenterally.

The pharmaceutical composition of the present invention may be administered in various dosage forms upon oral administration, and may be administered in the form of solid preparations such as pills, powders, granules, tablets or capsules, and various excipients, for example, wetting agents, It may further include a sweetening agent, a flavoring agent, a preservative, and the like. Specifically, when the composition of the present invention is formulated in powder, granule, tablet or capsule form, it may further include suitable carriers, excipients and diluents commonly used in the preparation thereof. The carrier, excipient and diluent include, for example, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and/or mineral oil may be used, but are not limited thereto. In addition, it may be prepared by including diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc. commonly used for formulation, and may further include a lubricant such as magnesium stearate or talc in addition to the excipients. .

The pharmaceutical composition of the present invention can be administered in various dosage forms when administered parenterally, and solid preparations include tablets, pills, powders, granules, capsules, etc., and liquid preparations include suspensions, internal solutions, emulsions, and syrups. In addition to water, liquid, and paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances, and preservatives may be included. Specifically, formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, and freeze-dried formulations. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. In addition, calcium or vitamin D3 may be added to enhance the efficacy of the therapeutic agent.

Such compositions may be presented in unit-dose (single-dose) or multi-dose (several-dose) containers, such as sealed ampoules and vials, and immediately prior to use in a sterile liquid carrier, e.g., water for injection. can be stored under freeze-drying conditions requiring only the addition of Extemporaneous preparations and suspensions may be prepared from sterile powders, granules and tablets.

The composition for inhibiting inflammation containing okra treated with sous vide has excellent anti-inflammatory and antioxidant effects. can be utilized.

1 is a graph showing the cytotoxicity of sous vide-treated okra extract (SVOE), raw okra extract without pretreatment (ROE), blanching-treated okra extract (BOE), and steaming-treated okra extract (SOE).
Figure 2 shows the inhibition of nitric oxide (NO) production of sous vide-treated okra extract (SVOE), raw okra extract without pretreatment (ROE), blanching-treated okra extract (BOE) and steaming-treated okra extract (SOE) is a graph showing
3 shows (A) raw okra extract without pretreatment (ROE), (B) blanching okra extract (BOE), (C) steamed okra extract (SOE), and (D) sous vide treated okra Western blot results showing the effect of the extract (SVOE) on the expression levels of COX-2 and iNOS proteins.
Figure 4 shows (A) raw okra extract (ROE) without pretreatment, (B) blanching okra extract (BOE), (C) steamed okra extract (SOE) and (D) sous vide treated okra RT-PCR results showing the effect of the extract (SVOE) on the expression levels of iNOS, TNF-α, IL-6 and IL-1β.
Figure 5 shows sous vide-treated okra extract (SVOE), raw okra extract without pretreatment (ROE), blanching-treated okra extract (BOE) and steaming-treated okra extract (SOE) active oxygen (ROS) of okra extract It is a graph showing the erasing ability.

Hereinafter, the present invention will be described in more detail through one or more embodiments. However, these examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited to these examples.

Example 1. Preparation of sous vide-treated okra extract (SVOE)

1-1. Pretreatment of okra

100 g of okra ( Abelmoschus esculentus L. ) (origin: Gangjin, Chungcheongnam-do) with the faucet removed was vacuum-sealed in a polyethylene vacuum sealing bag for food, and after sous vide treatment for 2 minutes at 80 ° C in a bath cooker (Fusion chef, Germany) It was quickly cooled in running water.

1-2. Preparation of Okra Extract

After freeze-drying the okra prepared in Example 1-1 at -75 ° C. to -80 ° C. for 48 hours with a freeze dryer (Ilsin Lab Co., Seoul, Korea), a grinder (Hanil Electric, HMF-3100S, Seoul, Korea) ) and ground down to a standard mesh sieve with 30 mesh to powder. 10 g of okra powder was extracted by stirring with 100 ml of ethanol at 25 ℃ and 150 rpm for 24 hours using a temperature shaker incubator (SI-900R, JEIO TECH, Kimpo, Korea), and then Whatman No. 4 Filtration with filter paper. Extraction was repeated in the same manner by adding 100 ml of ethanol to the residue. The prepared ethanol extract was evaporated to dryness at 40° C. using a rotary eva-porator (NVC-2100, EYELA, Tokyo, Japan), and then dissolved in ethanol at a concentration of 50 mg/ml to prepare an okra extract (SVOE).

Comparative Example 1. Preparation of raw okra extract (ROE)

An okra extract (ROE) was prepared in the same manner as in Example 1-2, using okra that was not subjected to a pretreatment step of heating okra.

Comparative Example 2. Preparation of Blanching Okra Extract (BOE)

100 g of okra with the faucet removed was added to 500 ml of boiling distilled water, blanching for 2 minutes, and then placed in a plastic bag and rapidly cooled in running water for 2 minutes. Thereafter, an okra extract (BOE) was prepared in the same manner as in Example 1-2.

Comparative Example 3. Preparation of steamed okra extract (SOE)

500 ml of distilled water was put into a steam cooker (Tefal, Model S07, Groupe SEB-France), and when the distilled water boiled, 100 g of okra with the faucet removed was added, the lid was covered, and steaming was performed for 2 minutes. Thereafter, an okra extract (SOE) was prepared in the same manner as in Example 1-2.

Example 2. Confirmation of excellent anti-inflammatory effect of okra extract according to MTT assay

2-1. Cell lines and cell culture

3T3-L1 preadipocyte and RAW 264.7 macrophage were sold from Korea Cell line Bank (KCLB: Korea Cell line Bank, Seoul, Korea) to confirm the anti-inflammatory effect of the okra extract prepared in Example 1 and Comparative Examples 1 to 3 was used. DMEM (Dulbecco's modigies Eagle's medium) medium supplemented with 10% FBS (fetal bovine serum) and 1% penicillin-streptomycin (Gibco, Gran Island, NY, USA) was used and cultured at 37 °C and 5% CO ₂ conditions.

2-2. Confirmation of cell safety of okra extract according to toxicity evaluation (MTT assay)

In order to confirm the toxicity of the okra extract prepared in Example 1 and Comparative Examples 1 to 3 to RAW 264.7 cells, 3-(4,5-dimethylthiazol-2-yl)-2,5- according to the method of Green et al. A diphenyltetrazoliumbromide (MTT) assay was performed.

Specifically, RAW264.7 cells were treated with 20, 50, 100 or 200 μg/ml of the okra extract prepared in Example 1 and Comparative Examples 1 to 3, respectively, and cultured for 24 hours. The control group was treated with DMSO 0.1% and incubated for 24 hours in the same manner. Then, a total of 20 μl of MTS(3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) solution was added to each well, and incubated for 1 hour, and absorbance was measured at 490 nm using a microplate reader (SPETRA max 340 PC; Molecular Devices, LLC, Silicon Valley, CA, USA), and the results are shown in Table 1 and FIG. 1 .

okra extract
(μg/ml) Comparative Example 1
(ROE) Comparative Example 2
(BOE) Comparative Example 3
(SOE) Example 1
(SVOE) F-value
( p ) 0 100±4.28 100±3.31 100±1.62 100±2.63 0
(-One) 25 106.55±8.27 ^aA 108.980±4.33 ^aA 103.09±7.26 ^aA 113.3±7.1 ^aAB 1.156
(-0.385) 50 105.76±7.07 ^aA 113.85±9.20 ^aA 107.25±7.89 ^aA 115.55±2.38 ^aB 1.374
(-0.319) 100 101.72±15.39 ^aA 110.58±1.81 ^abA 104.44±1.35 ^abA 118.68±5.60 ^bB 2.488
(-0.135) 200 103.46±13.44 ^abA 118.30±11.32 ^bA 99.01±1.13 ^aA 104.91±3.50 ^abA 2.572
(-0.127) F-value
( p ) 2.02
(-0.932) 2.82
(-0.84) 1.39
(-0.31) 8.54
(0.003) a, b: significance level for each treatment method
A, B: significance level for each concentration
^* : p<0.01

As a result of the measurement, there was no significant difference in cell viability by concentration of each extract, and it was confirmed that there was no cytotoxicity up to 200 μg/ml. In addition, it was found that there was no significant difference between each Example 1 and Comparative Examples 1 to 3.

Through these results, it was confirmed that the okra extract has no cytotoxicity and can be safely applied as a food material.

2-3. Confirmation of excellent NO production inhibitory effect of okra extract according to Griess Reagent System

In order to confirm the NO production inhibitory effect of the okra extract prepared in Example 1 and Comparative Examples 1 to 3, according to the method of the Griess Reagent System, RAW 264.7 cell line was 1 × 10 ⁵ cells/2 ㎖ / well 6 well plate After dispensing and leaving overnight, 20, 50, 100 and 200 μg/ml of the okra extract of Example 1, Comparative Example 1, 2, or 3 was treated with 1 μg/ml of LPS (lipopolysaccharide), an inflammation inducing agent, for 8 hours incubated during Take 100 μl of the cell culture supernatant, mix with 100 μl of Griess reagent, incubate at room temperature for 30 minutes, and measure the absorbance at 540 nm using a microplate reader (SPECTRA max 340PC; Molecular Devices, LLC). 2 and shown in FIG. 2 . Nitrite concentration (μM) was calculated by comparing it with a standard straight line obtained using sodium nitrite (NaNO ₂ ).

okra extract
(μg/ml) Comparative Example 1
(ROE) Comparative Example 2
(BOE) Comparative Example 3
(SOE) Example 1
(SVOE) F-value
( p ) control
200 100.00±2.16
74.86±8.80 100.00±20.55
43.78±1.02 100.00±1.40
47.85±3.04 100.0.490±8
54.26±0.10 LPS+1 264.67±9.57 ^bC 221.36±36.7 ^aC 254.06±0.52 ^{abD 267.52} ±12.82 bD 3.47
(-0.47) LPS+50 206.7±35.3 ^bB 179.0±17.88 ^abB 172.55±8.18 ^aB 200.43±6.83 ^abC 3.611
(-0.58) LPS+100 191.49±8.37 ^bB 182.85±1.53 ^bB 194.63±3.81 ^bC 132.71±15.26 ^aB 43.17 ^***
(0.000) LPS+200 141.34±8.80 ^cA 92.43±1.02 ^aA 112.51±3.04 ^bA 97.56±3.23 ^aA 68.83 ^***
(0.000) F-value
( p ) 35.88 ^**
(0.000) 21.24 ^***
(0.000) 451217 ^***
(0.000) 149.592 ^***
(0.000) ac: significance level for each treatment method
AD: significance level for each concentration
^** : p<0.01
^*** : p<0.001

As a result of the measurement, compared to the control group, the LPS-treated group showed 264.67% of Comparative Example 1, 220.70% of Comparative Example 2, 254.05% of Comparative Example 3, and 267.52% of Example 1 It was confirmed that the inflammatory response by LPS was well induced for each extract. In addition, in the group treated with LPS and okra at the same time, 50 μg/m in Comparative Example 1 (p<0.01), Comparative Example 2 (p<0.000), Comparative Example 3 (p<0.000), Example 1 (p<0.000) The amount of NO production was significantly inhibited in a concentration-dependent manner from the ml treatment group. At a concentration of 200 μg/ml, the inhibition rate of NO production compared to the LPS alone treatment group was 46.6% of Comparative Example 1, 58.12% of Comparative Example 2, 55.71% of Comparative Example 3, and 63.55% of Example 1 okra extract pretreated by the Sous vide treatment method. It was confirmed that the NO production inhibitory effect of Example 1 was excellent, especially in the case of 100 μg/ml concentration and 200 μg/ml concentration, the NO production inhibitory effect of Example 1 was excellent (p<0.000).

Through these results, it was confirmed that the NO production inhibitory effect of the sous vide-treated okra among the okra pre-treated by various methods was particularly excellent.

2-4. Confirmation of anti-inflammatory effect of okra extract according to Western blot

2-4-1. Protein sample preparation

The RAW 264.7 cell line was dispensed in a 6 well plate at 1×10 ⁵ cells/2 ㎖/well, and 20, 50, 100, or 200 μg/ml of the okra extract of Example 1, Comparative Example 1, 2, or 3 was added with an inflammation-inducing agent. Phosphorus LPS (lipopolysaccharide) 1 ㎍ / ㎖ treated and incubated for 8 hours. The control group was incubated for 8 hours without LPS treatment. After washing the cells twice with PBS, modified RIPA buffer (50 mM Tris-Cl (pH 7.4), 150 mM NaCl, 0.1 % sodium dodecyl sulfate (SDS), 0.25 % sodium deoxycholate, 1 % Triton X-100, 1 % Proteins were extracted using Nonidet P-40, 1 mM EDTA, 1 mM EGTA and protease inhibitor cocktail (PIC) (1X)). The cell lysate was centrifuged at 12,074 x g for 20 min at 4 °C, the supernatant was collected and the protein concentration was measured using a bicinconic acid protein assay kit (Thermo Fisher Scientific, Inc., Waltham, MA, Waltham). did.

2-4-2. Western blot analysis

In order to confirm the anti-inflammatory effect of the okra extract prepared in Example 1 and Comparative Examples 1 to 3, the effect of the okra extract on the expression of COX-2 and iNOS proteins, which are factors expressed in the inflammatory response, was confirmed through Western blot. did.

Specifically, 10% polyacrylamide gel electrophoresis (SDS-PAGE) was performed with 30 g of the protein treated in Example 2-4-1. After transferring the isolated protein using PVDF (polyvinylidene difluoride membrane, Milipore, Bedford, MA, USA), 5 in Tis Buffered Saline (TBS) containing 0.1% Tween 20 (TBST) at room temperature for 1 hour % (w/v) skim milk. Membrane overnight at 4 °C with COX-2 antibody (1:2000) (Cayman Chemical, USA), iNOS antibody (1:2000) (Santa Cruz Biotechnology, USA), or actin antibody (1:10,000) (Sigma, USA) overnight was treated, and then detected with anti-goat IgG, anti-mouse IgG, or anti-rabbit IgG bound to horseradish peroxidase for 2 hours at room temperature. Then, the membrane was washed three times with TBST and checked with ECL reagent. The results are shown in FIG. 3 , and actin was used as a control.

As a result of the detection, a significant increase in COX-2 and iNOS protein expression was confirmed in the LPS-treated group, whereas in Examples 1 and Comparative Examples 1 to 3 compared to the control not treated with LPS, COX-2 and iNOS protein expression was decreased in a concentration-dependent manner. was confirmed to be In particular, it was confirmed that the inhibitory effect of COX-2 and iNOS protein expression of Raw 264.7 cells induced by LPS at 200 μg/ml condition of Example 1 was the best.

Through these results, it was confirmed that the anti-inflammatory effect of the sous vide-treated okra among the okra pre-treated by various methods was particularly excellent.

2-5. Confirmation of anti-inflammatory effect of okra extract according to RT-PCR

RT-PCR ( Reverse-Transcription-Polymerase Chain Reaction) was performed.

Total cellular RNA was isolated from RAW 264.7 cells treated with okra extracts of Examples 1 and Comparative Examples 1 to 3 according to the manufacturer's protocol using TRIzol reagent (Thermo Fisher Scientific, Inc., Waltham, MA, USA), followed by RT PCR was performed. Specifically, 8 μl Molony Murine Leu-kemia Virus reverse transcriptase (MLVRT) 5× buffer, 3 μl 10 mM dNTPs, 0.45 μl 40 U/μl RNase inhibitor, 0.3 μl M MLV RT (Promega Corporation), and 3.75 μl 20 μM oligo dT The same amount of total RNA (5 μg) was reverse transcribed in 40 μl of a reaction solution containing (Bioneer Corporation, Oakland, CA, USA). Single-stranded cDNA was prepared with 4 μl 5 Green Go Taq Flexi reaction buffer, 0.4 μM 10 mM dNTPs, 0.1 μl 5 U/μl Taq polymerase, 1.2 μl 25 mM MgCl2 (Promega Corporation) and 0.4 μl primer (20 pM/μl). was amplified by PCR. The primers used are iNOS, TNF-α, IL-6, and IL-1β related to the inflammatory reaction as shown in Table 3, and the results of 30 cycles of RT-PCR under the PCR conditions of Table 4 are shown in FIG. .

primer Primer sequence (5'→3') SEQ ID NO: iNOs forward GACAAGCTGCATGTGACATC SEQ ID NO: 1 reverse GCTGGTAGGTTCCTGTTGTT SEQ ID NO: 2 TNF-α forward GGCAGGTCTACTTTGGAGTCATTGC SEQ ID NO: 3 reverse ACATTCGAGGCTCCAGTGAATTCG SEQ ID NO: 4 IL-6 forward GTCGGAGGCTTAATTACACATGTTC SEQ ID NO: 5 reverse ACTCCTTCTGTGACTCCAGCTTATC SEQ ID NO: 6 IL-1β forward TGCAGAGTTCCCCAACTGGTACATC SEQ ID NO: 7 reverse GTGCTGCCTAATGTCCCCTTGAAT SEQ ID NO: 8

denaturation annealing extension iNOs 95 ℃ 1 min 50 ℃ 1 min 72 ℃ 1 min TNF-α 95 ℃ 30 sec 58 ℃ 1 min 72 ℃ 30 sec IL-6 95 ℃ 30 sec 59 ℃ 1 min 72 ℃ 1 min IL-1β 95 ℃ 30 sec 60 ℃ 1 min 72 ℃ 30 sec β-actin 95 ℃ 30 sec 63 ℃ 1 min 72 ℃ 1 min

In Examples 1 and 1 to 3, the expression levels of iNOS and inflammatory cytokines (TNF-α, IL-6, IL-1β) of each okra extract 200 μg/ml treatment group decreased compared to the control group, whereas the LPS treatment group expressed amount increased significantly. In addition, it was confirmed that the expression of inflammatory cytokines (TNF-α, IL-6, IL-1β) was remarkably inhibited in Example 1 and Comparative Examples 1 to 3 in a concentration-dependent manner, and iNOS mRNA induced by LPS of Example 1 It was found that the expression inhibitory effect was the best.

Through these results, it was confirmed that the anti-inflammatory effect of the sous vide-treated okra among okra pre-treated by various methods was particularly excellent.

Example 3. Confirmation of antioxidant effect of okra extract according to measurement of free radical scavenging ability

In order to check the effect of the okra extract of Example 1 and Comparative Examples 1 to 3 on the generation of reactive oxygen species (ROS) in cells, the RAW 264.7 cell line was added to a 96 well plate at a concentration of 2.4 × 10 ⁴ cells/well. After aliquoting and leaving overnight, incubated with CM-H2DCFDA (10 μM, Abcam, Cambridge, MA, USA) solution at 37° C. for 30 minutes. After removing the CM-H2DCFDA solution, the cells were washed with phosphate buffered saline (PBS), and the okra extracts of Examples 1 and Comparative Examples 1 to 3 were treated with H ₂ O ₂ (200 μM) for 30 minutes, and the control group was DMSO ( 0.1 %). The fluorescence intensity of DCF was quantified at 488 nm and 520 nm, respectively, using Victor3 (Perkin Elmer, CT, USA).

okra extract
(μg/ml) Comparative Example 1 Comparative Example 2 Comparative Example 3 Example 1 F-value
( p ) control
200 100±2.00
76.17±5.52 76.17±5.64
88.07±5.20 100.00±8.83
81.3±12.08 100±4.56
88.02±8.40 H ₂ O ₂ (200 uM) 531.38± ^{50.87 abA} 514.25±60.19 ^aC 605.85±21.83 ^bcC 628.35±32.93 ^cC 5.680 ^*
(0.016) H ₂ O ₂ +50 433.61±8.98 ^aB 423.36±19.30 ^{aB 679.68} ±44.7 bD 531.30±14.04 ^cB 80.059 ^***
(0.000) H ₂ O ₂ +100 420.81±9.65 ^aB 440.67±31.06 ^aB 526.33±22.52 ^bB 535.43±14.72 ^bB 32.174 ^***
(0.000) H ₂ O ₂ +200 423.00±20.84 ^bB 333.35±29.36 ^aA 463.77±2.82 ^cA 329.29±19.79 ^aA 35.408 ^***
(0.000) F-value
( p ) 44.23 ^***
(0.000) 11.39 ^**
(0.000) 35.43 ^***
(0.000) 280.56 ^***
(0.000) ac: significance level for each treatment method
AD: significance level for each concentration
^* : p<0.05
^*** : p<0.001

As can be seen in Table 5 and Figure 5, the H ₂ O ₂ treatment group was strongly induced to generate ROS, Comparative Example 1 531.387%, Comparative Example 2 514.25%, Comparative Example 3 605.85%, Examples at 0 ㎍ / ㎖ condition 1 The level of ROS production increased to 628.35%. In addition, H ₂ O ₂ and the okra extract treated group was H ₂ in Comparative Example 1 ( p <0.000), Comparative Example 2 (p <0.005), Comparative Example 3 (p < 0.000) and Example 1 (p < 0.000). Compared to the group not treated with O ₂ , ROS production was significantly lower in a concentration-dependent manner. Specifically, compared to the group treated with H ₂ O ₂ alone at a concentration of 200 μg/ml, Comparative Example 1 20.40%, Comparative Example 2 35.18%, Comparative Example 3 23.45%, Example 1 47.60% ROS production amount in all treatment methods It was confirmed that this was reduced, and in particular, Example 1 showed the highest reduction rate, confirming that the antioxidant effect was excellent.

Through these results, it was confirmed that the antioxidant effect of the sous vide-treated okra among okra pre-treated by various methods was particularly excellent.

Up to now, the present invention has been looked at focusing on the embodiments thereof. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within an equivalent scope should be construed as being included in the present invention.

<110> Sookmyung Women's university industry-academic cooperation foundation <120> Composition for Inhibiting Inflammation containing Sous Vide-treated Okra <130> SP21-0026KR <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOs_forward <400> 1 gacaagctgc atgtgacatc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> iNOs_reverse <400> 2 gctggtaggt tcctgttgtt 20 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TNF-a_forward <400> 3 actccttctg tgactccagc ttatc 25 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TNF-a_reverse <400> 4 acattcgagg ctccagtgaa ttcg 24 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-6_forward <400> 5 gtcggaggct taattacaca tgttc 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-6_reverse <400> 6 actccttctg tgactccagc ttatc 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IL-1b_forward <400> 7 tgcagagttc cccaactggt acatc 25 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> IL-1b_reverse <400> 8 gtgctgccta atgtcccctt gaat 24

Claims (7)

Okra ( Abelmoschus esculentus L. ) A composition for inhibiting inflammation comprising an extract.
According to claim 1,
The extract is a composition for inhibiting inflammation that is extracted with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, and mixtures thereof.
The method of claim 1,
The composition for inhibiting inflammation that the okra is pre-treated for 100 to 140 seconds at 70 ℃ to 90 ℃.
The method of claim 1,
The composition is a powder, granules, tablets, capsules or liquid formulations, the composition for inhibiting inflammation.
A cosmetic composition comprising the composition of claim 1 .
A food composition comprising the composition of claim 1 .
A pharmaceutical composition comprising the composition of claim 1 .

Images