KR102529008B1 - Composition for Nucleic Acid Extraction and Method for Extracting Nucleic Acid Using the Same - Google Patents

Abstract

The present invention is a composition for nucleic acid purification or nucleic acid extraction comprising distilled water, sodium hydroxide and CHAPS; A kit for nucleic acid purification or nucleic acid extraction comprising the composition; a nucleic acid purification or nucleic acid extraction method using the composition; a kit for detecting bacteria comprising the composition; And it relates to a method for detecting bacteria using the composition.
When using the composition for nucleic acid purification or nucleic acid extraction comprising distilled water, sodium hydroxide and CHAPS according to the present invention, it was confirmed that the nucleic acid extraction step was simplified and nucleic acids from food poisoning bacteria could be extracted at low cost and in a short time. In addition, it was confirmed that the nucleic acid extraction sensitivity was excellent and that even low concentrations of bacteria could be extracted or detected. That is, the composition containing distilled water, sodium hydroxide and CHAPS can be used not only for nucleic acid purification or nucleic acid extraction, but also for food quality control through rapid detection of food poisoning bacteria.

Description

Composition for extracting nucleic acid and method for extracting nucleic acid using the same {Composition for Nucleic Acid Extraction and Method for Extracting Nucleic Acid Using the Same}

The present invention is a composition for nucleic acid purification or nucleic acid extraction containing distilled water, sodium hydroxide (NaOH) and CHAPS; A kit for nucleic acid purification or nucleic acid extraction comprising the composition; a nucleic acid purification or nucleic acid extraction method using the composition; a kit for detecting bacteria comprising the composition; And it relates to a method for detecting bacteria using the composition.

Food poisoning refers to any infectious or toxin-type disease suspected to be caused by microorganisms or toxins produced by microorganisms harmful to the human body associated with the intake of food. It is a disease accompanied by symptoms such as fever, nausea, vomiting, diarrhea and abdominal pain, and most of them are bacterial food poisoning caused by bacteria. Bacterial food poisoning varies in incubation period and symptoms depending on the bacteria, but can be largely divided into toxin-type and infectious-type. Toxin-type food poisoning is food poisoning caused by ingestion of toxins produced by bacteria growing in food, and causative bacteria of toxin-type food poisoning include Staphylococcus aureus , Clostridium botulinum , and the like. Infectious food poisoning is food poisoning caused by eating food contaminated with bacteria, and Salmonella spp, Vibrio parahaemolyticus , and Escherichia coli O157:H7 are the main causative bacteria.

Most food poisoning bacteria proliferate at a temperature between 4℃ and 60℃, and the propagation rate of food poisoning bacteria varies from bacteria to bacteria, but most of them reproduce the fastest around 35~36℃. In the case of Vibrio enteritis, one bacterium can multiply to 2 after 10 minutes and to 1 million or more after 4 hours.

The number of bacteria required for food poisoning varies depending on the type of bacteria, but is usually known to be 10 ⁵ to 10 ⁸ CFU / g or more, but microorganisms such as Escherichia coli O157: H7 or Listeria monocytogenes ( Listeria monocytogenes ) are several or 10 to 10 It is known that only 1000 germs can cause food poisoning in humans.

Accordingly, in order to prevent food poisoning, as technology for early detection of food poisoning bacteria is required, various molecular biological methods and kits for detecting food poisoning bacteria from samples such as food have been developed. However, Gram-positive bacteria, such as Listeria monocytogenes , Staphylococcus aureus , Bacillus cereus , and Clostridium perfringens , have more cell walls than Gram-negative bacteria. It is difficult to extract nucleic acids due to the thick peptidoglycan layer.

In addition, conventionally, a method using phenol and chloroform has been used to extract bacterial nucleic acids, and recently, a silica adsorption method in which nucleic acids are bound to a silica resin is also widely used. However, existing commercially available nucleic acid extraction methods and kits use enzymes, so they must be performed under conditions of optimal activity temperature and time for enzymes, and the cost required for nucleic acid extraction is also high.

Under this background, the present inventors have tried to develop a nucleic acid extraction method that can overcome the time and economic disadvantages of existing nucleic acid extraction methods. The present invention has been completed by confirming that nucleic acids of food poisoning bacteria can be extracted at low cost and in a short time, and the nucleic acid extraction sensitivity is excellent, so that even low concentrations of bacteria can be extracted or detected.

Republic of Korea Patent Registration No. 10-2065620

The present invention aims to solve the above problems and other problems related thereto.

One exemplary object of the present invention is to provide a composition for nucleic acid purification or nucleic acid extraction containing distilled water, sodium hydroxide and CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate).

Another exemplary object of the present invention is to provide a kit for nucleic acid purification or nucleic acid extraction comprising the composition.

Another exemplary object of the present invention is to provide a nucleic acid purification or nucleic acid extraction method using the composition.

Another exemplary object of the present invention is to provide a kit for detecting bacteria including the composition.

Another exemplary object of the present invention is to provide a method for detecting bacteria using the composition.

The technical problem to be achieved according to the technical idea of the invention disclosed in this specification is not limited to the problem to solve the problems mentioned above, and another problem not mentioned can be clearly understood by those skilled in the art from the following description. There will be.

A detailed description of this is as follows. Meanwhile, each description and embodiment disclosed in this application may also be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application is not to be construed as being limited by the specific descriptions described below.

As one aspect for achieving the above object, the present invention provides a composition for nucleic acid purification or nucleic acid extraction containing distilled water, sodium hydroxide and CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate).

The term "nucleic acid purification" of the present invention refers to removing impurities contained in a sample (eg, food, etc.) in addition to nucleic acids by various methods such as precipitation.

The term "nucleic acid extraction" of the present invention refers to separating nucleic acids included in a sample so as to facilitate amplification, which may be performed by cell lysis or removal of impurities such as proteins.

In the present invention, the composition may include 0.5% CHAPS and 0.05N NaOH. In addition, the distilled water, sodium hydroxide, and CHAPS may be mixed in a volume ratio of 180 to 200: 1 to 20: 0.5 to 10, or 190: 10: 1, but is not limited thereto.

In the present invention, the nucleic acid may be a nucleic acid derived from bacteria, and the bacteria may be Gram-positive bacteria. Specifically, the Gram-positive bacteria may be food poisoning bacteria, for example, Listeria monocytogenes , Staphylococcus aureus, Bacillus cereus , or Clostridium perfringens ), but is not limited thereto.

In the present invention, the concentration of the bacteria may be a low concentration of 1 Log CFU / mL to 2 Log CFU / mL, but is not limited thereto.

In the present invention, the composition may be a cell membrane lysis buffer for nucleic acid extraction.

In the present invention, distilled water was used as a kind of solution for dissolving the solute instead of using a buffer solution such as PBS or Tris-HCl, which is generally used for dissolving cell membranes, in consideration of economic feasibility. The composition according to the present invention dissolves cell membranes and dissolves nucleic acids only with a buffer solution such as PBS or Tris-HCl, or a combination of CHAPS, NaOH, and distilled water that does not contain chlorine (Cl), potassium (K), or phosphate (PO ₄ ) components. can be extracted.

In the present invention, CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) is known as a surfactant, but as confirmed in Experimental Example 1, it was found that nucleic acid was not extracted with CHAPS alone.

Using the composition for purifying or extracting nucleic acids according to the present invention, purification or extraction of bacterial (e.g., food poisoning bacteria) nucleic acid with high sensitivity from a sample containing low concentrations of bacteria at the level of 1 Log CFU/mL or 2 Log CFU/mL It is possible, and it is possible to purify or extract nucleic acids simply and quickly at low cost even in the field.

As another aspect for achieving the above object, the present invention provides a nucleic acid purification or nucleic acid extraction kit comprising the composition for nucleic acid purification or nucleic acid extraction.

The terms "nucleic acid purification" and "nucleic acid extraction" of the present invention are as described above.

In addition to the composition for nucleic acid purification or nucleic acid extraction according to the present invention, the kit for purifying or extracting nucleic acids of the present invention may further include reagents generally used for purifying or extracting nucleic acids in the art.

As another aspect for achieving the above object, the present invention comprises the steps of (a) centrifuging a sample to obtain a pellet (pellet); (b) mixing the nucleic acid purification or nucleic acid extraction composition with the pellet; (c) heating the mixture; and (d) cooling the heated mixture and centrifuging to obtain a supernatant.

The terms "nucleic acid purification" and "nucleic acid extraction" of the present invention are as described above.

In the present invention, the sample is suspected of having bacteria and may be various food groups, or may be food, water, agricultural products, aquatic products, livestock products, fruits, vegetables, human-derived biological samples such as saliva of animals, etc. It is not limited.

In the present invention, the nucleic acid may be a nucleic acid derived from bacteria, and the bacteria may be Gram-positive bacteria. Specifically, the Gram-positive bacteria may be food poisoning bacteria, for example, Listeria monocytogenes , Staphylococcus aureus, Bacillus cereus , or Clostridium perfringens ), but is not limited thereto.

In the present invention, the concentration of the bacteria may be a low concentration of 1 Log CFU / mL to 2 Log CFU / mL, but is not limited thereto.

The heating step may be performed in a microwave oven for 5 seconds to 1 minute, 10 seconds to 30 seconds, or 20 seconds, but is not limited thereto. In addition, a microwave oven of 700W to 2,000W or a microwave oven of 1,100W may be used, but is not limited thereto.

The heating step may be heating to 60 to 80 ° C, specifically 70 to 75 ° C, but is not limited thereto. The heating step may be performed using a water bath or a heating block in addition to a microwave oven.

The heated mixture may be cooled at room temperature for 1 minute to 5 minutes, specifically 2 minutes, but is not limited thereto.

According to the method of the present invention, it is possible to purify or detect bacterial (e.g., food poisoning bacteria) nucleic acid with high sensitivity from a sample containing low-concentration bacteria at the level of 1 Log CFU/mL or 2 Log CFU/mL, and at low cost in the field. Nucleic acids can be purified or extracted simply and quickly.

As another aspect for achieving the above object, the present invention provides a kit for detecting bacteria including the composition for nucleic acid purification or nucleic acid extraction.

Since the composition for purifying nucleic acids or extracting nucleic acids according to the present invention can be used to remove impurities contained in a sample and extract nucleic acids from bacteria, the nucleic acid amplification efficiency of bacteria present in the sample is excellent and can be usefully used for detecting bacteria. there is.

The kit for detecting nucleic acids of the present invention may further include, in addition to the composition for purifying nucleic acids or extracting nucleic acids according to the present invention, primer sets and reagents generally used for amplification of nucleic acids in the art.

As another aspect for achieving the above object, the present invention comprises the steps of (a) centrifuging a sample to obtain a pellet (pellet); (b) mixing the nucleic acid purification or nucleic acid extraction composition with the pellet; (c) heating the mixture; (d) cooling the heated mixture and centrifuging to obtain a supernatant; and (e) detecting nucleic acids in the obtained supernatant.

According to the above method, since the pretreatment of the sample and the amplification of bacterial nucleic acid can be performed at once, bacteria present in the sample can be detected quickly and simply.

In the present invention, the bacteria may be Gram-positive bacteria. Specifically, the Gram-positive bacteria may be food poisoning bacteria, for example, Listeria monocytogenes , Staphylococcus aureus, Bacillus cereus , or Clostridium perfringens ), but is not limited thereto.

In the present invention, the concentration of the bacteria may be a low concentration of 1 Log CFU / mL to 2 Log CFU / mL, but is not limited thereto.

Detection of step (e) is polymerase chain reaction (Polymerase Chain Reaction; 　PCR), reverse transcription-polymerase chain reaction (RT-PCR), nested polymerase chain reaction (N-PCR; nested 　PCR), multiple polymerase It may be by multiplex-PCR, real-time polymerase chain reaction (real-time PCR) or loop-mediated isothermal amplification (　LAMP), but is not limited thereto.

Specifically, the step of detecting the nucleic acid may be performed by a PCR method. In this case, a nucleic acid amplification reaction may be performed using a primer set and reagents commonly used in PCR reactions in the art, for example, dNTP and polymerases such as Taq and Q5, etc. to detect nucleic acids.

According to the method of the present invention, bacteria (for example, food poisoning bacteria) can be detected with high sensitivity from a sample containing low-concentration bacteria at the level of 1 Log CFU/mL or 2 Log CFU/mL, and it is possible to detect bacteria (e.g., food poisoning bacteria) easily and quickly at a low cost even in the field. bacteria can be detected.

Representative methods/kits for extracting nucleic acid from Gram-positive bacteria include Qiagen Kit, TaKaRa Kit, Promega Kit, and SDS+NaOH combination. Existing commercialized kits have the disadvantages of requiring a lot of time due to complicated procedures, high price per sample, and many necessary equipment. However, if the composition for purifying or extracting nucleic acid according to the present invention containing purified water, NaOH, and CHAPS is used, nucleic acid can be extracted efficiently in a short time due to a simple procedure, and the cost is low.

In particular, when using the nucleic acid purification or extraction composition according to the present invention, nucleic acid extraction is possible even from Gram-positive bacteria at a concentration of 1 Log CFU/mL, unlike the case of using methods such as 0.25% SDS and 0.05N NaOH. Sensitivity can be used to detect bacteria and prevent diseases caused by them.

When using the nucleic acid purification or nucleic acid extraction composition containing distilled water, NaOH and CHAPS according to the present invention, it was confirmed that the nucleic acid extraction step was simplified and nucleic acids from food poisoning bacteria could be extracted at low cost and in a short time. In addition, it was confirmed that the nucleic acid extraction sensitivity was excellent and that even low concentrations of bacteria could be extracted or detected. That is, the composition containing distilled water, NaOH and CHAPS can be used not only for nucleic acid purification or nucleic acid extraction, but also for food quality control through rapid detection of food poisoning bacteria.

However, effects according to one embodiment of the technology disclosed in this specification are not limited to those mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

In order to more fully understand the drawings cited herein, a brief description of each drawing is provided.
1 is a result of confirming whether nucleic acid was extracted by applying 5 types of nucleic acid extraction methods to Listeria monocytogenes ( L. monocytogenes ). (PC: positive control, NC: negative control, Q: Qiagen Kit, T: TaKaRa Kit, P: Promega Kit, S+N: SDS+NaOH, D+C+N: DW+CHAPS+NaOH)
2 is a result of confirming whether nucleic acid was extracted using CHAPS alone for Listeria monocytogenes. (PC: positive control, NC: negative control, D+C: DW+CHAPS)
Figure 3 is a result of confirming whether nucleic acids were extracted by applying five nucleic acid extraction methods to Staphylococcus aureus ( S. aureus ). (PC: positive control, NC: negative control, Q: Qiagen Kit, T: TaKaRa Kit, P: Promega Kit, S+N: SDS+NaOH, D+C+N: DW+CHAPS+NaOH)
Figure 4 is the result of confirming whether nucleic acid was extracted using only CHAPS alone for Staphylococcus aureus. (PC: positive control, NC: negative control, D+C: DW+CHAPS)
Figure 5 is a result of confirming whether nucleic acids were extracted by applying 5 types of nucleic acid extraction methods to Bacillus cereus ( B. cereus ). (PC: positive control, NC: negative control, Q: Qiagen Kit, T: TaKaRa Kit, P: Promega Kit, S+N: SDS+NaOH, D+C+N: DW+CHAPS+NaOH)
Figure 6 is a result of confirming whether nucleic acid was extracted by applying five nucleic acid extraction methods to Clostridium perfringens ( C. perfringens ). (PC: positive control, NC: negative control, Q: Qiagen Kit, T: TaKaRa Kit, P: Promega Kit, S+N: SDS+NaOH, D+C+N: DW+CHAPS+NaOH)
7 is a result of confirming whether nucleic acid was extracted using only CHAPS alone for Clostridium perfringens. (PC: positive control, NC: negative control, D+C: DW+CHAPS)
8 is a result of comparing the sensitivity of each nucleic acid extraction method to a low concentration of Listeria monocytogenes. (PC: positive control, NC: negative control, Q: Qiagen Kit, D+C+N: DW+CHAPS+NaOH)
9 is a result of comparing the sensitivity of each nucleic acid extraction method for low-concentration Staphylococcus aureus. (PC: positive control, NC: negative control, S+N: SDS+NaOH, D+C+N: DW+CHAPS+NaOH)
10 is a result of comparing the sensitivity of each nucleic acid extraction method for a low concentration of Bacillus cereus. (PC: positive control, NC: negative control, S+N: SDS+NaOH, D+C+N: DW+CHAPS+NaOH)
11 is a result of comparing the sensitivity of each nucleic acid extraction method for a low concentration of Clostridium perfringens. (PC: positive control, NC: negative control, Q: Qiagen Kit, D+C+N: DW+CHAPS+NaOH)
12 is a result of confirming whether nucleic acid was extracted by applying the nucleic acid extraction method according to the present invention to E. coli . (PC: positive control, NC: negative control, D+C+N: DW+CHAPS+NaOH)
13 is a result of confirming whether nucleic acid was extracted by applying the nucleic acid extraction method according to the present invention to Salmonella spp . (PC: positive control, NC: negative control, D+C+N: DW+CHAPS+NaOH)

Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to illustrate the present invention by way of example, and the scope of the present invention is not limited only to these examples.

Example 1: Preparation of composition for nucleic acid purification or nucleic acid extraction according to the present invention

A composition for nucleic acid purification or nucleic acid extraction according to the present invention was prepared by mixing 3.8 mL of distilled water, 0.02 g of 0.5% CHAPS (density: 1.01 g/mL), and 0.2 mL of 0.05 N NaOH.

Example 2: Preparation of test bacterial solution

Example 2-1: Listeria monocytogenes ( L. monocytogenes ) Bacterial solution preparation

A bacterial solution was prepared by mixing L. monocytogenes ATCC 13932, ATCC 51774 and ATCC BAA-839 strains. In order to confirm nucleic acid extraction, a bacterial solution diluted to 3 Log CFU/mL was prepared, and to confirm sensitivity, a bacterial solution diluted to 1 Log CFU/mL was prepared.

Example 2-2: Staphylococcus aureus ( S. aureus ) Bacterial solution preparation

A bacterial solution was prepared by mixing S. aureus ATCC 13565, ATCC 14458, ATCC 23235 and ATCC 27664 strains. In order to confirm nucleic acid extraction, a bacterial solution diluted to 3 Log CFU/mL was prepared, and to confirm sensitivity, a bacterial solution diluted to 1 Log CFU/mL was prepared.

Example 2-3: Bacillus cereus ( B. cereus ) Bacterial solution preparation

B. cereus KCTC 1013, KCTC 1094 and KCTC 3624 strains were mixed to prepare a bacterial solution. In order to confirm nucleic acid extraction, a bacterial solution diluted to 3 Log CFU/mL was prepared, and to confirm sensitivity, a bacterial solution diluted to 1 Log CFU/mL was prepared.

Example 2-4: Clostridium perfringens ( C. perfringens ) Bacterial solution preparation

A bacterial solution was prepared by mixing C. perfringens KCCM 10976, KCCM 12098, KCCM 40946 and KCCM 40947 strains. In order to confirm nucleic acid extraction, a bacterial solution diluted to 3 Log CFU/mL was prepared, and to confirm sensitivity, a bacterial solution diluted to 1 Log CFU/mL was prepared.

Example 2-5: Escherichia coli ( E. coli ) Bacterial solution preparation

E. coli KCTC 2615 and KCTC 2643 strains were mixed, and a bacterial solution diluted to 3 Log CFU/mL was prepared to confirm nucleic acid extraction.

Example 2-6: Salmonella ( Salmonella spp. ) Bacterial solution preparation

Salmonella Agona ( Salmonella agona ) NCCP12231; Salmonella enteritidis ( Salmonella enteritidis ) NCCP 12236, NCCP 12243 and NCCP 12244; And Salmonella Montevideo ( Salmonella Montevideo ) NCCP 10140 strain was mixed, and a bacterial solution diluted to 3 Log CFU / mL was prepared to check whether nucleic acid was extracted.

Example 3: Nucleic Acid Extraction

Example 3-1: Use of Qiagen DNeasy Blood & Tissue Kit

Nucleic acids were extracted according to the instructions for use of the Qiagen DNeasy Blood & Tissue Kit as follows.

1) Put 1 mL of bacterial solution in an e-tube, centrifuge (7,500 rpm, 10 minutes), and extract the pellet.

2) Suspend the pellet with 180 μL of Enzymatic lysis buffer (20 mM Tris-Cl pH 8.0, 2 mM sodium EDTA, 1.2% Triton X-100, lysozyme 20 mg/mL).

3) Incubate at 37℃ for 30 minutes.

4) Add 20 μL of proteinase K and 200 μL of AL buffer and vortex.

5) Incubate for 30 minutes in a 56℃ heat block.

6) Add 200 μL of 99% ethanol and vortex vigorously.

7) Insert the DNeasy minispin column into a 2 mL collection tube and transfer the mixture from ⑥ to the column. Discard the flow-through and collection tube after centrifugation (6,000 × g, 1 min).

8) Insert the DNeasy minispin column into a new collection tube, add 500 μL of AW1 buffer, centrifuge (6,000×g, 1 minute), and discard the flow-through and collection tube.

9) Insert the DNeasy minispin column into a new collection tube, add 500 μL of AW2 buffer, centrifuge (20,000×g, 3 minutes), and discard the flow-through and collection tube.

10) Insert the column into the e-tube and pour 200 μL of AE buffer directly onto the column membrane. After incubation at room temperature for 1 minute, centrifugation (6,000 × g, 1 minute) is performed to obtain template DNA.

Example 3-2: Using TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit

Nucleic acids were extracted according to the instructions for use of the TaKaRa MiniBEST Bacterial Genomic DNA Extraction Kit as shown below.

1) Put 1 mL of bacterial solution in an e-tube, centrifuge (12,000 rpm, 2 minutes), and extract the pellet.

2) After suspending the pellet with 500 μL of buffer BS and 50 μL of lysozyme (20 mg/mL), react at 37 ^° C for 1 hour.

3) Discard the supernatant after centrifugation (12,000 rpm, 5 minutes).

4) After suspending the pellet with 180 μL of buffer GL, 20 μL of proteinase K, and 10 μL of RNase A (10 mg/mL), react at 56°C for 10 minutes.

5) Suspend by adding 200 μL of Buffer GB and 200 μL of 99% ethanol.

6) Insert the spin column into the collection tube, transfer the mixture of ⑤ to the column, centrifuge (12,000 rpm, 2 minutes), and discard the flow-through.

7) Add 500 μL of buffer WA to the column, centrifuge (12,000 rpm, 1 minute), and discard the flow-through.

8) Add 700 μL of Buffer WB to the column while washing the wall to remove any remaining salt. After centrifugation (12,000 rpm, 1 min), the flow-through is discarded.

9) Repeat step 8) one more time.

10) Insert the column into the collection tube and centrifuge (12,000 rpm, 2 minutes).

11) Insert the column into a new e-tube, put 50 μL of elution buffer directly into the center of the membrane, and react at room temperature for 5 minutes.

12) Extract the template DNA by centrifugation (12,000 rpm, 2 minutes).

Example 3-3: Use of Promega Wiziard Genomic DNA Purification Kit

Nucleic acids were extracted according to the instruction manual of the Promega Wiziard Genomic DNA Purification Kit as follows.

1) Put 1 mL of bacterial solution in an e-tube, centrifuge (13,000×g, 2 minutes), and extract the pellet.

2) Suspend the pellet with 480 μL of 50 mM EDTA.

3) Add 120 μL of lysozyme.

4) Incubate at 37℃ for 30 minutes.

5) Discard the supernatant after centrifugation (13,000×g, 2 minutes).

6) Add 600 μL of Nuclei lysis solution and pipette.

7) After incubation at 80℃ for 5 minutes, cool at room temperature.

8) Add 3 μL of RNase solution, mix, incubate at 37℃ for 40 minutes, and cool at room temperature.

9) Add 200 μL of protein precipitation solution and vortex.

10) Incubate on ice for 5 minutes.

11) Centrifuge (13,000×g, 3 minutes).

12) Transfer the supernatant to an e-tube containing 600 μL of isopropanol and mix.

13) After centrifugation (13,000×g, 2 minutes), discard the supernatant.

14) Add 600 μL of 70% ethanol.

15) Centrifuge (13,000 × g, 2 minutes).

16) Discard the ethanol and air-dry the pellet for 10 minutes.

17) Add 100 μL of rehydration solution to the DNA pellet, react at 65°C for 1 hour, and use this as template DNA.

Example 3-4: Using 0.25% SDS and 0.05 N NaOH

1) Put 1 mL of bacterial solution in an e-tube, centrifuge (13,000×g, 10 minutes), and extract the pellet.

2) Suspend the pellet in 50 μL of a mixture of 0.25% SDS, 0.05 N NaOH and sterile distilled water.

3) Add 100 μL of sterile distilled water.

4) Heat 3) in a 99℃ heat block for 15 minutes.

5) After cooling at room temperature for 2 minutes, and centrifugation (13,000×g, 10 minutes), the obtained supernatant is used as template DNA.

Example 3-5: Use of dissolution buffer according to the present invention comprising distilled water, NaOH and CHAPS

1) Put 1 mL of bacterial solution in an e-tube, centrifuge (13,000×g, 10 minutes), and extract the pellet.

2) Suspend the pellet with 1 mL of dissolution buffer containing distilled water, NaOH and CHAPS.

3) Put the e-tube containing the suspension in a microwave oven (1,100 W) and heat it for 20 seconds.

4) After cooling at room temperature for 2 minutes, centrifugation (13,000×g, 10 minutes) and the obtained supernatant is used as template DNA.

Experimental Example 1: Confirmation of Bacterial Nucleic Acid Extraction

Listeria monocytogenes by the method according to Example 3 ( L. monocytogenes ), Staphylococcus aureus ( S. aureus ), Bacillus cereus ( B. cereus ) and Clostridium perfringens ( C. perfringens ) nucleic acids It was confirmed whether it could be extracted.

Experimental Example 1-1: Listeria monocytogenes ( L. monocytogenes ) Confirmation of nucleic acid extraction

For each nucleic acid extraction method according to Example 3, the effect of extracting 3 Log CFU/mL of Listeria monocytogenes nucleic acid was confirmed through PCR and electrophoresis. The PCR conditions and primer sequences used are shown in Tables 1 and 2 below.

PCR cycle temperature hour early degeneration 94℃ 4 minutes denaturalization 94℃ 30 seconds 40 cycles annealing 60℃ 45 seconds height 72℃ 1 min final height 72℃ 5 minutes

gene Sequence (5’to 3’) sequence number Size (bp) reference prf A Forward CAATGGGATCCACAAGAATA One 186 Klein and JuneJa, 1997 Reverse AGCCTGCTCGCTAATGACTT 2

As a result, as shown in FIG. 1, when extracting L. monocytogenes nucleic acid with the mixed composition (D+C+N) of distilled water, 0.5% CHAPS, and 0.05N NaOH according to the present invention, it is superior to or better than the existing kit. It was confirmed that nucleic acids were extracted at a similar level.

In addition, using the method of Example 3-5, but using only CHAPS as a dissolution buffer, PCR and electrophoresis confirmed whether Listeria monocytogenes nucleic acid was extracted. As a result, as shown in FIG. 2, nucleic acid was not extracted. appeared not to

Experimental Example 1-2: Staphylococcus aureus ( S. aureus ) Confirmation of nucleic acid extraction

For each nucleic acid extraction method according to Example 3, the effect of 3 Log CFU/mL of Staphylococcus aureus nucleic acid extraction was confirmed through PCR and electrophoresis. The PCR conditions and primer sequences used are shown in Tables 3 and 4 below.

PCR cycle temperature hour denaturalization 94℃ 1 min 37 cycles annealing 55℃ 30 seconds height 72℃ 1 minute 30 seconds final height 72℃ 3 minutes 30 seconds

gene Sequence (5’to 3’) sequence number Size (bp) reference nuc A Forward GCGATTGATGGTGATACGGTT 3 267 Alni et al., 2020 Reverse AGCCAAGCCTTGACGAACTAAAGC 4

As a result, as shown in FIG. 3, when extracting S. aureus nucleic acid with the composition (D+C+N) in which distilled water, 0.5% CHAPS, and 0.05N NaOH are mixed according to the present invention, it is superior or better than the existing kit. It was confirmed that nucleic acids were extracted at a similar level.

In addition, using the method of Example 3-5, but using only CHAPS as a lysis buffer, PCR and electrophoresis confirmed whether or not Staphylococcus aureus nucleic acid was extracted. As a result, as shown in FIG. 4, nucleic acid was not extracted. appeared to be

Experimental Example 1-3: Bacillus cereus ( B. cereus ) Confirmation of nucleic acid extraction

For each nucleic acid extraction method according to Example 3, the effect of extracting 3 Log CFU/mL of Bacillus cereus nucleic acid was confirmed through PCR and electrophoresis. The PCR conditions and primer sequences used are shown in Tables 5 and 6 below.

PCR cycle temperature hour early degeneration 94℃ 2 minutes denaturalization 94℃ 1 min 35 cycles annealing 55℃ 1 min height 72℃ 2 minutes final height 72℃ 5 minutes

gene Sequence (5’to 3’) sequence number Size (bp) reference bce T Forward CGTATCGGTCGTTCACTCGG 5 661 Ministry of Food and Drug Safety, 2019 Reverse GTTGATTTCCGTAGCCTGGG 6

As a result, as shown in FIG. 5, when extracting B. cereus nucleic acid with the composition (D+C+N) in which distilled water, 0.5% CHAPS and 0.05N NaOH are mixed according to the present invention, it is superior or better than the existing kit. It was confirmed that nucleic acids were extracted at a similar level.

Experimental Example 1-4: Clostridium perfringens ( C. perfringens ) Confirmation of nucleic acid extraction

For each nucleic acid extraction method according to Example 3, the effect of extracting 3 Log CFU/mL Clostridium perfringens nucleic acid was confirmed through PCR and electrophoresis. The PCR conditions and primer sequences used are shown in Tables 7 and 8 below.

PCR cycle temperature hour early degeneration 94℃ 3 minutes denaturalization 94℃ 1 min 35 cycles annealing 53℃ 1 min height 72℃ 1 min final height 72℃ 10 minutes

gene Sequence (5’to 3’) sequence number Size (bp) reference cpb Forward GCGAATATGCTGAATCATCTA 7 196 Moller and Ahrens, 1996 Reverse GCAGGAACATTAGTATATCTTC 8

As a result, as shown in FIG. 6, when B. cereus nucleic acid is extracted with the composition (D+C+N) in which distilled water, 0.5% CHAPS and 0.05N NaOH are mixed according to the present invention, it is superior or better than the existing kit. It was confirmed that nucleic acids were extracted at a similar level.

In addition, using the method of Example 3-5, but using only CHAPS as a lysis buffer, PCR and electrophoresis confirmed whether Clostridium perfringens nucleic acid was extracted, as shown in FIG. 7, nucleic acid It turned out not to be extracted.

Experimental Example 2: Verification of nucleic acid extraction sensitivity for Gram-positive bacteria

Experimental Example 2-1: Listeria monocytogenes ( L. monocytogenes ) Confirmation of the sensitivity of the nucleic acid extraction method for

The nucleic acid of the L. monocytogenes bacterial solution diluted to a concentration of 1 Log CFU/mL with the Qiagen DNeasy Blood & Tissue Kit (Q) according to Example 3 and the composition for nucleic acid purification or nucleic acid extraction (D+C+N) according to the present invention The sensitivity of each nucleic acid extraction method was confirmed by extraction.

As a result, as shown in FIG. 8, when using the mixed composition (D + C + N) of distilled water, 0.5% CHAPS and 0.05N NaOH according to the present invention, a very low concentration of 1 Log CFU / mL of L. It was confirmed that monocytogenes nucleic acid could be extracted.

Experimental Example 2-2: Staphylococcus aureus ( S. aureus ) Confirmation of the sensitivity of the nucleic acid extraction method for

S diluted to a concentration of 1 Log CFU / mL with a mixture of 0.25% SDS and 0.05N NaOH (S + N) according to Example 3 and a composition for nucleic acid purification or nucleic acid extraction (D + C + N) according to the present invention. The sensitivity of each nucleic acid extraction method was confirmed by extracting nucleic acids from the bacterial solution of aureus .

As a result, as shown in FIG. 9, when using the mixed composition (D + C + N) of distilled water, 0.5% CHAPS and 0.05N NaOH according to the present invention, a very low concentration of 1 Log CFU / mL of S. It was confirmed that aureus nucleic acid could be extracted.

Experimental Example 2-3: Bacillus cereus ( B. cereus ) Confirmation of the sensitivity of the nucleic acid extraction method for

B diluted to a concentration of 1 Log CFU / mL with the mixture of 0.25% SDS and 0.05N NaOH according to Example 3 (S + N) and the composition for nucleic acid purification or nucleic acid extraction (D + C + N) according to the present invention. The sensitivity of each nucleic acid extraction method was confirmed by extracting nucleic acids from cereus strains.

As a result, as shown in FIG. 10, when using the composition (D + C + N) in which distilled water, 0.5% CHAPS and 0.05N NaOH are mixed according to the present invention, a very low concentration of 1 Log CFU / mL of B. It was confirmed that cereus nucleic acid could be extracted.

Experimental Example 2-4: Clostridium perfringens ( C. perfringens ) Confirmation of the sensitivity of the nucleic acid extraction method for

The nucleic acid of C. perfringens bacterial solution diluted to a concentration of 1 Log CFU/mL with the Qiagen DNeasy Blood & Tissue Kit (Q) according to Example 3 and the composition for nucleic acid purification or nucleic acid extraction (D+C+N) according to the present invention The sensitivity of each nucleic acid extraction method was confirmed by extraction.

As a result, as shown in FIG. 11, when using the mixed composition (D + C + N) of distilled water, 0.5% CHAPS and 0.05N NaOH according to the present invention, a very low concentration of 1 Log CFU / mL of C. It was confirmed that perfringens nucleic acid could be extracted.

Experimental Example 3: Confirmation of nucleic acid extraction from Gram-negative bacteria

Experimental Example 3-1: Escherichia coli ( E. coli ) Confirmation of nucleic acid extraction

It was confirmed through PCR and electrophoresis whether nucleic acid extraction was effective even for E. coli at 3 Log CFU/mL using the composition in which distilled water, 0.5% CHAPS, and 0.05N NaOH were mixed according to the present invention. The PCR conditions and primer sequences used are shown in Tables 9 and 10 below.

PCR cycle temperature hour early degeneration 94℃ 4 minutes denaturalization 95℃ 30 seconds 30 cycles annealing 55℃ 40 seconds height 72℃ 1 minute 30 seconds final height 72℃ 10 minutes

gene Sequence (5’to 3’) sequence number Size (bp) reference 16s rRNA Forward AGAGTTTGATCCTGGCTCAG 9 1,500 Jiang et al., 2006 Reverse CGGTTACCTTGTTACGACTT 10

As a result, as shown in FIG. 12, it was confirmed that E. coli nucleic acid was effectively extracted with the composition (D+C+N) in which distilled water, 0.5% CHAPS, and 0.05N NaOH were mixed according to the present invention.

Experimental Example 3-2: Salmonella ( Salmonella spp. ) Confirmation of nucleic acid extraction

It was confirmed through PCR and electrophoresis whether nucleic acid extraction was effective against Salmonella at 3 Log CFU/mL using the mixed composition of distilled water, 0.5% CHAPS, and 0.05N NaOH according to the present invention. PCR conditions and primer sequences used are shown in Tables 11 and 12 below.

PCR cycle temperature hour early degeneration 95℃ 5 minutes denaturalization 95℃ 1 minute 30 seconds 35 cycles annealing 62℃ 1 min height 72℃ 1 minute 30 seconds final height 72℃ 7 minutes

gene Sequence (5’to 3’) sequence number Size (bp) reference salm Forward GCTGCGCGCGAACGGCGAAG 11 389 Ministry of Food and Drug Safety, 2019 Reverse TCCCGGCAGAGTTCCCATT 12

As a result, as shown in FIG. 13, it was confirmed that Salmonella nucleic acid was effectively extracted with the composition (D+C+N) in which distilled water, 0.5% CHAPS, and 0.05N NaOH were mixed according to the present invention.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later and equivalent concepts rather than the detailed description above are included in the scope of the present invention.

<110> Sookmyung Women's university industry-academic cooperation foundation <120> Composition for Nucleic Acid Extraction and Method for Extracting Nucleic Acid Using the Same <130> KPA2021-064 <160> 12 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> prfA forward <400> 1 caatgggatc cacaagaata 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> prfA reverse <400> 2 agcctgctcg ctaatgactt 20 <210> 3 <211> 21 <212> DNA <213> artificial sequence <220> <223> nucA forward <400> 3 gcgattgatg gtgatacggt t 21 <210> 4 <211> 24 <212> DNA <213> artificial sequence <220> <223> nucA reverse <400> 4 agccaagcct tgacgaacta aagc 24 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> bceT forward <400> 5 cgttcggtc gttcactcgg 20 <210> 6 <211> 21 <212> DNA <213> artificial sequence <220> <223> bceT reverse <400> 6 gttgattttc cgtagcctgg g 21 <210> 7 <211> 21 <212> DNA <213> artificial sequence <220> <223> cpb forward <400> 7 gcgaatatgc tgaatcatct a 21 <210> 8 <211> 22 <212> DNA <213> artificial sequence <220> <223> cpb reverse <400> 8 gcaggaacat tagtatatct tc 22 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> 16s rRNA forward <400> 9 agagtttgat cctggctcag 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> 16s rRNA reverse <400> 10 cggttacctt gttacgactt 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> <400> 11 gctgcgcgcg aacggcgaag 20 <210> 12 <211> 19 <212> DNA <213> artificial sequence <220> 223 <#223> <400> 12 tcccggcaga gttcccatt 19

Claims (21)

A composition for nucleic acid purification or nucleic acid extraction comprising distilled water, sodium hydroxide, and CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate). According to claim 1,
The composition is a composition for nucleic acid purification or nucleic acid extraction comprising 0.5% CHAPS and 0.05N sodium hydroxide. According to claim 1,
Wherein the distilled water, sodium hydroxide and CHAPS are mixed in a volume ratio of 180 to 200: 1 to 20: 0.5 to 10, nucleic acid purification or nucleic acid extraction composition. According to claim 1,
The nucleic acid is a bacterial-derived nucleic acid, a composition for nucleic acid purification or nucleic acid extraction. According to claim 4,
The bacteria are Gram-positive bacteria, nucleic acid purification or nucleic acid extraction composition. According to claim 5,
The gram-positive bacteria are Listeria monocytogenes , Staphylococcus aureus , Bacillus cereus , or Clostridium perfringens , for nucleic acid purification or nucleic acid extraction composition. According to claim 1,
The composition is a cell membrane lysis buffer for nucleic acid extraction, nucleic acid purification or nucleic acid extraction composition. According to claim 4,
The concentration of the bacteria is 1 Log CFU / mL to 2 Log CFU / mL, nucleic acid purification or nucleic acid extraction composition. A kit for purifying nucleic acids or extracting nucleic acids comprising the composition according to any one of claims 1 to 8. (a) centrifuging the sample to obtain a pellet;
(b) mixing the composition according to any one of claims 1 to 8 with pellets;
(c) heating the mixture; and
(d) cooling the heated mixture and centrifuging to obtain a supernatant
Nucleic acid purification or nucleic acid extraction method comprising a. According to claim 10,
The nucleic acid is a bacterial-derived nucleic acid, nucleic acid purification or nucleic acid extraction method. According to claim 11,
The bacteria are Gram-positive bacteria, nucleic acid purification or nucleic acid extraction method. According to claim 12,
Wherein the gram-positive bacteria are Listeria monocytogenes , Staphylococcus aureus , Bacillus cereus , or Clostridium perfringens , nucleic acid purification or nucleic acid extraction method . According to claim 10,
The heating step is performed in a microwave oven for 10 to 30 seconds, nucleic acid purification or nucleic acid extraction method. According to claim 11,
The concentration of the bacteria is 1 Log CFU / mL to 2 Log CFU / mL, nucleic acid purification or nucleic acid extraction method. A kit for detecting bacteria comprising the composition according to any one of claims 1 to 8. (a) centrifuging the sample to obtain a pellet;
(b) mixing the composition according to any one of claims 1 to 8 with pellets;
(c) heating the mixture;
(d) cooling the heated mixture and centrifuging to obtain a supernatant; and
(e) detecting nucleic acids in the obtained supernatant
Bacterial detection method comprising a. According to claim 17,
Wherein the bacteria are Gram-positive bacteria, a method for detecting bacteria. According to claim 18,
Wherein the gram-positive bacteria are Listeria monocytogenes, Staphylococcus aureus , Bacillus cereus, or Clostridium perfringens . According to claim 17,
The concentration of the bacteria is 1 Log CFU / mL to 2 Log CFU / mL, a method for detecting bacteria. According to claim 17,
The detection is polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), nested polymerase chain reaction (N-PCR; nested PCR), multiplex-polymerase chain reaction (Multiplex- PCR), real-time polymerase chain reaction (real-time PCR) or loop-mediated isothermal amplification (LAMP), which is a bacterial detection method.

Images