KR20050082595A - Methods and Kit for Detecting Listeria spp. - Google Patents

Abstract

The present invention relates to a method and a detection kit for detecting a species of Listeria spp . , Comprising : (a) adding a bacteriocin belonging to subclass IIa to a sample and reacting the same; (Iii) amplifying the PCR template with a specific primer pair capable of amplifying the DNA of the Listeria spp., Using the reaction of Step VII as a PCR template to obtain a PCR product; And (i) Visualizing the PCR product obtained in step iii by electrophoresis, a method of detecting a Listeria spp. And a specific primer pair, DNA polymerase, dNTP mixture and PCR that can amplify DNA of the Listeria spp. The present invention relates to a Listeria spp. Detection kit comprising a reaction buffer.

The detection method and detection kit of the present invention can detect a small amount of Listeria spp. Causing food poisoning by improving the detection sensitivity of Listeria spp.

Description

Method and kit for detecting Listeria spp. {Methods and Kit for Detecting Listeria spp.}

The invention relates to a method for detecting a species of the genus Listeria (Listeria spp.) And detection kit. More specifically, the step of reacting by adding a bacteriocin belonging to subclass IIa to the sample; (Iii) amplifying the PCR template with a specific primer pair capable of amplifying the DNA of the Listeria spp., Using the reaction of Step VII as a PCR template to obtain a PCR product; And (iv) visualizing the PCR product obtained in step (v) by electrophoresis, thereby detecting a Listeria spp. The present invention also relates to a Listeria spp. Detection kit comprising a specific primer pair, DNA polymerase, dNTP mixture, and PCR reaction buffer capable of amplifying DNA of Listeria spp.

Food poisoning is food poisoning caused by natural poisoning (blowfish poison, mushroom poison, etc.) based on the cause; Food poisoning due to food decay; And food poisoning by incorporation or reproduction of bacteria in food. Among these food poisonings, food poisoning caused by natural poisoning can be easily prevented by avoiding the ingestion of the foods that cause the food poisoning. Food corruption is easily detected by changes in the appearance, smell, etc. of food poisonings. Relatively easy. However, in the case of food poisoning caused by bacteria, that is, bacterial food poisoning, food poisoning is most difficult to prevent because the incorporation or reproduction of bacteria in food is generally not observed with the naked eye and it is very difficult to detect by professional methods. can do. As a method of detecting and confirming the causative agent of bacterial food poisoning, the collected sample is cultured using a selective medium, the colonies formed on the medium are visually observed, or other detection and confirmation means are used. The test method using the polymerase chain reaction has been developed and used.

Polymerase Chain Reaction (hereinafter referred to as "PCR") is a widely used method for detecting and identifying pathogenic microorganisms from environmental or clinical samples (Bhaduri et al. Molecular and Cellular Probes, 2001, Vol. 15, p267; Bubert et al. J. Clin. Microbiol., 1997, Vol. 35, p179; Shin et al. J. Microbiol. Biotechnol., 1999, Vol. 9, p184; Venkateswaran et al. Appl. Environ. Microbiol., 1998, Vol. 64, p681). For example, PCR can be used to quickly and specifically detect pathogens present in foods, to identify pathogens isolated from food samples, and to prepare DNA templates for further detailed genetic analysis. In particular, the method of extracting genomic DNA of pathogens from food and analyzing it with a conventional kit has been in the spotlight. However, in applying the kit, there are limited problems such as the presence of a small amount of the desired organism, the presence of a PCR-inhibitor in food, and an expensive analysis equipment (Bej et al. Detection of food borne microbial pathogens, 1994, p341., Griffin et al. and AM Griffin (ed.), PCR technology: current innovations.CRC Press, Boca Raton, Fl.). Thus, some research reports have reported that purely cultured cells and artificially contaminated food lysates are used as templates for PCR detection (Shin et al. J. Microbiol. Biotechnol., 1999 , Vol. 9, p184; Venkateswaran et al. Appl. Environ.Microbiol., 1998, Vol. 64, p681). Centrifugation, cleaning agents, lysozyme, enrichment media and antibody-coated magnetic beads are also used to remove PCR inhibitors or to increase the sensitivity of PCR detection (Bhaduri et al. Molecular and Cellular Probes. 2001, Vol. 15, p 267.).

The present inventors also effectively detected the Gram-negative bacterium Escherichia coli O157: H7 ( E. coli O157: H7), but the Gram-positive bacterium Listeria monocytogenes was not easily detected because of its robust cell wall.

Accordingly, the present inventors found that the sensitivity of the Listeria monocytogenes bacterium, which is a cause of food poisoning, was poor, and thus the detection sensitivity was low when PCR was detected. Was detected by treatment with Listeria monocytogenes bacteria, and the detection sensitivity was increased.

Therefore, the present invention comprises the steps of reacting by adding a bacteriocin belonging to subclass IIa to the sample; (Iii) amplifying the PCR template with a specific primer pair capable of amplifying the DNA of the Listeria spp., Using the reaction of Step VII as a PCR template to obtain a PCR product; And (iii) visualizing the PCR product obtained in step (iii) by electrophoresis, to provide a method for detecting Listeria spp.

In addition, the present invention is to provide a Listeria genus species detection kit, characterized in that consisting of a specific primer pair, DNA polymerase, dNTP mixture and PCR reaction buffer that can amplify the DNA of Listeria genus.

The present invention comprises the steps of reacting by adding a bacteriocin belonging to subclass IIa to the sample; (Iii) amplifying the PCR template with a specific primer pair capable of amplifying the DNA of the Listeria spp., Using the reaction of Step VII as a PCR template to obtain a PCR product; And (iv) visualizing the PCR product obtained in step (v) by electrophoresis, thereby providing a method for detecting a Listeria spp.

Samples used in the present invention can be used by homogenizing and suspending food, such as milk, dairy products, meat and processed meat that can be contaminated or contaminated by the Listeria spp.

Listeria spp. To be detected in the present invention are Gram-positive, non-porous, anaerobic bacillus, and are species that are widely distributed in nature as cold and microorganisms. It can survive in various environmental conditions, can grow at pH 5.0 to 9.0, and can survive and grow for a long time even at refrigerated temperatures. Also, Listeria spp. Are the causes of food poisoning, such as Listeria monocytogenes, Listeria ivanovii , Listeria innocua , Listeria seeligeri , Listeria welshimeri , Listeria Gray ( Listeria grayi ) and Listeria murrayi ( Listeria murrayi ) and the like are known, but the infection caused by Listeria monocytogenes bacteria among them mainly causes food poisoning. In addition, the bacteria of the genus Listeria are gram positive, so that the cell wall is firm, and if detected by the conventional PCR method, the cell number is detected at 10 ³ CFU / reaction or more. That is, since DNA release is not easy due to the robust cell wall of Listeria spp., The detection sensitivity of Listeria spp. Is low by the conventional PCR method.

Therefore, in order to solve the above problem, the present invention can treat bacteriocin belonging to subclass IIa to a sample to effectively destroy cell membranes of the cell wall of Listeria spp., Thereby improving detection sensitivity during PCR detection.

The term "bacteriocin" refers to a natural antimicrobial peptide or protein-based substance produced by a variety of microorganisms. The antimicrobial properties of bacteriocins vary widely with their amino acid sequences, but they are generally low in molecular weight, heat stable, cationic and hydrophobic (Oscariz et al. Int. Microbiol., 2001, Vol. 4, p13). .).

The classification of bacteriocin can be divided into class I, II and III, of which class II can be divided into subclass IIa, IIb and IIc, in particular subclass IIa as pediosin-like. Called pediocin-like bacteriocins, a representative feature of this group is its strong antibacterial activity against the Listeria genus.

Thus, the bacteriocins belonging to subclass IIa which can be used in the present invention include natural pediosin PA-1; Enterocin A; Divergicin DV41; Mesenterocin Y105 (mesenterocin); Sakacin P; Curvacin A; Leucocin UAL-187; And carnobacteriocin B2 (carnobacteriocin B2) can be used any one selected from the group consisting of, preferably a natural pediosin PA-1 having a broad antibacterial spectrum can be used.

The natural pediosin PA-1 can be extracted from the Pediococcus sididilaccity K10 ( Pediococcus acidilactici ).

In the present invention, the concentration of the bacteriocin belonging to the subclass IIa to the sample to derive the optimum detection condition is 80 to 240 AU / reaction.

As an example, a bacteriocin belonging to subclass IIa may be added to a sample of natural pediosin PA-1 and reacted with a sample, and then, as a template, PCR may be used as a template. (See Example 8). This can be seen that the detection sensitivity is improved compared to the minimum cell number 10 ³ CFU / reaction when detecting the species of Listeria genus from a sample not treated with natural pediosin PA-1 (see Example 6).

In the present invention, the PCR template may be directly used as a PCR template by reacting the sample by adding bacteriocin belonging to subclass IIa. This is a bacteriocin belonging to subclass IIa, which firstly destroys the cell membrane, which is a cell wall component of the Listeria spp. The time for reacting the sample by adding bacteriocin belonging to the subclass IIa is preferably 20 to 40 minutes.

In addition, the present invention can heat the sample reacted with bacteriocin belonging to subclass IIa so that DNA present in the cells of the pathogen to be detected can be easily released. Heat treatment temperature and time is preferably carried out at 90 to 100 ℃ 5 to 15 minutes.

In the present invention, a primer used for amplification of a PCR template may use a specific primer pair capable of amplifying the DNA of the genus Listeria.

For example, primer pairs capable of amplifying the DNA of Listeria monocytogenes bacteria include the hly A gene (Mengaud et al. Infec. Immun ., 1988, Vol. 56, p76; Mengaud et al. Infec. Immun ., 1989). , Vol. 57, p3695) can be prepared based on the downstream (downstream) region, which is shown as primer 1 (SEQ ID NO: 1) and primer 2 (SEQ ID NO: 2) (see Table 1).

On the other hand, primer pairs used to amplify the DNA of a specific bacterium belonging to the Listeria genus including the Listeria monocytogenes can be used as described in the literature (Andreas Bubert et al. Applied and envrionmental microbiology, 1999, 65 (10) ), p4688.).

Finally, the PCR amplified product can be visualized using electrophoresis commonly used in the art.

The present invention provides a Listeria spp. Species detection kit, comprising a specific primer pair, DNA polymerase, dNTP mixture, and PCR reaction buffer capable of amplifying DNA of Listeria spp.

The detection kit of the present invention includes primers capable of specifically amplifying the DNA of the genus Listeria, and PCR reaction buffers, DNA polymerases, and the like, which are general components. For example, kits for the detection of Listeria monocytogenes bacteria include primer pairs (SEQ ID NOs: 1 and 2), heat-resistant DNA polymerase, dNTP mixtures and PCR that can amplify the DNA of Listeria monocytogenes bacteria. Tris-hydrochloric acid, calcium chloride, magnesium chloride, and the like, which are components of the reaction buffer.

A method for detecting Listeria spp. Using the detection kit of the present invention is as follows.

PCR preparing a PCR template by adding a bacteriocin belonging to subclass IIa to a sample of food contaminated or contaminated from the Listeria spp.

하고자 PCR product is obtained by amplifying DNA of the desired Listeria spp. By adding PCR template of Step V to the detection kit of the present invention consisting of specific primer pairs of the Listeria spp., DNA polymerase, dNTP mixture and PCR reaction buffer. Obtaining a; And

The PCR product of step VII can be visualized by electrophoresis to detect the species of the genus Listeria.

Hereinafter, the present invention will be described in detail by the following examples. However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

<Example>

Example 1

Cultivation of Strains

Listeria monocytogenes (ATCC 19111) bacteria were inoculated in BHI broth (brain heart infusion Broth; BHI Broth, Merck KGaA, Darmstadt, Germany), followed by aerobic culture at 37 ° C. for 18 hours to obtain a culture solution. After diluting the culture solution stepwise, the BHI agar plate (BHI agar plate, Merck KGaA, Darmstadt, Germany) was plated to measure the number of bacteria (unit: CFU / ㎖).

Meanwhile, in order to extract natural pediosin PA-1 having a broad antibacterial spectrum among bacteriocins belonging to subclass IIa, pediococcus esididilacti K10 was isolated from kimchi. The bacteria were inoculated in MRS broth (Merck KGaA, Darmstadt, Germany) and incubated at 37 ° C. for 18 hours.

Example 2

Extraction of natural pediosin PA-1 and determination of bacteriocin activity

Pediococcus esididilacti K10 incubated in Example 1 was centrifuged at 10,000 x g for 15 minutes to obtain a supernatant, which was then passed through a 0.22 μm membrane filter. 100 ml of the culture solution was taken and mixed well while adding ammonium sulfate crystals while maintaining the mixture at 50 ° C. to maintain 50% saturation. The samples were mixed at 4 ° C. for 4 hours and centrifuged at 15,000 × g for 15 minutes. The pelletized sample was centrifuged to dissolve by adding distilled water and deionized water. The sample was removed from the Spectra / Por CE membrane [MWCO (fraction molecular weight): 1,000 to remove salts; Spectrum Medical Industries, Inc., Houston, Texas, USA)] was dialyzed with distilled water and deionized water at 4 ° C. for 12 hours, and freeze-dried to be frozen and dissolved in distilled and deionized water as needed. 1 preparation (Moon et al. J. Microbiol. Biotechnol., 2000, Vol. 10, p507; Moon et al. J. Microbiol. Biotechnol., 2002, Vol. 12, p936.).

On the other hand, the bacteriocin activity of the extracted natural pediosin PA-1 was measured using a spot-on-lawn test. That is, mixed with 5 ml of BHI soft agar (0.7% W / V) so that the Listeria monocytogenes bacteria purely cultured in Example 1 to 10 ⁷ CFU / ㎖, and evenly poured on a BHI agar plate and thereon natural pediosin 2 μl of the PA-1 preparation was added dropwise and incubated overnight at 37 ° C., and growth inhibition was observed to determine whether there was activity. The results are shown in FIG. 1.

As shown in Figure 1, the bacteriocin activity of the natural pediosin PA-1 was measured, the growth inhibition ring markedly appeared on the BHI agar plate. This means that pediosin PA-1 extracted from Pediococcus erylacthysi K10 has antimicrobial activity against Listeria monocycogenes. The activity of bacteriocin, expressed in arbitrary units (arbitrary unit / AU), was two-fold dilution of the natural pediosin PA-1 preparation, indicating growth refractory to indicators as a result of the spot-on-low assay. The inverse of the highest dilution factor multiplied by the conversion factor (conversion factor is 500 if 2 μl of natural pediosin PA-1 is used) (Daeschel, MA Procedures to detect antimicrobial activities of microorganisms, 1992. p57.- Ray et al. Food Biopreservatives of Microbial Origin, CRC Press, Ann Arbor, USA).

Example 3

Preparation of the primer

In order to specifically detect Listeria monocytogenes bacteria using PCR,hly AGene (Mengaud et al.Infec. Immun, 1988. Vol. 56, p76; Mengaud et al.Infec. Immun, 1989, Vol. 57, p3695.), Based on the downstream region of the oligonucleotide primer set was synthesized by the request of Bioneer (Korea, Korea). This is shown in Table 1 below.

Primers for PCR Amplification primer Base sequence SEQ ID NO: Size of PCR Amplification Products Forward primer  5'- TTACGAATTAAAAAGGAGCG -3 ' One 161 bp Reverse primer  5'- TTAAATCAGCAGGGGTCTTT -3 ' 2

Example 4

Preparation of PCR Template from Pure Cultured Listeria Monocytogenes Strains and Food Samples

To compare PCR products amplified from several PCR templates of Listeria monocytogenes strains, resuspended cells, heat lysates obtained from heat and genomic DNA obtained from a DNA purification kit (Bio-Rad Laboratories Inc., USA). Three PCR template types were prepared.

Preparation of the PCR template is as follows. Listeria monocytogenes strains of 10 ⁴ , 10 ⁵ and 10 ⁶ CFU / mL of pure cells cultured in Example 1 were centrifuged at 10,000 μg for 5 minutes at 4 ° C., respectively, and the supernatant was removed from the cell pellet. Obtained. The cell pellet was washed twice with 1 ml of distilled water and deionized water, which was then resuspended by adding 0.1 ml of distilled water and deionized water (resuspended cells), and the resuspended cells were used at 98 ° C. The cells in which the cells were lysed by heating for 10 minutes were used as a PCR template (cell lysate).

On the other hand, in order to prepare a PCR template of Listeria monocytogenes strain from food samples, the Listeria monocytogenes strain was inoculated into whole milk and raw pork to obtain a PCR template from it. The food samples used whole milk sold in the general market (Korea, Bundang) and raw pork refrigerated at 4 ℃. The method of artificially contaminating Listeria monocytogenes strain in the food sample is as follows. 9 ml of whole milk was injected into a sterile test tube. In addition, 10 g of raw pork was cut and injected into a stomacher filter bag (Seward Ltd., UK) with 90 ml of 0.1% peptone solution, followed by a stomacher 400 circulator (Seward Ltd., UK). ) Was homogenized at 200 rpm for 1 minute, and then 9 ml of the homogenized filtrate was injected into a sterile test tube. The final concentration of bacteria was inoculated by Listeria monocytogenes jeneseu strains cultured in Example 1 the test tube is a pig and the sample homogenized whole milk implanted 10 ³ 10 ^4, and Each was diluted to 10 ⁵ CFU / mL. The method for preparing a PCR template from the diluent was performed in the same manner as the method for preparing a PCR template from the pure cultured strain.

Example 5

Preparation of PCR Template Treated with Natural Pediosin PA-1

PCR template was prepared by treating the natural template pdiosin PA-1, a cell membrane disruption factor, to the PCR template obtained from the resuspended cells and food samples prepared in Example 4. That is, the natural pediosin PA-1 obtained in Example 2 was treated to the PCR template obtained from the resuspended cells and the food sample of Example 4, which was incubated at room temperature for 30 minutes. Each incubated sample was heat treated at 98 ° C. for 10 minutes to use as a PCR template.

Example 6

PCR analysis of PCR templates prepared from purely cultured Listeria monocytogenes strains

In order to compare the detection sensitivity of the pure cultured Listeria monocytogenes strain, three types of PCR templates prepared in Example 4 were used.

PCR analysis was performed by adding PCR templates of three types of Listeria monocytogenes strains obtained in Example 4 to 20 µl PCR PreMix (Bionia, Korea) each. The PCR mixture consisted of primers of SEQ ID NO: 1 and SEQ ID NO: 2, respectively, 10 pmole, heat resistant DNA polymerase 1U, 250 nM of dNTP, tris-hydrochloric acid 50 mM (pH 8.3), calcium chloride 40 mM and magnesium chloride 1.5 mM.

The PCR was performed using a BIO-Rad Gene Cycler (Model No. 10167, Japan). That is, after undergoing a preheating step at 94 ° C. for 2 minutes, a total of 35 repetitions were performed for 30 seconds at 94 ° C., 30 seconds at 55 ° C., and 1 minute at 72 ° C. for 1 cycle. Termination was performed by The PCR product was analyzed using 1.5% agarose gel electrophoresis, staining was done with ethidium bromide solution. The gel was visualized by ultraviolet imaging, which is shown in FIG. 2.

As shown in FIG. 2, PCR products were detected using three types of PCR templates: resuspended cells prepared from Listeria monocytogenes strain, cell lysate obtained by heating, and purified genomic DNA. Number 10 ⁴ , PCR products corresponding to Listeria monocytogenes strains of 10 ³ and 10 ³ CFU / reaction were detected. This is generally due to the thick peptidoglycan layer that constitutes the cell wall of Gram-positive bacteria compared to the case where E. coli O157: H7 is detected at 10 CFU / reaction. It was found that detection sensitivity was limited.

Example 7

PCR Analysis of PCR Templates Treated with Natural Pediosin PA-1

In order to measure the detection sensitivity of the Listeria monocytogenes strain due to the cell membrane destruction effect of natural pediosin PA-1, the PCR template prepared in Example 5 was used. That is, a PCR template prepared by treating natural pediosin PA-1 with resuspended cells of Example 4 at 80, 160, and 240 AU, respectively, and heat-treating them was used. PCR analysis was performed in the same manner as in Example 6 using 1 μl of the PCR template. The results are shown in FIG. 3.

As shown in FIG. 3, resuspended cells prepared from Listeria monocytogenes strains were treated with 80, 160, and 240 AU of natural pediosin PA-1, respectively, and subjected to heat treatment to detect PCR products. As a result, PCR products corresponding to the Listeria monocytogenes strain of cell number 10 ² CFU / reaction were detected when 80 AU of natural pediosin PA-1 was treated. It was found that the sensitivity of detection was higher than that of the PCR product corresponding to the Listeria monocytogenes strain of 10 ³ CFU / reaction.

In addition, cell number 10 when treated with 160 and 240 AU of natural pediosin PA-1 PCR products corresponding to Listeria monocytogenes strains of CFU / reaction were detected.

That is, the detection sensitivity of the Listeria monocytogenes strain was increased as the amount of natural pediosin PA-1 was increased, and the optimal amount of natural pediosin PA-1 was 160AU when detecting the Listeria monocytogenes strain. (See C, D in FIG. 3).

Example 8

PCR analysis of PCR templates treated with natural pediosin PA-1 in food samples

PCR obtained from the food sample prepared in Example 5 to determine the detection sensitivity of the Listeria monocytogenes strain in the food sample using that the natural pediosin PA-1 increases the detection sensitivity of the Listeria monocytogenes strain A template was used. That is, after inoculating and diluting the food sample of Example 4 with a Listeria monocytogenes strain, and treated with 160AU natural pediosin PA-1 was used as a PCR template by dividing it before and after heat treatment. PCR analysis was performed in the same manner as in Example 6 using 1 μl of the PCR template. The results are shown in FIG. 4.

As shown in FIG. 4, after inoculating and diluting the food sample with a Listeria monocytogenes strain, the PCR product was detected by using a PCR template divided by before and after heat treatment by treating natural pediosin PA-1 with 160 AU. , PCR products corresponding to Listeria monocytogenes strain of 10 ² CFU / reaction of cell number obtained from contaminated whole milk were detected, and the detection sensitivity was changed even after treatment with natural pediosin PA-1 before and after heat treatment. Did not do it.

On the other hand, PCR products corresponding to the Listeria monocytogenes strain of 10 CFU / reaction cell number obtained from contaminated raw pork was detected when treated with natural pediosin PA-1 prior to heat treatment. However, PCR products corresponding to the Listeria monocytogenes strain of 10 ³ CFU / reaction cell number obtained from contaminated raw pork were detected when natural pediosin PA-1 was treated after heat treatment. It was found that the treatment of natural pediosin PA-1 prior to heat treatment destroys the cell membrane, and therefore, DNA was easily released after the heat treatment.

The detection method and detection kit of the present invention can detect a small amount of Listeria spp. Causing food poisoning by improving the detection sensitivity of Listeria spp.

Figure 1 is a photograph showing the antimicrobial activity against Listeria monocytogenes strain of natural pediosin PA-1 (arrow: growth inhibitory ring).

FIG. 2 is a photograph showing the PCR template prepared from the pure cultured Listeria monocytogenes strain, followed by electrophoresis (A: resuspended cells; B: cell lysate obtained by heating; C : Purified genomic DNA; lane 1: cell number 10 ⁴ CFU / reaction; lane 2: cell number 10 ³ CFU / reaction; lane 3: cell number 10 ² CFU / reaction, M: marker, 100 bp leather (biolabs, UK) ).

Figure 3 is treated with natural pediosin PA-1 to the resuspended cells prepared from pure cultured Listeria monocytogenes strain, and then heat treated it to prepare a PCR template, and the PCR amplified it is a photograph showing the electrophoresis ( A: natural pediosin PA-1 untreated; B: 80AU treated; C: 160AU treated; D: 240AU treated; lane 1: cell count 10 ³ CFU / reaction; lane 2: cell count 10 ² CFU / reaction; lane 3 : Cell number 10 CFU / reaction; M: marker, 100 bp leather).

Figure 4 divided the samples inoculated with the Listeria monocytogenes strain purely cultured and the food Listeria monocytogenes strain before and after heat treatment to prepare a PCR template by treatment with natural pediosin PA-1, respectively, electrophoresis of the PCR amplification (A: pure culture; B: whole milk; C: raw pork; a: heat treatment; b: heat treatment after natural pediosin PA-1 treatment; c: natural pediosin PA-1 treatment after heat treatment; lanes 1: cell number 10 ³ CFU / reaction; lane 2: cell number 10 ² CFU / reaction; lane 3: cell number 10 CFU / reaction; M: marker, 100 bp leather).

<110> KOREA FOOD RESEARCH INSTITUTE <120> Methods and Kit for Detecting Listeria spp. <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 1 ttacgaatta aaaaggagcg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PRIMER <400> 2 ttaaatcagc aggggtcttt 20

Claims (9)

(C) adding and reacting bacteriocin belonging to subclass IIa to the sample; (Iii) amplifying the PCR template with a specific primer capable of amplifying the DNA of the Listeria spp. Using the reaction of step (v) as a PCR template to obtain a PCR product; And (Iv) a method for detecting a Listeria spp. Characterized in that the PCR product obtained in step (v) is visualized by electrophoresis. The method of claim 1, wherein the sample is milk, dairy products, meat or meat products. The method according to claim 1, wherein the bacteriocin belonging to the subclass IIa is added at 80 to 240AU. The method according to claim 1, wherein the bacteriocin belonging to the subclass IIa is added to the sample and reacted with the sample for 20 to 40 minutes, followed by further heat treatment at 90 to 100 ° C. Way. 5. The bacteriocin of claim 1, wherein the bacteriocin belonging to subclass IIa is selected from the group of native pediocin PA-1; Enterosine A; Debuggysin DV41; Mesenterosin Y105; Saccharin P; Curvacin A; Leucosin UAL-187; And canobacteriocin B2. The method of detecting a Listeria spp. The method according to any one of claims 1 to 4, wherein the bacteriocin belonging to subclass IIa is natural pediocin PA-1. The method according to claim 6, wherein the natural pediosin PA-1 is extracted from Pediococcus acididiactici ( P10 ) bacterium. The method according to any one of claims 1 to 4, wherein the genus of Listeria is Listeria monocytogenes ; Listeria ivanovii ; Listeria innocua ; Listeria seeligeri ; Listeria welshimeri ; Listeria grayi ; And Listeria murray ( Listeria murrayi ) characterized in that any one selected from the group consisting of. A Listeria spp. Detection kit comprising a primer pair, DNA polymerase, dNTP mixture, and PCR reaction buffer capable of specifically amplifying the DNA of the Listeria spp.